METHODS AND COMPOSITIONS FOR HIGH SENSITIVITY DETECTION OF BIOTHREAT PATHOGENS

20220372555 · 2022-11-24

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided herein are methods of amplifying and detecting biothreat pathogens in complex samples (e.g., blood), as well as related panels and compositions (e.g., systems, cartridges, and kits).

    Claims

    1. A method for detecting the presence of a biothreat pathogen in a biological sample, the method comprising: (a) amplifying in a biological sample or a fraction thereof one or more biothreat pathogen target nucleic acids in a multiplexed amplification reaction, wherein the multiplexed amplification reaction is configured to amplify biothreat pathogen target nucleic acids characteristic of two or more of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii; and (b) detecting the one or more amplified biothreat pathogen target nucleic acids to determine whether one or more of the biothreat pathogens is present in the biological sample, wherein the method individually detects a biothreat pathogen present at a concentration of 10 cells/mL of biological sample or less.

    2. The method of claim 1, wherein the method comprises amplifying and/or detecting biothreat pathogen target nucleic acids characteristic of at least three, at least four, at least five, or all six of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii.

    3. The method of claim 1 or 2, wherein: (i) the method comprises amplifying and/or detecting a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii; and/or (ii) the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii.

    4. The method of any one of claims 1-3, wherein: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4; (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 6; (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 8; (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 10; and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 12.

    5. The method of claim 4, wherein: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2); (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4); (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6); (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8); (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10); and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12).

    6. The method of any one of claims 1-5, wherein: (i) amplifying step (a) further comprises amplifying a target nucleic acid characteristic of a drug resistance gene, and detecting step (b) further comprises detecting the amplified target nucleic acid characteristic of a drug resistance gene to determine whether the drug resistance gene is present; and/or (ii) the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of a drug resistance gene.

    7. The method of claim 6, wherein the drug resistance gene is selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC.

    8. The method of claim 7, wherein the method comprises detecting more than one drug resistance gene.

    9. The method of any one of claims 1-8, wherein: (i) amplifying step (a) further comprises amplifying an internal amplification control (IC) target nucleic acid and detecting step (b) further comprises detecting the amplified IC target nucleic acid; and/or (ii) the multiplexed amplification reaction is configured to amplify an amplified IC target nucleic acid.

    10. The method of any one of claims 1-9, wherein the method detects a biothreat pathogen present at a concentration of 2 cells/mL of biological sample or less.

    11. The method of claim 10, wherein the method detects a biothreat pathogen present at a concentration of 1 cells/mL of biological sample.

    12. The method of any one of claims 1-11, wherein the detecting of step (b) comprises magnetic, sequencing, optical, fluorescent, mass, density, chromatographic, and/or electrochemical detection.

    13. The method of claim 12, wherein the detecting of step (b) comprises T2 magnetic resonance (T2MR).

    14. The method of claim 12, wherein the detecting of step (b) comprises sequencing.

    15. A method for detecting the presence of a biothreat pathogen in a biological sample, the method comprising: (a) providing a biological sample; (b) lysing biothreat pathogen cells in the biological sample; (c) amplifying in the product of step (b) one or more biothreat pathogen target nucleic acids in a multiplexed amplification reaction to form an amplified biological sample, wherein the multiplexed amplification reaction is configured to amplify biothreat pathogen target nucleic acids characteristic of two or more of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii; (d) preparing a first assay sample by contacting a portion of the amplified biological sample with a first population of magnetic particles, wherein the magnetic particles of the first population have binding moieties characteristic of a first biothreat pathogen target nucleic acid on their surface, the binding moieties operative to alter aggregation of the magnetic particles in the presence of a first amplified biothreat pathogen target nucleic acid; (e) preparing a second assay sample by contacting a portion of the amplified biological sample with a second population of magnetic particles, wherein the magnetic particles of the second population have binding moieties characteristic of a second biothreat pathogen target nucleic acid on their surface, the binding moieties operative to alter aggregation of the magnetic particles in the presence of a second amplified biothreat pathogen target nucleic acid; (f) providing each assay sample in a detection tube within a device, the device comprising a support defining a well for holding the detection tube comprising the assay sample, and having an RF coil configured to detect a signal produced by exposing the mixture to a bias magnetic field created using one or more magnets and an RF pulse sequence; (g) exposing each assay sample to a bias magnetic field and an RF pulse sequence; (h) following step (g), measuring the signal produced by each assay sample; and (i) on the basis of the result of step (h), detecting whether one or more of the biothreat pathogens is present in the biological sample.

    16. The method of claim 15, wherein the method comprises amplifying and/or detecting biothreat pathogen target nucleic acids characteristic of at least three, at least four, at least five, or all six of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii.

    17. The method of claim 15 or 16, wherein: (i) the method comprises amplifying and/or detecting a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii; and/or (ii) the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii.

    18. The method of any one of claims 15-17, wherein: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4; (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 6; (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 8; (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 10; and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 12.

    19. The method of claim 18, wherein: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2); (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4); (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6); (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8); (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10); and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12).

    20. The method of any one of claims 15-19, wherein: (i) the amplifying step (c) further comprises amplifying a target nucleic acid characteristic of a drug resistance gene, and detecting step (i) further comprises detecting the amplified target nucleic acid characteristic of a drug resistance gene to determine whether the drug resistance gene is present; and/or (ii) the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of a drug resistance gene.

    21. The method of claim 20, wherein the drug resistance gene is selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC.

    22. The method of claim 21, wherein the method comprises detecting more than one drug resistance gene.

    23. The method of any one of claims 15-22, wherein: amplifying step (c) further comprises amplifying an IC target nucleic acid and step (i) further comprises detecting the amplified IC target nucleic acid; and/or the multiplexed amplification reaction is configured to amplify an amplified IC target nucleic acid.

    24. The method of any one of claims 15-23, wherein the magnetic particles of each population comprise two subpopulations, a first subpopulation bearing a first probe on its surface, and a second subpopulation bearing a second probe on its surface.

    25. The method of any one of claims 15-23, wherein the magnetic particles of each population comprise two subpopulations, a first subpopulation bearing a first probe and a second probe on its surface, and a second subpopulation bearing a third probe and a fourth probe on its surface.

    26. The method of any one of claims 15-25, wherein: (i) a probe pair comprising a 5′ probe comprising the nucleotide sequence CCGCTATCCGCCTTTCTACCAG (SEQ ID NO: 13) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 13 and a 3′ probe comprising the nucleotide sequence GTATCCACCCTCACTCTTCCATTTTC (SEQ ID NO: 14) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 14 is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid; (ii) a probe pair comprising a 5′ probe comprising the nucleotide sequence CATTTGCTTGAATCATTTTATTTTGGAAG (SEQ ID NO: 15) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 15 and a 3′ probe comprising the nucleotide sequence TTAATCGGTTGCTCCTCGTCAGTA (SEQ ID NO: 16) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 16 is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid; (iii) a probe pair comprising a 5′ probe comprising the nucleotide sequence AACCTTCTGGAGCCTGCCATT (SEQ ID NO: 17) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 17 and a 3′ probe comprising the nucleotide sequence GCAGCAGCAGTATCTTTAGCTGA (SEQ ID NO: 18) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 18 is used for detection of the target nucleic acid characteristic of Francisella tularensis; (iv) a probe pair comprising a 5′ probe comprising the nucleotide sequence TCGCCGCGGTAAAGAACCGTAC (SEQ ID NO: 19) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 19 and a 3′ probe comprising the nucleotide sequence GACCGTCAGGGCCGCACG (SEQ ID NO: 20) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 20 is used for detection of the target nucleic acid characteristic of Burkholderia spp.; (v) a probe pair comprising a 5′ probe comprising the nucleotide sequence AAATACCGGCAGCATCTCCG (SEQ ID NO: 21) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 21 and a 3′ probe comprising the nucleotide sequence GGTTAATTACGGTACCATAATAACGTG (SEQ ID NO: 22) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 22 is used for detection of the target nucleic acid characteristic of Yersinia pestis; and/or (vi) a probe pair comprising a 5′ probe comprising the nucleotide sequence GCATCAAACTCAATAATTATAGCTTTAGTACC (SEQ ID NO: 23) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 23 and a 3′ probe comprising the nucleotide sequence CGGACGCAAAACTCAATAACACCATAC (SEQ ID NO: 24) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 24 is used for detection of the target nucleic acid characteristic of Rickettsia prowazekii.

    27. The method of claim 26, wherein: (i) a probe pair comprising a 5′ probe comprising the nucleotide sequence CCGCTATCCGCCTTTCTACCAG (SEQ ID NO: 13) and a 3′ probe comprising the nucleotide sequence GTATCCACCCTCACTCTTCCATTTTC (SEQ ID NO: 14) is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid; (ii) a probe pair comprising a 5′ probe comprising the nucleotide sequence CATTTGCTTGAATCATTTTATTTTGGAAG (SEQ ID NO: 15) and a 3′ probe comprising the nucleotide sequence TTAATCGGTTGCTCCTCGTCAGTA (SEQ ID NO: 16) is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid; (iii) a probe pair comprising a 5′ probe comprising the nucleotide sequence AACCTTCTGGAGCCTGCCATT (SEQ ID NO: 17) and a 3′ probe comprising the nucleotide sequence GCAGCAGCAGTATCTTTAGCTGA (SEQ ID NO: 18) is used for detection of the target nucleic acid characteristic of Francisella tularensis; (iv) a probe pair comprising a 5′ probe comprising the nucleotide sequence TCGCCGCGGTAAAGAACCGTAC (SEQ ID NO: 19) and a 3′ probe comprising the nucleotide sequence GACCGTCAGGGCCGCACG (SEQ ID NO: 20) is used for detection of the target nucleic acid characteristic of Burkholderia spp.; (v) a probe pair comprising a 5′ probe comprising the nucleotide sequence AAATACCGGCAGCATCTCCG (SEQ ID NO: 21) and a 3′ probe comprising the nucleotide sequence GGTTAATTACGGTACCATAATAACGTG (SEQ ID NO: 22) is used for detection of the target nucleic acid characteristic of Yersinia pestis; and/or (vi) a probe pair comprising a 5′ probe comprising the nucleotide sequence GCATCAAACTCAATAATTATAGCTTTAGTACC (SEQ ID NO: 23) and a 3′ probe comprising the nucleotide sequence CGGACGCAAAACTCAATAACACCATAC (SEQ ID NO: 24) is used for detection of the target nucleic acid characteristic of Rickettsia prowazekii.

    28. The method of any one of claims 15-27, wherein an assay sample is contacted with 1×10.sup.6 to 1×10.sup.13 magnetic particles per milliliter of the biological sample.

    29. The method of any one of claims 15-28, wherein step (h) comprises measuring the T.sub.2 relaxation response of the assay sample, and wherein increasing agglomeration in the assay sample produces an increase in the observed T.sub.2 relaxation time of the assay sample.

    30. The method of any one of claims 15-29, wherein the magnetic particles have a mean diameter of from 700 nm to 1200 nm.

    31. The method of claim 30, wherein the magnetic particles have a mean diameter of from 650 nm to 950 nm.

    32. The method of claim 31, wherein the magnetic particles have a mean diameter of from 670 nm to 890 nm.

    33. The method of any one of claims 15-32, wherein the magnetic particles have a T.sub.2 relaxivity per particle of from 1×10.sup.9 to 1×10.sup.12 mM.sup.−1s.sup.−1.

    34. The method of any one of claims 15-33, wherein the magnetic particles are substantially monodisperse.

    35. The method of any one of claims 15-34, further comprising sequencing the first and/or second amplified biothreat pathogen target nucleic acid.

    36. A method for detecting the presence of a biothreat pathogen in a biological sample obtained from a subject, wherein the biological sample comprises subject-derived cells or cell debris, the method comprising: (a) amplifying in a biological sample or a fraction thereof one or more biothreat pathogen target nucleic acids in a multiplexed amplification reaction, wherein the multiplexed amplification reaction is configured to amplify biothreat pathogen target nucleic acids characteristic of two or more of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii; and (b) sequencing the one or more amplified biothreat pathogen target nucleic acids to detect whether one or more of the biothreat pathogens is present in the biological sample, wherein the method is capable of detecting a biothreat pathogen present at a concentration of 10 cells/mL of biological sample or less.

    37. The method of claim 36, wherein the method comprises amplifying and/or detecting biothreat pathogen target nucleic acids characteristic of at least three, at least four, at least five, or all six of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii.

    38. The method of claim 36 or 37, wherein: (i) the method comprises amplifying and/or detecting a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii; and/or (ii) the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii.

    39. The method of any one of claims 36-38, wherein: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4; (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 6; (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 8; (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 10; and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 12.

    40. The method of claim 39, wherein: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2); (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4); (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6); (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8); (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10); and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12).

    41. The method of any one of claims 36-40, wherein: (i) amplifying step (a) further comprises amplifying a target nucleic acid characteristic of a drug resistance gene, and detecting step (b) further comprises sequencing the amplified target nucleic acid characteristic of a drug resistance gene to determine whether the drug resistance gene is present; and/or (ii) the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of a drug resistance gene.

    42. The method of claim 41, wherein the drug resistance gene is selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC.

    43. The method of claim 42, wherein the method comprises sequencing more than one drug resistance gene.

    44. The method of any one of claims 36-43, wherein step (a) comprises amplifying the one or more biothreat pathogen target nucleic acids in a lysate produced by lysing cells in the biological sample.

    45. The method of claim 44, wherein the lysate has at least about a 2:1, a 5:1, a 10:1, a 20:1, a 40:1, or a 60:1 higher concentration of cell debris relative to the biological sample.

    46. The method of claim 45, wherein the cell debris is solid material.

    47. The method of any one of claims 1-46, wherein the biological sample has a volume of about 0.1 mL to about 5 mL.

    48. The method of claim 47, wherein the biological sample has a volume of about 2 mL.

    49. The method of any one of claims 1-48, wherein the biological sample is selected from the group consisting of blood, bloody fluids, tissue samples, bronchiolar lavage (BAL), urine, cerebrospinal fluid (CSF), synovial fluid (SF), and sputum.

    50. The method of claim 49, wherein the blood is whole blood, a crude blood lysate, serum, or plasma.

    51. The method of claim 50, wherein the whole blood is ethylenediaminetetraacetic acid (EDTA) whole blood, sodium citrate whole blood, sodium heparin whole blood, lithium heparin whole blood, or potassium oxylate/sodium fluoride whole blood.

    52. The method of claim 49, wherein the bloody fluid is wound exudate, wound aspirate, phlegm, or bile.

    53. The method of claim 49, wherein the tissue sample is a tissue sample from a transplant, a tissue biopsy (e.g., a skin biopsy, muscle biopsy, or lymph node biopsy), a homogenized tissue sample, or bone.

    54. The method of claim 49, wherein the biological sample is urine or BAL.

    55. The method of any one of claims 1-48, wherein the biological sample is a swab.

    56. The method of any one of claims 36-55, further comprising detecting the amplified target pathogen nucleic acid(s) using T2 magnetic resonance (T2MR).

    57. A method for detecting the presence of a biothreat pathogen in a whole blood sample, the method comprising: (a) contacting a whole blood sample suspected of containing one or more biothreat pathogen cells with an erythrocyte lysis agent, thereby lysing red blood cells; (b) centrifuging the product of step (a) to form a supernatant and a pellet; (c) discarding some or all of the supernatant of step (b) and resuspending the pellet to form an extract, optionally washing the pellet one or more times prior to resuspending the pellet; (d) lysing the remaining cells in the extract of step (c) to form a lysate, the lysate containing both subject cell nucleic acid and pathogen nucleic acid; (e) amplifying in the lysate of step (d) one or more biothreat pathogen target nucleic acids in a multiplexed amplification reaction, wherein the multiplexed amplification reaction is configured to amplify biothreat pathogen target nucleic acids characteristic of two or more of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii; and (f) detecting the one or more amplified biothreat pathogen target nucleic acids, thereby detecting the presence of the one or more biothreat pathogens in the sample.

    58. The method of claim 57, wherein the method comprises amplifying and/or detecting biothreat pathogen target nucleic acids characteristic of at least three, at least four, at least five, or all six of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii.

    59. The method of claim 57 or 58, wherein: (i) the method comprises amplifying and/or detecting Bacillus anthracis pX01 plasmid, Bacillus anthracis pXO2 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii; and/or (ii) the multiplexed amplification reaction is configured to amplify Bacillus anthracis pX01 plasmid, Bacillus anthracis pXO2 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii.

    60. The method of any one of claims 57-59, wherein: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4; (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 6; (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 8; (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 10; and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 12.

    61. The method of claim 60, wherein: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2); (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4); (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6); (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8); (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10); and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12).

    62. The method of any one of claims 57-61, wherein: (i) amplifying step (e) further comprises amplifying a target nucleic acid characteristic of a drug resistance gene, and detecting step (f) further comprises detecting the amplified target nucleic acid characteristic of a drug resistance gene to determine whether the drug resistance gene is present; and/or (ii) the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of a drug resistance gene.

    63. The method of claim 62, wherein the drug resistance gene is selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC.

    64. The method of claim 63, wherein the method comprises detecting more than one drug resistance gene.

    65. The method of any one of claims 57-64, wherein step (c) comprises washing the pellet one time prior to resuspending the pellet.

    66. The method of any one of claims 57-65, wherein the washing or resuspending is performed with a wash buffer solution.

    67. The method of claim 66, wherein the wash buffer solution is Tris-EDTA (TE) buffer.

    68. The method of claim 66 or 67, wherein the washing is performed with a wash buffer solution having a volume of about 100 μL to about 500 μL.

    69. The method of claim 68, wherein the volume is about 150 μL.

    70. The method of any one of claims 57-69, wherein resuspending of step (c) is performed with a wash buffer solution having a volume of about 50 μL to about 150 μL.

    71. The method of claim 70, wherein the volume is about 100 μL.

    72. The method of any one of claims 36-71, wherein: (i) the amplifying further comprises amplifying an IC target nucleic acid and the method further comprises the amplified IC target nucleic acid; and/or (ii) the multiplexed amplification reaction is configured to amplify an amplified IC target nucleic acid.

    73. The method of any one of claims 57-72, wherein the wash buffer solution further comprises an IC nucleic acid.

    74. The method of any one of claims 57-73, wherein step (a) further comprises adding a total process control (TPC) to the whole blood sample.

    75. The method of claim 74, wherein the TPC is an engineered cell comprising a control target nucleic acid.

    76. The method of any one of claims 36-75, wherein amplifying is in the presence of whole blood proteins and non-target nucleic acids.

    77. The method of any one of claims 15-35 or 44-76, wherein lysing comprises mechanical lysis or heat lysis.

    78. The method of claim 77, wherein the mechanical lysis is beadbeating or sonicating.

    79. The method of any one of claims 1-78, wherein the steps of the method are completed within 5 hours.

    80. The method of claim 79, wherein the steps of the method are completed within 4 hours.

    81. The method of claim 80, wherein the steps of the method are completed within 3 hours.

    82. The method of any one of claims 57-81, wherein the detecting comprises T2MR.

    83. The method of any one of claims 57-82, wherein the detecting comprises sequencing.

    84. The method of any one of claims 1-83, wherein the B. anthracis pX01 plasmid target nucleic acid is characteristic of protective antigen (pag), lethal factor (lef), or edema factor (cya).

    85. The method of claim 84, wherein the B. anthracis pX01 plasmid target nucleic acid is characteristic of protective antigen (pag).

    86. The method of any one of claims 1-85, wherein the B. anthracis pX02 plasmid target nucleic acid is characteristic of capB, capC, capA, capD, capE, AcpA, or AcpB.

    87. The method of claim 86, wherein the B. anthracis pX02 plasmid target nucleic acid is characteristic of capB.

    88. The method of any one of claims 1-87, wherein the Francisella tularensis target nucleic acid is characteristic of lipoprotein.

    89. The method of any one of claims 1-88, wherein the Burkholderia spp. target nucleic acid is characteristic of B. mallei and B. pseudomallei.

    90. The method of claim 89, wherein the Burkholderia spp. target nucleic acid characteristic of B. mallei and B. pseudomallei is a braG gene or a 16S ribosomal RNA (rRNA) gene.

    91. The method of claim 89 or 90, wherein the Burkholderia spp. target nucleic acid is a braG gene.

    92. The method of any one of claims 1-91, wherein the Yersinia pestis target nucleic acid is characteristic of plasminogen.

    93. The method of any one of claims 1-92, wherein the Rickettsia prowazekii target nucleic acid is characteristic of cytochrome c oxidase assembly protein or citrate synthase.

    94. The method of claim 93, wherein the Rickettsia prowazekii target nucleic acid is characteristic of cytochrome c oxidase assembly protein.

    95. The method of any one of claims 1-94, wherein the amplifying comprises polymerase chain reaction (PCR), ligase chain reaction (LCR), multiple displacement amplification (MDA), strand displacement amplification (SDA), rolling circle amplification (RCA), loop mediated isothermal amplification (LAMP), nucleic acid sequence based amplification (NASBA), helicase dependent amplification, recombinase polymerase amplification, nicking enzyme amplification reaction, or ramification amplification (RAM).

    96. The method of claim 95, wherein the amplifying comprises PCR.

    97. The method of claim 96, wherein the PCR is symmetric PCR or asymmetric PCR.

    98. The method of any one of claims 14, 35-56, or 83-97, wherein the sequencing comprises massively parallel sequencing, Sanger sequencing, or single-molecule sequencing.

    99. The method of claim 98, wherein the massively parallel sequencing comprises sequencing by synthesis or sequencing by ligation.

    100. The method of claim 99, wherein the massively parallel sequencing comprises sequencing by synthesis.

    101. The method of claim 99 or 100, wherein the sequencing by synthesis comprises ILLUMINA™ dye sequencing, ion semiconductor sequencing, or pyrosequencing.

    102. The method of claim 101, wherein the sequencing by synthesis comprises ILLUMINA™ dye sequencing.

    103. The method of claim 99, wherein the sequencing by ligation comprises sequencing by oligonucleotide ligation and detection (SOLiD™) sequencing or polony-based sequencing.

    104. The method of claim 98, wherein the single-molecule sequencing is nanopore sequencing, single-molecule real-time (SMRT™) sequencing, or Helicos™ sequencing.

    105. A method for identifying a patient infected with a biothreat pathogen, the method comprising: (a) providing a biological sample obtained from the subject; and (b) detecting the presence of a biothreat pathogen target nucleic acid in the biological sample according to the method of any one of claims 1-104, wherein the presence of a biothreat pathogen target nucleic acid in the biological sample obtained from the subject identifies the subject as one who may be infected with a biothreat pathogen.

    106. The method of claim 105, further comprising selecting an optimized anti-bacterial therapy for the patient based on the presence of the biothreat pathogen target nucleic acid.

    107. The method of claim 106, further comprising administering the optimized anti-bacterial therapy to the patient.

    108. A method of treating a patient infected with a biothreat pathogen, the method comprising: administering an optimized anti-bacterial therapy to a patient who has been identified by detection of the presence of a biothreat pathogen target nucleic acid in the biological sample according to the method of any one of claims 1-104.

    109. The method of claim 107 or 108, wherein the optimized anti-bacterial therapy comprises one or more antibiotic agents.

    110. The method of claim 109, wherein the one or more antibiotic agents is selected from the group consisting of an aminoglycoside, a beta-lactam (e.g., penicillin), a fluoroquinolone (e.g., ciprofloxacin, levofloxacin, or moxifloxacin), amikacin, streptomycin, a carbapenem, ceftazidime, amoxicillin/clavulanic acid, piperacillin, chloramphenicol, sulfathiazole, or a tetracycline antibiotic (e.g., doxycycline).

    111. The method of claim 109 or 110, wherein the antibiotic agent is administered as a monotherapy.

    112. The method of claim 109 or 110, wherein the antibiotic agent is administered as a combination therapy.

    113. The method of any one of claims 107-112, wherein the optimized antibacterial therapy is administered to the patient orally, intravenously, intramuscularly, intra-arterially, subcutaneously, or intraperitoneally.

    114. A magnetic particle conjugated to a nucleic acid probe, wherein the nucleic acid probe is specific for a biothreat pathogen target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, Bacillus anthracis pXO2 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, or Rickettsia prowazekii.

    115. The magnetic particle of claim 114, further comprising an additional nucleic acid probe, wherein the additional nucleic acid probe is specific for a second biothreat pathogen target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, or Rickettsia prowazekii.

    116. The magnetic particle of claim 114 or 115, wherein the nucleic acid probe and, optionally, the additional nucleic acid probe, comprises a nucleic acid sequence selected from SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24, or a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs:13-24.

    117. A magnetic particle or population of magnetic particles which is conjugated to one or more of the following: (i) a probe pair comprising a 5′ probe comprising the nucleotide sequence CCGCTATCCGCCTTTCTACCAG (SEQ ID NO: 13) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 13 and a 3′ probe comprising the nucleotide sequence GTATCCACCCTCACTCTTCCATTTTC (SEQ ID NO: 14) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 14; (ii) a probe pair comprising a 5′ probe comprising the nucleotide sequence CATTTGCTTGAATCATTTTATTTTGGAAG (SEQ ID NO: 15) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 15 and a 3′ probe comprising the nucleotide sequence TTAATCGGTTGCTCCTCGTCAGTA (SEQ ID NO: 16) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 16; (iii) a probe pair comprising a 5′ probe comprising the nucleotide sequence AACCTTCTGGAGCCTGCCATT (SEQ ID NO: 17) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 17 and a 3′ probe comprising the nucleotide sequence GCAGCAGCAGTATCTTTAGCTGA (SEQ ID NO: 18) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 18; (iv) a probe pair comprising a 5′ probe comprising the nucleotide sequence TCGCCGCGGTAAAGAACCGTAC (SEQ ID NO: 19) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 19 and a 3′ probe comprising the nucleotide sequence GACCGTCAGGGCCGCACG (SEQ ID NO: 20) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 20; (v) a probe pair comprising a 5′ probe comprising the nucleotide sequence AAATACCGGCAGCATCTCCG (SEQ ID NO: 21) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 21 and a 3′ probe comprising the nucleotide sequence GGTTAATTACGGTACCATAATAACGTG (SEQ ID NO: 22) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 22; and/or (vi) a probe pair comprising a 5′ probe comprising the nucleotide sequence GCATCAAACTCAATAATTATAGCTTTAGTACC (SEQ ID NO: 23) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 23 and a 3′ probe comprising the nucleotide sequence CGGACGCAAAACTCAATAACACCATAC (SEQ ID NO: 24) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 24.

    118. The magnetic particle or population of magnetic particles of claim 117, which is conjugated to one or more of the following: (i) a probe pair comprising a 5′ probe comprising the nucleotide sequence CCGCTATCCGCCTTTCTACCAG (SEQ ID NO: 13) and a 3′ probe comprising the nucleotide sequence GTATCCACCCTCACTCTTCCATTTTC (SEQ ID NO: 14); (ii) a probe pair comprising a 5′ probe comprising the nucleotide sequence CATTTGCTTGAATCATTTTATTTTGGAAG (SEQ ID NO: 15) and a 3′ probe comprising the nucleotide sequence TTAATCGGTTGCTCCTCGTCAGTA (SEQ ID NO: 16); (iii) a probe pair comprising a 5′ probe comprising the nucleotide sequence AACCTTCTGGAGCCTGCCATT (SEQ ID NO: 17) and a 3′ probe comprising the nucleotide sequence GCAGCAGCAGTATCTTTAGCTGA (SEQ ID NO: 18); (iv) a probe pair comprising a 5′ probe comprising the nucleotide sequence TCGCCGCGGTAAAGAACCGTAC (SEQ ID NO: 19) and a 3′ probe comprising the nucleotide sequence GACCGTCAGGGCCGCACG (SEQ ID NO: 20); (v) a probe pair comprising a 5′ probe comprising the nucleotide sequence AAATACCGGCAGCATCTCCG (SEQ ID NO: 21) and a 3′ probe comprising the nucleotide sequence GGTTAATTACGGTACCATAATAACGTG (SEQ ID NO: 22); and/or (vi) a probe pair comprising a 5′ probe comprising the nucleotide sequence GCATCAAACTCAATAATTATAGCTTTAGTACC (SEQ ID NO: 23) and a 3′ probe comprising the nucleotide sequence CGGACGCAAAACTCAATAACACCATAC (SEQ ID NO: 24).

