Endocytosis enhancer for drug delivery system
11510987 · 2022-11-29
Assignee
Inventors
- Miho Suzuki (Saitama, JP)
- Ken Hatano (Saitama, JP)
- Shojiro Yoshida (Saitama, JP)
- Yasuhiro Yamashita (Tokyo, JP)
Cpc classification
A61K39/395
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A61K47/42
HUMAN NECESSITIES
A61K38/16
HUMAN NECESSITIES
A61K47/24
HUMAN NECESSITIES
G01N33/542
PHYSICS
International classification
A61K47/42
HUMAN NECESSITIES
A61K39/395
HUMAN NECESSITIES
Abstract
The present invention addresses the problem of providing an endocytosis enhancer comprising associates formed from a fluorescent protein. The fluorescent protein is preferably any one selected from the group consisting of a white fluorescent protein, a red fluorescent protein, a yellow fluorescent protein, a blue fluorescent protein and a green fluorescent protein. The endocytosis enhancer according to the present invention can enhance the cellular uptake of a drug, which is encapsulated in micelles each formed from a fluorescent-protein-supported carbosilane dendrimer, through endocytosis.
Claims
1. An endocytosis enhancing preparation comprising more than one fusion polypeptide comprising a fluorescent protein, and a target recognition sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
2. The endocytosis enhancing preparation according to claim 1, wherein said fluorescent proteins are selected from the group consisting of white fluorescent protein, red fluorescent protein, yellow fluorescent protein, blue fluorescent protein, and green fluorescent protein.
3. The endocytosis enhancing preparation according to claim 2 comprising, 2 to 10 molecules of the fluorescent protein.
4. The endocytosis enhancing preparation according to claim 2 further comprising a backbone structure shown in the following formula (I) where n is an integer from 1 to 6 and wherein a micelle is formed ##STR00006##
5. The endocytosis enhancing preparation according to claim 2, wherein the fluorescent protein is green fluorescent protein (GFP) and further comprising a backbone structure selected from the group consisting of the compound shown in the following formula (III) to (VI): ##STR00007##
6. The endocytosis enhancing preparation according to claim 1, comprising 4 to 10 molecules of the fluorescent protein.
7. The endocytosis enhancing preparation according to claim 1 further comprising a backbone structure shown in the following formula (I) where n means an integer from 1 to 6 and wherein a micelle is formed ##STR00008##
8. The endocytosis enhancing preparation according to claim), wherein said backbone structure shown in the formula (I) is a compound shown in the following formula (II) ##STR00009##
9. The endocytosis enhancing preparation according to claim 1, wherein said micelle is formed so as to have the protein on the outside in the aqueous medium, having a diameter from 50 to 500 nm, and emitting fluorescence derived from FRET.
10. The endocytosis enhancing preparation according to claim 7, wherein said micelle is formed so as to have the protein on the outside in the aqueous medium, having a diameter from 50 to 500 nm, and emitting fluorescence derived from FRET.
11. The endocytosis enhancing preparation according to claim 10, said micelle include any one selected from the group consisting of the molecule having not larger than the molecular weight of 200,000, a nucleic acid, and a lipophilic molecule.
12. The endocytosis enhancing preparation according to claim 11, said molecule having not larger than the molecular weight of 200,000 is preferably selected from the group consisting of immunoglobulin G, lectin, and peptide hormone.
13. The endocytosis enhancing preparation according to claim 1, wherein the fluorescent protein is green fluorescent protein (GFP) and further comprising a backbone structure selected from the group consisting of the compound shown in the following formula (III) to (VI): ##STR00010##
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
MODE FOR CARRYING OUT THE INVENTION
(24) Herein below, the present invention is explained in detail. The present invention is the endocytosis enhancing preparation comprising the conjugate formed by the fluorescent protein as described above. The fluorescent protein composes the endocytosis enhancing preparation of the present invention is particularly limited. However, it is preferably a fluorescent protein comprising green fluorescent protein or its derivatives. The reasons are as follows: GFP emits strong fluorescence, when they form the conjugate; the formed conjugate show the endocytosis effect which incorporates the substance close to the cell surface; and the conjugate itself is so as to be incorporated into the cell in a large amount.
(25) As GFP being employed in the present invention, there are mentioned such as white fluorescent protein, red fluorescent protein, yellow fluorescent protein, blue fluorescent protein, green fluorescent protein and the like, and it is particularly limited as long as they form the conjugate. For example, there are mentioned such as GFP shown in the SEQ ID NO: 7 or that shown in the SEQ ID NO: 8 in the sequence listing; BFP (blue fluorescent protein) shown in the SEQ ID NO: 9 in the sequence listing; TEP shown in the SEQ ID NO:10 in the sequence listing; commercially available CFP or RFP provided by Clontech and the like.
(26) Also, other than these, the fluorescent protein derived from Discosoma shown in the SEQ ID NO: 5 in the sequence listing may be preferably used. Furthermore, it is assumed that Azami-green provided from MBL and other derivatives thereof may be preferably used due to their structural properties. Since such fluorescent protein has broader wavelength range for the detection and has high intensity, they are suitably employed. Here, the blue fluorescent protein contains these emit blue or cyan fluorescence.
(27) As described above, GFP used in the present invention preferably has the property to form the conjugate of dimer or more than that. Also, it is preferable to use GFP shown in the SEQ ID NO: 7 in the sequence listing, because it has strong fluorescence and easily forms the conjugate.
(28) Such GFP may be produced by using the known method (see, for example, Biochim. Biophys. Acta 1679 (2004) 222-229; Biochem. Biophys. Res. Commun. 330 (2005) 454-460 and the like), or those provided by the manufacturer who conduct the production of GFP by commissioning may be used.
(29) Also, as the concrete degree of conjugation, the conjugate of 2 to 10 molecules of GFP as mentioned above is preferable, because it has high endocytosis effect. The conjugate of tetramer or more is more preferable; because the endocytosis enhancing preparation of the present invention has higher degree of conjugation, it has higher endocytosis enhancing effect, and also the conjugate enhances the incorporation of itself into the cell.
(30) It is preferable that the fluorescent protein further comprises the target recognition sequence, because it promotes the conjugate of GFP. As the target recognition sequence, there are mentioned such as the substance which specifically bounds to the target protein selected from the group consisting of a surface antigen, a receptor, a gate, a transporter, and a channel expressed on a variety of tissues.
(31) More concretely, as the functional peptide, there are mentioned such as any one of the peptide selected from the group consisting of those shown in the SEQ ID NOS: 1 to 3 in the sequence listing; because the addition of the peptide enables to control the formation of the conjugate of GFP as mentioned above.
(32) TABLE-US-00001 (SEQ ID NO: 1 in the sequence listing) DMPGTVLPGG (SEQ ID NO: 2 in the sequence listing) VPTDTDYSGG (SEQ ID NO: 3 in the sequence listing) DMPGTVLPGG GGGSEGEWQ QQQHQWAKQE
(33) As GFP having the peptide, there are mentioned such as that having the sequence selected from the group consisting of those of SEQ ID NOS: 4 to 6 in the sequence listing.