    119. A removable cartridge comprising a well comprising the magnetic particle of any one of claims 114-118.

    120. The removable cartridge of claim 119, further comprising one or more chambers for holding a plurality of reagent modules for holding one or more assay reagents.

    121. The removable cartridge of claim 119 or 120, further comprising a chamber comprising beads for lysing cells.

    122. The removable cartridge of any one of claims 119-121, further comprising a chamber comprising a polymerase.

    123. The removable cartridge of any one of claims 119-122, further comprising a chamber comprising one or more primers.

    124. A system for the detection of one or more biothreat pathogen target nucleic acids, the system comprising: (a) a first unit comprising (i) a permanent magnet defining a magnetic field; (ii) a support defining a well holding a liquid sample comprising magnetic particles having a mean particle diameter between 700 and 1200 nm, preferably between 650 and 950 nm, and one or more biothreat pathogen target nucleic acids characteristic of Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and/or Rickettsia prowazekii, and having an RF coil disposed about the well, the RF coil configured to detect a signal produced by exposing the liquid sample to a bias magnetic field created using the permanent magnet and an RF pulse sequence; and (iii) one or more electrical elements in communication with the RF coil, the electrical elements configured to amplify, rectify, transmit, and/or digitize the signal; and (b) a second unit comprising a removable cartridge sized to facilitate insertion into and removal from the system, wherein the removable cartridge is a modular cartridge comprising (i) a reagent module for holding one or more assay reagents, (ii) a detection module comprising a detection chamber for holding a liquid sample comprising the magnetic particles and the one or more analytes, and, optionally, (iii) a sterilizable inlet module, wherein the reagent module, the detection module, and, optionally, the sterilizable inlet module, can be assembled into the modular cartridge prior to use, and wherein the detection chamber is removable from the modular cartridge, preferably, wherein the system further comprises a system computer with processor for implementing an assay protocol and storing assay data, and wherein the removable cartridge further comprises (i) a readable label indicating the analyte to be detected, (ii) a readable label indicating the assay protocol to be implemented, (iii) a readable label indicating a patient identification number, (iv) a readable label indicating the position of assay reagents contained in the cartridge, or (v) a readable label comprising instructions for the programmable processor.

    125. A primer comprising a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 1-12.

    126. A primer pair comprising a forward primer and a reverse primer selected from: (i) a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; (ii) a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4; (iii) a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 6; (iv) a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 8; (v) a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 10; and/or (vi) a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 12.

    127. A composition comprising the primer of claim 125 or the primer pair of claim 126.

    128. The composition of claim 127, further comprising one or more additional reagents selected from a buffering agent, a thermostable DNA polymerase, deoxyribonucleotides (dNTPs), and MgCl.sub.2.

    129. A probe comprising a nucleotide sequence selected from SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 13-24.

    130. The probe of claim 129, further comprising a detectable label.

    Description

    DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION

    [0131] The invention provides, inter alia, methods, panels, systems, cartridges, and kits for detection of biothreat pathogens in complex biological or environmental samples containing cells, cell debris (e.g., blood), or non-specific nucleic acids (e.g., subject (e.g., host) cell DNA). For example, the invention provides methods, panels, systems, cartridges, and kits for amplification and/or detection of one or more biothreat pathogen target nucleic acids characteristic of Bacillus anthracis (e.g., Bacillus anthracis pX01 plasmid and/or Bacillus anthracis pX02 plasmid), Francisella tularensis, Burkholderia spp., Yersinia pestis, and/or Rickettsia prowazekii.

    [0132] In some embodiments, detection of biothreat pathogen target nucleic acids allows for rapid, accurate, and high sensitivity detection and identification of a biothreat pathogen present in a biological or environmental sample containing host cells, cell debris, and/or host cell nucleic acids (e.g., DNA), including but not limited to whole blood, processed whole blood (e.g., a crude whole blood lysate), serum, plasma, or other blood derivatives; bloody fluids such as wound exudate, phlegm, bile, and the like; bronchiolar lavage (BAL), urine, tissue samples (e.g., tissue biopsies); and sputum (e.g., purulent sputum and bloody sputum)), which may be used, for example, for diagnosis of a pathogen exposure (e.g., sepsis, bloodstream infections (BSIs) (e.g., bacteremia, fungemia (e.g., Candidemia), and viremia), anthrax, botulism, plague, tularemia, viral hemorrhagic fevers, melioidosis, Q fever, brucellosis, glanders, Psittacosis, tickborne hemorrhagic fever viruses Lyme disease, septic shock, and diseases that may manifest with similar symptoms to diseases caused by or associated with biothreat pathogens, e.g., systemic inflammatory response syndrome (SIRS)).

    [0133] In some embodiments, the methods, panels, systems, cartridges, and kits can involve T2MR detection of target nucleic acids. T2MR detection enables rapid and sensitive detection of target nucleic acids (e.g., biothreat pathogen target nucleic acids or drug resistance target nucleic acids) in complex samples. In some embodiments, the T2MR detection approaches employ magnetic particles. In some embodiments, the methods and systems employ an NMR unit, optionally one or more magnetic assisted agglomeration (MAA) units, optionally one or more incubation stations at different temperatures, optionally one or more vortexers, optionally one or more centrifuges, optionally a fluidic manipulation station, optionally a robotic system, and optionally one or more modular cartridges, as described in International Patent Application Publication No. WO 2012/054639, which is incorporated herein by reference in its entirety. In some embodiments, the methods of the invention are performed using a fully-automated system, e.g., which may contain a sequencing unit and, optionally, a NMR unit. T2MR approaches can be combined with sequencing. For example, in some embodiments, the T2MR detection can provide group-level information that is used to direct or narrow sequencing in a sample.

    [0134] In some embodiments, the methods, systems, cartridges, kits, and panels can involve sequencing of target nucleic acids (e.g., biothreat pathogen target nucleic acids or drug resistance target nucleic acids). Any suitable sequencing approach can be used, e.g., massively parallel sequencing (e.g., sequencing by synthesis (e.g., ILLUMINA™ dye sequencing, ion semiconductor sequencing, or pyrosequencing) or sequencing by ligation (e.g., oligonucleotide ligation and detection (SOLiD™) sequencing or polony-based sequencing)), long-read or single-molecule sequencing (e.g., Helicos™ sequencing, single-molecule real-time (SMRT™) sequencing, and nanopore sequencing) and/or Sanger sequencing.

    Definitions

    [0135] The terms “amplification” or “amplify” or derivatives thereof, as used herein, mean one or more methods known in the art for copying a target or template nucleic acid, thereby increasing the number of copies of a selected nucleic acid sequence. Amplification may be exponential or linear. A “target nucleic acid” refers to a nucleic acid or a portion thereof that is to be amplified, detected, and/or sequenced. A target or template nucleic acid may be any nucleic acid, including DNA or RNA. A target nucleic acid may be characteristic of a biothreat, also referred to herein as a “biothreat pathogen target nucleic acid.” Exemplary, non-limiting biothreat pathogen target nucleic acids include target nucleic acids characteristic of Bacillus anthracis (e.g., Bacillus anthracis pX01 plasmid and/or Bacillus anthracis pX02 plasmid), Francisella tularensis, Burkholderia spp., Yersinia pestis, and/or Rickettsia prowazekii. A target nucleic acid may include a drug resistance marker (e.g., a drug resistance gene such as an antibiotic resistance gene, e.g., an antibiotic resistance gene selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC) or a portion thereof that is to be amplified, detected, and/or sequenced. The sequences amplified in this manner form an “amplified target nucleic acid,” “amplified region,” or “amplicon,” which are used interchangeably herein. Primers and/or probes can be readily designed to target a specific template nucleic acid sequence. Exemplary amplification approaches include but are not limited to polymerase chain reaction (PCR), ligase chain reaction (LCR), multiple displacement amplification (MDA), strand displacement amplification (SDA), rolling circle amplification (RCA), loop mediated isothermal amplification (LAMP), nucleic acid sequence based amplification (NASBA), helicase dependent amplification, recombinase polymerase amplification, nicking enzyme amplification reaction, and ramification amplification (RAM).

    [0136] The term “drug resistance” refers to the ability of a pathogen (e.g., a biothreat pathogen, including an engineered biothreat pathogen) to resist one or more effects of a therapeutic agent. For example, “antimicrobial resistance” refers to the ability of a microbe (e.g., a bacterial or fungal pathogen) to resist one or more effects of an antimicrobial agent, and “antibiotic resistance” refers to the ability of a bacterium to resist one or more effects of an antibiotic agent. Drug-resistant pathogens can be more difficult to treat than drug-sensitive pathogens. Resistance can occur naturally in pathogens, or can arise via spontaneous mutation or by gene transfer between different species. A pathogen may be become resistant to a therapeutic agent that previously was able to treat an infection caused by the pathogen. In some embodiments, a drug-resistant pathogen is able to survive or proliferate upon exposure to a concentration of a therapeutic agent that would kill or slow proliferation of a drug-sensitive pathogen.

    [0137] A “drug resistance gene” or a “drug resistance target nucleic acid” refers to a gene that confers or facilitates drug resistance, or a portion thereof.

    [0138] An “antibiotic resistance gene” or an “antibiotic resistance target nucleic acid” refers to a gene that confers or facilitates antibiotic resistance, or a portion thereof. Exemplary antibiotic (e.g., carbapenem) resistance genes include, but are not limited to, KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC. Additional antibiotic resistance genes are described herein or are known in the art. In the literature, the enzymes encoded by these genes are typically spelled in capital letters, while the gene names are italicized. For example, the enzyme NDM is encoded by the bla.sub.NDM gene. This convention generally holds for all of the beta lactamase genes (e.g., NDM, KPC, IMP, VIM, DHA, CMY, FOX, CTX-M, SHV, TEM, and OXA-48-like).

    [0139] In the present application, these terms are used interchangeably, and the capitalized shorthand terms, e.g., “NDM” may be used to refer to a nucleic acid for simplicity. Other resistance genes are typically italicized in the literature (e.g., otr, tcr3, gepAB, opxAB, gyrA, and gyrB), but in the present application, it is to be understood that italicized and non-italicized versions of these names are used interchangeably. In other examples, a target nucleic acid may be characteristic of a pathogen species (for example, any of the pathogen species described herein).

    [0140] The terms “NDM” or “bla.sub.NDM” refer to New Delhi metallo-beta-lactamase (e.g., NDM-1), as well as variants thereof, which may differ from NDM-1 by one or more amino acid substitutions, insertions, and/or deletions (including, e.g., NDM-2, NDM-3, NDM-4, NDM-5, NDM-6, NDM-7, NDM-8, NDM-9, NDM-10, NDM-11, NDM-12, NDM-13, NDM-14, NDM-15, NDM-16, NDM-17, NDM-18, NDM-19, NDM-20, NDM-21, NDM-22, NDM-23, NDM-24, and NDM-27).

    [0141] The terms “KPC” or “bla.sub.KPC” refer to K. pneumoniae carbapenemase (e.g., KPC-2), as well as variants thereof, which may differ from KPC-2 by one or more amino acid substitutions, insertions, and/or deletions (including, e.g., KPC-3, KPC-4, KPC-5, KPC-6, KPC-7, KPC-8, KPC-10, KPC-11, KPC-12, KPC-13, KPC-14, KPC-15, KPC-16, KPC-17, KPC-18, KPC-19, KPC-21, KPC-22, KPC-23, KPC-24, KPC-25, KPC-26, KPC-27, KPC-28, KPC-29, KPC-30, KPC-31, KPC-32, KPC-33, KPC-34, KPC-35, KPC-36, KPC-37, KPC-38, and KPC-39).

    [0142] The terms “IMP” or “bla.sub.lMP” refers to a metallo-beta-lactamase active on imipenem, including IMP-1, as well as variants thereof, which may differ from IMP-1 by one or more amino acid substitutions, insertions, and/or deletions (including, e.g., IMP-2, IMP-3, IMP-4, IMP-5, IMP-6, IMP-7, IMP-8, IMP-9, IMP-10, IMP-11, IMP-12, IMP-13, IMP-14, IMP-15, IMP-16, IMP-17, IMP-18, IMP-19, IMP-20, IMP-21, IMP-22, IMP-23, IMP-24, IMP-25, IMP-26, IMP-27, IMP-28, IMP-29, IMP-30, IMP-31, IMP-32, IMP-33, IMP-34, IMP-35, IMP-37, IMP-38, IMP-40, IMP-41, IMP-42, IMP-43, IMP-44, IMP-45, IMP-48, IMP-49, IMP-51, IMP-52, IMP-53, IMP-54, IMP-55, IMP-56, IMP-58, IMP-59, IMP-60, IMP-61, IMP-62, IMP-63, IMP-64, IMP-66, IMP-67, IMP-68, IMP-70, IMP-71, IMP-73, IMP-74, IMP-75, IMP-76, IMP-77, IMP-78, IMP-79, and IMP-80).

    [0143] The terms “VIM” or “blav.sub.IMP” refers to Verona integron-encoded metallo-beta-lactamase, also referred to as VIM-1, as well as variants thereof, which may differ from VIM-1 by one or more amino acid substitutions, insertions, and/or deletions (including, e.g., VIM-2, VIM-3, VIM-4, VIM-5, VIM-6, VIM-7, VIM-8, VIM-9, VIM-10, VIM-11, VIM-12, VIM-13, VIM-14, VIM-15, VIM-16, VIM-17, VIM-18, VIM-19, VIM-20, VIM-23, VIM-24, VIM-25, VIM-26, VIM-27, VIM-28, VIM-29, VIM-30, VIM-31, VIM-32, VIM-33, VIM-34, VIM-35, VIM-36, VIM-37, VIM-38, VIM-39, VIM-40, VIM-41, VIM-42, VIM-43, VIM-44, VIM-45, VIM-46, VIM-47, VIM-49, VIM-50, VIM-51, VIM-52, VIM-53, VIM-54, VIM-56, VIM-57, VIM-58, VIM-59, VIM-60, VIM-61, and VIM-62).

    [0144] The term “OXA-48-like” refers to a group of carbapenem-hydroyzing class D beta lactamases. This group encompasses OXA-48 (also referred to as bla.sub.OXA-48) as well as OXA-48-like variants, which may differ from OXA-48 by one or more amino acid substitutions, insertions, and/or deletions (including, e.g., OXA-162, OXA-163, OXA-181, OXA-199, OXA-204, OXA-232, OXA-244, OXA-245, OXA-247, OXA-252, OXA-370, OXA-405, OXA-416, OXA-438, OXA-439, OXA-484, OXA-505, OXA-514, OXA-515, OXA-517, OXA-519, OXA-538, OXA-546, OXA-547, OXA-566, OXA-567). A sequence alignment of OXA-48 and OXA-48-like variants is shown in FIG. 2 of Poirel et al. J. Antimicrob. Chemother. 67(7):1597-606, 2012).

    [0145] The terms “DHA” or “bla.sub.DHA” refer to plasmid-mediated Dhahran beta-lactamase, including DHA-1, as well as variants thereof, which may differ from DHA-1 by one or more amino acid substitutions, insertions, and/or deletions (including, e.g., DHA-2, DHA-3, DHA-4, DHA-5, DHA-6, DHA-7, DHA-10, DHA-12, DHA-13, DHA-14, DHA-15, DHA-16, DHA-17, DHA-18, DHA-19, DHA-20, DHA-21, DHA-22, DHA-23, DHA-24, DHA-25, DHA-26, DHA-27, and DHA-28).

    [0146] The terms “CMY” or “bla.sub.CMY” refers to a group of plasmid-mediated class C beta-lactamases that encode for resistance to antibiotics such as cephamycins, including CMY-2, as well as variants thereof, which may differ from CMY-2 by one or more amino acid substitutions, insertions, and/or deletions (including, e.g., CMY-4, CMY-5, CMY-6, CMY-7, CMY-12, CMY-13, CMY-14, CMY-15, CMY-16, CMY-17, CMY-18, CMY-20, CMY-21, CMY-22, CMY-23, CMY-24, CMY-25, CMY-26, CMY-27, CMY-28, CMY-29, CMY-30, CMY-31, CMY-32, CMY-33, CMY-34, CMY-35, CMY-36, CMY-37, CMY-38, CMY-39, CMY-40, CMY-41, CMY-42, CMY-43, CMY-44, CMY-45, CMY-46, CMY-47, CMY-48, CMY-49, CMY-50, CMY-51, CMY-53, CMY-54, CMY-55, CMY-56, CMY-57, CMY-58, CMY-59, CMY-60, CMY-61, CMY-62, CMY-63, CMY-64, CMY-65, CMY-66, CMY-67, CMY-68, CMY-69, CMY-70, CMY-71, CMY-72, CMY-73, CMY-74, CMY-75, CMY-76, CMY-77, CMY-78, CMY-79, CMY-80, CMY-81, CMY-82, CMY-83, CMY-84, CMY-85, CMY-86, CMY-87, CMY-89, CMY-90, CMY-93, CMY-94, CMY-95, CMY-96, CMY-97, CMY-99, CMY-100, CMY-101, CMY-102, CMY-103, CMY-104, CMY-105, CMY-106, CMY-107, CMY-108, CMY-109, CMY-110, CMY-111, CMY-112, CMY-113, CMY-114, CMY-115, CMY-116, CMY-117, CMY-118, CMY-119, CMY-121, CMY-122, CMY-124, CMY-125, CMY-127, CMY-128, CMY-129, CMY-130, CMY-131, CMY-132, CMY-133, CMY-134, CMY-135, CMY-138, CMY-139, CMY-140, CMY-141, CMY-142, CMY-143, CMY-144, CMY-145, CMY-146, CMY-147, CMY-148, CMY-149, CMY-150, CMY-151, CMY-152, CMY-153, CMY-154, CMY-155, CMY-156, CMY-158, CMY-159, CMY-160, CMY-161, CMY-162, CMY-163, and BIL-1).

    [0147] The terms “CTX-M” or “bla.sub.CTX-M” refer to a class of extended spectrum beta-lactamases active on cefotaxime and first discovered in Munich. For example, in some embodiments the CTX-M belongs to the “CTX-M 14” group (also referred to as the CTX-M 9 group), which includes CTX-M-9, CTX-M-13, CTX-M-14, CTX-M-16, CTX-M-17, CTX-M-19, CTX-M-21, CTX-M-24, CTX-M-27, CTX-M-46, CTX-M-47, CTX-M-48, CTX-M-49, CTX-M-50, CTX-M-64, CTX-M-73, CTX-M-81, CTX-M-87, CTX-M-90, CTX-M-93, CTX-M-98, CTX-M-102, CTX-M-104, CTX-M-121, CTX-M-125, CTX-M-148, CTX-M-168, CTX-M-198, CTX-M-199, CTX-M-201, CTX-M-214, CTX-M-221, and CTX-M-223. In other embodiments, the CTX-M belongs to the “CTX-M 15” group (also referred to as the CTX-M 1 group), which includes CTX-M-1, CTX-M-3, CTX-M-10, CTX-M-12, CTX-M-15, CTX-M-22, CTX-M-23, CTX-M-28, CTX-M-29, CTX-M-30, CTX-M-32, CTX-M-33, CTX-M-36, CTX-M-42, CTX-M-53, CTX-M-54, CTX-M-55, CTX-M-61, CTX-M-66, CTX-M-69, CTX-M-71, CTX-M-72, CTX-M-80, CTX-M-82, CTX-M-101, CTX-M-114, CTX-M-116, CTX-M-117, CTX-M-144, CTX-M-166, CTX-M-170, CTX-M-178, CTX-M-179, CTX-M-180, CTX-M-181, CTX-M-182, CTX-M-186, CTX-M-187, CTX-M-188, CTX-M-189, CTX-M-190, CTX-M-197, CTX-M-206, CTX-M-207, and CTX-M-222. Other CTX-M variants are known in the art and may be detected using the approaches described herein.

    [0148] The terms “SHV” or “bla.sub.SHV” refers to a class of beta-lactamases. The term encompasses, for example, SHV-1, as well as variants thereof, which may differ from SHV-1 by one or more amino acid substitutions, insertions, and/or deletions (including, e.g., SHV-1, SHV-1b, SHV-2, SHV-2A, SHV-3, SHV-5, SHV-7, SHV-8, SHV-9, SHV-11, SHV-12, SHV-13, SHV-14, SHV-15, SHV-16, SHV-18, SHV-24, SHV-27, SHV-28, SHV-30, SHV-31, SHV-33, SHV-34, SHV-35, SHV-36, SHV-37, SHV-38, SHV-40, SHV-41, SHV-42, SHV-43, SHV-44, SHV-45, SHV-46, SHV-48, SHV-49, SHV-50, SHV-51, SHV-52, SHV-55, SHV-56, SHV-57, SHV-59, SHV-60, SHV-61, SHV-62, SHV-63, SHV-64, SHV-65, SHV-66, SHV-67, SHV-69, SHV-70, SHV-71, SHV-72, SHV-73, SHV-74, SHV-75, SHV-76, SHV-77, SHV-78, SHV-79, SHV-80, SHV-81, SHV-82, SHV-85, SHV-86, SHV-89, SHV-92, SHV-93, SHV-94, SHV-95, SHV-96, SHV-97, SHV-98, SHV-99, SHV-100, SHV-101, SHV-102, SHV-103, SHV-104, SHV-105, SHV-106, SHV-107, SHV-108, SHV-109, SHV-110, SHV-111, SHV-115, SHV-119, SHV-120, SHV-121, SHV-128, SHV-129, SHV-132, SHV-133, SHV-134, SHV-135, SHV-137, SHV-141, SHV-142, SHV-143, SHV-144, SHV-145, SHV-146, SHV-147, SHV-148, SHV-149, SHV-150, SHV-151, SHV-152, SHV-153, SHV-154, SHV-155, SHV-156, SHV-157, SHV-158, SHV-159, SHV-160, SHV-161, SHV-162, SHV-163, SHV-164, SHV-165, SHV-168, SHV-172, SHV-173, SHV-178, SHV-179, SHV-180, SHV-182, SHV-183, SHV-185, SHV-186, SHV-187, SHV-188, SHV-189, SHV-190, SHV-191, SHV-193, SHV-194, SHV-195, SHV-196, SHV-197, SHV-198, SHV-199, SHV-200, SHV-201, SHV-202, SHV-203, SHV-204, SHV-205, SHV-206, SHV-207, SHV-208, SHV-209, SHV-210, SHV-211, SHV-212, SHV-213, SHV-214, SHV-215, SHV-216, SHV-217, SHV-218, SHV-219, SHV-220, SHV-221, SHV-222, SHV-223, SHV-224, SHV-225, SHV-226, SHV-227, and SHV-228). For a review, see Liakoipolos et al. Front. Microbiol. 7:1374, 2016, which shows an alignment of SHV-type genes.

    [0149] The terms “TEM” or “bla.sub.TEM” refers to a class of beta-lactamases. The term encompasses, for example, TEM-1, as well as variants thereof, which may differ from TEM-1 by one or more amino acid substitutions, insertions, and/or deletions (including, e.g., TEM-2, TEM-3, TEM-4, TEM-6, TEM-8, TEM-9, TEM-10, TEM-11, TEM-12, TEM-15, TEM-16, TEM-17, TEM-19, TEM-20, TEM-21, TEM-22, TEM-24, TEM-26, TEM-28, TEM-29, TEM-30, TEM-32, TEM-33, TEM-34, TEM-35, TEM-36, TEM-40, TEM-43, TEM-45, TEM-47, TEM-48, TEM-49, TEM-52, TEM-53, TEM-54, TEM-55, TEM-56, TEM-57, TEM-60, TEM-63, TEM-67, TEM-68, TEM-70, TEM-71, TEM-72, TEM-76, TEM-77, TEM-78, TEM-79, TEM-80, TEM-81, TEM-82, TEM-83, TEM-84, TEM-85, TEM-86, TEM-87, TEM-88, TEM-90, TEM-91, TEM-92, TEM-93, TEM-94, TEM-95, TEM-96, TEM-97, TEM-98, TEM-99, TEM-101, TEM-102, TEM-104, TEM-105, TEM-106, TEM-107, TEM-108, TEM-109, TEM-110, TEM-111, TEM-112, TEM-113, TEM-114, TEM-115, TEM-116, TEM-120, TEM-121, TEM-122, TEM-123, TEM-124, TEM-125, TEM-126, TEM-127, TEM-128, TEM-129, TEM-130, TEM-131, TEM-132, TEM-133, TEM-134, TEM-135, TEM-136, TEM-137, TEM-138, TEM-139, TEM-141, TEM-142, TEM-143, TEM-144, TEM-145, TEM-146, TEM-147, TEM-148, TEM-149, TEM-150, TEM-151, TEM-152, TEM-153, TEM-154, TEM-155, TEM-156, TEM-157, TEM-158, TEM-159, TEM-160, TEM-162, TEM-163, TEM-164, TEM-166, TEM-167, TEM-168, TEM-169, TEM-171, TEM-176, TEM-177, TEM-178, TEM-181, TEM-182, TEM-183, TEM-184, TEM-185, TEM-186, TEM-187, TEM-188, TEM-189, TEM-190, TEM-191, TEM-193, TEM-194, TEM-195, TEM-196, TEM-197, TEM-198, TEM-201, TEM-205, TEM-206, TEM-207, TEM-208, TEM-209, TEM-210, TEM-211, TEM-212, TEM-213, TEM-214, TEM-215, TEM-216, TEM-217, TEM-219, TEM-220, TEM-224, TEM-225, TEM-226, TEM-227, TEM-229, TEM-230, TEM-231, TEM-233, TEM-234, TEM-236, and TEM-237).

    [0150] As used herein, the terms “unit” or “units,” when used in reference to thermostable nucleic acid polymerases, refer to an amount of the thermostable nucleic acid polymerase (e.g., thermostable DNA polymerase). Typically, a unit is defined as the amount of enzyme that will incorporate a particular amount of dNTPs (e.g., 10-20 nmol) into acid-insoluble material in 30-60 min at 65° C.-75° C. under particular assay conditions, although each manufacturer may define units differently. Unit definitions and assay conditions for commercially-available thermostable nucleic acid polymerases are known in the art. In some embodiments, one unit of thermostable nucleic acid polymerase (e.g., Taq DNA polymerase) may be the amount of enzyme that will incorporate 15 nmol of dNTP into acid-insoluble material in 30 min at 75° C. in an assay containing 1× ThermoPol® Reaction Buffer (New England Biosciences), 200 μM dNTPs including [.sup.3H]-dTTP, and 15 nM primed M13 DNA.

    [0151] The term “sequencing” refers to any method for determining the nucleotide order of a nucleic acid (e.g., DNA), such as a target nucleic acid or an amplified target nucleic acid. Exemplary sequencing approaches include but are not limited to massively parallel sequencing (e.g., sequencing by synthesis (e.g., ILLUMINA™ dye sequencing, ion semiconductor sequencing, or pyrosequencing) or sequencing by ligation (e.g., oligonucleotide ligation and detection (SOLiD™) sequencing or polony-based sequencing)), long-read or single-molecule sequencing (e.g., Helicos™ sequencing, single-molecule real-time (SMRT™) sequencing, and nanopore sequencing) and Sanger sequencing. Massively parallel sequencing is also referred to in the art as next-generation or second-generation sequencing, and typically involves parallel sequencing of a large number (e.g., thousands, millions, or billions) of spatially-separated, clonally amplified templates or single nucleic acid molecules. Short reads are often used in massively parallel sequencing. See, e.g., Metzker, Nature Reviews Genetics 11:31-36, 2010. Long-read sequencing and/or single-molecule sequencing are sometimes referred to as third-generation sequencing. Hybrid approaches (e.g., massively parallel and single molecule approaches or massively parallel and long-read approaches) can also be used. It is to be understood that some approaches may fall into more than one category, for example, some approaches may be considered both second-generation and third-generation approaches, and some sources refer to both second and third generation sequencing as “next-generation” sequencing.

    [0152] By “analyte” is meant a substance or a constituent of a sample to be analyzed. Exemplary analytes include one or more species of one or more of the following: a nucleic acid (e.g., DNA or RNA (e.g., mRNA)), an oligonucleotide, a protein, a peptide, a polypeptide, an amino acid, an antibody, a carbohydrate, a polysaccharide, glucose, a lipid, a gas (e.g., oxygen or carbon dioxide), an electrolyte (e.g., sodium, potassium, chloride, bicarbonate, blood urea nitrogen (BUN), magnesium, phosphate, calcium, ammonia, lactate), a lipoprotein, cholesterol, a fatty acid, a glycoprotein, a proteoglycan, a lipopolysaccharide, a cell surface marker (e.g., a cell surface protein of a pathogen), a cytoplasmic marker (e.g., CD4/CD8 or CD4/viral load), a therapeutic agent, a metabolite of a therapeutic agent, a marker for the detection of a weapon (e.g., a chemical or biological weapon), an organism, a pathogen, a pathogen byproduct, a parasite (e.g., a protozoan or a helminth), a protist, a fungus (e.g., yeast (e.g., a Candida species (e.g., Candida albicans, Candida glabrata, Candida krusei, C. parapsilosis, Candida auris, Candida lusitaniae, Candida haemulonii, Candida duobushaemulonii, Candida pseudohaemulonii, Candida guilliermondii, and C. tropicalis)) or mold), a bacterium (e.g., Acinetobacter baumannii, Escherichia coli, Enterococcus faecalis, Enterococcus faecium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Borrelia burgdorferi, Borrelia afzelii, Borrelia garinii, Rickettsia rickettsii, Anaplasma phagocytophilum, Coxiella burnetii, Ehrlichia chaffeensis, Ehrlichia ewingii, Francisella tularensis, Streptococcus pneumoniae, Enterobacter cloacae, Streptococcus pyogenes, Streptococcus mutans, Streptococcus sanguinis, Haemophilus influenzae, or Neisseria meningitides), an actinomycete, a cell (e.g., a whole cell, a tumor cell, a stem cell, a white blood cell, a T cell (e.g., displaying CD3, CD4, CD8, IL2R, CD35, or other surface markers), or another cell identified with one or more specific markers), a virus (e.g., a coronavirus (e.g., a SARS-CoV or a SARS-CoV-2), a prion, a plant component, a plant by-product, algae, an algae by-product, plant growth hormone, an insecticide, a man-made toxin, an environmental toxin, an oil component, and components derived therefrom. In particular embodiments, the analyte is a nucleic acid (e.g., DNA or RNA (e.g., mRNA)), such as a target nucleic acid or an amplified target nucleic acid. In some embodiments, the analyte is a biothreat pathogen target nucleic acid (e.g., a target nucleic acid characteristic of Bacillus anthracis (e.g., Bacillus anthracis pX01 plasmid and/or Bacillus anthracis pX02 plasmid), Francisella tularensis, Burkholderia spp., Yersinia pestis, and/or Rickettsia prowazekii). In further particular embodiments, the analyte is a drug resistance marker (e.g., an antibiotic resistance gene, e.g., an antibiotic resistance gene selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC) or a portion thereof.

    [0153] A “biological sample” is a sample obtained from a subject including but not limited to blood (e.g., whole blood, processed whole blood (e.g., a crude whole blood lysate), serum, plasma, and other blood derivatives), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), urine, cerebrospinal fluid (CSF), synovial fluid (SF), breast milk, sweat, tears, saliva, semen, feces, vaginal fluid or tissue, sputum (e.g., purulent sputum and bloody sputum), nasopharyngeal aspirate or swab, lacrimal fluid, mucous, epithelial swab (e.g., a buccal swab, an axilla swab, a groin swab, an axilla/groin swab, or an ear swab), tissues (e.g., tissue biopsies (e.g., skin biopsies (e.g., from wounds, burns, or tick bites), muscle biopsies, or lymph node biopsies)), including tissue homogenates), organs, bones, teeth, or culture media (e.g., BHI, SABHI, SDA, LB, and the like), among others. In some embodiments, the biological sample is whole blood, which may contain an anticoagulant (e.g., EDTA, sodium citrate, sodium heparin, lithium heparin, and/or potassium oxylate/sodium fluoride). In several embodiments, the biological sample contains cells, cell debris, and/or nucleic acids (e.g., DNA) derived from the subject from which the sample was obtained. In particular embodiments, the subject is a host of a pathogen (e.g., a biothreat pathogen), and the biological sample obtained from the subject includes subject (host)-derived cells, cell debris, and nucleic acids (e.g., DNA), as well as one or more pathogen cells. The biological sample may be a swab sample, which may include a swab buffer diluent or swab transport medium. In some embodiments, the swab buffer diluent or swab transport medium is, without limitation, PBST, Amies Buffer, Amies Buffer+10% (v/v) 10×PBST, Cary Blair Media, or Liquid Stuart Swabs (which may include addition of 10% (v/v) 10×PBST). The biological sample may be a liquid sample.

    [0154] As used herein, an “environmental sample” is a sample obtained from an environment, e.g., a surface swab sample, a sample from a building or a container, an air sample, a water sample, a soil sample, and the like. The environmental sample may contain any analyte described herein, e.g., a pathogen such as a bacterial (e.g., Acinetobacter baumannii, Escherichia coli, Enterococcus faecalis, Enterococcus faecium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Borrelia burgdorferi, Borrelia afzelii, Borrelia garinii, Rickettsia rickettsii, Anaplasma phagocytophilum, Coxiella burnetii, Ehrlichia chaffeensis, Ehrlichia ewingii, Francisella tularensis, Streptococcus pneumoniae, Enterobacter cloacae, Streptococcus pyogenes, Streptococcus mutans, Streptococcus sanguinis, Haemophilus influenzae, or Neisseria meningitides), fungal (e.g., a Candida species (e.g., Candida auris, Candida lusitaniae, Candida haemulonii, Candida duobushaemulonii, Candida pseudohaemulonii, Candida guilliermondii, Candida albicans, Candida glabrata, Candida krusei, C. parapsilosis, and/or C. tropicalis)), protozoan, or viral organism or pathogen. In some embodiments, the environmental sample includes a biothreat pathogen, e.g., any biothreat pathogen described herein. In some embodiments, an environmental sample is from a hospital or other healthcare facility. In some embodiments, the environmental sample is a swab, which may include a swab buffer diluent or swab transport medium. In some embodiments, the swab buffer diluent or swab transport medium is, without limitation, PBST, Amies Buffer, Amies Buffer+10% (v/v) 10×PBST, Cary Blair Media, or Liquid Stuart Swabs (which may include addition of 10% (v/v) 10×PBST). The environmental sample may be a liquid sample. In some embodiments, the environmental sample includes a biothreat pathogen target nucleic acid (e.g., a target nucleic acid characteristic of Bacillus anthracis (e.g., Bacillus anthracis pX01 plasmid and/or Bacillus anthracis pXO2 plasmid), Francisella tularensis, Burkholderia spp., Yersinia pestis, and/or Rickettsia prowazekii). In further particular embodiments, the environmental sample includes a drug resistance marker (e.g., an antibiotic resistance gene, e.g., an antibiotic resistance gene selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC) or a portion thereof.

    [0155] A “biomarker” is a biological substance that can be used as an indicator of a particular disease state or particular physiological state of an organism, generally a biomarker is a protein or other native compound measured in bodily fluid whose concentration reflects the presence or severity or staging of a disease state or dysfunction, can be used to monitor therapeutic progress of treatment of a disease or disorder or dysfunction, or can be used as a surrogate measure of clinical outcome or progression. In some embodiments, the biomarker is a nucleic acid (e.g., DNA or RNA (e.g., mRNA)).

    [0156] The term “cell debris” refers to any materials released from cells that have been lysed or otherwise died. Cell debris may include any material that is contained within a cell, e.g., nucleic acids, proteins (e.g., hemoglobin), lipids, glycolipids, small molecules, carbohydrates, heme compounds, membranes, and the like. In several embodiments, the cell debris is or includes solid material, such as solid material that can be concentrated with a liquid-solid separation method (e.g., centrifugation or filtration). In some examples, the cell debris is the solid material present after centrifugation (such as solid material produced by the sample processing procedure described in Examples 1-6 of International Patent Application Publication No. WO 2020/055887).

    [0157] As used herein, the term “cells/mL” indicates the number of cells per milliliter of a biological or environmental sample. The number of cells may be determined using any suitable method, for example, hemocytometer, quantitative PCR, and/or automated cell counting. It is to be understood that in some embodiments, cells/mL may indicate the number of colony-forming units (CFU) per milliliter of a biological or environmental sample.

    [0158] As used herein, the term “copies/mL” indicates the number of copies of a nucleic acid (e.g., a biothreat pathogen target nucleic acid) or a portion thereof per milliliter of a biological or environmental sample.

    [0159] A “group,” as used herein, refers to a grouping of organisms, including pathogens (e.g., biothreat pathogens). In some embodiments, a group may be a taxonomic classification, for instance, a taxonomic domain, a taxonomic kingdom, a taxonomic phylum, a taxonomic class, a taxonomic order, a taxonomic family, or a taxonomic genus. In other embodiments, a group may be defined by any desired or suitable characteristics such as, for example, resistance to an antimicrobial agent or Gram staining (e.g., Gram negative or Gram positive). For example, the group may be pan-Gram positive or pan-Gram negative. It is to be understood that, in some instances, a pathogen may belong to more than one group.

    [0160] A “group-level” identification refers to identification of an analyte (e.g., a target nucleic acid) that provides information regarding a group from which the analyte was obtained (e.g., a taxonomic classification, for instance, a taxonomic domain, a taxonomic kingdom, a taxonomic phylum, a taxonomic class, a taxonomic order, a taxonomic family, or a taxonomic genus). In some embodiments, a group-level identification does not provide species-level identification.

    [0161] The term “species,” as used herein, refers to a basic unit of biological classification as well as a taxonomic rank. A skilled artisan appreciates that a species may be defined based on a number of criteria, including, for example, DNA similarity, morphology, and ecological niche. The term encompasses any suitable species concept, including evolutionary species, phylogenetic species, typological species, genetic species, and reproductive species. The term also encompasses subspecies or strains.

    [0162] A “species-level” identification refers to identification of an analyte (e.g., a target nucleic acid) that provides information regarding the species from which the analyte was obtained. With respect to target nucleic acids, in some embodiments, species-level identification provides information regarding nucleic acid variants (e.g., a single nucleotide polymorphism (SNP), an insertion/deletion (indel), a repetitive element, or a microsatellite repeat), which is also referred to herein as a “variant-level” identification. In some embodiments, a species-level or variant-level identification also provides a group-level identification.

    [0163] A “pathogen” means an agent causing disease or illness to its host, such as an organism or infectious particle, capable of producing a disease in another organism, and includes but is not limited to bacteria (e.g., Acinetobacter baumannii, Escherichia coli, Enterococcus faecalis, Enterococcus faecium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Borrelia burgdorferi, Borrelia afzelii, Borrelia garinii, Rickettsia rickettsii, Anaplasma phagocytophilum, Coxiella burnetii, Ehrlichia chaffeensis, Ehrlichia ewingii, Francisella tularensis, Streptococcus pneumoniae, Enterobacter cloacae, Streptococcus pyogenes, Streptococcus mutans, Streptococcus sanguinis, Haemophilus influenzae, or Neisseria meningitides), viruses (e.g., any virus disclosed herein, including a coronavirus (e.g., SARS-CoV or SARS-CoV-2), protozoa, prions, fungi (e.g., yeast (e.g., Candida species), or pathogen by-products. “Pathogen by-products” are those biological substances arising from the pathogen that can be deleterious to the host or stimulate an excessive host immune response, for example pathogen nucleic acids, antigen(s), metabolic substances, enzymes, biological substances, or toxins (e.g., Bacillus anthracis toxin genes protective antigen (pagA), edema factor (cya), and lethal factor (lef); enteropathogenic E. coli translocated intimin receptor (Tir); Clostridium difficile toxins TcdA and TcdB; and Clostridium botulinum toxins BoNT/A, BoNT/B, BoNT/C, BoNT/D, BoNT/E, BoNT/F, and BoNT/G). In some embodiments, the pathogen is a bacterial pathogen, e.g., a drug resistant bacterial pathogen, e.g., a bacterial pathogen that expresses one or more antibiotic resistance genes selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC. In several embodiments, the pathogen is a biothreat pathogen.

    [0164] A “biothreat pathogen” refers to any pathogen that poses a threat to health. A biothreat pathogen may be naturally occurring or engineered. A biothreat pathogen may be used in bioterrorism or biological warfare. In other instances, a biothreat pathogen may be involved in an outbreak or epidemic. The CDC and NIAID, in conjunction with the U.S. Department of Homeland Security, evaluate the potential threat from various microorganisms and toxins and classify them into three categories. Category A includes agents that are considered to represent the highest risk, including Bacillus anthracis (anthrax), Clostridium botulinum toxin (botulism), Yersinia pestis (plague), Variola major (smallpox) and other related pox viruses, Francisella tularensis (tularemia), Viral hemorrhagic fevers (e.g., Arenaviruses (e.g., Junin, Machupo, Guanarito, Chapare, Lassa, and Lujo), Bunyaviruses (e.g., Hantaviruses causing Hanta pulmonary syndrome, Rift Valley Fever, and Crimean Congo Hemorrhagic Fever), Flaviviruses (e.g., Dengue), and Filoviruses (e.g., Ebola and Marburg viruses). Category B agents could conceivably threaten water and food safety and include Burkholderia pseudomallei (melioidosis), Coxiella burnetii (Q fever), Brucella species (spp.) (brucellosis), Burkholderia mallei (glanders), Chlamydia psittaci (Psittacosis), Ricin toxin (Ricinus communis), Epsilon toxin (Clostridium perfringens), Staphylococcus enterotoxin B (SEB), Typhus fever (Rickettsia prowazekii), food and waterborne pathogens (e.g., bacteria (e.g., diarrheagenic E. coli, pathogenic Vibrios, Shigella spp., Salmonella spp., Listeria monocytogenes, Campylobacter jejuni, and Yersinia enterocolitica), viruses (e.g., Caliciviruses and Hepatitis A), protozoa (e.g., Cryptosporidium parvum, Cyclospora cayatanensis, Giardia lamblia, Entamoeba histolytica, Toxoplasma gondii, Naegleria fowleri, Balamuthia mandrillaris), and fungi (e.g., Microsporidia)), and mosquito-borne viruses (e.g., West Nile virus, LaCross encephalitis, California encephalitis, Venezuelan equine encephalitis, Eastern equine encephalitis, Japanese encephalitis virus, St. Louis encephalitis virus, Yellow fever virus, Chikungunya virus, and Zika virus). Category C agents are considered emerging infectious disease threats which could be engineered for mass dissemination, including Nipah and Hendra viruses, Additional hantaviruses, Tickborne hemorrhagic fever viruses (e.g., Bunyaviruses (e.g., Severe Fever with Thrombocytopenia Syndrome virus (SFTSV), Heartland virus) and Flaviviruses (e.g., Omsk Hemorrhagic Fever virus, Alkhurma virus, Kyasanur Forest virus)), tickborne encephalitis complex flaviviruses (e.g., Tickborne encephalitis viruses, Eastern subtype, Far Eastern subtype, Siberian subtype, and Powassan/Deer Tick virus), tuberculosis (e.g., drug-resistant tuberculosis), influenza virus, other Rickettsias, Rabies virus, prions, Coccidioides spp., severe acute respiratory syndrome associated coronavirus (SARS-CoV), MERS-CoV, SARS-CoV-2 (which causes COVID-19), and other highly pathogenic human coronaviruses, and antimicrobial resistance. In particular embodiments, the biothreat pathogen is selected from the group consisting of Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei or B. pseudomallei), Yersinia pestis, and Rickettsia prowazekii.

    [0165] By “pathogen-associated analyte” is meant an analyte characteristic of the presence of a pathogen (e.g., a biothreat pathogen) in a sample. The pathogen-associated analyte can be a particular substance derived from a pathogen (e.g., a nucleic acid (e.g., DNA or RNA (e.g., mRNA)), a protein, lipid, polysaccharide, or any other material produced by a pathogen) or a mixture derived from a pathogen (e.g., whole cells, or whole viruses). In certain instances, the pathogen-associated analyte is selected to be characteristic of the genus, species, or specific strain of pathogen being detected. Alternatively, the pathogen-associated analyte is selected to ascertain a property of the pathogen, such as resistance to a particular therapy. In some embodiments, a pathogen-associated analyte may be a target nucleic acid that has been amplified. In other embodiments, a pathogen-associated analyte may be a host antibody or other immune system protein that is expressed in response to an infection by a pathogen (e.g., an IgM antibody, an IgA antibody, an IgG antibody, or a major histocompatibility complex (MHC) protein). The pathogen-associated analyte may be a toxin (e.g., Ricin toxin (Ricinus communis), Epsilon toxin (Clostridium perfringens), or Staphylococcus enterotoxin B (SEB)).

    [0166] A “subject” is an animal, preferably a mammal (including, for example, rodents (e.g., mice or rats), farm animals (e.g., cows, sheep, horses, and donkeys), pets (e.g., cats and dogs), or primates (e.g., humans and non-human primates (e.g., monkeys, chimpanzees, and gorillas)). In particular embodiments, the subject is a human. A subject may be a patient (e.g., a patient having or suspected of having a disease associated with or caused by a pathogen). In some embodiments, a subject is a host of one or more pathogens.

    [0167] By “pharmaceutical composition” is meant any composition that contains a therapeutically or biologically active agent (e.g., an antifungal agent) that is suitable for administration to a subject.

    [0168] As used herein, by “administering” is meant a method of giving a dosage of a composition (e.g., a pharmaceutical composition) described herein (e.g., a composition comprising an antimicrobial agent (e.g., an antibiotic agent)) to a subject. The compositions utilized in the methods described herein can be administered by any suitable route, e.g., parenteral (for example, intravenous, intramuscular, intra-arterial, intracardiac, subcutaneous, or intraperitoneal), dermal, transdermal, ocular, inhalation, buccal, sublingual, perilingual, nasal, rectal, topical, and oral. The compositions utilized in the methods described herein can also be administered locally or systemically. The preferred method of administration can vary depending on various factors (e.g., the components of the composition being administered and the severity of the condition being treated).

    [0169] As used herein, “linked” means attached or bound by covalent bonds, non-covalent bonds, and/or linked via Van der Waals forces, hydrogen bonds, and/or other intermolecular forces.

    [0170] The term “magnetic particle” refers to particles including materials of high positive magnetic susceptibility such as paramagnetic compounds, superparamagnetic compounds, and magnetite, gamma ferric oxide, or metallic iron.

    [0171] The terms “aggregation,” “agglomeration,” and “clustering” are used interchangeably in the context of the magnetic particles described herein and mean the binding of two or more magnetic particles to one another, for example, via a multivalent analyte, multimeric form of analyte, antibody, nucleic acid molecule, or other binding molecule or entity. In some instances, magnetic particle agglomeration is reversible. Such aggregation may lead to the formation of “aggregates,” which may include amplicons and magnetic particles bearing binding moieties.

    [0172] As used herein, “nonspecific reversibility” refers to the colloidal stability and robustness of magnetic particles against non-specific aggregation in a liquid sample and can be determined by subjecting the particles to the intended assay conditions in the absence of a specific clustering moiety (i.e., an analyte or an agglomerator). For example, nonspecific reversibility can be determined by measuring the T.sub.2 values of a solution of magnetic particles before and after incubation in a uniform magnetic field (defined as <5000 ppm) at 0.45T for 3 minutes at 37° C. Magnetic particles are deemed to have nonspecific reversibility if the difference in T.sub.2 values before and after subjecting the magnetic particles to the intended assay conditions vary by less than 10% (e.g., vary by less than 9%, 8%, 6%, 4%, 3%, 2%, or 1%). If the difference is greater than 10%, then the particles exhibit irreversibility in the buffer, diluents, and matrix tested, and manipulation of particle and matrix properties (e.g., coating and buffer formulation) may be required to produce a system in which the particles have nonspecific reversibility. In another example, the test can be applied by measuring the T.sub.2 values of a solution of magnetic particles before and after incubation in a gradient magnetic field 1 Gauss/mm-10000 Gauss/mm.

    [0173] As used herein, the term “NMR relaxation rate” refers to a measuring any of the following in a sample T.sub.1, T.sub.2, T.sub.1/T.sub.2 hybrid, T.sub.1rho, T.sub.2rho, and T.sub.2*. The systems and methods of the invention are designed to produce an NMR relaxation rate characteristic of whether an analyte is present in the liquid sample. In some instances the NMR relaxation rate is characteristic of the quantity of analyte present in the liquid sample.

    [0174] As used herein, the term “T.sub.1/T.sub.2 hybrid” refers to any detection method that combines a T.sub.1 and a T.sub.2 measurement. For example, the value of a T.sub.1/T.sub.2 hybrid can be a composite signal obtained through the combination of, ratio, or difference between two or more different T.sub.1 and T.sub.2 measurements. The T.sub.1/T.sub.2 hybrid can be obtained, for example, by using a pulse sequence in which T.sub.1 and T.sub.2 are alternatively measured or acquired in an interleaved fashion. Additionally, the T.sub.1/T.sub.2 hybrid signal can be acquired with a pulse sequence that measures a relaxation rate that is comprised of both T.sub.1 and T.sub.2 relaxation rates or mechanisms.

    [0175] By “pulse sequence” or “RF pulse sequence” is meant one or more radio frequency pulses to be applied to a sample and designed to measure, e.g., certain NMR relaxation rates, such as spin echo sequences. A pulse sequence may also include the acquisition of a signal following one or more pulses to minimize noise and improve accuracy in the resulting signal value.

    [0176] As used herein, the term “signal” refers to an NMR relaxation rate, frequency shift, susceptibility measurement, diffusion measurement, or correlation measurements.

    [0177] As used herein, reference to the “size” of a magnetic particle refers to the average diameter for a mixture of the magnetic particles as determined by microscopy, light scattering, or other methods.

    [0178] As used herein, the term “substantially monodisperse” refers to a mixture of magnetic particles having a polydispersity in size distribution as determined by the shape of the distribution curve of particle size in light scattering measurements. The FWHM (full width half max) of the particle distribution curve less than 25% of the peak position is considered substantially monodisperse. In addition, only one peak should be observed in the light scattering experiments and the peak position should be within one standard deviation of a population of known monodisperse particles.

    [0179] By “T.sub.2 relaxivity per particle” is meant the average T.sub.2 relaxivity per particle in a population of magnetic particles.

    [0180] As used herein, “unfractionated” refers to an assay in which none of the components of the sample being tested are removed following the addition of magnetic particles to the sample and prior to the NMR relaxation measurement.

    [0181] It is contemplated that units, methods, systems, cartridges, kits, panels, and processes of the claimed invention encompass variations and adaptations developed using information from the embodiments described herein. Throughout the description, where units, systems, cartridges, kits, or panels are described as having, including, or including specific components, or where processes and methods are described as having, including, or including specific steps, it is contemplated that, additionally, there are units, systems, cartridges, kits, or panels of the present invention that consist essentially of, or consist of, the recited components, and that there are processes and methods according to the present invention that consist essentially of, or consist of, the recited processing steps. It should be understood that the order of steps or order for performing certain actions is immaterial, unless otherwise specified, so long as the invention remains operable. Moreover, in many instances two or more steps or actions may be conducted simultaneously.

    [0182] Methods of Amplifying and/or Detecting Biothreat Pathogens in Complex Samples

    [0183] The invention provides methods of amplifying and/or detecting biothreat pathogens (e.g., biothreat pathogen target nucleic acids) in complex biological or environmental samples containing cells, cell debris (e.g., blood), or non-specific nucleic acids (e.g., subject (e.g., host) cell DNA).

    [0184] In one example, provided herein is a method for detecting the presence of a biothreat pathogen in a biological sample, the method including: (a) amplifying in a biological sample or a fraction thereof one or more biothreat pathogen target nucleic acids in a multiplexed amplification reaction, wherein the multiplexed amplification reaction is configured to amplify biothreat pathogen target nucleic acids characteristic of two or more of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii; and (b) detecting the one or more amplified biothreat pathogen target nucleic acids to determine whether one or more of the biothreat pathogens is present in the biological sample, wherein the method individually detects a biothreat pathogen present at a concentration of 10 cells/mL of biological sample or less (e.g., 10 cells/mL, 9 cells/mL, 8 cells/mL, 7 cells/mL, 6 cells/mL, 5 cells/mL, 4 cells/mL, 3 cells/mL, 2 cells/mL, or 1 cell/mL). In some embodiments, the method detects an antibiotic resistance gene of a bacterial pathogen present at a concentration of 2 cells/mL of biological sample or less. In some embodiments, the method detects a biothreat pathogen present at a concentration of 1 cells/mL of biological sample.

    [0185] In some embodiments, the method comprises amplifying and/or detecting biothreat pathogen target nucleic acids characteristic of at least three, at least four, at least five, or all six of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii. In some embodiments, the method comprises amplifying and/or detecting a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii. In some embodiments, the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii.

    [0186] In some embodiments: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4; (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 6; (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 8; (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 10; and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 12.

    [0187] For example, in some embodiments: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2); (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4); (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6); (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8); (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10); and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12).

    [0188] In some embodiments, the amplifying step (a) further includes amplifying a target nucleic acid characteristic of a drug resistance gene, and detecting step (b) further comprises detecting the amplified target nucleic acid characteristic of a drug resistance gene to determine whether the drug resistance gene is present. In some embodiments, the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of a drug resistance gene. In some embodiments, the drug resistance gene is selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC. In some embodiments, more than one drug resistance gene is amplified and/or detected, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 drug resistance genes selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC is amplified and/or detected.

    [0189] In some embodiments of any of the preceding methods, the amplifying step (a) further includes amplifying an internal amplification control (IC) target nucleic acid and the detecting step (b) further includes detecting the amplified IC target nucleic acid. In some embodiments, the multiplexed amplification reaction is configured to amplify an amplified IC target nucleic acid.

    [0190] The methods may utilize any suitable detection approach. In some embodiments of the preceding aspect, the detecting of step (b) includes magnetic, sequencing, optical, fluorescent, mass, density, chromatographic, and/or electrochemical detection. In some embodiments, the detecting of step (b) includes T2 magnetic resonance (T2MR). In some embodiments, the detecting of step (b) includes sequencing. In some embodiments, the detecting of step (b) includes T2MR and sequencing.