(34) TABLE-US-00002 (SEQ ID NO: 4 in the sequence listing) MASMTGGQQMGR DMPGTVLPGG MSKGEELFTG VVPILVELDG DVNGHKFSVS GEGEGDATYG KLTLKFISTT GKLPVPWPTL VTTLTYGVQC FSRYPDHMKR HDFFKSAMPE GYVQERTISF KDDGNYKTRA EVKFEGDTLV NRIELKGIDF KEDGNILGHK LEYNYNSHNV YITADKQRNG IKANFKTRHN IEDGSVQLAD HYQQNTPIGD GPVLLPDNHY LSTQSALLKD PNEKRDHMVL LEFVTAAGSGIT DEVDGT ELYK GG HHHHHH (SEQ ID NO: 5 in the sequence listing) MASMTGGQQMGR VPTDTDYSGG MSKGEELFTG VVPILVELDG DVNGHKFSVS GEGEGDATYG KLTLKFISTT GKLPVPWPTL VTTLTYGVQC FSRYPDHMKR HDFFKSAMPE GYVQERTISF NDDGNYKTRA EVKFEGDTLV NRIELKGIDF KEDGNILGHK LEYNYNSHNV YITADKQRNG IKANFKTRHN IEDGSVQLAD HYQQNTPIGD GPVLLPDNHY LSTQSALLKD PNDKRDHMVL LEFVTAAGSGIT DEVDGT ELYK GG HHHHHH (SEQ ID NO: 6 in the sequence listing) MASMTGGQQMGR DMPGTVLPGG GGGSEGEWQQQQHQWAKQE MSKGEELFTG VVPILVELDG DVNGHKFSVS GEGEGDATYG KLTLKFISTT GKLPVPWPTL VTTLTYGVQC FSRYPDHMKR HDFFKSAMPE GYVQERTISF KDDGNYKTRA EVKFEGDTLV NRIELKGIDF KEDGNILGHK LEYNYNSHNV YITADKQRNG IKANFKTRHN IEDGSVQLAD HYQQNTPIGD GPVLLPDNHY LSTQSALLKD PNEKRDHMVL LEFVTAAGSGIT DEVDGTC ELYK GG HHHHHH
(35) The endocytosis enhancing preparation of the present invention is obtained by dissolving GFP in the aqueous solution such physiological saline, which does not denature proteins to associate them. Alternatively, it is produced simultaneously through the reaction as shown in
(36) ##STR00004##
(37) For example, the reaction is conducted in the suitable medium, aqueous solution such as phosphate buffered saline (PBS), saline, Tris-HCl buffer, HEPES buffer, sodium citrate buffer, and carbonate-sodium bicarbonate buffer. The reaction condition varies on the depending on the protein to be used. However, the reaction temperature is as long as lower than that of the protein denaturation; it may be for example, 0 to 50° C., preferably 30° C. to 45° C., more preferably around 37° C. When GFP is used, the reaction property is improved up to 42° C. on temperature dependently.
(38) Also, by using the buffer as mentioned above used for the micelle formation, and for example, 1×PBS for the formed micelle separation, the micelle fraction wherein the buffer inside of the micelle and that outside of the micelle are different is obtained. By this, the micelle suitable for dissolving the drug included in the micelle is manufactured.
(39) It is preferable to treat GFP preliminary with a reducing agent such as DTT and the like to keep—SH group in non-oxidized state. Mixing ratio of the fluorescent protein and the dendrimer (molar ratio) may be that the protein equals 1 and the dendrimer is, for example, in the range of 1 to 20; preferably 1:5 to 1:15; more preferably 1:around 10. Note that the ratio varies depending on the concentrations.
(40) Also, the reaction period varies depending on the reaction temperature. However, it is, for example, 1 to 24 hours; preferably it is 10 to 19 hours; more preferably, it is 15 to 18 hours. Due to set the reaction period in the range, GFP having thiol group used is bound to the silole dendrimer (hereinbelow, it is sometimes referred to as “GFP-TPS”) and the conjugate of GFP, the endocytosis enhancing preparation, is formed. In the reaction, at least 1 molecule of GFP is combined into the silole dendrimer.
(41) After that, according to the conventional method for forming them, the fraction containing GFP-TPS is obtained. Here, the fraction containing GFP-TPS comprises certain amount of the GFP conjugate. The amount of the GFP conjugate varies depending on the presence or absence of the target peptide as well as the types thereof. They are classified into three such as the fraction contains small amount of GFP conjugate (the micelle A); that contains medium amount of them (the micelle B); and that contains large amount of them (the micelle C).
(42) The content amount of GFP in the fraction which containing the micelle may be measured by using the excitation wavelength 488 nm and detection wavelength 510 nm. Also, GFP-TPS may be measured by using the excitation wavelength 370 nm and detection wavelength 510 nm.
(43) When the micelle collapses, FRET of the micelle disappears. Therefore, the status of the carrier (the micelle) in the living body may monitored by changing FRET as an index. Furthermore, the monitoring enables to monitor the status of the micelle such that they are existing in the aqueous medium or incorporate in the cell, or they collapsed or not. On the other hand, since FRET of the conjugate remains, it is possible to monitor such that the conjugate is present, for example, in the aqueous solution or on the cell membrane and the like.
(44) According the present invention, the endocytosis enhancing preparation for the drug delivery system is provided.
EXAMPLES
(45) The following examples are merely illustrative and do not limit the scope of the invention.
(Example 1) Preparation of the Endocytosis Enhancing Agent of the Present Invention
(46) In the present embodiment, a protein for preparing the endocytosis enhancing agent, and GFP shown in SEQ ID NO: 7 of the sequence listing as the protein for preparing GFP-TPS are used. As the dendrimer, silole dendrimer is used. Here, the used GFP is prepared by using the method which has been reported by the inventors (see, Biochim. Biophys. Acta 1679 (2004) 222-229; Biochem. Biophys. Res. Commun. 330 (2005) 454-460); in the used GFP, Serine at the position 251 in C region of the GFP shown in SEQ ID NO: 7 in the sequence listing was replaced to Cysteine, and originally existed cysteines, at the positions of 48 and 70, were respectively replaced to Ser and Val.
(47) (1) Preparation of the Aggregatable Molecule for DDS
(48) In the example, the compound having the following chemical formula (I) as the dendrimer having halogen group and GFP (green fluorescent protein) (SEQ ID NO: 7) was used as the protein having thiol group.
(49) ##STR00005##
(50) At first, DTT was added to GFP solution of 20 μM concentration (in PBS) at 1 mM as a final concentration, and the GFP solution was treated for 10 minutes at room temperature to reduce cysteines on the surface of GFP. Ten μL of 200 μM of silole dendrimer shown the formula (VI) solution (in DMSO solution) was added to 400 to 450 μL of 20 μM GFP solution (in PBS) to have the final concentration of 10-fold molar equivalent, and then mixed with vortex mixer.
(51) After vortex, the solution was stood at 37° C. for overnight incubation to bind GFP and the silole dendrimer, and subsequently to form the micelles. The incubation time for this experiment was about 16 to 18 hours. The properties of the micelle particles in the solution were measured by using dynamic light scattering method (DLS; Dynamic light scattering). The result was shown in Table 1.