    [0191] In another example, provided herein is a method for detecting the presence of a biothreat pathogen in a biological sample, the method including: (a) providing a biological sample; (b) lysing biothreat pathogen cells in the biological sample; (c) amplifying in the product of step (b) one or more biothreat pathogen target nucleic acids in a multiplexed amplification reaction to form an amplified biological sample, wherein the multiplexed amplification reaction is configured to amplify biothreat pathogen target nucleic acids characteristic of two or more of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pXO2 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii; (d) preparing a first assay sample by contacting a portion of the amplified biological sample with a first population of magnetic particles, wherein the magnetic particles of the first population have binding moieties characteristic of a first biothreat pathogen target nucleic acid on their surface, the binding moieties operative to alter aggregation of the magnetic particles in the presence of a first amplified biothreat pathogen target nucleic acid; (e) preparing a second assay sample by contacting a portion of the amplified biological sample with a second population of magnetic particles, wherein the magnetic particles of the second population have binding moieties characteristic of a second biothreat pathogen target nucleic acid on their surface, the binding moieties operative to alter aggregation of the magnetic particles in the presence of a second amplified biothreat pathogen target nucleic acid; (f) providing each assay sample in a detection tube within a device, the device comprising a support defining a well for holding the detection tube comprising the assay sample, and having an RF coil configured to detect a signal produced by exposing the mixture to a bias magnetic field created using one or more magnets and an RF pulse sequence; (g) exposing each assay sample to a bias magnetic field and an RF pulse sequence; (h) following step (g), measuring the signal produced by each assay sample; and (i) on the basis of the result of step (h), detecting whether one or more of the biothreat pathogens is present in the biological sample.

    [0192] In some embodiments, the method comprises amplifying and/or detecting biothreat pathogen target nucleic acids characteristic of at least three, at least four, at least five, or all six of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii. In some embodiments, the method comprises amplifying and/or detecting a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii. In some embodiments, the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii.

    [0193] In some embodiments: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4; (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 6; (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 8; (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 10; and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 12.

    [0194] For example, in some embodiments: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2); (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4); (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6); (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8); (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10); and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12).

    [0195] In some embodiments, the amplifying step (c) further includes amplifying a target nucleic acid characteristic of a drug resistance gene, and detecting step (i) further comprises detecting the amplified target nucleic acid characteristic of a drug resistance gene to determine whether the drug resistance gene is present. In some embodiments, the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of a drug resistance gene. In some embodiments, the drug resistance gene is selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC. In some embodiments, more than one drug resistance gene is amplified and/or detected, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 drug resistance genes selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC is amplified and/or detected.

    [0196] In some embodiments, the amplifying step (c) further includes amplifying an IC target nucleic acid and step (i) further includes detecting the amplified IC target nucleic acid. In some embodiments, the multiplexed amplification reaction is configured to amplify an amplified IC target nucleic acid.

    [0197] The magnetic particles may be any of the magnetic particles described herein or in International Patent Application Publication Nos. WO 2012/054639, WO 2016/118766, WO 2017/127731, or in International Patent Application No. PCT/US2018/033278, each of which is incorporated herein by reference in its entirety.

    [0198] In some embodiments, the magnetic particles of each population include two subpopulations, a first subpopulation bearing a first probe on its surface, and a second subpopulation bearing a second probe on its surface. In other embodiments, the magnetic particles of each population include two subpopulations, a first subpopulation bearing a first probe and a second probe on its surface, and a second subpopulation bearing a third probe and a fourth probe on its surface.

    [0199] In some embodiments: (i) a probe pair comprising a 5′ probe comprising the nucleotide sequence CCGCTATCCGCCTTTCTACCAG (SEQ ID NO: 13) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 13 and a 3′ probe comprising the nucleotide sequence GTATCCACCCTCACTCTTCCATTTTC (SEQ ID NO: 14) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 14 is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid; (ii) a probe pair comprising a 5′ probe comprising the nucleotide sequence CATTTGCTTGAATCATTTTATTTTGGAAG (SEQ ID NO: 15) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 15 and a 3′ probe comprising the nucleotide sequence TTAATCGGTTGCTCCTCGTCAGTA (SEQ ID NO: 16) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 16 is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid; (iii) a probe pair comprising a 5′ probe comprising the nucleotide sequence AACCTTCTGGAGCCTGCCATT (SEQ ID NO: 17) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 17 and a 3′ probe comprising the nucleotide sequence GCAGCAGCAGTATCTTTAGCTGA (SEQ ID NO: 18) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 18 is used for detection of the target nucleic acid characteristic of Francisella tularensis; (iv) a probe pair comprising a 5′ probe comprising the nucleotide sequence TCGCCGCGGTAAAGAACCGTAC (SEQ ID NO: 19) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 19 and a 3′ probe comprising the nucleotide sequence GACCGTCAGGGCCGCACG (SEQ ID NO: 20) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 20 is used for detection of the target nucleic acid characteristic of Burkholderia spp.; (v) a probe pair comprising a 5′ probe comprising the nucleotide sequence AAATACCGGCAGCATCTCCG (SEQ ID NO: 21) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 21 and a 3′ probe comprising the nucleotide sequence GGTTAATTACGGTACCATAATAACGTG (SEQ ID NO: 22) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 22 is used for detection of the target nucleic acid characteristic of Yersinia pestis; and/or (vi) a probe pair comprising a 5′ probe comprising the nucleotide sequence GCATCAAACTCAATAATTATAGCTTTAGTACC (SEQ ID NO: 23) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 23 and a 3′ probe comprising the nucleotide sequence CGGACGCAAAACTCAATAACACCATAC (SEQ ID NO: 24) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 24 is used for detection of the target nucleic acid characteristic of Rickettsia prowazekii.

    [0200] For example, in some embodiments: (i) a probe pair comprising a 5′ probe comprising the nucleotide sequence CCGCTATCCGCCTTTCTACCAG (SEQ ID NO: 13) and a 3′ probe comprising the nucleotide sequence GTATCCACCCTCACTCTTCCATTTTC (SEQ ID NO: 14) is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid; (ii) a probe pair comprising a 5′ probe comprising the nucleotide sequence CATTTGCTTGAATCATTTTATTTTGGAAG (SEQ ID NO: 15) and a 3′ probe comprising the nucleotide sequence TTAATCGGTTGCTCCTCGTCAGTA (SEQ ID NO: 16) is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid; (iii) a probe pair comprising a 5′ probe comprising the nucleotide sequence AACCTTCTGGAGCCTGCCATT (SEQ ID NO: 17) and a 3′ probe comprising the nucleotide sequence GCAGCAGCAGTATCTTTAGCTGA (SEQ ID NO: 18) is used for detection of the target nucleic acid characteristic of Francisella tularensis; (iv) a probe pair comprising a 5′ probe comprising the nucleotide sequence TCGCCGCGGTAAAGAACCGTAC (SEQ ID NO: 19) and a 3′ probe comprising the nucleotide sequence GACCGTCAGGGCCGCACG (SEQ ID NO: 20) is used for detection of the target nucleic acid characteristic of Burkholderia spp.; (v) a probe pair comprising a 5′ probe comprising the nucleotide sequence AAATACCGGCAGCATCTCCG (SEQ ID NO: 21) and a 3′ probe comprising the nucleotide sequence GGTTAATTACGGTACCATAATAACGTG (SEQ ID NO: 22) is used for detection of the target nucleic acid characteristic of Yersinia pestis; and/or (vi) a probe pair comprising a 5′ probe comprising the nucleotide sequence GCATCAAACTCAATAATTATAGCTTTAGTACC (SEQ ID NO: 23) and a 3′ probe comprising the nucleotide sequence CGGACGCAAAACTCAATAACACCATAC (SEQ ID NO: 24) is used for detection of the target nucleic acid characteristic of Rickettsia prowazekii.

    [0201] Any suitable number of magnetic particles can be used in the methods, e.g., as described below.

    [0202] In some embodiments, an assay sample is contacted with 1×10.sup.6 to 1×10.sup.13 magnetic particles per milliliter of the biological sample.

    [0203] In some embodiments of the preceding aspect, step (h) includes measuring the T.sub.2 relaxation response of the assay sample, and increasing agglomeration in the assay sample produces an increase in the observed T.sub.2 relaxation time of the assay sample.

    [0204] The magnetic particles can have any suitable size, e.g., as described below. In some embodiments, the magnetic particles have a mean diameter of from 700 nm to 1200 nm. In some embodiments, the magnetic particles have a mean diameter of from 650 nm to 950 nm. In some embodiments, the magnetic particles have a mean diameter of from 670 nm to 890 nm.

    [0205] The magnetic particles can have any suitable T.sub.2 relaxivity per particle. In some embodiments, the magnetic particles have a T.sub.2 relaxivity per particle of from 1×10.sup.9 to 1×10.sup.12 mM.sup.−1s.sup.−1.

    [0206] In some embodiments, the magnetic particles are substantially monodisperse.

    [0207] In some embodiments, the method further includes sequencing the first and/or second amplified biothreat pathogen target nucleic acid.

    [0208] In yet another example, provided herein is a method for detecting the presence of a biothreat pathogen in a biological sample obtained from a subject, wherein the biological sample comprises subject-derived cells or cell debris, the method comprising: (a) amplifying in a biological sample or a fraction thereof one or more biothreat pathogen target nucleic acids in a multiplexed amplification reaction, wherein the multiplexed amplification reaction is configured to amplify biothreat pathogen target nucleic acids characteristic of two or more of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pXO2 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii; and (b) sequencing the one or more amplified biothreat pathogen target nucleic acids to detect whether one or more of the biothreat pathogens is present in the biological sample, wherein the method is capable of detecting a biothreat pathogen present at a concentration of 10 cells/mL of biological sample or less (e.g., 10 cells/mL, 9 cells/mL, 8 cells/mL, 7 cells/mL, 6 cells/mL, 5 cells/mL, 4 cells/mL, 3 cells/mL, 2 cells/mL, or 1 cell/mL).

    [0209] In some embodiments, the method comprises amplifying and/or sequencing biothreat pathogen target nucleic acids characteristic of at least three, at least four, at least five, or all six of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii. In some embodiments, the method comprises amplifying and/or sequencing a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii. In some embodiments, the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii.

    [0210] In some embodiments: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4; (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 6; (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 8; (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 10; and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 12.

    [0211] For example, in some embodiments: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2); (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4); (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6); (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8); (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10); and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12).

    [0212] In some embodiments, the amplifying step (a) further includes amplifying a target nucleic acid characteristic of a drug resistance gene, and sequencing step (b) further comprises sequencing the amplified target nucleic acid characteristic of a drug resistance gene to determine whether the drug resistance gene is present. In some embodiments, the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of a drug resistance gene. In some embodiments, the drug resistance gene is selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC. In some embodiments, more than one drug resistance gene is amplified and/or sequenced, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 drug resistance genes selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC is amplified and/or detected.

    [0213] In some embodiments, the amplifying step (c) further includes amplifying an IC target nucleic acid and step (i) further includes detecting the amplified IC target nucleic acid. In some embodiments, the multiplexed amplification reaction is configured to amplify an amplified IC target nucleic acid.

    [0214] In some embodiments of the preceding aspect, step (a) includes amplifying the one or more antibiotic resistance target nucleic acids in a lysate produced by lysing cells in the biological sample. In some embodiments, the lysate has at least about a 2:1, a 5:1, a 10:1, a 20:1, a 40:1, or a 60:1 higher concentration of cell debris relative to the biological sample. In some embodiments, the cell debris is solid material.

    [0215] In some embodiments of any of the preceding methods, the biological sample has a volume of about 0.1 mL to about 5 mL. In some embodiments, the biological sample has a volume of about 2 mL. In some embodiments of any of the preceding aspects, the biological sample is selected from the group consisting of blood, bloody fluids, tissue samples, bronchiolar lavage (BAL), urine, cerebrospinal fluid (CSF), synovial fluid (SF), and sputum. In some embodiments, the blood is whole blood, a crude blood lysate, serum, or plasma. In some embodiments, the whole blood is ethylenediaminetetraacetic acid (EDTA) whole blood, sodium citrate whole blood, sodium heparin whole blood, lithium heparin whole blood, or potassium oxylate/sodium fluoride whole blood. In some embodiments, the bloody fluid is wound exudate, wound aspirate, phlegm, or bile. In some embodiments, the tissue sample is a tissue sample from a transplant, a tissue biopsy (e.g., a skin biopsy, muscle biopsy, or lymph node biopsy), a homogenized tissue sample, or bone. In some embodiments, the biological sample is urine or BAL. In some embodiments of any of the preceding aspects, the biological sample is a swab.

    [0216] In some embodiments, the method further includes detecting the amplified biothreat pathogen target nucleic acid(s) using T2 magnetic resonance (T2MR).

    [0217] In another example, provided herein is a method for detecting the presence of a biothreat pathogen in a whole blood sample, the method comprising: (a) contacting a whole blood sample suspected of containing one or more biothreat pathogen cells with an erythrocyte lysis agent, thereby lysing red blood cells; (b) centrifuging the product of step (a) to form a supernatant and a pellet; (c) discarding some or all of the supernatant of step (b) and resuspending the pellet to form an extract, optionally washing the pellet one or more times prior to resuspending the pellet; (d) lysing the remaining cells in the extract of step (c) to form a lysate, the lysate containing both subject cell nucleic acid and pathogen nucleic acid; (e) amplifying in the lysate of step (d) one or more biothreat pathogen target nucleic acids in a multiplexed amplification reaction, wherein the multiplexed amplification reaction is configured to amplify biothreat pathogen target nucleic acids characteristic of two or more of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii; and (f) detecting the one or more amplified biothreat pathogen target nucleic acids, thereby detecting the presence of the one or more biothreat pathogens in the sample.

    [0218] In some embodiments, the method comprises amplifying and/or detecting biothreat pathogen target nucleic acids characteristic of at least three, at least four, at least five, or all six of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii. In some embodiments, the method comprises amplifying and/or detecting a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii. In some embodiments, the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, a target nucleic acid characteristic of Bacillus anthracis pX02 plasmid, a target nucleic acid characteristic of Francisella tularensis, a target nucleic acid characteristic of Burkholderia spp., a target nucleic acid characteristic of Yersinia pestis, and a target nucleic acid characteristic of Rickettsia prowazekii.

    [0219] In some embodiments: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4; (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 6; (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 8; (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 10; and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 12.

    [0220] For example, in some embodiments: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2); (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4); (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6); (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8); (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10); and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12).

    [0221] In some embodiments, the amplifying step (e) further includes amplifying a target nucleic acid characteristic of a drug resistance gene, and detecting step (f) further comprises detecting the amplified target nucleic acid characteristic of a drug resistance gene to determine whether the drug resistance gene is present. In some embodiments, the multiplexed amplification reaction is configured to amplify a target nucleic acid characteristic of a drug resistance gene. In some embodiments, the drug resistance gene is selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC. In some embodiments, more than one drug resistance gene is amplified and/or detected, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 drug resistance genes selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC is amplified and/or detected.

    [0222] In some embodiments, the amplifying step (c) further includes amplifying an IC target nucleic acid and step (i) further includes detecting the amplified IC target nucleic acid. In some embodiments, the multiplexed amplification reaction is configured to amplify an amplified IC target nucleic acid.

    [0223] In some embodiments of the preceding methods, step (c) includes washing the pellet one time prior to resuspending the pellet. In some embodiments, washing or resuspending is performed with a wash buffer solution. In some embodiments, the wash buffer solution is Tris-EDTA (TE) buffer. In some embodiments, the washing is performed with a wash buffer solution having a volume of about 100 μL to about 500 μL. In some embodiments, the volume is about 150 μL. In some embodiments, resuspending of step (c) is performed with a wash buffer solution having a volume of about 50 μL to about 150 μL. In some embodiments, the volume is about 100 μL.

    [0224] In some embodiments of any of the preceding methods, the amplifying further includes amplifying an IC target nucleic acid and the method further includes the amplified IC target nucleic acid. In some embodiments, the multiplexed amplification reaction is configured to amplify an amplified IC target nucleic acid. In some embodiments, the wash buffer solution further includes an IC nucleic acid.

    [0225] In some embodiments of the preceding methods, step (a) further includes adding a total process control (TPC) to the whole blood sample. In some embodiments, the TPC is an engineered cell includes a control target nucleic acid.

    [0226] In some embodiments of any of the preceding methods, amplifying is in the presence of whole blood proteins and non-target nucleic acids.

    [0227] Any suitable lysis approach can be used. In some embodiments of any of the preceding methods, lysing includes mechanical lysis or heat lysis. In some embodiments, the mechanical lysis is beadbeating or sonicating.

    [0228] In some embodiments of any of the preceding methods, the steps of the method are completed within 5 hours. In some embodiments, the steps of the method are completed within 4 hours. In some embodiments, the steps of the method are completed within 3 hours.

    [0229] In some embodiments of the preceding methods, the detecting includes T2MR. In some embodiments, the detecting includes sequencing. In some embodiments, the detecting includes T2MR and sequencing.

    [0230] For example, in some embodiments, the B. anthracis pX01 plasmid target nucleic acid is characteristic of protective antigen (pag), lethal factor (lef), or edema factor (cya). In some embodiments, the B. anthracis pX01 plasmid target nucleic acid is characteristic of protective antigen (pag). An exemplary nucleic acid encoding pag is provided in GenBank Accession No. M22589.1, which is incorporated by reference herein in its entirety.

    [0231] In another example, in some embodiments, the B. anthracis pX02 plasmid target nucleic acid is characteristic of capB, capC, capA, capD, capE, AcpA, or AcpB. In some embodiments, the B. anthracis pX02 plasmid target nucleic acid is characteristic of capB. An exemplary nucleic acid encoding capB is provided in GenBank Accession No. CP001597.1, which is incorporated by reference herein in its entirety.

    [0232] In another example, in some embodiments, the Francisella tularensis target nucleic acid is characteristic of lipoprotein. An exemplary nucleic acid encoding F. tularensis lipoprotein is provided in GenBank Accession No. AM233362, which is incorporated herein by reference in its entirety, at position: 388817-389266.

    [0233] In another example, in some embodiments, the Burkholderia spp. target nucleic acid is characteristic of B. mallei and B. pseudomallei. In some embodiments, the Burkholderia spp. target nucleic acid characteristic of B. mallei and B. pseudomallei is a braG gene or a 16S ribosomal RNA (rRNA) gene. An exemplary B. pseudomallei 16S rRNA gene is provided in GenBank Accession No. CP018415.1, which is incorporated herein by reference in its entirety, at position: 1161197-1161762. An exemplary B. mallei 16S rRNA gene is provided in GenBank Accession No. CP010066.1, which is incorporated herein by reference in its entirety, at position: 1617484-1618049. In some embodiments, the Burkholderia spp. target nucleic acid is a braG gene. An exemplary nucleic acid encoding braG is provided in GenBank Accession No. BX571966, at position: 787037-787738, which is incorporated by reference herein in its entirety.

    [0234] In another example, in some embodiments, the Yersinia pestis target nucleic acid is characteristic of plasminogen. An exemplary nucleic acid encoding Y. pestis plasminogen is provided in GenBank Accession No. KJ361945.1, which is incorporated by reference herein in its entirety.

    [0235] In another example, in some embodiments, the Rickettsia prowazekii target nucleic acid is characteristic of cytochrome c oxidase assembly protein or citrate synthase. An exemplary nucleic acid encoding Rickettsia prowazekii citrate synthase is provided in GenBank Accession No. CP014865.1, which is incorporated herein by reference in its entirety, at position: 1062793-1064103. In some embodiments, the Rickettsia prowazekii target nucleic acid is characteristic of cytochrome c oxidase assembly protein. An exemplary nucleic acid encoding R. prowazekii cytochrome c oxidase assembly protein is provided in GenBank Accession No. CP014865, at position: 373819-374355, which is incorporated herein by reference in its entirety.

    [0236] Any suitable amplification approach can be used, e.g., any amplification approach described herein or known in the art. In some embodiments of any of the preceding aspects, the amplifying includes polymerase chain reaction (PCR), ligase chain reaction (LCR), multiple displacement amplification (MDA), strand displacement amplification (SDA), rolling circle amplification (RCA), loop mediated isothermal amplification (LAMP), nucleic acid sequence based amplification (NASBA), helicase dependent amplification, recombinase polymerase amplification, nicking enzyme amplification reaction, or ramification amplification (RAM). In some embodiments, the amplifying includes PCR. In some embodiments, the PCR is symmetric PCR or asymmetric PCR.

    [0237] Any suitable sequencing approach can be used, e.g., any sequencing approach described herein or known in the art. In some embodiments of any of the preceding aspects, the sequencing includes massively parallel sequencing, Sanger sequencing, or single-molecule sequencing. In some embodiments, the massively parallel sequencing includes sequencing by synthesis or sequencing by ligation. In some embodiments, the massively parallel sequencing includes sequencing by synthesis. In some embodiments, the sequencing by synthesis includes ILLUMINA™ dye sequencing, ion semiconductor sequencing, or pyrosequencing. In some embodiments, the sequencing by synthesis includes ILLUMINA™ dye sequencing. In some embodiments, the sequencing by ligation includes sequencing by oligonucleotide ligation and detection (SOLiD™) sequencing or polony-based sequencing. In some embodiments, the single-molecule sequencing is nanopore sequencing, single-molecule real-time (SMRT™) sequencing, or Helicos™ sequencing.

    [0238] Additional Sequencing-Based Methods of Detecting and Analyzing Biothreat Pathogens in Complex Samples

    [0239] The invention provides methods for sequencing target nucleic acids associated with biothreat pathogens in complex samples (e.g., biological or environmental samples) containing cells, cell debris (e.g., solid material), or nucleic acids (e.g., DNA or RNA (e.g., mRNA), e.g., non-target and/or subject-derived nucleic acids). In several embodiments, the sample contains cells and/or cell debris derived from a mammalian host subject and one or more pathogen cells. In several embodiments, the sample contains nucleic acids (e.g., DNA or RNA (e.g., mRNA)) derived from a mammalian host subject and one or more pathogen cells.

    [0240] For example, provided herein is a method for detecting a biothreat pathogen target nucleic acid in an environmental sample or a biological sample obtained from a subject, wherein the environmental or biological sample includes cells (e.g., subject-derived cells) or cell debris, the method including one or two of the following steps: (a) amplifying a target nucleic acid in the biological sample to form an amplified solution including an amplified target nucleic acid; and (b) sequencing the amplified target nucleic acid to detect whether the target nucleic acid is present in the biological sample, wherein the method is capable of detecting a concentration of about 10 copies/mL (or less, e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 copies/mL) of the target nucleic acid in the biological sample.

    [0241] Also provided herein is a method for determining the sequence of a biothreat pathogen target nucleic acid in an environmental sample or a biological sample obtained from a subject, wherein the environmental or biological sample includes cells (e.g., subject-derived cells) or cell debris, the method including one or two of the following steps: (a) amplifying a target nucleic acid in the biological sample to form an amplified solution including an amplified target nucleic acid; and (b) sequencing the amplified target nucleic acid to detect whether the target nucleic acid is present in the biological sample, wherein the method is capable of determining the sequence of the target nucleic acid at a concentration of about 10 copies/mL (or less, e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 copies/mL) of the target nucleic acid in the biological sample.

    [0242] Further provided herein is a method for detecting a biothreat pathogen target nucleic acid in an environmental sample or a biological sample obtained from a subject, wherein the environmental or biological sample includes cells (e.g., subject-derived cells) or cell debris, the method including sequencing an amplified target nucleic acid to detect whether the target nucleic acid is present in the biological sample, wherein the amplified target nucleic acid has been amplified in the environmental or biological sample, and the method is capable of detecting a concentration of about 10 copies/mL (or less, e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 copies/mL) of the target nucleic acid in the biological sample.

    [0243] Also provided herein is a method for determining the sequence of a biothreat pathogen target nucleic acid in an environmental sample or a biological sample obtained from a subject, wherein the environmental or biological sample includes cells (e.g., subject-derived cells) or cell debris, the method including sequencing an amplified target nucleic acid to detect whether the target nucleic acid is present in the biological sample, wherein the amplified target nucleic acid has been amplified in the environmental or biological sample, and the method is capable of detecting a concentration of about 10 copies/mL (or less, e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 copies/mL) of the target nucleic acid in the biological sample.

    [0244] In any of the preceding methods, the environmental sample or biological sample may contain nucleic acids (e.g., DNA or RNA (e.g., mRNA)), such as host-derived nucleic acids or non-target nucleic acids present in the sample.

    [0245] Further provided herein is a method for detecting a biothreat pathogen target nucleic acid in an environmental sample or a biological sample obtained from a subject, wherein the environmental or biological sample also includes non-target nucleic acids (e.g., DNA or RNA (e.g., mRNA)), the method including one or two of the following steps: (a) amplifying a target nucleic acid in the biological sample to form an amplified solution including an amplified target nucleic acid; and (b) sequencing the amplified target nucleic acid to detect whether the target nucleic acid is present in the biological sample, wherein the method is capable of detecting a concentration of about 10 copies/mL (or less, e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 copies/mL) of the target nucleic acid in the biological sample.

    [0246] Also provided herein is a method for determining the sequence of a biothreat pathogen target nucleic acid in an environmental sample or a biological sample obtained from a subject, wherein the environmental or biological sample also includes non-target nucleic acids (e.g., DNA or RNA (e.g., mRNA)), the method including one or two of the following steps: (a) amplifying a target nucleic acid in the biological sample to form an amplified solution including an amplified target nucleic acid; and (b) sequencing the amplified target nucleic acid to detect whether the target nucleic acid is present in the biological sample, wherein the method is capable of determining the sequence of the target nucleic acid at a concentration of about 10 copies/mL (or less, e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 copies/mL) of the target nucleic acid in the biological sample.

    [0247] In yet another example, provided herein is a method for detecting a biothreat pathogen target nucleic acid in an environmental sample or a biological sample obtained from a subject, wherein the environmental or biological sample also includes non-target nucleic acids (e.g., DNA or RNA (e.g., mRNA)), the method including sequencing an amplified target nucleic acid to detect whether the target nucleic acid is present in the biological sample, wherein the amplified target nucleic acid has been amplified in the environmental or biological sample, and the method is capable of detecting a concentration of about 10 copies/mL (or less, e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 copies/mL) of the target nucleic acid in the biological sample.

    [0248] Further provided herein is a method for determining the sequence of a biothreat pathogen target nucleic acid in an environmental sample or a biological sample obtained from a subject, wherein the environmental or biological sample also includes non-target nucleic acids (e.g., DNA or RNA (e.g., mRNA)), the method including sequencing an amplified target nucleic acid to detect whether the target nucleic acid is present in the biological sample, wherein the amplified target nucleic acid has been amplified in the environmental or biological sample, and the method is capable of detecting a concentration of about 10 copies/mL (or less, e.g., 1, 2, 3, 4, 5, 6, 7, 8, or 9 copies/mL) of the target nucleic acid in the biological sample.

    [0249] In any of the methods described herein, the environmental or biological sample (e.g., blood (e.g., whole blood (e.g., ethylenediaminetetraacetic acid (EDTA) whole blood, sodium citrate whole blood, sodium heparin whole blood, lithium heparin whole blood, and/or potassium oxylate/sodium fluoride whole blood), a crude blood lysate, serum, or plasma)) can have any suitable volume. For example, in some embodiments, the environmental or biological sample has a volume of about 0.2 mL to about 50 mL, e.g., about 0.2 mL, about 0.3 mL, about 0.4 mL, about 0.5 mL, about 0.6 mL, about 0.7 mL, about 0.8 mL, about 0.9 mL, about 1 mL, about 2 mL, about 3 mL, about 4 mL, about 5 mL, about 6 mL, about 7 mL, about 8 mL, about 9 mL, about 10 mL, about 15 mL, about 20 mL, about 25 mL, about 30 mL, about 35 mL, about 40 mL, about 45 mL, or about 50 mL. In some embodiments, the environmental or biological sample has a volume of about 0.2 mL to about 20 mL, about 0.2 mL to about 15 mL, about 0.2 mL to about 10 mL, about 0.2 mL to about 5 mL, about 0.2 mL to about 2 mL, about 0.4 mL to about 20 mL, about 0.4 mL to about 15 mL, about 0.4 mL to about 10 mL, about 0.4 mL to about 5 mL, about 0.4 mL to about 2 mL, about 0.6 mL to about 20 mL, about 0.6 mL to about 15 mL, about 0.6 mL to about 10 mL, about 0.6 mL to about 5 mL, about 0.6 mL to about 2 mL, about 0.8 mL to about 20 mL, about 0.8 mL to about 15 mL, about 0.8 mL to about 10 mL, about 0.8 mL to about 5 mL, about 0.8 mL to about 2 mL, about 1 mL to about 20 mL, about 1 mL to about 15 mL, about 1 mL to about 10 mL, about 1 mL to about 5 mL, about 1 mL to about 4 mL, about 1 mL to about 3 mL, about 1 mL to about 2 mL, about 1.5 mL to about 20 mL, about 1.5 mL to about 15 mL, about 1.5 mL to about 10 mL, about 1.5 mL to about 5 mL, about 1.5 mL to about 4 mL, about 1.5 mL to about 3 mL, about 1.5 mL to about 2 mL, about 2 mL to about 20 mL, about 2 mL to about 15 mL, about 2 mL to about 10 mL, about 2 mL to about 5 mL, about 2 mL to about 4 mL, about 2 mL to about 3 mL, about 3 mL to about 20 mL, about 3 mL to about 15 mL, about 3 mL to about 10 mL, about 3 mL to about 5 mL, about 3 mL to about 4 mL, about 4 mL to about 20 mL, about 4 mL to about 15 mL, about 4 mL to about 10 mL, about 4 mL to about 5 mL, about 5 mL to about 20 mL, about 5 mL to about 15 mL, about 5 mL to about 10 mL, about 6 mL to about 20 mL, about 6 mL to about 15 mL, about 6 mL to about 10 mL, about 7 mL to about 20 mL, about 7 mL to about 15 mL, about 7 mL to about 10 mL, about 8 mL to about 20 mL, about 8 mL to about 15 mL, about 8 mL to about 10 mL, about 9 mL to about 20 mL, about 9 mL to about 15 mL, about 9 mL to about 10 mL, about 10 mL to about 20 mL, or about 10 mL to about 15 mL. In some embodiments, the environmental or biological sample has a volume of about 0.2 mL to about 20 mL, about 0.2 mL to about 15 mL, about 0.2 mL to about 10 mL, about 0.2 mL to about 5 mL, or about 0.2 mL to about 2 mL. In some embodiments, the environmental or biological sample has a volume of about 2 mL.

    [0250] Any suitable environmental or biological sample can be used. For example, the biological sample can be selected from the group consisting of blood (e.g., whole blood (e.g., ethylenediaminetetraacetic acid (EDTA) whole blood, sodium citrate whole blood, sodium heparin whole blood, lithium heparin whole blood, and/or potassium oxylate/sodium fluoride whole blood), a crude blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, or bile), tissue samples (e.g., a tissue biopsy such as a skin biopsy, muscle biopsy, or lymph node biopsy), urine, bronchiolar lavage (BAL), cerebrospinal fluid (CSF), synovial fluid (SF), and sputum. In some embodiments, the biological sample is blood (e.g., whole blood (e.g., EDTA whole blood, sodium citrate whole blood, sodium heparin whole blood, lithium heparin whole blood, and/or potassium oxylate/sodium fluoride whole blood), a crude blood lysate, serum, or plasma). In some embodiments, the tissue sample is a homogenized tissue sample. The environmental sample may be an environmental swab, e.g., a surface swab. In some embodiments, the swab buffer diluent or swab transport medium is, without limitation, phospho-buffered saline-TWEEN® (PBST), Amies Buffer, Amies Buffer+10% (v/v) 1 Ox PBST, Cary Blair Media, or Liquid Stuart Swabs (which may include addition of 10% (v/v) 1 Ox PBST).

    [0251] In some embodiments of any of the preceding methods, the target nucleic acid is characteristic of a biothreat pathogen. In some embodiments, the biothreat pathogen target nucleic acid is characteristic of one of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, or Rickettsia prowazekii.

    [0252] In some embodiments: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4; (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 6; (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 8; (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 10; and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 12.

    [0253] For example, in some embodiments: (i) the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2); (ii) the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid is amplified in the presence of a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4); (iii) the target nucleic acid characteristic of Francisella tularensis is amplified in the presence of a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6); (iv) the target nucleic acid characteristic of Burkholderia spp. is amplified in the presence of a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8); (v) the target nucleic acid characteristic of Yersinia pestis is amplified in the presence of a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10); and/or (vi) the target nucleic acid characteristic of Rickettsia prowazekii is amplified in the presence of a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12).

    [0254] In some embodiments of any of the preceding methods, step (a) includes amplifying the target nucleic acid in a lysate produced by lysing cells in the environmental or biological sample. The lysate may contain a concentration of cells, cell debris, and/or non-target or subject-cell derived nucleic acids (e.g., DNA) relative to the original environmental or biological sample. As an example, 2 mL of a biological sample concentrated down to 0.1 mL in a lysate corresponds to a 20:1 higher concentration of debris compared to the original sample. If the lysate is diluted 1:1 for amplification, the amplification is performed in a lysate that represents a 10:1 concentration of the debris in the original sample. In some embodiments, the lysate has at least about a 1.5:1 higher concentration of cell debris relative to the environmental or biological sample, e.g., about 1.5:1, about 2:1, about 3:1, about 4:1, about 5:1, about 6:1, about 7:1, about 8:1, about 9:1, about 10:1, about 11:1, about 12:1, about 13:1, about 14:1, about 15:1, about 16:1, about 18:1, about 19:1, about 20:1, about 21:1, about 22:1, about 23:1, about 24:1, about 25:1, about 30:1, about 35:1, about 40:1, about 45:1, about 50:1, about 55:1, about 60:1, about 65:1, about 70:1, about 75:1, about 80:1, about 90:1, about 100:1, about 120:1, about 140:1, about 160:1, about 180:1, about 200:1, about 300:1, about 400:1, about 500:1, about 600:1, about 700:1, about 800:1, about 900:1, about 1000:1, or higher concentration of cell debris relative to the environmental or biological sample. In some embodiments, the lysate is not diluted prior to amplification. In other embodiments, the lysate is diluted to produce a diluted lysate (e.g., for use in amplification), and the diluted lysate has at least about a 1.5:1 higher concentration of cell debris relative to the environmental or biological sample, e.g., about 1.5:1, about 2:1, about 3:1, about 4:1, about 5:1, about 6:1, about 7:1, about 8:1, about 9:1, about 10:1, about 11:1, about 12:1, about 13:1, about 14:1, about 15:1, about 16:1, about 18:1, about 19:1, about 20:1, about 21:1, about 22:1, about 23:1, about 24:1, about 25:1, about 30:1, about 35:1, about 40:1, about 45:1, about 50:1, about 55:1, about 60:1, about 65:1, about 70:1, about 75:1, about 80:1, about 90:1, about 100:1, about 120:1, about 140:1, about 160:1, about 180:1, about 200:1, about 300:1, about 400:1, about 500:1, about 600:1, about 700:1, about 800:1, about 900:1, about 1000:1, or higher concentration of cell debris relative to the environmental or biological sample. In some embodiments, the lysate or the diluted lysate has about a 10:1 higher concentration of cell debris relative to the environmental or biological sample. In other embodiments, the lysate or the diluted lysate has about a 20:1 higher concentration of cell debris relative to the environmental or biological sample. In some embodiments, the cell debris is solid material (e.g., solid material that can be concentrated with a liquid-solid separation method (e.g., centrifugation or filtration). In some embodiments, the lysate or the amplified lysate solution is a super-saturated solution of cell debris (e.g., solid material).

    [0255] Also provided herein is a method for detecting a biothreat pathogen target nucleic acid in a whole blood sample, the method including the following steps: (a) contacting a whole blood sample suspected of containing one or more biothreat pathogen cells with an erythrocyte lysis agent, thereby lysing red blood cells; (b) centrifuging the product of step (a) to form a supernatant and a pellet; (c) discarding some or all of the supernatant of step (b) and resuspending the pellet to form an extract, optionally washing the pellet one or more times prior to resuspending the pellet; (d) lysing the remaining cells in the extract of step (c) to form a lysate, the lysate containing both subject cell nucleic acid and pathogen nucleic acid; (e) amplifying pathogen nucleic acids in the lysate of step (d) to form an amplified lysate solution including an amplified biothreat pathogen target nucleic acid; and (f) sequencing the amplified biothreat pathogen target nucleic acid, thereby detecting the biothreat pathogen target nucleic acid in the sample.

    [0256] Further provided herein is a method for determining the sequence of a biothreat pathogen target nucleic acid in a whole blood sample, the method including the following steps: (a) contacting a whole blood sample suspected of containing one or more biothreat pathogen cells with an erythrocyte lysis agent, thereby lysing red blood cells; (b) centrifuging the product of step (a) to form a supernatant and a pellet; (c) discarding some or all of the supernatant of step (b) and resuspending the pellet to form an extract, optionally washing the pellet one or more times prior to resuspending the pellet; (d) lysing the remaining cells in the extract of step (c) to form a lysate, the lysate containing both subject cell nucleic acid and pathogen nucleic acid; (e) amplifying pathogen nucleic acids in the lysate of step (d) to form an amplified lysate solution including an amplified biothreat pathogen target nucleic acid; and (f) sequencing the amplified biothreat pathogen target nucleic acid, thereby determining the sequence of the biothreat pathogen target nucleic acid in the sample.

    [0257] In some embodiments of any of the preceding methods, step (c) can include washing the pellet one time prior to resuspending the pellet. In other embodiments, step (c) can include washing the pellet more than one time prior to resuspending the pellet, e.g., two, three, four, five, six, seven, eight, nine, or ten times. In some embodiments, the washing or resuspending is performed with a wash buffer solution (e.g., Tris-EDTA (TE) buffer). The wash buffer solution may have any suitable volume, e.g., about 25 μL to about 1 mL, e.g., about 25 μL, about 30 μL, about 35 μL, about 40 μL, about 45 μL, about 50 μL, about 55 μL, about 60 μL, about 65 μL, about 70 μL, about 75 μL, about 80 μL, about 85 μL, about 90 μL, about 100 μL, about 110 μL, about 120 μL, about 130 μL, about 140 μL, about 150 μL, about 160 μL, about 170 μL, about 180 μL, about 190 μL, about 200 μL, about 225 μL, about 250 μL, about 275 μL, about 300 μL, about 350 μL, about 400 μL, about 450 μL, about 500 μL, about 550 μL, about 600 μL, about 650 μL, about 700 μL, about 800 μL, about 850 μL, about 900 μL, about 950 μL, or about 1 mL. In some embodiments, the washing is performed with a wash buffer solution having a volume of about 100 μL to about 500 μL. In some embodiments, the washing is performed with a wash buffer solution having a volume of about 100 μL to about 200 μL. In some embodiments, the volume is about 150 μL.

    [0258] The resuspending of step (c) can be performed with a wash buffer solution having any suitable volume, e.g., about 25 μL to about 1 mL, e.g., about 25 μL, about 30 μL, about 35 μL, about 40 μL, about 45 μL, about 50 μL, about 55 μL, about 60 μL, about 65 μL, about 70 μL, about 75 μL, about 80 μL, about 85 μL, about 90 μL, about 100 μL, about 110 μL, about 120 μL, about 130 μL, about 140 μL, about 150 μL, about 160 μL, about 170 μL, about 180 μL, about 190 μL, about 200 μL, about 225 μL, about 250 μL, about 275 μL, about 300 μL, about 350 μL, about 400 μL, about 450 μL, about 500 μL, about 550 μL, about 600 μL, about 650 μL, about 700 μL, about 800 μL, about 850 μL, about 900 μL, about 950 μL, or about 1 mL. In some embodiments, the resuspending is performed with a wash buffer solution having a volume of about 100 μL to about 500 μL or about 100 μL to about 200 μL. In some embodiments, the volume is about 100 μL.

    [0259] In some embodiments of any of the preceding methods, the wash buffer solution further includes an amplification control nucleic acid. In some embodiments of any of the preceding methods, step (a) further includes adding a total process control (TPC) to the whole blood sample, e.g., an engineered cell including a control target nucleic acid.

    [0260] In another example, provided herein is a method for detecting a biothreat pathogen target nucleic acid in a whole blood sample, the method including the following steps: (a) providing an amplified lysate solution that has been produced by: (i) contacting a whole blood sample suspected of containing one or more pathogen cells with an erythrocyte lysis agent, thereby lysing red blood cells; (ii) centrifuging the product of step (a)(i) to form a supernatant and a pellet; (iii) discarding some or all of the supernatant of step (a)(ii) and resuspending the pellet to form an extract, optionally washing the pellet one or more times prior to resuspending the pellet; (iv) lysing the remaining cells in the extract of step (a)(iii) to form a lysate, the lysate containing both subject cell nucleic acid and pathogen nucleic acid; (v) amplifying pathogen nucleic acids in the lysate of step (a)(iv) to form an amplified lysate solution including an amplified biothreat pathogen target nucleic acid; and (b) sequencing the amplified biothreat pathogen target nucleic acid, thereby detecting the biothreat pathogen target nucleic acid in the sample.

    [0261] In a further example, provided herein is a method for determining the sequence of a biothreat pathogen target nucleic acid in a whole blood sample, the method including the following steps: (a) providing an amplified lysate solution that has been produced by: (i) contacting a whole blood sample suspected of containing one or more pathogen cells with an erythrocyte lysis agent, thereby lysing red blood cells; (ii) centrifuging the product of step (a)(i) to form a supernatant and a pellet; (iii) discarding some or all of the supernatant of step (a)(ii) and resuspending the pellet to form an extract, optionally washing the pellet one or more times prior to resuspending the pellet; (iv) lysing the remaining cells in the extract of step (a)(iii) to form a lysate, the lysate containing both subject cell nucleic acid and pathogen nucleic acid; (v) amplifying pathogen nucleic acids in the lysate of step (a)(iv) to form an amplified lysate solution including an amplified biothreat pathogen target nucleic acid; and (b) sequencing the amplified biothreat pathogen target nucleic acid, thereby determining the sequence of the biothreat pathogen target nucleic acid in the sample.

    [0262] In some embodiments of any of the preceding methods, step (a)(iii) includes washing the pellet one time prior to resuspending the pellet. In other embodiments, step (a)(iii) includes washing the pellet more than one time prior to resuspending the pellet, e.g., two, three, four, five, six, seven, eight, nine, or ten times.

    [0263] In some embodiments, the washing or resuspending is performed with a wash buffer solution (e.g., Tris-EDTA (TE) buffer). The wash buffer solution may have any suitable volume, e.g., about 25 μL to about 1 mL, e.g., about 25 μL, about 30 μL, about 35 μL, about 40 μL, about 45 μL, about 50 μL, about 55 μL, about 60 μL, about 65 μL, about 70 μL, about 75 μL, about 80 μL, about 85 μL, about 90 μL, about 100 μL, about 110 μL, about 120 μL, about 130 μL, about 140 μL, about 150 μL, about 160 μL, about 170 μL, about 180 μL, about 190 μL, about 200 μL, about 225 μL, about 250 μL, about 275 μL, about 300 μL, about 350 μL, about 400 μL, about 450 μL, about 500 μL, about 550 μL, about 600 μL, about 650 μL, about 700 μL, about 800 μL, about 850 μL, about 900 μL, about 950 μL, or about 1 mL. In some embodiments, the washing is performed with a wash buffer solution having a volume of about 100 μL to about 500 μL. In some embodiments, the washing is performed with a wash buffer solution having a volume of about 100 μL to about 200 μL. In some embodiments, the volume is about 150 μL.

    [0264] The resuspending of step (a)(iii) can be performed with a wash buffer solution having any suitable volume, e.g., about 25 μL to about 1 mL, e.g., about 25 μL, about 30 μL, about 35 μL, about 40 μL, about 45 μL, about 50 μL, about 55 μL, about 60 μL, about 65 μL, about 70 μL, about 75 μL, about 80 μL, about 85 μL, about 90 μL, about 100 μL, about 110 μL, about 120 μL, about 130 μL, about 140 μL, about 150 μL, about 160 μL, about 170 μL, about 180 μL, about 190 μL, about 200 μL, about 225 μL, about 250 μL, about 275 μL, about 300 μL, about 350 μL, about 400 μL, about 450 μL, about 500 μL, about 550 μL, about 600 μL, about 650 μL, about 700 μL, about 800 μL, about 850 μL, about 900 μL, about 950 μL, or about 1 mL. In some embodiments, the resuspending is performed with a wash buffer solution having a volume of about 100 μL to about 500 μL or about 100 μL to about 200 μL. In some embodiments, the volume is about 100 μL.

    [0265] In some embodiments of any of the preceding methods, the wash buffer solution further includes an amplification control nucleic acid. In some embodiments of any of the preceding methods, step (a)(i) further includes adding a total process control (TPC) to the whole blood sample, e.g., an engineered cell including a control target nucleic acid.

    [0266] In a still further example, provided herein is a method for detecting a biothreat pathogen target nucleic acid in a whole blood sample, the method including the following steps: (a) contacting a whole blood sample suspected of containing one or more pathogen cells with an erythrocyte lysis agent, thereby lysing red blood cells; (b) centrifuging the product of step (a) to form a supernatant and a pellet; (c) discarding some or all of the supernatant of step (b) and washing the pellet once; (d) centrifuging the product of step (c) to form a supernatant and a pellet; (e) discarding some or all of the supernatant of step (d) and mixing the pellet of (d) with a buffer solution; (f) combining the product of step (e) with beads to form a mixture and agitating the mixture to form a lysate, said lysate containing both subject cell nucleic acid and pathogen nucleic acid; (g) amplifying pathogen nucleic acids in the lysate of step (f) to form an amplified lysate solution including an amplified biothreat pathogen target nucleic acid; and (h) sequencing the amplified biothreat pathogen target nucleic acid, thereby detecting the biothreat pathogen target nucleic acid in the sample.

    [0267] In yet another example, provided herein is a method for determining the sequence of a biothreat pathogen target nucleic acid in a whole blood sample, the method including the following steps: (a) contacting a whole blood sample suspected of containing one or more pathogen cells with an erythrocyte lysis agent, thereby lysing red blood cells; (b) centrifuging the product of step (a) to form a supernatant and a pellet; (c) discarding some or all of the supernatant of step (b) and washing the pellet once; (d) centrifuging the product of step (c) to form a supernatant and a pellet; (e) discarding some or all of the supernatant of step (d) and mixing the pellet of (d) with a buffer solution; (f) combining the product of step (e) with beads to form a mixture and agitating the mixture to form a lysate, said lysate containing both subject cell nucleic acid and pathogen nucleic acid; (g) amplifying pathogen nucleic acids in the lysate of step (f) to form an amplified lysate solution including an amplified biothreat pathogen target nucleic acid; and (h) sequencing the amplified biothreat pathogen target nucleic acid, thereby determining the sequence of the biothreat pathogen target nucleic acid in the sample.

    [0268] In some embodiments of any of the preceding methods, the washing of step (c) is performed with a wash buffer solution (e.g., TE buffer). The wash buffer solution may have any suitable volume, e.g., about 25 μL to about 1 mL, e.g., about 25 μL, about 30 μL, about 35 μL, about 40 μL, about 45 μL, about 50 μL, about 55 μL, about 60 μL, about 65 μL, about 70 μL, about 75 μL, about 80 μL, about 85 μL, about 90 μL, about 100 μL, about 110 μL, about 120 μL, about 130 μL, about 140 μL, about 150 μL, about 160 μL, about 170 μL, about 180 μL, about 190 μL, about 200 μL, about 225 μL, about 250 μL, about 275 μL, about 300 μL, about 350 μL, about 400 μL, about 450 μL, about 500 μL, about 550 μL, about 600 μL, about 650 μL, about 700 μL, about 800 μL, about 850 μL, about 900 μL, about 950 μL, or about 1 mL. In some embodiments, the washing is performed with a wash buffer solution having a volume of about 100 μL to about 500 μL. In some embodiments, the washing is performed with a wash buffer solution having a volume of about 100 μL to about 200 μL. In some embodiments, the volume is about 150 μL.

    [0269] In some embodiments of any of the preceding methods, step (e) includes mixing the pellet with a buffer solution. The buffer solution (e.g., TE buffer) may have any suitable volume, e.g., about 25 μL to about 1 mL, e.g., about 25 μL, about 30 μL, about 35 μL, about 40 μL, about 45 μL, about 50 μL, about 55 μL, about 60 μL, about 65 μL, about 70 μL, about 75 μL, about 80 μL, about 85 μL, about 90 μL, about 100 μL, about 110 μL, about 120 μL, about 130 μL, about 140 μL, about 150 μL, about 160 μL, about 170 μL, about 180 μL, about 190 μL, about 200 μL, about 225 μL, about 250 μL, about 275 μL, about 300 μL, about 350 μL, about 400 μL, about 450 μL, about 500 μL, about 550 μL, about 600 μL, about 650 μL, about 700 μL, about 800 μL, about 850 μL, about 900 μL, about 950 μL, or about 1 mL. In some embodiments, the buffer solution has a volume of about 100 μL to about 200 μL. In some embodiments, the volume is about 100 μL.

    [0270] In some embodiments of any of the preceding methods, the buffer solution and/or the wash buffer solution further includes an amplification control nucleic acid. In some embodiments of any of the preceding methods, step (a) further includes adding a TPC to the whole blood sample, e.g., an engineered cell including a control target nucleic acid.

    [0271] In any of the method described herein, the lysate or the amplified lysate solution may contain a concentration of cells, cell debris, and/or non-target or subject-cell derived nucleic acids (e.g., DNA) relative to the original environmental or biological sample. As an example, 2 mL of a biological sample concentrated down to 0.1 mL in a lysate corresponds to a 20:1 higher concentration of debris compared to the original sample. If the lysate is diluted 1:1 for amplification, the amplification is performed in a lysate (e.g., an amplified lysate solution) that represents a 10:1 concentration of the debris in the original sample. In some embodiments of any of the preceding methods, the lysate or the amplified lysate solution has at least about a 1.5:1 higher concentration of subject cell DNA and/or cell debris relative to the whole blood sample, e.g., about 1.5:1. about 2:1, about 3:1, about 4:1, about 5:1, about 6:1, about 7:1, about 8:1, about 9:1, about 10:1, about 11:1, about 12:1, about 13:1, about 14:1, about 15:1, about 16:1, about 18:1, about 19:1, about 20:1, about 21:1, about 22:1, about 23:1, about 24:1, about 25:1, about 30:1, about 35:1, about 40:1, about 45:1, about 50:1, about 55:1, about 60:1, about 65:1, about 70:1, about 75:1, about 80:1, about 90:1, about 100:1, about 120:1, about 140:1, about 160:1, about 180:1, about 200:1, about 300:1, about 400:1, about 500:1, about 600:1, about 700:1, about 800:1, about 900:1, about 1000:1, or higher concentration of subject cell DNA and/or cell debris relative to the whole blood sample. In some embodiments, the lysate or the amplified lysate solution has about a 10:1 higher concentration of subject cell DNA and/or cell debris relative to the whole blood sample. In some embodiments, the lysate or the amplified lysate solution has a 20:1 higher concentration of subject cell DNA and/or cell debris relative to the whole blood sample. In some embodiments, the lysate has about a 20:1 higher concentration of subject cell DNA and/or cell debris relative to the whole blood sample. In some embodiments, the amplified lysate solution has about a 10:1 higher concentration of subject cell DNA and/or cell debris relative to the whole blood sample. In some embodiments, the cell debris is solid material (e.g., solid material that can be concentrated with a liquid-solid separation method (e.g., centrifugation or filtration)). In some embodiments, the lysate or the amplified lysate solution is a super-saturated solution of cell debris (e.g., solid material).

    [0272] In some embodiments of any of the methods described herein, an amplified drug resistance (e.g., antibiotic resistance) target nucleic acid is produced in the presence of at least 1 μg of subject DNA, e.g., at least 1 μg of subject DNA, at least 5 μg of subject DNA, at least 10 μg of subject DNA, at least 15 μg of subject DNA, at least 20 μg of subject DNA, at least 25 μg of subject DNA, at least 30 μg of subject DNA, at least 35 μg of subject DNA, at least 40 μg of subject DNA, at least 45 μg of subject DNA, at least 50 μg of subject DNA, at least 55 μg of subject DNA, at least 60 μg of subject DNA, at least 80 μg of subject DNA, at least 90 μg of subject DNA, at least 100 μg of subject DNA, or more. For example, in some embodiments, the amplifying is performed in the presence of from about 0.5 μg to about 100 μg or about 20 to about 80 μg of subject cell DNA. In some embodiments, the amplifying is performed in the presence of about 60 μg of subject cell DNA. In some embodiments, at least a portion of the subject DNA is from white blood cells of the subject.

    [0273] Any suitable amplification approach can be used. For example, in some embodiments, the amplifying includes polymerase chain reaction (PCR), ligase chain reaction (LCR), multiple displacement amplification (MDA), strand displacement amplification (SDA), rolling circle amplification (RCA), loop mediated isothermal amplification (LAMP), nucleic acid sequence based amplification (NASBA), helicase dependent amplification, recombinase polymerase amplification, nicking enzyme amplification reaction, or ramification amplification (RAM). In some embodiments, the amplifying includes PCR (e.g., symmetric PCR or asymmetric PCR).

    [0274] In some embodiments of any of the preceding methods, the amplifying includes the following steps: (i) adding to the lysate an amplification buffer solution including a buffering agent to form a reaction mixture; (ii) heating the reaction mixture to form a denatured reaction mixture; and (iii) adding a thermostable nucleic acid polymerase to the denatured reaction mixture under conditions and for a time sufficient for amplification of the target nucleic acid. The method can further include centrifuging the denatured reaction mixture to form a pellet and a supernatant prior to step (iii). In some embodiments, step (iii) includes adding the thermostable nucleic acid polymerase to the supernatant.

    [0275] In other embodiments of any of the preceding methods, the amplifying includes the following steps: (i) adding to the lysate an amplification buffer solution including a buffering agent and a thermostable nucleic acid polymerase to form a reaction mixture under conditions and for a time sufficient for amplification of the target nucleic acid; (ii) heating the reaction mixture to form a denatured reaction mixture; and (iii) centrifuging the denatured reaction mixture to form a pellet and a supernatant. In some embodiments, the final concentration of the thermostable nucleic acid polymerase in step (i) is at least about 0.02 units per microliter of the reaction mixture. In some embodiments, step (i) comprises adding at least about 2.4×10.sup.−5 micrograms of a thermostable nucleic acid polymerase per microliter of reaction mixture.