(52) TABLE-US-00003 TABLE 1 Average particle diameters of raw materials and products in PBS measured 5 times at 25° C. [nm] Particle diameter Zeta peak by scattering Particle diameter Average intensity peak by number 20 μM GFP only 860.7 838.8 4.682 50 μM Silole only 894.5 664.6 649.3 20 μM GFP-Silole only 210.3 256.8 147.7
(53) Also, the particle size in the reaction mixture was measured at 25° C. by using ZETASIZER NANO-S (manufactured by Malvern Instrument Ltd.) with a laser beam wavelength of 532 nm. The result was shown in
(54)
(55) When GFP and the silole dendrimer were incubated (in Table 1, it is shown as “GFP-Silole only”), the particle size of the micelle obtained was about 150 nm. In contrast, the particle size observed when GFP only was incubated was about 4 nm, and the particle size observed when silole dendrimer only was incubated was about 650 nm.
(56) Next, according to the observation of the obtained micelle particles by using scanning electron microscope (SEM; Scanning Electron Microscope), a large number of particles having the particle size of about from 100 to 500 nm and a small number of those of about 500 nm were confirmed (see
(57) From these results, it was clearly demonstrated that the micelle formed by using the aggregatable carrier for DDS of the present invention has the particle size distribution range between about 100 and 500 nm, and there were many particles having the particle size range between about 100 and 200 nm. Also, the electron micrograph by using SEM demonstrated that these particles have spherical micelle structures (see
(58) (2) Confirmation of Fluorescence Resonance Energy Transfer
(59) The silole dendrimers used in the example have the emission property that aggregated hydrophobic core parts of the silole gave AIE effects. Therefore, it was confirmed that the dendrimers emit, when they form the micelle structures. Therefore, we examined whether fluorescence resonance energy transfer (FRET: Fluorescence resonance energy transfer) between the silole and GFP occurs or not in the micelles composed of GFP-silole dendrimers to which GFP binds to the silole dendrimer (see
(60) Unreacted fluorescent proteins and dendrimers, free molecules, were removed from the reaction mixture; we conducted the emission property experiment (see
(61) As shown in
(62) That is, the conjugate molecule composed of the dendrimer having AIE effect and the associative protein such as fluorescent protein is prepared to form the micelles. It was demonstrated that the micelles give FRET between the dendrimers and GFP, and FRET was lost when the micelles are collapsed. Also, the present endocytosis enhancing agent, the conjugate of GFP (a conjugated GFP) itself shows emission.
(63) From the above, it was shown that the use of the micelle of the present invention as the aggregatable carrier for DDS enables to confirm the GFP-TPS and the conjugate of GFP delivered into the tissues or organs. Also, the fluorescence from the fluorescent protein may be traced even after the micelle delivered to the targeted tissue or organ collapses. Thereby, the intracellular environment and the like, to which the GFP protein were delivered, may be detected.
(Example 2) Preparation of the Fluorescent Protein which Binds the Target Peptide Sequence
(64) The target peptide sequence binding fluorescent protein was prepared as follows. The protein bound to the micelle of the present invention at the C terminal, and it bound to the target peptide, which binds the receptor expressed on the surface of a cancer cell, at N terminal.
(65) (1) Inverse PCR
(66) (1-1) Selection of the Peptide Sequence
(67) The peptide sequence of the selected target peptide was shown in the following Table 3. MCF-7 is a human breast adenocarcinoma-derived cell, having the sequence listed in the following Table 2, and it is sometimes referred to as “target type 1”. MCF7-2 is the variant of MCF7-1 having the sequence listed in the following Table 3, and it is sometimes referred to as “target type 2”. Also, MCF7-1+α stand is another variant having the structure that the short peptide with α-helix, which is sometimes referred to as “α-stand”, was connected to MCF7-1 as shown in the following Table 3, and it is sometimes referred to as “type 1 enhanced”.
(68) TABLE-US-00004 TABLE 2 SEQ ID Cell Species Peptide Sequence NO: MCF7-1 DMPGTVLP 1 MCF7-2 VPTDTDYSGG 2 MCF7-1 + DMPGTVLPGG 3 α stand GGGSEGEWQQQQHQWAKQE
(1-2) Preparation of Primers
(69) Primers for conducting inverse PCR of the peptide sequence shown in Table 2 were written in the following Table 3. Among these primers, SEQ ID NO: 1 (DMPGTVLP) and SEQ ID NO: 3(DMPGTVLPGG GGGSEGEWQQQQHQWAKQE) in the sequence listing were designed so as that elongation reaction initiates between the DM (residues 1 and 2 of SEQ ID NO: 3) and the PGTVLP (residues 3-8 of SEQ ID NO: 3) of the peptide sequence. SEQ ID NO: 2 (VPTDTDYSGG) was designed so as that the reaction initiates between the VP (residues 1 and 2 of SEQ ID NO: 2) and the DTDYSGG (residues 4-10 of SEQ ID NO: 2) of the peptide sequence. They were designed for conducting optimal inverse PCR.
(70) TABLE-US-00005 TABLE 3 Introduced SEQ Peptide ID Sequence Primer NO: DMPGTVLP F: CCTGGTACTGTTCTTCCTGGTGGTATGAGTA 12 (SEQ ID AAGGAGAAGAACTT NO: 1) R: CATATCGCGACCCATTTGCTGTCCACC 13 VPTDTDYSGG F: ACTGATACTGATTATAGTGGAGGAATGAGTA 14 (SEQ ID AAGGAGAAGAACTT NO: 2) R: AGGAACGCGACCCATTTGCTGTCCACC 15 DMPGTVLPGG F: CAACAACAACAACATCAATGGGCAAAACAAG 16 GGGSEGEWQQ AAATGAGTAAAGGAGAAGAA QQHQWAKQE R: CCATTCACCTTCACTACCACCACCACCACCA 17 (SEQ ID GGAAGAACAGT NO: 3)
(1-3) Preparation of the Template Plasmid for Inverse PCR
(71) A template plasmid for inverse PCR was prepared by the method described in the following paper.
(72) “Protease-sensitive signaling by chemically engineered intramolecular fluorescent resonance energy transfer mutants of green fluorescent protein.—Miho Suzuki, et al. Biochimica et Biophysica Acta (BBA)—Gene Structure and Expression Volume 1679, Issue 3, 17 Sep. 2004, Pages 222-229”
(1-3-1) Plasmid Construction for GFPuv5 Mutant
(73) GFPuv5 was prepared from the pGFPgcn4 as follows. Firstly, the inverse PCR products, which has a synonymous mutation for gene manipulation was generated by using inverse PCR with 1167T mutation and forward primer, 5′CATTGAAGATGGCTCCGTTCAA (SEQ ID NO: 18) and reverse primer, 5′CATTGAAGATGGCTCCGTTCAA (SEQ ID NO: 19), were obtained. Subsequently, cyclization treatment of the products was conducted for obtaining GFPuv5. The construct obtained in this way was named pGFPgcn5.