    [0276] In some embodiments of any of the preceding methods, the amplification buffer solution has a moderately alkaline pH at ambient temperature. In some embodiments of any of the preceding methods, the moderately alkaline pH at ambient temperature is from about pH 7.1 to about pH 11.5 or higher (e.g., about pH 7.1, about pH 7.2, about pH 7.3, about pH 7.4, about pH 7.5, about pH 7.6, about pH 7.7, about pH 7.8, about pH 7.9, about pH 8.0, about pH 8.1, about pH 8.2, about pH 8.3, about pH 8.4, about pH 8.5, about pH 8.6, about pH 8.7, about pH 8.8, about pH 8.9, about pH 9.0, about pH 9.1, about pH 9.2, about pH 9.3, about pH 9.4, about pH 9.5, about pH 9.6, about pH 9.7, about pH 9.8, about pH 9.9, about pH 10.0, about pH 10.1, about pH 10.2, about pH 10.3, about pH 10.4, about pH 10.5, about pH 10.6, about pH 10.7, about pH 10.8, about pH 10.9, about pH 11, about pH 11.1, about pH 11.2, about pH 11.3, about pH 11.3, about pH 11.4, about pH 11.5, or higher. In some embodiments, the moderately alkaline pH at ambient temperature is from about pH 7.1 to about pH 11.5, about pH 7.1 to about pH 11.0, about pH 7.1 to about pH 10.5, about pH 7.1 to about pH 10.0, about pH 7.1 to about pH 9.5, about pH 7.1 to about pH 9.0, about pH 7.1 to about pH 8.5, about pH 7.1 to about pH 8, about pH 7.1 to about pH 7.5, about pH 7.5 to about pH 11.5, about pH 7.5 to about pH 11.0, about pH 7.5 to about pH 10.5, about pH 7.5 to about pH 10.0, about pH 7.5 to about pH 9.5, about pH 7.5 to about pH 9.0, about pH 7.5 to about pH 8.5, about pH 7.5 to about pH 8.0, about pH 8.0 to about pH 11.5, about pH 8.0 to about pH 11.0, about pH 8.0 to about pH 10.5, about pH 8.0 to about pH 10.0, about pH 8.0 to about pH 9.5, about pH 8.0 to about pH 9.0, about pH 8.0 to about pH 9.0, about pH 8.0 to about pH 8.5, about pH 8.5 to about pH 11.5, about pH 8.5 to about pH 11.0, about pH 8.5 to about pH 10.0, about pH 8.5 to about pH 9.5, about pH 8.5 to about pH 9.0, about pH 9.0 to about pH 11.5, about pH 9.0 to about pH 11.0, about pH 9.0 to about pH 10.5, about pH 9.0 to about pH 10.0, about pH 9.0 to about pH 9.5, about pH 9.5 to about pH 11.5, about pH 9.5 to about pH 11.0, about pH 9.5 to about pH 10.5, or about pH 9.5 to about pH 10.0. In some embodiments, the moderately alkaline pH at ambient temperature is about pH 8.7. In some embodiments, ambient temperature is about 25° C. (e.g., about 20° C., about 21° C., about 22° C., about 23° C., about 24° C., about 25° C., about 26° C., about 27° C., about 28° C., about 29° C., about 30° C.). In some embodiments, ambient temperature is about 20° C. to about 30° C., about 20° C. to about 29° C., about 20° C. to about 28° C., about 20° C. to about 27° C., about 20° C. to about 26° C., about 20° C. to about 25° C., about 20° C. to about 24° C., about 20° C. to about 23° C., about 20° C. to about 22° C., about 20° C. to about 21° C., about 22° C. to about 30° C., about 22° C. to about 29° C., about 22° C. to about 28° C., about 22° C. to about 27° C., about 22° C. to about 26° C., about 22° C. to about 25° C., about 22° C. to about 24° C., about 22° C. to about 23° C., about 24° C. to about 30° C., about 24° C. to about 29° C., about 24° C. to about 28° C., about 24° C. to about 27° C., about 24° C. to about 26° C., or about 24° C. to about 25° C.

    [0277] In some embodiments of any of the preceding methods, the pH of the buffer solution remains approximately at or above a neutral pH at 95° C. In some embodiments, the pH of the buffer solution is about pH 6.5 to about pH 10 (e.g., about pH 6.5, about pH 6.6, about pH 6.7, about pH 6.8, about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, about pH 7.4, about pH 7.5, about pH 7.6, about pH 7.7, about pH 7.8, about pH 7.9, about pH 8.0, about pH 8.1, about pH 8.2, about pH 8.3, about pH 8.4, about pH 8.5, about pH 8.6, about pH 8.7, about pH 8.8, about pH 8.9, about pH 9.0, about pH 9.1, about pH 9.2, about pH 9.3, about pH 9.4, about pH 9.5, about pH 9.6, about pH 9.7, about pH 9.8, about pH 9.9, or about pH 10.0) at 95° C. For example, in some embodiments, the pH of the buffer solution at 95° C. is from about pH 6.5 to about pH 10.0, about pH 6.5 to about pH 9.5, about pH 6.5 to about pH 9.0, about pH 6.5 to about pH 8.5, about pH 6.5 to about pH 8.0, about pH 6.5 to about pH 7.5, about pH 7.0 to about pH 10.0, about pH 7.0 to about pH 9.5, about pH 7.0 to about pH 9.0, about pH 7.0 to about pH 8.5, about pH 7.0 to about pH 8.0, about pH 7.0 to about pH 7.5, about pH 7.5 to about pH 10.0, about pH 7.5 to about pH 9.5, about pH 7.5 to about pH 9.0, about pH 7.5 to about pH 8.5, about pH 7.5 to about pH 8.0, about pH 8.0 to about pH 10.0, about pH 8.0 to about pH 9.5, about pH 8.0 to about pH 9.0, about pH 8.0 to about pH 8.5, about pH 8.5 to about pH 10.0, about pH 8.5 to about pH 9.5, about pH 8.5 to about pH 9.0, about pH 9.0 to about pH 10.0, or about pH 9.5 to about pH 10.0. For example, in some embodiments, the pH of the buffer solution is about 6.5 to about 9.0, about 7.0 to about 8.5, or about 7.0 to about 7.5 at 95° C. In some embodiments, the pH of the buffer solution is about 7.2 at 95° C.

    [0278] In some embodiments of any of the preceding methods, the final concentration of the thermostable nucleic acid polymerase in step (iii) is at least about 0.01 units (e.g., about 0.01 units, about 0.02 units, about 0.03 units, about 0.04 units, about 0.05 units, about 0.06 units, about 0.07 units, about 0.08 units, about 0.09 units, about 0.10 units, about 0.15 units about 0.2 units, about 0.25 units, about 0.3 units, about 0.35 units, about 0.4 units, about 0.45 units, about 0.5 units, about 0.6 units, about 0.65 units, about 0.7 units, about 0.8 units, about 0.9 units, about 1 unit, or more) per microliter of the denatured reaction mixture. In some embodiments, the final concentration of the thermostable nucleic acid polymerase may range from about 0.01 units to about 1 unit (e.g., about 0.01 units to about 1 unit, about 0.01 units to about 0.9 units, about 0.01 units to about 0.8 units, about 0.01 units to about 0.7 units, about 0.01 units to about 0.6 units, about 0.01 units to about 0.5 units, about 0.01 units to about 0.4 units, about 0.01 units to about 0.3 units, about 0.01 units to about 0.25 units, about 0.01 units to about 0.2 units, about 0.01 units to about 0.1 unit, about 0.02 units to about 1 unit, about 0.02 units to about 0.9 units, about 0.02 units to about 0.8 units, about 0.02 units to about 0.7 units, about 0.02 units to about 0.6 units, about 0.02 units to about 0.5 units, about 0.02 units to about 0.4 units, about 0.02 units to about 0.3 units, about 0.02 units to about 0.25 units, about 0.02 units to about 0.2 units, about 0.02 units to about 0.1 units, about 0.04 units to about 1 unit, about 0.04 unit to about 0.9 units, about 0.04 units to about 0.8 units, about 0.04 units to about 0.7 units, about 0.04 units to about 0.6 units, about 0.04 units to about 0.5 units, about 0.04 units to about 0.4 units, about 0.04 units to about 0.3 units, about 0.04 units to about 0.25 units, about 0.04 units to about 0.2 units, about 0.04 units to about 0.1 units, about 0.06 units to about 1 unit, about 0.06 units to about 0.9 units, about 0.06 units to about 0.8 units, about 0.06 units to about 0.7 units, about 0.06 units to about 0.6 units, about 0.06 units to about 0.5 units, about 0.06 units to about 0.4 units, about 0.06 units to about 0.3 units, about 0.06 units to about 0.25 units, about 0.06 units to about 0.2 units, about 0.06 units to about 0.1 units, about 0.08 units to about 1 unit, about 0.08 units to about 0.9 units, about 0.08 units to about 0.8 units, about 0.08 units to about 0.7 units, about 0.08 units to about 0.6 units, about 0.08 units to about 0.5 units, about 0.08 units to about 0.4 units, about 0.08 units to about 0.3 units, about 0.08 units to about 0.25 units, about 0.08 units to about 0.2 units, about 0.08 units to about 0.1 units, about 0.1 units to about 1 unit, about 0.1 units to about 0.9 units, about 0.1 units to about 0.8 units, about 0.1 units to about 0.7 units, about 0.1 units to about 0.6 units, about 0.1 units to about 0.5 units, about 0.1 units to about 0.4 units, about 0.1 units to about 0.3 units, about 0.1 units to about 0.25 units, about 0.1 units to about 0.2 units, about 0.2 units to about 1 unit, about 0.2 units to about 0.9 units, about 0.2 units to about 0.8 units, about 0.2 units to about 0.7 units, about 0.2 units to about 0.6 units, about 0.2 units to about 0.5 units, about 0.2 units to about 0.4 units, about 0.2 units to about 0.3 units, about 0.2 units to about 0.25 units, about 0.3 units to about 1 unit, about 0.3 units to about 0.9 units, about 0.3 units to about 0.8 units, about 0.3 units to about 0.7 units, about 0.3 units to about 0.6 units, about 0.3 units to about 0.5 units, about 0.3 units to about 0.4 units, about 0.4 units to about 1 unit, about 0.4 units to about 0.9 units, about 0.4 units to about 0.8 units, about 0.4 units to about 0.7 units, about 0.4 units to about 0.6 units, about 0.4 units to about 0.5 units, about 0.5 units to about 1 unit, about 0.5 units to about 0.9 units, about 0.5 units to about 0.8 units, about 0.5 units to about 0.7 units, about 0.5 units to about 0.6 units, about 0.6 units to about 1 unit, about 0.6 units to about 0.9 units, about 0.6 units to about 0.8 units, about 0.6 units to about 0.7 units, about 0.6 units to about 0.6 units, about 0.7 units to about 1 unit, about 0.7 units to about 0.9 units, about 0.7 units to about 0.8 units, about 0.8 units to about 1 unit, or about 0.8 units to about 0.9 units) per microliter of the mixture. In some embodiments, the final concentration of the thermostable nucleic acid polymerase ranges from about 0.125 to about 0.5 units/μL. In some embodiments, the final concentration of the thermostable nucleic acid ranges from about 0.125 to about 0.25 units/μL.

    [0279] In some embodiments of any of the preceding methods, step (iii) includes adding to the denatured reaction mixture at least about 1×10.sup.−5 micrograms (e.g., about 1×10.sup.−5 micrograms, about 1.5×10.sup.−5 micrograms, about 2×10.sup.−5 micrograms, about 2.4×10.sup.−5 micrograms, about 2.5×10.sup.−5 micrograms, about 3×10.sup.−5 micrograms, about 4×10.sup.−5 micrograms, about 5×10.sup.−5 micrograms, about 6×10.sup.−5 micrograms, about 7×10.sup.−5 micrograms, about 8×10.sup.−5 micrograms, about 9×10.sup.−5 micrograms, about 1×10.sup.−4 micrograms, about 2×10.sup.−4 micrograms, about 3×10.sup.−4 micrograms, about 4×10.sup.−4 micrograms, about 5×10.sup.−4 micrograms, about 6×10.sup.−4 micrograms, about 7×10.sup.−4 micrograms, about 8×10.sup.−4 micrograms, about 9×10.sup.−4 micrograms, about 1×10.sup.−3 micrograms, about 2×10.sup.−3 micrograms, 3×10.sup.−3 micrograms, about 4×10.sup.−3 micrograms, about 5×10.sup.−3 micrograms, about 6×10.sup.−3 micrograms, about 7×10.sup.−3 micrograms, about 8×10.sup.−3 micrograms, about 9×10.sup.−3 micrograms, about 0.01 micrograms, about 0.02 micrograms, about 0.03 micrograms, about 0.04 micrograms, about 0.05 micrograms, or more) of a thermostable nucleic acid polymerase per microliter of denatured reaction mixture. For example, In some embodiments of any of the preceding methods, the mixture includes from about 1×10.sup.−5 micrograms to about 0.05 micrograms (e.g., about 1×10.sup.−5 micrograms to about 0.05 micrograms, about 1×10.sup.−5 micrograms to about 0.025 micrograms, about 1×10.sup.−5 micrograms to about 0.01 micrograms, about 1×10.sup.−5 micrograms to about 0.0075 micrograms, about 1×10.sup.−5 micrograms to about 0.005 micrograms, about 1×10.sup.−5 micrograms to about 0.0025 micrograms, about 1×10.sup.−5 micrograms to about 0.001 micrograms, about 1×10.sup.−5 micrograms to about 1×10.sup.−4 micrograms, about 2×10.sup.−5 micrograms to about 0.05 micrograms, about 2×10.sup.−5 micrograms to about 0.025 micrograms, about 2×10.sup.−5 micrograms to about 0.01 micrograms, about 2×10.sup.−5 micrograms to about 0.0075 micrograms, about 2×10.sup.−5 micrograms to about 0.005 micrograms, about 2×10.sup.−5 micrograms to about 0.0025 micrograms, about 2×10.sup.−5 micrograms to about 0.001 micrograms, about 2×10.sup.−5 micrograms to about 1×10.sup.−4 micrograms, about 2.4×10.sup.−5 micrograms to about 0.05 micrograms, about 2.4×10.sup.−5 micrograms to about 0.025 micrograms, about 2.4×10.sup.−5 micrograms to about 0.01 micrograms, about 2.4×10.sup.−5 micrograms to about 0.0075 micrograms, about 2.4×10.sup.−5 micrograms to about 0.005 micrograms, about 2.4×10.sup.−5 micrograms to about 0.0025 micrograms, about 2.4×10.sup.−5 micrograms to about 0.001 micrograms, about 2.4×10.sup.−5 micrograms to about 1×10.sup.−4 micrograms, about 5×10.sup.−5 micrograms to about 0.05 micrograms, about 5×10.sup.−5 micrograms to about 0.025 micrograms, about 5×10.sup.−5 micrograms to about 0.01 micrograms, about 5×10.sup.−5 micrograms to about 0.0075 micrograms, about 5×10.sup.−5 micrograms to about 0.005 micrograms, about 5×10.sup.−5 micrograms to about 0.0025 micrograms, about 5×10.sup.−5 micrograms to about 0.001 micrograms, about 5×10.sup.−5 micrograms to about 1×10.sup.−4 micrograms, about 8×10.sup.−5 micrograms to about 0.05 micrograms, about 8×10.sup.−5 micrograms to about 0.025 micrograms, about 8×10.sup.−5 micrograms to about 0.01 micrograms, about 8×10.sup.−5 micrograms to about 0.0075 micrograms, about 8×10.sup.−5 micrograms to about 0.005 micrograms, about 8×10.sup.−5 micrograms to about 0.0025 micrograms, about 8×10.sup.−5 micrograms to about 0.001 micrograms, about 8×10.sup.−5 micrograms to about 1×10.sup.−4 micrograms, about 1×10.sup.−4 micrograms to about 0.05 micrograms, about 1×10.sup.−4 micrograms to about 0.025 micrograms, about 1×10.sup.−4 micrograms to about 0.01 micrograms, about 1×10.sup.−4 micrograms to about 0.0075 micrograms, about 1×10.sup.−4 micrograms to about 0.005 micrograms, about 1×10.sup.−4 micrograms to about 0.0025 micrograms, about 1×10.sup.−4 micrograms to about 0.001 micrograms, about 5×10.sup.−4 micrograms to about 0.05 micrograms, about 5×10.sup.−4 micrograms to about 0.025 micrograms, about 5×10.sup.−4 micrograms to about 0.01 micrograms, about 5×10.sup.−4 micrograms to about 0.0075 micrograms, about 5×10.sup.−4 micrograms to about 0.005 micrograms, about 5×10.sup.−4 micrograms to about 0.0025 micrograms, about 5×10.sup.−4 micrograms to about 0.001 micrograms, about 1×10.sup.−3 micrograms to about 0.05 micrograms, about 1×10.sup.−3 micrograms to about 0.025 micrograms, about 1×10.sup.−3 micrograms to about 0.01 micrograms, about 1×10.sup.−3 micrograms to about 0.0075 micrograms, about 1×10.sup.−3 micrograms to about 0.005 micrograms, or about 1×10.sup.−3 micrograms to about 0.0025 micrograms) of the thermostable nucleic acid polymerase per microliter of the mixture. In some embodiments, the final concentration of thermostable nucleic acid polymerase is from about 2.4×10.sup.−5 micrograms to about 0.01 micrograms per microliter of denatured reaction mixture or reaction mixture. In some embodiments, the final concentration of thermostable nucleic acid polymerase is from about 2.4×10.sup.−5 micrograms to about 0.0001 micrograms per microliter of denatured reaction mixture or reaction mixture.

    [0280] In some embodiments of any of the preceding methods, step (ii) may include heating the reaction mixture to greater than about 55° C., e.g., 55° C., 60° C., 65° C., 70° C., 75° C., 80° C., 81° C., 82° C., 83° C., 84° C., 85° C., 86° C., 87° C., 88° C., 89° C., 90° C., 91° C., 92° C., 93° C., 94° C., 95° C., 96° C., 97° C., 98° C., 99° C., or 100° C. In some embodiments, the temperature is about 95° C.

    [0281] In some embodiments of any of the methods described herein, the thermostable nucleic acid polymerase is a thermostable DNA polymerase. Any suitable thermostable DNA polymerase may be used in the methods of the invention, for example, commercially available thermostable DNA polymerases, or any thermostable DNA polymerase described herein and/or known in the art. In some embodiments, the thermostable DNA polymerase is a wild-type thermostable DNA polymerase, e.g., Thermus aquaticus (Taq) DNA polymerase (see, e.g., U.S. Pat. No. 4,889,818), Thermus thermophilus (Tth) DNA polymerase (see, e.g., U.S. Pat. Nos. 5,192,674; 5,242,818; and 5,413,926), Thermus filiformis (Tfi) DNA polymerase, Thermus flavus (Tfl) DNA polymerase, Thermococcus litoralis (Tli) DNA polymerase (see, e.g., U.S. Pat. No. 5,332,785), Thermatoga maritima (Tma) DNA polymerase, Thermus spp. Z05 DNA polymerase, Tsp spsl7 DNA polymerase derived from Thermus species spsl 7, now called Thermus oshimai (see, e.g., U.S. Pat. No. 5,405,774), Bacillus stearothermophilus (Bst) DNA polymerase (see, e.g., U.S. Pat. No. 5,747,298), an archaeal polymerase (e.g., thermostable DNA polymerases from hyperthermophylic archaeons Pyrococcus furiosus (e.g., Pfu; see, e.g., U.S. Pat. No. 5,948,663), KOD DNA polymerase derived from Pyrococcus sp. KOD1 (e.g., U.S. Pat. No. 6,033,859), Thermococcus litoralis (e.g., VENTR® (NEB)), and 9° N™ (NEB)), or a mutant, derivative, or fragment thereof having DNA polymerase activity (e.g., mutant DNA polymerases that include point mutations compared to a reference thermostable DNA polymerase sequence, e.g., Taq A271 F667Y, Tth A273 F668Y, and Taq A271 F667Y E681W; truncation mutants, e.g., KIenTAQ®, an N-terminal deletion variant of Taq lacking the first 280 amino acids; and mutants that include truncations and point mutations, e.g., Hemo KlenTaq®, an N-terminal deletion variant of Taq lacking the first 280 amino acids containing three internal point mutations that make it resistant to inhibitors in whole blood). For example, suitable DNA polymerases include, but are not limited to, Taq, Hemo KlenTaq®, Hawk Z05, APTATAQ™, Pfu, VENTR®, or higher fidelity DNA polymerases such as PHUSION® (Thermo Scientific), Q5® (NEB), KAPA HiFi™ (Roche), PfuUltra (Agilent), KOD XTREME™ (Millipore), HotStar HiFidelity (Qiagen), ACCUPRIME™ Pfx (Invitrogen), and PLATINUM™ Taq (Invitrogen).

    [0282] In some embodiments, the thermostable DNA polymerase is a mutant thermostable DNA polymerase. In some embodiments, the mutant thermostable DNA polymerase is listed in Table B. In some embodiments, the mutant thermostable DNA polymerase is selected from the group consisting of Klentaq®1, Klentaq® LA, Cesium Klentaq® AC, Cesium Klentaq® AC LA, Cesium Klentaq® C, Cesium Klentaq® C LA, Omni Klentaq®, Omni Klentaq® 2, Omni Klentaq® LA, Omni Taq, OmniTaq LA, Omni Taq 2, Omni Taq 3, Hemo KlenTaq®, KAPA Blood DNA polymerase, KAPA3G Plant DNA polymerase, KAPA 3G Robust DNA polymerase, MyTaq™ Blood, PHUSION® Blood II DNA polymerase, AmpliTaq® (Taq G46D), AmpliTaq® Gold, RealTaq, ExcelTaq™, and BioReady Taq. In some embodiments, the thermostable DNA polymerase is a hot start thermostable DNA polymerase (e.g., APTATAQ™, Hawk Z05, or PHUSION® Blood II DNA polymerase).

    [0283] In some embodiments, the thermostable nucleic acid polymerase (e.g., thermostable DNA polymerase) is inhibited by the presence of subject-derived cells or cell debris under normal reaction conditions. In some embodiments, the thermostable nucleic acid polymerase (e.g., thermostable DNA polymerase) is inhibited by whole blood under normal reaction conditions. In some embodiments, the thermostable nucleic acid polymerase (e.g., thermostable DNA polymerase) is inhibited by 1% (v/v) whole blood under normal reaction conditions. In some embodiments, the thermostable nucleic acid polymerase (e.g., thermostable DNA polymerase) is inhibited by 8% (v/v) whole blood under normal reaction conditions. In some embodiments, the normal reaction conditions are the reaction conditions recommended by the manufacturer of the thermostable DNA polymerase or reaction conditions that are commonly used in the art.

    [0284] In some embodiments of any of the preceding methods, the method further includes amplifying one or more additional target nucleic acids in a multiplexed PCR reaction to generate one or more additional amplicons. In some embodiments, the multiplexed PCR reaction amplifies 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, 35, 40, 45, 50, 60, or more target nucleic acids.

    [0285] In some embodiments of any of the preceding methods, the method further includes adding deoxynucleotide triphosphates (dNTPs), magnesium, one or more forward primers (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 forward primers), and/or one or more reverse primers (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 reverse primers) during step (i) or during step (iii).

    [0286] In some embodiments of any of the preceding methods, the whole blood sample is about 0.2 mL to about 5 mL (e.g., about 0.2 mL, about 0.3 mL, about 0.4 mL, about 0.5 mL, about 0.6 mL, about 0.7 mL, about 0.8 mL, about 0.9 mL, about 1 mL, about 1.1 mL, about 1.2 mL, about 1.3 mL, about 1.4 mL, about 1.5 mL, about 1.6 mL, about 1.7 mL, about 1.8 mL, about 1.9 mL, about 2 mL, about 2.5 mL, about 3 mL, about 3.5 mL, about 4 mL, about 5 mL).

    [0287] The invention allows use of a concentrated lysate prepared from a larger volume of whole blood.

    [0288] In some embodiments, a lysate produced from a whole blood sample of about 0.2 mL to about 10 mL has a volume of about 10 μL to about 1000 μL (e.g., about 10 μL, about 20 μL about 30 μL, about 40 μL, about 50 μL, about 60 μL, about 70 μL, about 80 μL, about 90 μL, about 100 μL, about 125 μL, about 150 μL, about 175 μL, about 200 μL, about 225 μL, about 250 μL, about 275 μL, about 300 μL, about 325 μL, about 350 μL, about 375 μL, about 400 μL, about 425 μL, about 450 μL, about 475 μL, about 500 μL, about 525 μL, about 550 μL, about 600 μL, about 625 μL, about 650 μL, about 675 μL, about 700 μL, about 725 μL, about 750 μL, about 775 μL, about 800 μL, about 825 μL, about 850 μL, about 875 μL, about 900 μL, about 925 μL, about 950 μL, about 975 μL, or about 1000 μL). In some embodiments, the lysate produced from the whole blood sample has a volume of about 25 μL to about 200 μL. In some embodiments, the lysate produced from the whole blood sample has a volume of about 50 μL. In some embodiments, the lysate is concentrated at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, or more compared to the whole blood sample.

    [0289] In some embodiments, the reaction mixture of step (i) contains about 1% to about 80% lysate (e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, or about 80% crude blood lysate In some embodiments, the reaction mixture of step (i) contains about 50% lysate.

    [0290] In some embodiments of any of the preceding methods, the denatured reaction mixture has a volume ranging from about 0.1 μL to about 250 μL or more, e.g., about 1 μL, about 10 μL, about 20 μL, about 30 μL, about 40 μL, about 50 μL, about 50 μL, about 60 μL, about 70 μL, about 80 μL, about 90 μL, about 100 μL, about 110 μL, about 120 μL, about 130 μL, about 140 μL, about 150 μL, about 160 μL, about 170 μL, about 180 μL, about 190 μL, about 200 μL, or more. In some embodiments, the volume of the denatured reaction mixture is about 100 μL.

    [0291] In some embodiments of any of the preceding methods, the method does not include extracting or purifying the amplified biothreat pathogen target nucleic acid prior to the sequencing. In some embodiments, the extracting includes chloroform or phenol/chloroform extraction, nuclease digestion, salting out, ion exchange extraction, binding to silica or other solid phase materials, or gel extraction.

    [0292] In some embodiments of any of the preceding methods, the method further includes cleaning up the amplified drug resistance (e.g., antibiotic resistance) target nucleic acid prior to the sequencing. In some embodiments, the cleaning up includes magnetic bead purification, enzymatic clean-up, or column clean-up. In other embodiments, no clean-up step is performed.

    [0293] Any suitable sequencing approach can be used in the methods described herein. For example, in some embodiments, the sequencing includes massively parallel sequencing (e.g., sequencing by synthesis (e.g., ILLUMINA™ dye sequencing, ion semiconductor sequencing, or pyrosequencing) or sequencing by ligation (e.g., oligonucleotide ligation and detection (SOLiD™) sequencing or polony-based sequencing)), single molecule sequencing (e.g., Helicos™ sequencing, single-molecule real-time (SMRT™) sequencing, and nanopore sequencing) and Sanger sequencing.

    [0294] In some embodiments of any of the preceding methods, the method further includes amplifying one or more additional target nucleic acids in a multiplexed amplification (e.g., multiplexed PCR) reaction to generate one or more additional amplicons. Such additional target nucleic acids can be used, for example, to detect members of any of the panels described herein.

    [0295] In some embodiments of any of the preceding methods, the method identifies the genus from which the biothreat pathogen target nucleic acid is derived. In some embodiments of any of the preceding methods, the method identifies the species of the pathogen from which the biothreat pathogen target nucleic acid is derived.