(74) After that, cDNA of GFPuv5 was cloned into pET21a (manufactured by Novaben Inc.) to express the protein, and then the protein was purified and named GFPuv5tag. The code region was amplified using the primers 5′CTCGACCAT[ATGGCTAGCATGACTGGTGGACAGCAAATGGGT]CGCA TGAGTAAAGGAGAAGAACTTTTCA (SEQ ID NO: 20) and 5′TGACGTGAATTCATTA[GTGATGGTGATGGTGATG]TTTGTAGAGCTCA TCCATGC (SEQ ID NO: 21). In SEQ ID NO: 20, an adhesive tag adhering to the epitope tag composed of 11 amino acids from the terminal for 10 proteins of T7 gene toward N terminal of GFPuv5 series was marked as [ ]. The SEQ ID NO: 21 provides His tag to C terminal of GFPuv5 series, and His tag in the sequence was shown as [ ].
(75) The nucleotide sequences shown in the SEQ ID NOS: 1 to 3 were inserted into pET21a, and then it was digested with both of NdeI and EcoRI. The pGFPgcn plasmid was used for gene manipulation and the pET21a plasmid was used for protein expression under the control of the T7 promoter. The nucleotide sequences of the gene of GFPuv5 and the mutants thereof were confirmed by DNA sequencing (ABI PRISM 3100, manufactured by Genetic Analyzer). Three more synonymous mutations were found during the experiment. Those have the following mutations: agt to age at Ser at 30, cat to cac at His 78, and caa to cag at Gln 183.
(76) The experiment was continued including these mutations, because these mutations were not harmful for the fluorescent proteins. The fluorescent intensity of the purified GFPuv5tag was about 1.9 times higher than that of GFPuv4tag. After that, either of the cysteine residues at position 48 or position 70 (sometimes referred to as “cysteine 48” or “cysteine 70”) was replaced with randomized amino acid by inverse PCR using pGFPgcn5.
(77) Both oligonucleotides 5′ CTTAAATTTATTNNKACTGGAAAAC (SEQ ID NO: 22) and 5′ GGTAAGTTTTCCGTATGTTG (SEQ ID NO: 23) were used for mutation of cysteine 48. Both of 5′ GTGTTCAANNKTTTTCCCGTTATCCG (SEQ ID NO: 24) and 5′ CATACGTCAGAGTAGTGACAAG (SEQ ID NO: 25) were used for the mutation of cysteine 70. Culture of E. coli BL21 (DE3) was transformed with the obtained plasmids and screened by using daylight excitation for those having strong fluorescence, and selected on an agar medium. Several mutants emitting strong florescence were obtained at position 48 (replaced with one of Ala, Asp, Glu, Gly, Ile, Leu, Asn, Pro, Ser, Thr, Val, and Tyr). However, the C70V cysteine mutant gave only proper fluorescence at position 70.
(78) In order to produce double cysteine mutations GFPuv5 having strong fluorescent intensity, the plasmid having the single mutation was digested with both of NcoI and EcoRI and ligated to each region again. Selection was conducted by using the single mutants. The UV5CO tag (C48S/C70V) showed the highest fluorescence intensity among all the recombinants.
(79) Next, cysteines were introduced at both positions 6 and 229 by inverse PCR, respectively. The plasmid having C48S mutation and a set of the following primers were used for introducing respective mutation.
(80) TABLE-US-00006 For Glu replacement: (SEQ ID NO: 26) 5′TGTCTTTTCACTGGAGTTGTCCC and (SEQ ID NO: 27) 5′ TTCTCCTTTACTCATTTTTTC For Ile replacement: (SEQ ID NO: 28) 5′TGCACACATGGCATGGATGAGCTC and (SEQ ID NO: 29) 5′CCCAGCAGCAGTTACAAACTC
(81) Three protease tags having trypsin target sequence (Glu-Gly-Arg) have various spacer sequence, which were no spacer, Thr spacer or Gly-Thy spacer, and necessary cysteine was replaced between His-231 and Asp-231. These constructs were obtained by using puvC48Stag, the obtained plasmid (a template), and the primers shown in the following Table 4.
(82) TABLE-US-00007 TABLE 4 Plasmid Name Primers SEQ ID NO: pUV5trypS0tag F: 5′CAGCGCCGTTGTGAGCTCTACAAATAATGAATT 30 (without spacer) R: 5′TGTAATCCCAGCAGCAGTTAC 31 pUV5-trypS1tag F: 5′ACATGTGAGCTCTACAAATAA 32 (with Thr spacer) R: 5′ACGGCCCTGTGTAATCC 33 pUV5trypS2tag F: 5′GGAACATGTGAGCTCTACAAA 34 (with Gly-Thr spacer) R: 5′ACGGCCCTGTGTAATCCC 33
(1-3-2) Purification of GFPuv5tag Mutant
(83) E. coli BL 21 (DE3) was transfected by using all of the plasmids. 12 mL of E. coli at the stationary phase after overnight culture was seeded in 38 ml of LB medium supplemented with 50 μg/ml ampicillin and 0.5 mM IPTG, and incubated at 37° C. for 8 hours. The cells were collected by centrifugation at 2,500×g for 20 minutes and resuspended in 10 mL of PBS. The pellet of the cells was lysed in 10 ml of lysis buffer (pH 8.0) containing 50 mM Tris and 8 M urea at room temperature for 15 minutes, and then vortexed. The lysed cells were centrifuged at 1,200×g for 15 minutes, and the supernatant was taken to mix with Ni.sup.2+-NTA resins (manufactured by Qiagen Co. Ltd.) which were suspended in PBS. After sequentially washing the resins with PBS and 20 mM imidazole, the bound GFPuv5tag mutant was eluted with 250 mM imidazole solution.
(84) In order to exchange the buffer, the eluate was applied to PD-10 gel electrophoresis filtration column (manufactured by Amersham Bioscience Co. Ltd.), which was equilibrated with 10-fold diluted PBS. The eluted GFPuv5tag mutant protein was collected, and the concentrations thereof were determined by using Coomassie protein assay reagent (manufactured by Pierce Co.). Purified GFPuv tag mutants were analyzed by 15% SDS-PAGE.
(85) Nucleic acid sequence of the template plasmid for inverse PCR was shown as SEQ ID NO: 26.
(86) (1-4) Conditions for PCR
(87) A reaction mixture shown in the following Table 5 was prepared, and the inverse PCR was conducted under the condition shown in the following Table 6.