    [0296] Any of the methods described above may include detecting the amplified biothreat pathogen target nucleic acid using T2 magnetic resonance (T2MR). The detecting by T2MR can occur prior to, after, or concurrent with the sequencing. In particular embodiments, the detecting by T2MR occurs prior to the sequencing. For example, in some embodiments, the method includes the following steps: (i) adding magnetic particles to a portion of the amplified solution or amplified lysate solution to form a detection mixture, wherein the magnetic particles have binding moieties on their surface, the binding moieties operative to alter aggregation of the magnetic particles in the presence of the amplified target nucleic acid, and (ii) detecting the presence of the amplified target nucleic acid by measuring the aggregation of the magnetic particles using T2MR. In some embodiments, step (ii) includes the following steps: (a) providing the detection mixture in a detection tube within a device, the device including a support defining a well for holding the detection tube including the mixture, and having an RF coil configured to detect a signal produced by exposing the mixture to a bias magnetic field created using one or more magnets and an RF pulse sequence; (b) exposing the detection mixture to a bias magnetic field and an RF pulse sequence; (c) following step (b), measuring the signal from the detection tube; and (d) on the basis of the result of step (c), detecting the amplified target nucleic acid.

    [0297] The magnetic particles may be any of the magnetic particles described herein or in International Patent Application Publication Nos. WO 2012/054639, WO 2016/118766, WO 2017/127731, or in International Patent Application No. PCT/US2018/033278, each of which is incorporated herein by reference in its entirety. In some embodiments, the magnetic particles include a first population of magnetic particles conjugated to a first probe, and a second population of magnetic particles conjugated to a second probe, the first probe operative to bind to a first segment of the amplified target nucleic acid and the second probe operative to bind to a second segment of the amplified target nucleic acid, wherein the magnetic particles form aggregates in the presence of the amplified target nucleic acid. The magnetic particles may be substantially monodisperse.

    [0298] In some embodiments: (i) a probe pair comprising a 5′ probe comprising the nucleotide sequence CCGCTATCCGCCTTTCTACCAG (SEQ ID NO: 13) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 13 and a 3′ probe comprising the nucleotide sequence GTATCCACCCTCACTCTTCCATTTTC (SEQ ID NO: 14) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 14 is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid; (ii) a probe pair comprising a 5′ probe comprising the nucleotide sequence CATTTGCTTGAATCATTTTATTTTGGAAG (SEQ ID NO: 15) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 15 and a 3′ probe comprising the nucleotide sequence TTAATCGGTTGCTCCTCGTCAGTA (SEQ ID NO: 16) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 16 is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid; (iii) a probe pair comprising a 5′ probe comprising the nucleotide sequence AACCTTCTGGAGCCTGCCATT (SEQ ID NO: 17) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 17 and a 3′ probe comprising the nucleotide sequence GCAGCAGCAGTATCTTTAGCTGA (SEQ ID NO: 18) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 18 is used for detection of the target nucleic acid characteristic of Francisella tularensis; (iv) a probe pair comprising a 5′ probe comprising the nucleotide sequence TCGCCGCGGTAAAGAACCGTAC (SEQ ID NO: 19) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 19 and a 3′ probe comprising the nucleotide sequence GACCGTCAGGGCCGCACG (SEQ ID NO: 20) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 20 is used for detection of the target nucleic acid characteristic of Burkholderia spp.; (v) a probe pair comprising a 5′ probe comprising the nucleotide sequence AAATACCGGCAGCATCTCCG (SEQ ID NO: 21) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 21 and a 3′ probe comprising the nucleotide sequence GGTTAATTACGGTACCATAATAACGTG (SEQ ID NO: 22) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 22 is used for detection of the target nucleic acid characteristic of Yersinia pestis; and/or (vi) a probe pair comprising a 5′ probe comprising the nucleotide sequence GCATCAAACTCAATAATTATAGCTTTAGTACC (SEQ ID NO: 23) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 23 and a 3′ probe comprising the nucleotide sequence CGGACGCAAAACTCAATAACACCATAC (SEQ ID NO: 24) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 24 is used for detection of the target nucleic acid characteristic of Rickettsia prowazekii.

    [0299] For example, in some embodiments: (i) a probe pair comprising a 5′ probe comprising the nucleotide sequence CCGCTATCCGCCTTTCTACCAG (SEQ ID NO: 13) and a 3′ probe comprising the nucleotide sequence GTATCCACCCTCACTCTTCCATTTTC (SEQ ID NO: 14) is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX01 plasmid; (ii) a probe pair comprising a 5′ probe comprising the nucleotide sequence CATTTGCTTGAATCATTTTATTTTGGAAG (SEQ ID NO: 15) and a 3′ probe comprising the nucleotide sequence TTAATCGGTTGCTCCTCGTCAGTA (SEQ ID NO: 16) is used for detection of the target nucleic acid characteristic of Bacillus anthracis pX02 plasmid; (iii) a probe pair comprising a 5′ probe comprising the nucleotide sequence AACCTTCTGGAGCCTGCCATT (SEQ ID NO: 17) and a 3′ probe comprising the nucleotide sequence GCAGCAGCAGTATCTTTAGCTGA (SEQ ID NO: 18) is used for detection of the target nucleic acid characteristic of Francisella tularensis; (iv) a probe pair comprising a 5′ probe comprising the nucleotide sequence TCGCCGCGGTAAAGAACCGTAC (SEQ ID NO: 19) and a 3′ probe comprising the nucleotide sequence GACCGTCAGGGCCGCACG (SEQ ID NO: 20) is used for detection of the target nucleic acid characteristic of Burkholderia spp.; (v) a probe pair comprising a 5′ probe comprising the nucleotide sequence AAATACCGGCAGCATCTCCG (SEQ ID NO: 21) and a 3′ probe comprising the nucleotide sequence GGTTAATTACGGTACCATAATAACGTG (SEQ ID NO: 22) is used for detection of the target nucleic acid characteristic of Yersinia pestis; and/or (vi) a probe pair comprising a 5′ probe comprising the nucleotide sequence GCATCAAACTCAATAATTATAGCTTTAGTACC (SEQ ID NO: 23) and a 3′ probe comprising the nucleotide sequence CGGACGCAAAACTCAATAACACCATAC (SEQ ID NO: 24) is used for detection of the target nucleic acid characteristic of Rickettsia prowazekii.

    [0300] The magnetic particles may have any suitable size, for example, any size described below, or in International Patent Application Publication Nos. WO 2012/054639, WO 2016/118766, WO 2017/127731, or in International Patent Application No. PCT/US2018/033278. In some embodiments, the magnetic particles have a mean diameter of from 650 nm to 950 nm. In some embodiments, the magnetic particles have a mean diameter of from about 670 nm to about 890 nm.

    [0301] The magnetic particles may have any T.sub.2 relaxivity per particle, for example, T.sub.2 relaxivity per particle described below. In some embodiments, the magnetic particles have a T.sub.2 relaxivity per particle of from 1×10.sup.9 to 1×10.sup.12 mM.sup.−1s.sup.−1.

    [0302] Any suitable amount of magnetic particles can be added to the sample, for example, any amount described below. In some embodiments, from 1×10.sup.6 to 1×10.sup.13 magnetic particles are added per milliliter of the sample or the amplified solution.

    [0303] In another example, provided herein is a method for detecting a biothreat pathogen target nucleic acid in a biological sample obtained from a subject, wherein the biological sample includes subject-derived cells or cell debris, the method including the following steps: (a) amplifying a target nucleic acid in the biological sample to form an amplified solution including an amplified target nucleic acid; (b) detecting the amplified target nucleic acid using T2MR to provide a group-level identification of the target nucleic acid; and (c) sequencing the amplified target nucleic acid to provide a species-level or variant-level identification of the target nucleic acid, wherein the method is capable of detecting a concentration of about 10 copies/mL of the target nucleic acid in the biological sample.

    [0304] In any of the preceding methods, detecting the amplified biothreat pathogen target nucleic acid using T2MR can result in a group-level identification of the biothreat pathogen target nucleic acid by T2MR. The detecting can provide group-level information for any species described herein. In some embodiments, the group-level identification identifies the organism from which the biothreat pathogen target nucleic acid is obtained as Bacillus anthracis, Francisella tularensis, a Burkholderia spp. (e.g., B. mallei or B. pseudomallei), Yersinia pestis, or Rickettsia prowazekii. In some embodiments, the group-level identification identifies the target nucleic acid as including a sequence of a biothreat pathogen target nucleic acid or a fragment thereof. In some embodiments, detecting the amplified target nucleic acid using T2MR results in the identification of a sequence of an antimicrobial resistance gene or a fragment thereof. Non-limiting examples of antimicrobial resistance genes include bla.sub.KPC, blaZ, bla.sub.NDM, bla.sub.IMP, bla.sub.VIM, bla.sub.OXA, bla.sub.CMY, bla.sub.DHA, bla.sub.TEM, bla.sub.SHV, bla.sub.CTX-M, bla.sub.SME, bla.sub.FOX, bla.sub.MIR, femA, femB, mecA, macB, fosA, vanA, vanB, vanC, vanD, vanE, vanG, mefA, mefE, ermA, ermB, tetA, tetB, tetX, tetR, gnrA, gnrB, gnrS, FKS1, FKS2, ERG11, PDR1, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC, or variants thereof.

    [0305] In any of the preceding methods, sequencing the amplified target nucleic acid can result in a species-level or variant-level identification of the biothreat pathogen target nucleic acid. In some embodiments, the species level is a taxonomic species, a taxonomic subspecies, or a strain. In some embodiments, the variant-level identification is a nucleic acid variant (e.g., a single nucleotide polymorphism (SNP), an insertion/deletion (indel), a repetitive element, or a microsatellite repeat).

    [0306] In some embodiments, the group-level identification by T2MR is an antimicrobial resistance gene, and the species-level identification by sequencing is a nucleic acid variant of the antimicrobial resistance gene (e.g., bla.sub.KPC, blaZ, bla.sub.NDM, bla.sub.IMP, bla.sub.VIM, bla.sub.OXA, bla.sub.CMY, bla.sub.DHA, bla.sub.TEM, bla.sub.SHV, bla.sub.CTX-M, bla.sub.SME, bla.sub.FOX, bla.sub.MIR, femA, femB, mecA, macB, fosA, vanA, vanB, vanC, vanD, vanE, vanG, mefA, mefE, ermA, ermB, tetA, tetB, tetX, tetR, qnrA, qnrB, qnrS, FKS1, FKS2, ERG11, PDR1, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC. For example, in some embodiments, (i) the identification by T2MR is bla.sub.KPC, and the variant-level identification by sequencing is KPC-1, KPC-2, KPC-3, KPC-4, KPC-5, KPC-6, KPC-7, KPC-8, KPC-10, KPC-11, KPC-12, KPC-13, KPC-14, KPC-15, KPC-16, KPC-17, KPC-18, KPC-19, KPC-21, KPC-22, KPC-23, KPC-24, KPC-25, KPC-26, KPC-27, KPC-28, KPC-29, KPC-30, KPC-31, KPC-32, KPC-33, KPC-34, or KPC-35; (ii) the identification by T2MR is bla.sub.CTX-M, and the variant-level identification by sequencing is CTX-M-1, CTX-M-2, CTX-M-3, CTX-M-4, CTX-M-5, CTX-M-6, CTX-M-7, CTX-M-8, CTX-M-9, CTX-M-10, CTX-M-12, CTX-M-13, CTX-M-14, CTX-M-15, CTX-M-16, CTX-M-17, CTX-M-19, CTX-M-20, CTX-M-21, CTX-M-22, CTX-M-23, CTX-M-24, CTX-M-25, CTX-M-26, CTX-M-27, CTX-M-28, CTX-M-29, CTX-M-30, CTX-M-31, CTX-M-32, CTX-M-33, CTX-M-34, CTX-M-35, CTX-M-36, CTX-M-37, CTX-M-38, CTX-M-39, CTX-M-40, CTX-M-41, CTX-M-42, CTX-M-43, CTX-M-44, CTX-M-46, CTX-M-47, CTX-M-48, CTX-M-49, CTX-M-50, CTX-M-51, CTX-M-52, CTX-M-53, CTX-M-54, CTX-M-55, CTX-M-56, CTX-M-58, CTX-M-59, CTX-M-60, CTX-M-61, CTX-M-62, CTX-M-63, CTX-M-64, CTX-M-65, CTX-M-66, CTX-M-67, CTX-M-68, CTX-M-69, CTX-M-71, CTX-M-72, CTX-M-73, CTX-M-74, CTX-M-75, CTX-M-76, CTX-M-77, CTX-M-78, CTX-M-79, CTX-M-80, CTX-M-81, CTX-M-82, CTX-M-83, CTX-M-84, CTX-M-85, CTX-M-86, CTX-M-87, CTX-M-88, CTX-M-89, CTX-M-90, CTX-M-91, CTX-M-92, CTX-M-93, CTX-M-94, CTX-M-95, CTX-M-96, CTX-M-97, CTX-M-98, CTX-M-99, CTX-M-100, CTX-M-101, CTX-M-102, CTX-M-103, CTX-M-104, CTX-M-105, CTX-M-110, CTX-M-111, CTX-M-112, CTX-M-113, CTX-M-114, CTX-M-115, CTX-M-116, CTX-M-117, CTX-M-121, CTX-M-122, CTX-M-123, CTX-M-124, CTX-M-125, CTX-M-126, CTX-M-127, CTX-M-129, CTX-M-130, CTX-M-131, CTX-M-132, CTX-M-134, CTX-M-136, CTX-M-137, CTX-M-138, CTX-M-139, CTX-M-141, CTX-M-142, CTX-M-144, CTX-M-146, CTX-M-147, CTX-M-148, CTX-M-150, CTX-M-151, CTX-M-152, CTX-M-155, CTX-M-156, CTX-M-157, CTX-M-158, CTX-M-159, CTX-M-160, CTX-M-161, CTX-M-162, CTX-M-163, CTX-M-164, CTX-M-165, CTX-M-166, CTX-M-167, CTX-M-168, CTX-M-169, CTX-M-170, CTX-M-171, CTX-M-172, CTX-M-173, CTX-M-174, CTX-M-175, CTX-M-176, CTX-M-177, CTX-M-178, CTX-M-179, CTX-M-180, CTX-M-181, CTX-M-182, CTX-M-183, CTX-M-184, CTX-M-185, CTX-M-186, CTX-M-187, CTX-M-188, CTX-M-189, CTX-M-190, CTX-M-191, CTX-M-192, CTX-M-193, CTX-M-194, CTX-M-195, CTX-M-196, CTX-M-197, CTX-M-198, CTX-M-199, CTX-M-200, CTX-M-201, CTX-M-202, CTX-M-203, CTX-M-204, CTX-M-205, CTX-M-206, CTX-M-207, CTX-M-208, CTX-M-209, CTX-M-210, CTX-M-211, CTX-M-212, CTX-M-213, CTX-M-214, CTX-M-216, CTX-M-217, CTX-M-218, CTX-M-219, or CTX-M-220; or (iii) the identification by T2MR is bla.sub.NDM, and the variant-level identification by sequencing is NDM-1, NDM-2, NDM-3, NDM-4, NDM-5, NDM-6, NDM-7, NDM-8, NDM-9, NDM-10, NDM-11, NDM-12, NDM-13, NDM-14, NDM-15, NDM-16, NDM-17, NDM-18, NDM-19, NDM-20, NDM-21, NDM-22, NDM-23, or NDM-24.

    [0307] In any of the preceding methods, the detecting by T2MR can be completed within 5 hours of amplifying the target nucleic acid, e.g., within about 5, 4, 3, 2, or 1 hour.

    [0308] Any suitable biothreat pathogen can be detected and/or sequenced using any of the methods described herein.

    [0309] In some embodiments, the biothreat pathogen is a bacterial pathogen. Any suitable bacterial pathogen may be detected, including any described herein, e.g., Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei and B. pseudomallei), Yersinia pestis, and/or Rickettsia prowazekii. In some embodiments, the amplifying includes amplifying a pan-bacterial amplicon (e.g., a 16S rRNA amplicon). Any suitable primer pair described herein or known in the art can be used. In some embodiments, the bacterial pathogen is a Gram positive bacterium, a Gram negative bacterium, an Enterobacteriaceae family bacterium, an Enterobacter spp., a Citrobacter spp., a Enterococcus spp., a Streptococcus spp. (e.g., a viridans Streptococcus), a Staphylococcus spp. (e.g., a coagulase-negative Staphylococcus spp.), an Acinetobacter spp., a Corynebacterium spp., Enterobacter cloacae complex, or a Mycobacterium spp. In some embodiments, the bacterial pathogen is selected from the group consisting of Acinetobacter baumannii, Escherichia coli, Enterococcus faecalis, Enterococcus faecium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Borrelia burgdorferi, Borrelia afzelii, Borrelia garinii, Rickettsia rickettsii, Anaplasma phagocytophilum, Coxiella burnetii, Ehrlichia chaffeensis, Ehrlichia ewingii, Francisella tularensis, Streptococcus pneumoniae, Enterobacter cloacae, Streptococcus pyogenes, Streptococcus mutans, Streptococcus sanguinis, Haemophilus influenzae, and Neisseria meningitides. In some embodiments, the bacterial pathogen is selected from the group consisting of Acinetobacter baumannii, Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Escherichia coli. In other embodiments, the bacterial pathogen is selected from Borrelia burgdorferi, Borrelia afzelii, and Borrelia garinii.

    [0310] In other embodiments, the pathogen is a fungal pathogen (e.g., a Candida spp.). Any suitable fungal pathogen may be detected. In some embodiments, the amplifying includes amplifying a pan-fungal or pan-Candida spp. amplicon. In some embodiments, the Candida spp. is selected from the group consisting of Candida albicans, Candida guilliermondii, Candida glabrata, Candida krusei, Candida lusitaniae, Candida parapsilosis, Candida metapsilosis, Candida orthopsilosis, Candida dublinensis, Candida tropicalis, Candida auris, Candida haemulonii, Candida duobushaemulonii, Candida pseudohaemulonii, an Aspergillus spp., or a Cryptococcus spp. In some embodiments, the Candida spp. is selected from the group consisting of Candida albicans, Candida guilliermondii, Candida glabrata, Candida krusei, Candida lusitaniae, Candida parapsilosis, and Candida tropicalis.

    [0311] In other embodiments, the pathogen is a protozoan pathogen. Any suitable protozoan pathogen may be detected, including any described herein, e.g., Babesia microti or Babesia divergens.

    [0312] In other embodiments, the pathogen is a viral pathogen. Any suitable viral pathogen may be detected, including any described herein, e.g., a coronavirus (e.g., SARS-CoV or SARS-CoV-2).

    [0313] In some embodiments, the pathogen is a biothreat species, e.g., Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei or B. pseudomallei), Yersinia pestis, or Rickettsia prowazekii.

    [0314] In any of the preceding methods, the method can be capable of detecting a concentration of about 10 colony-forming units (CFU)/mL of the pathogen species in the whole blood sample or lower, e.g., about 1 CFU/mL to about 10 CFU/mL (e.g., about 1 CFU/mL, about 2 CFU/mL, about 3 CFU/mL, about 4 CFU/mL, about 5 CFU/mL, about 6 CFU/mL, about 7 CFU/mL, about 8 CFU/mL, about 9 CFU/mL, or about 10 CFU/mL) of the pathogen species in the whole blood sample.

    [0315] In some embodiments of any of the preceding methods, the target nucleic acid may be an antimicrobial (e.g., antibiotic) resistance gene. Any suitable antimicrobial resistance gene may be detected and/or sequenced using the methods described herein. Exemplary antimicrobial resistance genes include but are not limited to KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC.

    [0316] Any of the methods described herein may further include diagnosing the subject based on the detection of the biothreat pathogen target nucleic acid, or the nucleotide sequence of the biothreat pathogen target nucleic acid, wherein the presence or sequence of the target nucleic indicates that the subject is suffering from a disease associated with a biothreat pathogen. The method may further include administering to the subject a suitable therapy, e.g., a therapy tailored to identity of the biothreat pathogen and/or the drug resistance profile of the pathogen based on the sequence of the target nucleic acid.

    [0317] In another example, in some embodiments, the invention provides a method for sequencing a biothreat pathogen target nucleic acid in a sample including unprocessed whole blood, the method including: (a) providing a mixture including a buffer solution including a buffering agent, dNTPs, magnesium, a forward primer, a reverse primer, and a thermostable nucleic acid polymerase, wherein the buffer solution has a moderately alkaline pH at ambient temperature, and wherein the final concentration of the thermostable nucleic acid polymerase is at least about 0.01 units (e.g., about 0.01 units, about 0.02 units, about 0.03 units, about 0.04 units, about 0.05 units, about 0.06 units, about 0.07 units, about 0.08 units, about 0.09 units, about 0.10 units, about 0.15 units about 0.2 units, about 0.25 units, about 0.3 units, about 0.35 units, about 0.4 units, about 0.45 units, about 0.5 units, about 0.6 units, about 0.65 units, about 0.7 units, about 0.8 units, about 0.9 units, about 1 unit, or more) per microliter of the mixture; (b) adding to the mixture a portion of a whole blood sample obtained from a subject to form a reaction mixture; (c) amplifying the target nucleic acid to form an amplified solution including an amplicon; and (d) sequencing the amplicon. In some embodiments, the reaction mixture contains from about 1% to about 70% (v/v) whole blood, e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, or about 70% (v/v) whole blood). In some embodiments, the reaction mixture contains more than about 1%, more than about 2%, more than about 3%, more than about 4%, more than about 5%, more than about 10%, more than about 15%, more than about 20%, more than about 25%, more than about 30%, more than about 35%, more than about 40%, more than about 45%, more than about 50%, more than about 55%, more than about 60%, more than about 65%, or more than about 70% (v/v) whole blood.

    [0318] In a still further example, in some embodiments, the invention provides a method for sequencing a biothreat pathogen target nucleic acid in a sample including whole blood, the method including: (a) providing a mixture, wherein the mixture includes a buffer solution including a buffering agent, dNTPs, magnesium, a forward primer, a reverse primer, and a thermostable nucleic acid polymerase, wherein the buffer solution has a moderately alkaline pH at ambient temperature, and wherein the mixture contains about at least about 1×10.sup.−5 micrograms (e.g., about 1×10.sup.−5 micrograms, about 1.5×10.sup.−5 micrograms, about 2×10.sup.−5 micrograms, about 2.4×10.sup.−5 micrograms, about 2.5×10.sup.−5 micrograms, about 3×10.sup.−5 micrograms, about 4×10.sup.−5 micrograms, about 5×10.sup.−5 micrograms, about 6×10.sup.−5 micrograms, about 7×10.sup.−5 micrograms, about 8×10.sup.−5 micrograms, about 9×10.sup.−5 micrograms, about 1×10.sup.−4 micrograms, about 2×10.sup.−4 micrograms, about 3×10.sup.−4 micrograms, about 4×10.sup.−4 micrograms, about 5×10.sup.−4 micrograms, about 6×10.sup.−4 micrograms, about 7×10.sup.−4 micrograms, about 8×10.sup.−4 micrograms, about 9×10.sup.−4 micrograms, about 1×10.sup.−3 micrograms, about 2×10.sup.−3 micrograms, 3×10.sup.−3 micrograms, about 4×10.sup.−3 micrograms, about 5×10.sup.−3 micrograms, about 6×10.sup.−3 micrograms, about 7×10.sup.−3 micrograms, about 8×10.sup.−3 micrograms, about 9×10.sup.−3 micrograms, about 0.01 micrograms, about 0.02 micrograms, about 0.03 micrograms, about 0.04 micrograms, about 0.05 micrograms, or more) of the thermostable nucleic acid polymerase per microliter of the mixture of the thermostable nucleic acid polymerase; (b) adding to the mixture a portion of a whole blood sample obtained from a subject to form a reaction mixture; (c) amplifying the target nucleic acid to form an amplified solution including an amplicon; and (d) sequencing the amplicon. In some embodiments, the reaction mixture contains from about 1% to about 70% (v/v) whole blood, e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, or about 70% (v/v) whole blood).

    [0319] Any suitable buffering agent may be used in the methods of the invention. For example, in some embodiments, any buffer with a pKa ranging from about 7.0 to about 9.2 (e.g., about 7.0 to about 7.6; from about 7.6 to about 8.2; or about 8.2 to about 9.2) may be used. Exemplary buffering agents with a pKa ranging from about 7.0 to about 7.6 include but are not limited to: MOPS, BES, phosphoric acid, TES, HEPES, and DIPSO. Exemplary buffering agents with a pKa ranging from about 7.6 to about 8.2 include but are not limited to: TAPSO, TEA, n-ethylmorpholine, POPSO, EPPS, HEPPSO, Tris, and Tricine. Exemplary buffering agents with a pKa ranging from about 8.2 to about 9.2 include but are not limited to: glycylglycine, Bicine, TAPS, morpholine, n-methyldiethanolamine, AMPD (2-amino-2-methyl-1,3-propanediol), diethanolamine, and AMPSO. In some embodiments, a buffering agent with a pKa greater than 9.2 may be used. Exemplary buffering agents with a pKa greater than 9.2 include but are not limited to boric acid, CHES, glycine, CAPSO, ethanolamine, AMP (2-amino-2-methyl-1-propanol), piperazine, CAPS, 1,3-diaminopropane, CABS, and piperadine.

    [0320] In some embodiments of any of the preceding methods, the method results in the production of at least 105 copies of the amplicon, e.g., at least 105 copies, at least 10.sup.6 copies, at least 107 copies, at least 10.sup.8 copies, at least 109 copies, at least 10.sup.10 copies, at least 10.sup.11 copies, at least 10.sup.12 copies, at least 10.sup.13 copies, or at least 10.sup.14 copies of the amplicon. For example, in some embodiments, the method results in the production of at least 10.sup.8 copies of the amplicon. In some embodiments, the method results in the production of at least 109 copies of the amplicon.

    [0321] Any of the preceding methods can further include detecting one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, or more) additional analytes (e.g., nucleic acids (e.g., DNA or RNA (e.g., mRNA)), proteins, cells, or the like. The detecting may be by any suitable approach, e.g., sequencing (e.g., massively-parallel, long-read, and/or Sanger sequencing), optical, fluorescent, mass, density, magnetic, chromatographic, and/or electrochemical measurement. In some embodiments, the detecting is performed by T2MR.

    [0322] Further provided herein are systems for performing any of the methods described herein, as described further below.

    [0323] Sample Preparation and Cell Lysis

    [0324] The methods and systems of the invention may involve sample preparation and/or cell lysis. For example, an organism (e.g., a biothreat pathogen (e.g., Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei and B. pseudomallei), Yersinia pestis, and/or Rickettsia prowazekii)) present in a biological sample containing cells, cell debris, and/or nucleic acids (e.g., DNA or RNA (e.g., mRNA)), including but not limited to blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), tissue samples (e.g., tissue biopsies, including homogenized tissue samples), urine, BAL, CSF, SF, or sputum may be lysed prior to amplification of a target nucleic acid. Suitable lysis methods for lysing cells (e.g., pathogen cells) in a biological sample include, for example, mechanical lysis (e.g., beadbeating and sonication), heat lysis, and alkaline lysis.

    [0325] In some embodiments, the lysis method is beadbeating. In some embodiments, beadbeating may be performed by adding glass beads (e.g., 0.5 mm glass beads, 0.6 mm glass beads, 0.7 mm glass beads, 0.8 mm glass beads, or 0.9 mm glass beads) to a biological sample to form a mixture and agitating the mixture. As an example, the sample preparation and cell lysis (e.g., beadbeating) may be performed using any of the approaches and methods described in WO 2012/054639. Following lysis, the sample may include cell debris or nucleic acids derived from mammalian host cells and/or from the pathogen cell(s) present in the sample.