(88) TABLE-US-00008 TABLE 5 Components Amount (μL) Template (plasmid->pET21a (+) NSS25 5 KOD Dash Buffer (Toyobo Co. Ltd.) 5 2 mM dNTP (Toyobo Co. Ltd.) 5 F primer (2.5 pmol) 10 R primer (2.5 pmol) 10 KOD Dash (2.5 U/μL) (Toyobo Co. Ltd.) 0.5 Sterile distilled water 14.5 Total 50
(89) TABLE-US-00009 TABLE 6 Temp. (° C.) Reaction period (min.) Cycles 95 3 — 98 0.1 5 65 2 70 4 98 0.1 — 74 2 25 70 4 70 7 4 — — 4 — —
(1-5) Confirmation by Gel Electrophoresis
(90) A portion of the PCR solution was taken, and subjected to gel electrophoresis with 0.8% PAGE at voltage 100 V for 30 minutes of applied voltage time to confirm the amplified peptides in each sample. The result of the electrophoresis was shown in
(91) (2) Removal of Independent A Sequence and Purification of PCR Products
(92) The reaction mixture shown in the following Table 7 was prepared and reacted at 120° C. for 30 minutes to remove the independent A sequence which was produced by the PCR. After that, the PCR products were purified by using QIAquick (a registered trademark), PCR Purification Kit (manufactured by QIAGEN) according to the instruction attached to the kit.
(93) TABLE-US-00010 TABLE 7 Composition Amount (μL) inverse PCR product 50 10 × NE Buffer 2.1 (New England Biolabs Inc. (NEB)) 1 10 mg/ml BSA (NEB) 2 2 mM dNTP 8.3 T4 DNA polymerase (3,000 unit/μL) (NEB) 0.5 Total 60
(3) Ligation Reaction
(94) Subsequently, the reaction mixture shown in the following Table 8 was prepared and reacted at 16° C. for more than 3 hours to prepare a circular plasmid for transformation of E. coli DH5a described later. Depending on the variants, the temperature, 25° C., 37° C., and the like were used.
(95) TABLE-US-00011 TABLE 8 Composition Amount (μL) PCR product 8 10 × T4ligase B (NEB) 1 T4 DNA polynucleotide kinase (40,0000 unit/μL) (NEB) 0.5 T4 DNA ligase (10,000 unit/μL) (NEB) 0.5 Total 10
(4) Transformation of E. coli DH5α
(96) 10 μL of competent cells of E. coli DH5α (manufactured by BioDynamics Laboratory) was thawed on ice immediately before use, and then prepared a competent cell solution. One μL of the ligation reaction solution was added to the competent cell solution, and then left on ice for 30 minutes. After that, the solution was incubated at 42° C. for 30 seconds and then cooled on ice for 2 minutes. 90 μL of SOC medium (manufactured by TOYOBO Co., LTD.) was added to the solution, and reacted on a shaker at 37° C. for 1 hour. Thereafter, it was seeded on LB selection medium supplemented with ampicillin (manufactured by TOYOBO Co., LTD.), and incubated for overnight at 37° C.
(97) (5) Colony PCR
(98) Colonies obtained from the transformation were subjected to Colony PCR to confirm the predicted inserts.
(99) (5-1) Preparation of the Reaction Mixture for PCR
(100) The reaction mixture for colony PCR shown in the following Table 9 was prepared.
(101) TABLE-US-00012 TABLE 9 Composition Amount added (μL) KOD Dash Buffer (Toyobo Co. Ltd.) 2 2 mM dNTP 2 Double His primer (2.5 pmol) 4 pET primer 4 KOD Dash (2.5 U/μL) (Toyobo Co. 0.2 Ltd.) Sterilized distilled water 7.8 Total 20
(102) The reaction mixture for colony PCR was poured into a PCR tube. E. coli grown on the LB medium supplemented with ampicillin was collected and added to the tube. PCR was conducted according to the program shown in the following Table 10.
(103) TABLE-US-00013 TABLE 10 Temp. (° C.) Reaction time (min.) Cycles 95 3 — 98 0.5 5 50 0.5 70 0.5 98 0.1 — 72 0.5 25 70 0.5 70 7 4 — —
(5-2) Electrophoresis
(104) Electrophoresis of the PCR reaction mixture was conducted with 1.2% PAGE at applied voltage of 100 V for 30 minutes. The colonies of which amplification were confirmed were inoculated into the culture bottle containing LB liquid medium (manufactured by TOYOBO Co., LTD.) and incubated at 37° C.
(105) (6) Purification of Plasmid
(106) The plasmid in E. coli cultured in the LB liquid medium was purified by using Wizard Plus SV Minipreps. DNA Purification System (manufactured by Promega Co.) according the instruction attached thereto. After that, the sequences of the purified plasmid were sent to Eurofin Genomics Co., Ltd. for their analysis.
(107) (7) Transformation of E. coli BL21 (DE3)
(108) Ten μL of E. coli BL21 (DE3) competent cells (manufactured by BioDynamics Laboratory) were thawed on ice immediately before use, and then prepared the competent cell solution. One μL of the plasmid solution, which was confirmed to contain the target sequence by the sequencing, was added to the competent cell solution, and left to stand on ice for 30 minutes.
(109) After that, the solution was incubated at 42° C. for 30 seconds and then cooled on ice for 2 minutes. 90 μL of SOC medium (manufactured by TOYOBO Co., LTD.) was added to the solution, and reacted on a shaker at 37° C. for 1 hour. Thereafter, it was seeded on LB selection medium supplemented with ampicillin, and left to stand overnight at 37° C. Next day, transformed colonies emitting green fluorescence were collected, and inoculated into culture bottles containing 1 ml of LB liquid medium supplemented with ampicillin. Then, they were left to stand overnight at 37° C. for pre-culture.
(110) (8) Purification of the Fluorescent Protein Binding to the Target Peptide Sequence
(111) (8-1) Colony Cultivation
(112) For samples, 4 tubes in 50 mL size to which both of 4 ml of the LB liquid medium supplemented with ampicillin and 290 μL of the pre-cultured solutions were added were prepared, and then cultured on the shaker at 28° C. for 4 hours. After that, 43 μL of 100 mM IPTG (isopropyl-β-thiogalactopyranoside) was added to them, and they were cultured overnight at 28° C. on the shaker.
(113) (8-2) Recovery of the Protein
(114) Next day, the cultures in the four tubes were collected into one tube. Three tubes of which contents were transferred were washed with 1 ml PBS (−) buffer (manufactured by Wako Pure Chemical Industry, Ltd.), and the washed solutions were also added to the collected tube to which the cultures were collected. The tube containing the collected cultures was centrifuged at room temperature for 5 minutes at 5,000 rpm (the name of centrifuge: KUBOTA3740, the rotor number: KUBOTA AF2018, manufactured by KUBOTA Co.).
(115) After that, (i) the supernatant was removed and 3 ml of PBS (−) buffer was added to the precipitation pellet (ii) to vortex well, and then the tube was centrifuged at 5,000 rpm for 5 minutes. The steps (i) and (ii) were repeated twice. Four ml of B-PER Lysis Buffer (manufactured by Reagent) was added to the precipitation pellet, and it was capped and stirred overnight at room temperature on the shaker.
(116) (8-3) Purification by His-Tag
(117) Two ml of Ni-NTA Agarose (manufactured by QIAGEN) was put in 15 ml tube, (i) the tube was centrifuged at 1,000 rpm for 1 minute, (ii) the supernatant was discarded, and 1×PBS buffer was added to the tube and vortexed well. The steps (i) and (ii) were repeated three times for preparing Ni-NTA resin.
(118) The tube containing B-PER Lysis buffer solution was centrifuged at 12,000 rpm for 10 minutes at room temperature, and then the supernatant was transferred to a 15 ml Falcon tube. 400 μL of well stirred Ni-NTA resin was added to the tube, and then the tube was placed on the rotary shaker and shook at room temperature for 10 minutes. After that, the tube was centrifuged at 1,000 rpm for 1 minute at room temperature, and the supernatant was discarded. (iii) 4 mL of 1×PBS buffer was added to the tube and vortexed well, (iv) the tube was centrifuged at 1,000 rpm for 1 minute at room temperature, and the supernatant was discarded. The steps (iii) and (iv) were repeated twice.
(119) After that, (v) 4 ml of 20 mM imidazole (manufactured by Wako Pure Chemical Industry, Ltd.) was added to the tube and vortexed well, (vi) the tube was centrifuged at 1,000 rpm for 1 minute at room temperature, and the supernatant was removed. The steps (v) and (vi) were repeated twice. 500 μL of 250 mM imidazole was added to the tube, and then it was stirred at room temperature for 10 minutes with the rotary shaker. Thereafter, the tube was centrifuged at 1,000 rpm for 1 minute, and the supernatant emitting green fluorescence was transferred to a new 15 ml Falcon tube to prepare the protein purified solution for the gel filtration in next stage.
(120) (8-4) Purification by Gel Filtration
(121) Imidazole in the protein purified solution was exchanged with PBS and the solution was purified to obtain the target peptide sequence binding fluorescent protein of interest. In the procedures described above, Nap 5 column manufactured by GE Heath Care Japan KK. was used to conduct the purification according to the instruction attached thereto.
(122) (9) Selection of the Target Peptide Sequence Binding Fluorescent Protein
(123) The concentration of the target peptide sequence binding fluorescent protein obtained from the purification procedure was measures by using absorbance, 280 nm, and the chromophore concentration (chromophore forming ability) was measured by using absorbance, 488 nm, according to the conventional method. The proteins of which ratio of A 488/A 280 exceeded 1.5 were selected as the target peptide sequence binding fluorescent protein of the interest. The result was shown in Table 11.
(124) TABLE-US-00014 TABLE 11 Wave length (nm) Ratio Type Absorbance 280 488 488/280 Target type 1 sample 1 0.2459 0.5246 2.1335 sample 2 0.2487 0.5295 2.1289 sample 3 0.2494 0.5307 2.1280 Target type 2 sample 1 0.4280 0.8236 1.9241 sample 2 — — — sample 3 — — — Target type 1 sample 1 0.6300 0.9039 14348 enhanced sample 2 0.7695 1.1427 14850 sample 3 — — — Non-target sample 1 0.6689 13 189 1.9717 type sample 2 0.4544 0.9915 2.1821 sample 3 1.0079 20110 1.9952
(Example 3) Preparation of the Target Peptide Sequence-Binding Micelle (Associated Fluorescent Protein Driving Type Micelle)
(125) Instead of unmodified GFP, the aggregable molecule to which the target peptide sequence is bound is prepared. Subsequently, the micelle, the conjugated fluorescent protein driving micelle, as the same as those employed in the example 1, were prepared to investigate the amount of the conjugate existed in the micelle fraction.
(126) (1) Emission Properties
(127) A variety of the conjugate amount in the micelle fractions, reacted as described above, depending on the target peptides were measured as the same as that in Example 1 (see,
(128) (2) Confirmation of the Existence of the Conjugate
(129) Next, the amount of the endocytosis enhancing agent of the present invention (the aggregated body) existed in the micelle fraction was confirmed for the case wherein the following 4 types were used: without target peptide sequence (MCF7-0: non-target type); with the target type (MCF7-1 (the target type 1); MCF7-2 (the target type 2)); and the target peptide+α stand (MCF7-1+α (the enhanced target type 1)).
(130) (3) Confirmation of GFP Bounds to the Target Peptide
(131) (3-1) Classification of the Fractions when y Typed of the Aggregable Molecules are Used
(132) Each GFP produced as described above was mixed with TPS at the ratio of 10:1. Then, the mixture was stood at 37° C. overnight to obtain the aggregates of the target peptides with GFP (the peptides are MCF7-0, MCF7-1, MCF7-2, and MCF7-1+α) and GFP-TPS.
(133) Then, the content amount of the aggregated body, which is referred to as the “remained GFP amount”, was classified on the basis of the intensity ratio (I.sub.0) between that of the excitation wavelength 370 nm—measurement wavelength 510 nm and that of the excitation wavelength 488 nm—measurement wavelength 510 nm into 3 classes: A (I.sub.0≤1.0 (less remained GFP content amount)), B (1≤I.sub.0≤2.0 (medium remained GFP content amount), and C (I.sub.0≤2.0 (more remained GFP content amount) (See,
(134) On the basis of the following reasons, we classified as described above. Firstly, as described above, the aggregable molecule presenting the protein is obtained by reacting the carbosilane dendrimer and GFP overnight as shown in
(135) Here, the shape of the fluorescent wavelength excited at the wavelength of 370 nm shows FLET efficiency of the micelle. Therefore, it shows higher the ratio between the intensities at 480 nm (the fluorescence from the aggregated body having silole backbone) and 510 nm (the fluorescence from GFP), better the FRET efficiency.
(136) Also, it means to measure the fluorescence of the excitation wavelength at 488 nm that total amount of GFP which independently exists from GFP inside the micelle, and reasons are as follows: the fluorescent amount behaves independently from the efficiency of FRET as described above; they are predicted as remained GFP, and the existence of conjugated GFPs were actually confirmed by subjecting the micelle components. As a result, it was shown that there is difference among the amount of the conjugates belonging to the 3 classes as mentioned above depending on the used target peptides.
(137) TABLE-US-00015 TABLE 12 Generation ratio of conjugate*.sup.1 (other than he experiment for inclusion) A B C Generation small medium large ratio of C (%) MCF7-0 (Non-target tyke) 8 3 3 21.4 MCF7-1 (Target type 1) 11 6 4 19.0 MCF7-2 (Target type 2) 3 7 8 44.4 MCF7-1 + α (Target type 1 3 2 7 58.3 reinforced) *.sup.1The ratio of the fluorescent intensity excited at the wavelength of 488 nm and that excited at the wavelength of 370 nm *2: A ≤ 1.0, 1.0 < B < 3, 3.0 ≤ C
(138) As shown in the table 12, the generation ratio of the conjugate was significantly higher in the molecule having the target sequence either of MCF7-2 or MCF7-1+α than those having other sequences.
(139) (3-2) Variety of the GFP-Conjugate Depending on the Target Peptides
(140) Ten μL of the protein solution, of which concentration was 5 μM, was taken out from each solution includes the aggregable molecules obtained as described above was subjected to gel electrophoresis without any treatment to confirm the conjugate included thereof. Results are shown in
(Example 4) Incorporation Experiment of DDS Liposome or the Micelle-2 (the Association Bodies are Co-Existed)
(141) (1) Variety of the Micelle Solution Including the Aggregable Molecule Depending on the Target Peptides-1
(142) Conjugates of GFP without the target peptide obtained in Example 3 are classified into the groups the solution including the high content amount of the conjugate (the micelle C), the medium content amount of that (the micelle B), and the less amount of that (the micelle A) to prepare the sample solutions. Then, they were subjected to gel electrophoresis to discuss which mer of the conjugates were formed. SDS is added to 12% of running gel-4% stacking gel at final concentration of 0.1%. The fluorescent measurement condition for each sample is set that the sensitivity to 3×3, Max of the fluorescent intensity to 500. When the micelle C equals to 1, the amount of the micelle A was double, and that of GFP was 5 times were applied to conduct gel electrophoresis and 20 mA for 2 hours. In this experiment, both of the micelle solution and GFP were applied as undiluted solutions.
(143) Results are shown in
(144) As shown in both of
(145) (2) Variety of the Micelle Solution Containing the Aggregable Molecule Depending on the Target Peptide-2
(146) Next, under the same conditions for the gel electrophoresis employed in Example 2, GFP, which was concentrated by using Amikon 100K to be associated, the sample containing MCF7-1 and that containing MCF7-2 were compared. The fluorescent measurement was conducted under the condition for each sample at the sensitivity 3×3 of the spectrophotometer, and then 5 μL or 20 μL of the micelle C having MCF7-1—protein (300 μM) is applied. The micelle C having MCF7-2—protein (300 μM) is applied at the same amount. The fluorescence detection or staining is performed according to those as mentioned (1).
(147) The results are shown in
(148) (3) Correlation Between the Incorporated Amount of the Protein Mixture and the Amount of the Associated Protein
(149) The micelle with the target peptide or without the target peptide are respectively added into the wells, wherein MCF-7 cells are cultured, at 50 μL of the volume to study the relationship of the incorporation amount of the micelles into the cells and the amount of the conjugate in the same fraction.
(150) Against 1×10.sup.9 cells/well, 50 μL of the sample containing both of the micelle and the conjugate being composed of the aggregable molecules are added. It is incubated at 37° C. for 9 hours, and then it is detected by using FACS.
(151) FACS data was summarized: the horizontal axis is set to the emission intensity of the fluorescence showing the classifications of the remained protein (herein fellow, it is collectively referred to as the “micelle”); and the longitudinal axis is set to the ratio (%) of the cell numbers, wherein the cell clearly has the fluorescent intensity among 50,000 cells of the FCS data clearly. The results are shown in
(152) In both of
(153) Both of
(154) As described above, it was demonstrated that the endocytosis enhancing preparation of the present invention strongly enhances the incorporation of the micelle being composed of the carbosilane dendrimer (or the vesicle) presenting GFP into the cells.
(Example 5) Study of the Buffer for the Micelle Preparation
(155) Until now, we conducted the MCF-7 micelle preparation in only one buffer, 1×PBS. In order to conduct the experiment for incorporation of the drugs, we had to consider the solubility or stability of the variety of the drugs to be incorporated. Therefore, we studied whether the micelle preparation in the buffer other than 1×PBS was possible or not.
(156) (1) Study of the Buffer to be Used
(157) We prepared following 4 buffers: Tris-HCl buffer, which is most popularly used around pH 7 in the field of the molecular biology; HEPES buffer, which is one buffer included in Good buffer (it is collectively referred to as 12 buffers shown in Norman Good et, al. in 1966); citrate buffer as the organic buffer; and carbonate buffer as the inorganic buffer. The micelles are formed in each buffer and separated, and used to obtain the micelle fraction in PBS, of which inside is one of the above-mentioned buffer, and outside is PBS. Their fluorescence and the particle size were measured to confirm short-term stability (the stability of the micelle 1 to 2 days after their preparation).
(158) (2) The Micelle Formation in 50 mM Tris-HCl Buffer (pH 8.0)
(159) (2-1) Conventional Preparation Method of the Micelle
(160) Until now, the micelle was prepared in 1×PBS, because it includes the same ion species as these in the living body and it is thought to be closer to the biological condition due to isotonic.
(161) However, by using the conventional method, inside of the micelle is filled with the buffer used to form the micelle. Therefore, we studied the micelle formation in the buffer which has good compatibility for the drugs. As the generally used buffers, there are mentioned such as Tris-HCl buffer, Hepes buffer, MOPS buffer, CHAPS buffer and the like. Among them, firstly choose Tris-HCl buffer to study the micelle formation in 50 mM Tris-HCl (pH 8.0) (herein below it is referred to as simple “Tris buffer”).
(162) (2-2) Modification of the Micelle Preparation
(163) The buffer to be used was 50 mM Tris-HCl (pH 8.0). NICK column was washed by using Tris buffer in 5 times, and then it was equilibrated by using Tris buffer.
(164) (2-3) Preparation of the Micelle
(165) By using Amicon 10 k Filter, the column was centrifuged at 14,000×g for 15 minutes to concentrate 219.2 μL of the fluorescent protein for MCF-7 micelle. It was diluted by using Tris buffer to 99 μL, 1 μL of 100 mM DTT was added and then stood for 10 minutes to prepare the sample mixture.
(166) The sample mixture is applied to NICK column being equilibrated as described above, and 365 μL of Tris buffer is added into it, and then 380 μL of Tris buffer is used for elution. After that, 10.28 μL of TPS is added into the eluted solution, and the solution is vortexed for 10 minutes and stood at 37° C. overnight to obtain the micelle reaction mixture. The reaction mixture includes the formed micelle (hereinbelow, it is referred to as “MCF-7 micelle”.) and the associated fluorescent protein for MCF-7 micelle.
(167) Tris buffer employed here is prepared as 1 M Tris-HCl (pH 8.0) as the stock solution, which is used by diluting 20 times with MilliQ (Merk Millipore).
(168) (2-4) Separation of the Micelle
(169) The micelle reaction mixture as described above is applied onto Amicon 100 k Filter, and then it is centrifuged at 14,000×g for 10 minutes to separate the upper-filter solution and the lower-filter solution.
(170) 100 μL of 1×PBS is added to the filter includes the upper-filter solution, and then it is centrifuged at 14,000×g for 10 minutes as washing operation. The washing operation is repeated 3 times to exchange Tris buffer to 1×PBS. The upper filter solution after the buffer exchange (the micelle fraction solution) is centrifuged by using the tabletop centrifuge to collect the micelle. Next, the suitable volume of 1×PBS is added into the filter being empty and stood 10 minutes, and the micelle is further recovered after reversing the upside of the filter to down. Thus recovered solution is diluted by using 1×PBS to 160 μL. For 20 timed dilution (2.5 μM), 95 μL of 1×PBS is added to 5 μL of the portion taken out from the solution to dilute.
(171) The particle size of the micelle included it was measured. For 50 timed dilution (1 μM), 392 μL of 1×PBS is added to 8 μL of the portion taken out from the solution to measure its fluorescence.
(172) From the lower-filter solution (the micelle unreacted fraction), 5 μL of the portion is taken out, and diluted 20 times to adjust 100 μL to measure the micelle size (see
(173) Zetasizer (Malvern, the cell: ZEN0040) is uses for the particle size measurement. Also, the fluorescent spectrometer RF-5300PC (Shimadzu Corporation) was used for the fluorescent measurement with the excitation wavelength of 370 nm and detection wavelength 488 nm.
(174) (3) Micelle Formation in 50 mM HEPES Buffer (pH 7.6)
(175) As the micelle fraction solution, 50 μM×160 μL was prepared. Concentration in the reaction was 20 μM, and the final concentration was 50 μM. The micelle was formed as the same as those when Tris buffer is used except that 50 mM HEPES buffer (pH 7.6) is used instead of Tris buffer. The separation of the formed micelle was conducted by using Amicon 100 k Filter. Then, the micelle fraction was obtained through buffer exchange to 1×PBS as the same as that conducted in the case of Tris buffer is used.
(176) 5 μL of the portion is respectively taken out from the micelle fraction solution or the micelle unreacted fraction solution, and diluted 20 times (2.5 μM) by adding 95 μL of 1×PBS to measure the micelle size (See
(177) 392 μL of 1×PBS is added to 8 μL portion of the micelle fraction solution to prepare 50 times diluted solution (1 μM) to measure its fluorescence. 384 μL of 1×PBS is added to 16 μL of the micelle unreacted solution to prepare 25 times diluted solution to prepare its fluorescence (See,
(178) (4) The Micelle Formation in 50 mM Citrate Buffer (pH 7.6)
(179) By using sodium citrate is used to prepare 50 mM citrate buffer (pH 7.6). As the micelle fraction solution, 50 μM×160 μL is prepared. The concentration during the reaction is 20 μM, and the final concentration is 50 μM. The micelle was formed as the same as those when Tris buffer is used except that the 50 mM citrate buffer is used, and separated. Then, the micelle fraction was obtained through buffer exchange to 1×PBS as the same as that conducted in the case of Tris buffer is used. 5 μL of the portion is respectively taken out from the micelle fraction solution or the micelle unreacted fraction solution, and diluted 20 times (2.5 μM) by adding 95 μL of 1×PBS to measure the micelle size (See
(180) 5 μL of the portion is respectively taken out from the micelle fraction solution or the micelle unreacted fraction solution, and diluted 20 times (2.5 μM) by adding 95 μL of 1×PBS to measure the micelle size (See
(181) 392 μL of 1×PBS is added to 8 μL portion of the micelle fraction solution to prepare 50 times diluted solution (1 μM) to measure its fluorescence. 384 μL of 1×PBS is added to 16 μL of the micelle unreacted solution to prepare 25 times diluted solution to prepare its fluorescence (See,
(182) (5) The Micelle Formation in 50 mM Carbonate-Bicarbonate Buffer (pH 8.36)
(183) By using sodium bicarbonate, 50 mM carbonate-bicarbonate (pH 8.36) was prepared. As the micelle fraction solution, 50 μM×160 μL is prepared. The micelle was formed as the same as those when the carbonate-bicarbonate (pH 8.36) is used instead of the 50 mM citrate buffer. The separation of the formed micelle was conducted by using Amicon 100 k Filter as the same as that Tris buffer is used. Then, the micelle fraction was obtained through buffer exchange to 1×PBS as the same as that conducted in the case of Tris buffer is used.
(184) 5 μL of the portion is respectively taken out from the micelle fraction solution or the micelle unreacted fraction solution, and diluted 20 times (2.5 μM) by adding 95 μL of 1×PBS to measure the micelle size (See
(185) 392 μL of 1×PBS is added to 8 μL portion of the micelle fraction solution to prepare 50 times diluted solution (1 μM) to measure its fluorescence. 384 μL of 1×PBS is added to 16 μL of the micelle unreacted solution to prepare 25 times diluted solution to prepare its fluorescence (See,
(186) (6) Results
(187) As described above, MCF-7 micelle was prepared at the final concentration of 50 μM by using 4 buffers as described above. In the micelle size measurement of each MCF-7 micelle, all of them showed the distribution peak around 100 to 200 nm as the same as those in 1×PBS (
(188) Also, the MCF-7 micelles prepared in each buffer are stored at 4° C., and 1 to 4 days later, they are subjected to the fluorescent analysis under the same conditions as described above. The fluorescent intensity of the micelle used in the above-mentioned buffer showed almost flat, and it demonstrated that they have short-term stabilities (
INDUSTRIAL APPLICABILITY
(189) The present invention is useful in the field of the pharmaceutical preparations, particularly in the field of drug delivery.
FREE TEXT FOR SEQUENCE LISTING
(190) SEQ ID NO: 1: Target recognition sequence peptide (MCF7-1) incorporated into GFP
(191) SEQ ID NO: 2: Target recognition sequence peptide (MCF7-2) incorporated into GFP
(192) SEQ ID NO: 3: Target recognition sequence peptide (MCF7-1+α stand) incorporated into GFP
(193) SEQ ID NO: 4: GFP incorporating MCF7-1
(194) SEQ ID NO: 5: GFP incorporating MCF7-2
(195) SEQ ID NO: 6: GFP incorporating MCF7-1+α stand
(196) SEQ ID NO: 7: amino acid sequence of GFP
(197) SEQ ID NO: 8: amino acid sequence of GFP
(198) SEQ ID NO: 9: amino acid sequence of BFP
(199) SEQ ID NO: 10: amino acid sequence of YFP
(200) SEQ ID NO: 11: amino acid sequence of the fluorescent protein derived from Discosoma
(201) SEQ ID NO: 12: forward primer for MCF7-1 amplification
(202) SEQ ID NO: 13: reverse primer for MCF7-1 amplification
(203) SEQ ID NO: 14: forward primer for MCF7-2 amplification
(204) SEQ ID NO: 15: reverse primer for MCF7-2 amplification
(205) SEQ ID NO: 16: forward primer for MCF7-1+α stand amplification
(206) SEQ ID NO: 17: reverse primer for MCF7-1+α stand amplification
(207) SEQ ID NO: 18: forward primer for inverse PCR
(208) SEQ ID NO: 19: reverse primer for inverse PCR
(209) SEQ ID NO: 20: forward primer for inverse PCR
(210) SEQ ID NO: 21: reverse primer for inverse PCR
(211) SEQ ID NO: 22: oligonucleotide
(212) SEQ ID NO: 23: oligonucleotide
(213) SEQ ID NO: 24: oligonucleotide
(214) SEQ ID NO: 25: oligonucleotide
(215) SEQ ID NO: 26: forward primer for inverse PCR
(216) SEQ ID NO: 27: reverse primer for inverse PCR
(217) SEQ ID NO: 28: forward primer for inverse PCR
(218) SEQ ID NO: 29: reverse primer for inverse PCR
(219) SEQ ID NO: 30: forward primer for inverse PCR
(220) SEQ ID NO: 31: reverse primer for inverse PCR
(221) SEQ ID NO: 32: forward primer for inverse PCR
(222) SEQ ID NO: 33: reverse primer for inverse PCR
(223) SEQ ID NO: 34: forward primer for inverse PCR