    [0326] In some embodiments, the methods of the invention may include preparing a tissue homogenate. Any suitable method or approach known in the art and/or described herein may be used, including but not limited to grinding (e.g., mortar and pestle grinding, cryogenic mortar and pestle grinding, or glass homogenizer), shearing (e.g., blender, rotor-stator, dounce homogenizer, or French press), beating (e.g., beadbeating), or sonication. In some embodiments, several approaches may be combined to prepare a tissue homogenate.

    [0327] In some embodiments, the methods of the invention involve detection of one or more biothreat pathogen target nucleic acids (e.g., a biothreat target nucleic acid characteristic of Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei and B. pseudomallei), Yersinia pestis, and/or Rickettsia prowazekii)). In some embodiments, the methods of the invention involve detection of one or more antibiotic resistance genes (e.g., one or more antibiotic resistance genes selected from the group consisting of NDM, KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC) in a whole blood sample. In some embodiments, the methods may involve disruption of red blood cells (erythrocytes). In some embodiments, the disruption of the red blood cells can be carried out using an erythrocyte lysis agent (i.e., a lysis buffer, an isotonic lysis agent, or a nonionic detergent). Erythrocyte lysis buffers which can be used in the methods of the invention include, without limitation, isotonic solutions of ammonium chloride (optionally including carbonate buffer and/or EDTA), and hypotonic solutions. The basic mechanism of hemolysis using isotonic ammonium chloride is by diffusion of ammonia across red blood cell membranes. This influx of ammonium increases the intracellular concentration of hydroxyl ions, which in turn reacts with CO.sub.2 to form hydrogen carbonate.

    [0328] Erythrocytes exchange excess hydrogen carbonate with chloride which is present in blood plasma via anion channels and subsequently increase in intracellular ammonium chloride concentrations. The resulting swelling of the cells eventually causes loss of membrane integrity.

    [0329] Alternatively, the erythrocyte lysis agent can be an aqueous solution of nonionic detergents (e.g., nonyl phenoxypolyethoxylethanol (NP-40), 4-octylphenol polyethoxylate (TRITON™ X-100), BRIJ® 58, or related nonionic surfactants, and mixtures thereof). The erythrocyte lysis agent disrupts at least some of the red blood cells, allowing a large fraction of certain components of whole blood (e.g., certain whole blood proteins) to be separated (e.g., as supernatant following centrifugation) from the white blood cells or other cells (e.g., pathogen cells (e.g., bacterial cells and/or fungal cells)) present in the whole blood sample. Following erythrocyte lysis and centrifugation, the resulting pellet may be lysed, for example, as described above.

    [0330] In some embodiments, the methods provided herein may include (a) providing a whole blood sample from a subject; (b) mixing the whole blood sample with an erythrocyte lysis agent solution to produce disrupted red blood cells; (c) following step (b), centrifuging the sample to form a supernatant and a pellet, discarding some or all of the supernatant, and resuspending the pellet to form an extract, (d) lysing cells of the extract (which may include white blood cells and/or pathogen cells) to form a lysate. In some embodiments, the method further comprises amplifying one or more biothreat pathogen nucleic acids in the lysate. In some embodiments, the method further comprises sequencing one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, or more) biothreat pathogen nucleic acids in the lysate. In some embodiments, the method further comprises amplifying one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, or more) target drug resistance (e.g., antibiotic resistance) nucleic acids in the lysate. In some embodiments, the method further comprises sequencing one or more target drug resistance (e.g., antibiotic resistance) nucleic acids in the lysate. In some embodiments, the sample of whole blood is from about 0.5 to about 10 mL of whole blood, for example, 0.5 mL, 1 mL, 2 mL, 3 mL, 4 mL, 5 mL, 6 mL, 7 mL, 8 mL, 9 mL, or 10 mL of whole blood. In some embodiments, the method may include washing the pellet (e.g., with a buffer such as TE buffer) prior to resuspending the pellet and optionally repeating step (c). In some embodiments, step (c) does not involve resuspending the pellet but instead includes adding a buffer solution to the pellet to form the extract. In some embodiments, the method may include 1, 2, 3, 4, 5, or more wash steps. In other embodiments, the method is performed without performing any wash step. In some embodiments, the amplifying is in the presence of whole blood proteins, non-target nucleic acids, or both. In some embodiments, the amplifying may be in the presence of from about 0.5 μg to about 200 μg (e.g., about 0.5 μg, 1 μg, 5 μg, 10 μg, 15 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 70 μg, 80 μg, 90 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, or 200 μg) of subject (i.e., host) DNA. In some embodiments, the amplifying may be in the presence of more than about 1 μg (e.g., more than about 10 μg, 15 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 70 μg, 80 μg, 90 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, or 200 μg) of subject (i.e., host) DNA. In some embodiments, at least a portion of the subject (i.e., host) DNA is from white blood cells of the subject. In some embodiments, the subject (i.e., host) DNA is from white blood cells of the subject.

    [0331] Amplification Approaches

    [0332] In several embodiments, the methods and systems of the invention involve amplification of one or more nucleic acids. Amplification may be exponential or linear. A target or template nucleic acid may be any suitable nucleic acid (e.g., one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, or more) biothreat pathogen target nucleic acids (e.g., a biothreat pathogen target nucleic acid characteristic of Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei and/or B. pseudomallei), Yersinia pestis, and/or Rickettsia prowazekii)). In some embodiments, the target nucleic acid is DNA or RNA (e.g., mRNA). The sequences amplified in this manner form an amplified target nucleic acid (also referred to herein as an amplicon). Primers and probes can be readily designed by those skilled in the art to target a specific template nucleic acid sequence. In certain preferred embodiments, resulting amplicons are short to allow for rapid cycling and generation of copies. The size of the amplicon can vary as needed, for example, to provide the ability to discriminate target nucleic acids from non-target nucleic acids. For example, amplicons can be less than about 1,000 nucleotides in length. In some embodiments, the amplicons are from 100 to 500 nucleotides in length (e.g., 100 to 200, 150 to 250, 300 to 400, 350 to 450, or 400 to 500 nucleotides in length). In other embodiments, the amplicons are greater than about 1,000 nucleotides in length, e.g., about 1,000, about 2,000, about 3,000, about 4,000, about 5,000, about 6,000, about 7,000, about 8,000, about 9,000, about 10,000, or more nucleotides in length. In some embodiments, more than one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) target nucleic acids may be amplified in one reaction. In other embodiments, a single target nucleic acid may be amplified in one reaction. In some embodiments, the invention provides amplification-based nucleic acid detection assays conducted in complex samples containing cells and/or cell debris, including but not limited to blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), tissue samples (e.g., tissue biopsies (e.g., skin biopsies, muscle biopsies, or lymph node biopsies), including homogenized tissue samples), urine, CSF, BAL, SF, or sputum (e.g., purulent sputum or bloody sputum). In several embodiments, the method provides methods for amplifying target nucleic acids in a biological sample that includes cells, cell debris, and/or nucleic acids (e.g., DNA or RNA (e.g., mRNA)) derived from both a host mammalian subject and from a microbial organism, particularly a microbial pathogen. The resulting amplified target nucleic acids, or portions or fragments thereof, can be sequenced according to any of the sequencing approaches known in the art and/or described herein.

    [0333] Sample preparation typically involves removing or providing resistance for common PCR inhibitors found in complex samples containing cells and/or cell debris. Common inhibitors are listed in Table A (see also Wilson, Appl. Environ. Microbiol., 63:3741 (1997)). The “facilitators” in Table A indicate methodologies or compositions that may be used to reduce or overcome inhibition. Any of the facilitators may be used in the methods described herein. Inhibitors typically act by either prevention of cell tysis, degradation or sequestering a target nucleic acid, and/or inhibition of a polymerase activity. The most commonly employed polymerase, Taq, is typically inhibited by the presence of 0.1% blood in a reaction. Mutant Taq polymerases have been engineered that are resistant to common inhibitors (e.g., hemoglobin and/or humic acid) found in blood (see, e.g., Kermekchiev et al., Nucl. Acid. Res., 37(5): e40, (2009)). Manufacturer recommendations indicate these mutations enable direct amplification from up to 20% blood.

    TABLE-US-00001 TABLE A PCR inhibitors and facilitators for overcoming inhibition Sample or Specimen Type Target Inhibitor Facilitator feces Escherichia coli >10.sup.3 bacterial cells ion-exchange column CSF Treponema Cell debris causing nonspecific nested primers pallidum amplification whole blood mammalian >4 μl of blood/100-ml reaction 1-2% blood per reaction tissue mix (hemoglobin) feces Rotavirus unknown dilution cellulose fiber clinical Cytomegalovirus unidentified components glass bead extraction specimens human blood human genes DNA binding proteins thermophilic protease from and tissue Thermus strain rt44A mammalian Mammalian thermal cycler variations formamide tissue tissue genetics mammalian Mammalian thermal cycler variations DMSO, glycerol, PEG, tissue tissue genetics organic solvents clinical Treponema unknown factors Various substrate-specific specimens pallidum physicochemical methods forensic semen Sperm Genotyping errors; samples selective/total PCR inhibition by vaginal microorganisms feces Salmonella various body fluids immunomagnetic enterica separation feces Various enteric unknown size exclusion viruses chromatography, physicochemical extraction clinical Herpes simplex endogenous inhibitors, random repurification, coamplified specimens virus effects positive control feces Escherichia coli nonspecific inhibitors, urea, additional primers and hemoglobin, heparin, phenol, reaction cyclers, booster SDS PCR tissue culture Cytomegalovirus glove powder HIV suspensions, Mycobacterium mercury-based fixatives, reduced fixation times, skin biopsies leprae neutral buffered formaline ethanol fixation clinical Mycobacterium unknown inhibitors in pus, physicochemical extraction specimens tuberculosis tissue biopsies, sputum, pleural fluid mammalian mammalian unknown contaminant of additional DNA tissue tissue genetics reverse transcriptase formalin-fixed Hepatitis C virus ribonucleotide vanadyl phenol/chloroform paraffin tissue complexes extraction nasopharyngeal Bordetella unknown inhibitors phenol/chloroform aspirates and pertussis extraction swabs human HIV type I detergents mineral oil mononuclear blood cells bloodstain human unidentified heme compound, BSA mitochondrial hemin DNA blood various heparin alternative polymerases and buffers, chelex, spermine, [Mg2+], glycerol, BSA, heparinase sputum Mycoplasma N-acetyl-L-cysteine, pneumoniae dithiothreitol, mucolytic agents human tissue HLA-DRB1 pollen, glove powder, impure genotyping DNA, heparin, hemoglobin clinical Mycobacterium unknown competitive internal control specimens tuberculosis dental plaque many unknown diatomaceous earth, guanidium isothiocyanate, ethanol, acetone ancient Cytochrome b unknown ammonium acetate, mammalian gene ethidium bromide tissues

    [0334] Polymerase chain reaction amplification of DNA or cDNA is a tried and trusted methodology; however, as discussed above, polymerases are inhibited by agents contained in complex biological samples containing cells, cell debris, and/or nucleic acids (e.g., DNA or RNA)), including but not limited to commonly used anticoagulants and hemoglobin. Recently, mutant Taq polymerases have been engineered to harbor resistance to common inhibitors found in blood and soil. Currently available polymerases, e.g., HemoKlenTaq® (New England BioLabs, Inc., Ipswich, Mass.) as well as OmniTaq® and OmniKlenTaq® (DNA Polymerase Technology, Inc., St. Louis, Mo.) are mutant (e.g., N-terminal truncation and/or point mutations) Taq polymerase that render them capable of amplifying DNA in the presence of up to 10%, 20% or 25% whole blood, depending on the product and reaction conditions (See, e.g., Kermekchiev et al. Nucl. Acids Res. 31:6139 (2003); and Kermekchiev et al., Nucl. Acid. Res., 37:e40 (2009); and see U.S. Pat. No. 7,462,475). Additionally, PHUSION® Blood Direct PCR Kits (Finnzymes Oy, Espoo, Finland), include a unique fusion DNA polymerase enzyme engineered to incorporate a double-stranded DNA binding domain, which allows amplification under conditions which are typically inhibitory to conventional polymerases such as Taq or Pfu, and allow for amplification of DNA in the presence of up to about 40% whole blood under certain reaction conditions. See Wang et al., Nucl. Acids Res. 32:1197 (2004); and see U.S. Pat. Nos. 5,352,778 and 5,500,363. Furthermore, Kapa Blood PCR Mixes (Kapa Biosystems, Woburn, Mass.), provide a genetically engineered DNA polymerase enzyme which allows for direct amplification of whole blood at up to about 20% of the reaction volume under certain reaction conditions. Despite these breakthroughs, direct optical detection of generated amplicons is typically not possible with existing methods since fluorescence, absorbance, and other light-based methods yield signals that are quenched by the presence of blood. See Kermekchiev et al., Nucl. Acid. Res., 37:e40 (2009).

    [0335] Table B shows a list of mutant thermostable DNA polymerases that are compatible with many types of interfering substances and that may be used in the methods of the invention for amplification of target nucleic acids in biological samples containing cells and/or cell debris. In certain embodiments, the invention features the use of enzymes compatible with whole blood, e.g., mutant thermostable DNA polymerases including but not limited to NEB HemoKlenTa™, DNAP OmniKlenTaq™, Kapa Biosystems whole blood enzyme, Thermo-Fisher Finnzymes PHUSION® enzyme, or any of the mutant thermostable DNA polymerases shown in Table B.

    TABLE-US-00002 TABLE B Exemplary mutant thermostable DNA polymerases Polymerase Reference Klentaq ®1 Barnes, Proc Natl Acad Sci USA. 91(6): 2216-2220, 1994. Klentaq ® LA ″ Cesium Klentaq ® AC Kermekchiev et al., Nuc. Acids Res. 31(21): 6139-6147, 2003. Cesium Klentaq ® AC LA ″ Cesium Klentaq ® C ″ Cesium Klentaq ® C LA ″ Omni Klentaq ® Kermekchiev et al. Nuc. Acids Res. 37(5): e40, 2009. Omni Klentaq ® 2 ″ Omni Klentaq ® LA ″ Omni Taq ″ Omni Taq LA ″ Omni Taq 2 ″ Omni Taq 3 ″ Hemo KlenTaq ® ″ KAPA Blood DNA KAPA Biosystems Polymerase KAPA3G Plant DNA KAPA Biosystems Polymerase KAPA2G Robust DNA KAPA Biosystems Polymerase MyTaq ™ Blood-PCR Kit Bioline Phusion ® Blood DNA Kit Thermo Scientific with Hot Start Phusion II Manage et al., Microfluid. Nanofluid. 10, 697-702, 2011.

    [0336] As described above, a variety of impurities and components of whole blood can be inhibitory to the polymerase and primer annealing. These inhibitors can sometimes lead to generation of false positives and low sensitivities. To reduce the generation of false positives and low sensitivities when amplifying and detecting nucleic acids in complex samples, it is desirable to utilize a thermal stable polymerase not inhibited by whole blood samples, for example as described above, and include one or more internal PCR assay controls (see Rosenstraus et al. J. Clin Microbiol. 36:191 (1998) and Hoofar et al., J. Clin. Microbiol. 42:1863 (2004)).

    [0337] For example, the assay can include an internal control nucleic acid that contains primer binding regions identical to those of the target sequence to assure that clinical specimens are successfully amplified and detected. In some embodiments, the target nucleic acid and internal control can be selected such that each has a unique probe binding region that differentiates the internal control from the target nucleic acid. The internal control is, optionally, employed in combination with a processing positive control, a processing negative control, and a reagent control for the safe and accurate determination and identification of an infecting organism in, e.g., a whole blood clinical sample. The internal control can be an inhibition control that is designed to co-amplify with the nucleic acid target being detected. Failure of the internal inhibition control to be amplified is evidence of a reagent failure or process error. Universal primers can be designed such that the target sequence and the internal control sequence are amplified in the same reaction tube. Thus, using this format, if the target DNA is amplified but the internal control is not it is then assumed that the target DNA is present in a proportionally greater amount than the internal control and the positive result is valid as the internal control amplification is unnecessary. If, on the other hand, neither the internal control nor the target is amplified it is then assumed that inhibition of the PCR reaction has occurred and the test for that particular sample is not valid.

    [0338] The assays of the invention can include one or more positive processing controls in which one or more target nucleic acids is included in the assay (e.g., each included with one or more cartridges) at 3× to 5× the limit of detection. If detected by T2MR, the measured T.sub.2 for each of the positive processing controls must be above the pre-determined threshold indicating the presence of the target nucleic acid. The positive processing controls can detect all reagent failures in each step of the process (e.g., lysis, PCR, and T2MR detection), and can be used for quality control of the system. The assays of the invention can include one or more negative processing controls consisting of a solution free of target nucleic acid (e.g., buffer alone). If detected by T2MR, the T.sub.2 measurements for the negative processing control should be below the threshold indicating a negative result while the T.sub.2 measured for the internal control is above the decision threshold indicating an internal control positive result. The purpose of the negative control is to detect carry-over contamination and/or reagent contamination. The assays of the invention can include one or more reagent controls. The reagent control will detect reagent failures in the PCR stage of the reaction (i.e. incomplete transfer of master mix to the PCR tubes). The reagent controls can also detect gross failures in reagent transfer prior to T.sub.2 detection.

    [0339] The methods of the invention can also include use of a total process control (TPC), for example, an engineered cell (e.g., an engineered bacterium or fungus (e.g., yeast)) comprising a control target nucleic acid that has a known and defined sequence. The TPC may be added to the sample (e.g., environmental or biological sample) as a control to monitor steps including cell lysis, amplification, and sequencing.

    [0340] In some embodiments, complex samples, which may be a liquid sample (including, for example, a biological sample containing cells and/or cell debris including but not limited to blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), tissue samples (e.g., tissue biopsies, including homogenized tissue samples), urine, BAL, CSF, SF, or sputum) can be directly amplified using about 5%, about 10%, about 20%, about 25%, about 30%, about 25%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, or more complex liquid sample in amplification reactions, and that the resulting amplicons can be directly detected from amplification reaction using, for example, sequencing (e.g., massively parallel, long-read, and/or Sanger sequencing) and/or magnetic resonance (MR) relaxation measurements (e.g., T2MR) upon the addition of conjugated magnetic particles bound to oligonucleotides complementary to the target nucleic acid sequence. Alternatively, the magnetic particles can be added to the sample prior to amplification. Thus, provided are methods for the use of nucleic acid amplification in a complex dirty sample, sequencing and/or hybridization of the resulting amplicon to paramagnetic particles, which may be followed by direct detection of hybridized magnetic particle conjugate and target amplicons using magnetic particle-based detection systems. In some embodiments, the detection is by sequencing only. In other embodiments, direct detection of hybridized magnetic particle conjugates and amplicons is via MR relaxation measurements (e.g., T.sub.2, T.sub.1, T.sub.1/T.sub.2 hybrid, T.sub.2*, and the like). Further provided are methods which are kinetic, in order to quantify the original nucleic acid copy number within the sample (e.g., sampling and nucleic acid detection at pre-defined cycle numbers, comparison of endogenous internal control nucleic acid, use of exogenous spiked homologous competitive control nucleic acid). In some embodiments, the resulting amplicons are detected using a non-MR-based approach, for example, optical, fluorescent, mass, density, chromatographic, and/or electrochemical measurement.

    [0341] While the exemplary methods described hereinafter relate to amplification using PCR, numerous other methods are known in the art for amplification of nucleic acids (e.g., isothermal methods, rolling circle methods, etc.). Those skilled in the art will understand that these other methods may be used either in place of, or together with, PCR methods. See, e.g., Saiki, “Amplification of Genomic DNA” in PCR Protocols, Innis et al., Eds., Academic Press, San Diego, Calif., pp 13-20 (1990); Wharam et al., Nucleic Acids Res. 29:E54 (2001); Hafner et al., Biotechniques, 30:852 (2001). Further amplification methods suitable for use with the present methods include, for example, reverse transcription PCR (RT-PCR), ligase chain reaction (LCR), multiple displacement amplification (MDA), strand displacement amplification (SDA), rolling circle amplification (RCA), loop mediated isothermal amplification (LAMP), nucleic acid sequence based amplification (NASBA), helicase dependent amplification, recombinase polymerase amplification, nicking enzyme amplification reaction, ramification amplification (RAM), transcription based amplification system (TAS), transcription mediated amplification (TMA), the isothermal and chimeric primer-initiated amplification of nucleic acid (ICAN) method, and the smart amplification system (SMAP) method. These methods, as well as others are well known in the art and can be adapted for use in conjunction with provided methods of detection of amplified nucleic acid.

    [0342] The PCR method is a technique for making many copies of a specific template DNA sequence. The PCR process is disclosed, for example, in U.S. Pat. Nos. 4,683,195; 4,683,202; and 4,965,188. One set of primers complementary to a template DNA are designed, and a region flanked by the primers is amplified by DNA polymerase in a reaction including multiple amplification cycles. Each amplification cycle includes an initial denaturation, and up to 50 cycles of annealing, strand elongation (or extension) and strand separation (denaturation). In each cycle of the reaction, the DNA sequence between the primers is copied. Primers can bind to the copied DNA as well as the original template sequence, so the total number of copies increases exponentially with time. PCR can be performed as according to Whelan et al., Journal of Clinical Microbiology 33:556 (1995). Various modified PCR methods are available and well known in the art. Various modifications such as the “RT-PCR” method, in which DNA is synthesized from RNA using a reverse transcriptase before performing PCR; and the “TaqMan® PCR” method, in which only a specific allele is amplified and detected using a fluorescently labeled TaqMan® probe, and Taq DNA polymerase, are known to those skilled in the art. RT-PCR and variations thereof have been described, for example, in U.S. Pat. Nos. 5,804,383; 5,407,800; 5,322,770; and 5,310,652, and references described therein; and TaqMan® PCR and related reagents for use in the method have been described, for example, in U.S. Pat. Nos. 5,210,015; 5,876,930; 5,538,848; 6,030,787; and 6,258,569.

    [0343] In some embodiments, asymmetric PCR is performed to preferentially amplify one strand of a double-stranded DNA (dsDNA) template. Asymmetric PCR typically involves addition of an excess of the primer for the strand targeted for amplification. An exemplary asymmetric PCR condition is 300 nM of the excess primer and 75 nM of the limiting primer to favor single strand amplification. In other embodiments, 400 nM of the excess primer and 100 nM of the limiting primer may be used to favor single strand amplification. In other embodiments, symmetric PCR is performed.

    [0344] In some embodiments, including embodiments that employ multiplexed PCR reactions, hot start PCR conditions may be used to reduce mis-priming, primer-dimer formation, improve yield, and/or and ensure high PCR specificity and sensitivity. A variety of approaches may be employed to achieve hot start PCR conditions, including hot start DNA polymerases (e.g., hot start DNA polymerases with aptamer-based inhibitors or with mutations that limit activity at lower temperatures) as well as hot start dNTPs (e.g., CLEANAMP™ dNTPs, TriLink Biotechnologies).

    [0345] In some embodiments, a PCR reaction may include from about 20 cycles to about 55 cycles or more (e.g., about 20, 25, 30, 35, 40, 45, 50, or 55 cycles).

    [0346] LCR is a method of DNA amplification similar to PCR, except that it uses four primers instead of two and uses the enzyme ligase to ligate or join two segments of DNA. Amplification can be performed in a thermal cycler (e.g., LCx of Abbott Labs, North Chicago, Ill.). LCR can be performed for example, as according to Moore et al., Journal of Clinical Microbiology 36:1028 (1998). LCR methods and variations have been described, for example, in European Patent Application Publication No. EP0320308, and U.S. Pat. No. 5,427,930.

    [0347] The TAS method is a method for specifically amplifying a target RNA in which a transcript is obtained from a template RNA by a cDNA synthesis step and an RNA transcription step. In the cDNA synthesis step, a sequence recognized by a DNA-dependent RNA polymerase (i.e., a polymerase-binding sequence or PBS) is inserted into the cDNA copy downstream of the target or marker sequence to be amplified using a two-domain oligonucleotide primer. In the second step, an RNA polymerase is used to synthesize multiple copies of RNA from the cDNA template. Amplification using TAS requires only a few cycles because DNA-dependent RNA transcription can result in 10-1000 copies for each copy of cDNA template. TAS can be performed according to Kwoh et al., PNAS 86:1173 (1989). The TAS method has been described, for example, in International Patent Application Publication No. WO1988/010315.

    [0348] Transcription mediated amplification (TMA) is a transcription-based isothermal amplification reaction that uses RNA transcription by RNA polymerase and DNA transcription by reverse transcriptase to produce an RNA amplicon from target nucleic acid. TMA methods are advantageous in that they can produce 100 to 1000 copies of amplicon per amplification cycle, as opposed to PCR or LCR methods that produce only 2 copies per cycle. TMA has been described, for example, in U.S. Pat. No. 5,399,491. NASBA is a transcription-based method which for specifically amplifying a target RNA from either an RNA or DNA template. NASBA is a method used for the continuous amplification of nucleic acids in a single mixture at one temperature. A transcript is obtained from a template RNA by a DNA-dependent RNA polymerase using a forward primer having a sequence identical to a target RNA and a reverse primer having a sequence complementary to the target RNA a on the 3′ side and a promoter sequence that recognizes T7 RNA polymerase on the 5′ side. A transcript is further synthesized using the obtained transcript as template. This method can be performed as according to Heim, et al., Nucleic Acids Res., 26:2250 (1998). The NASBA method has been described in U.S. Pat. No. 5,130,238.

    [0349] The SDA method is an isothermal nucleic acid amplification method in which target DNA is amplified using a DNA strand substituted with a strand synthesized by a strand substitution type DNA polymerase lacking 5′->3′ exonuclease activity by a single stranded nick generated by a restriction enzyme as a template of the next replication. A primer containing a restriction site is annealed to template, and then amplification primers are annealed to 5′ adjacent sequences (forming a nick). Amplification is initiated at a fixed temperature. Newly synthesized DNA strands are nicked by a restriction enzyme and the polymerase amplification begins again, displacing the newly synthesized strands. SDA can be performed according to Walker, et al., PNAS, 89:392 (1992). SDA methods have been described in U.S. Pat. Nos. 5,455,166 and 5,457,027.

    [0350] The LAMP method is an isothermal amplification method in which a loop is always formed at the 3′ end of a synthesized DNA, primers are annealed within the loop, and specific amplification of the target DNA is performed isothermally. LAMP can be performed according to Nagamine et al., Clinical Chemistry. 47:1742 (2001). LAMP methods have been described in U.S. Pat. Nos. 6,410,278; 6,974,670; and 7,175,985.

    [0351] The ICAN method is anisothermal amplification method in which specific amplification of a target DNA is performed isothermally by a strand substitution reaction, a template exchange reaction, and a nick introduction reaction, using a chimeric primer including RNA-DNA and DNA polymerase having a strand substitution activity and RNase H. ICAN can be performed according to Mukai et al., J. Biochem. 142: 273(2007). The ICAN method has been described in U.S. Pat. No. 6,951,722.

    [0352] The SMAP (MITANI) method is a method in which a target nucleic acid is continuously synthesized under isothermal conditions using a primer set including two kinds of primers and DNA or RNA as a template. The first primer included in the primer set includes, in the 3′ end region thereof, a sequence (Ac′) hybridizable with a sequence (A) in the 3′ end region of a target nucleic acid sequence as well as, on the 5′ side of the above-mentioned sequence (Ac′), a sequence (B′) hybridizable with a sequence (Bc) complementary to a sequence (B) existing on the 5′ side of the above-mentioned sequence (A) in the above-mentioned target nucleic acid sequence. The second primer includes, in the 3′ end region thereof, a sequence (Cc′) hybridizable with a sequence (C) in the 3′ end region of a sequence complementary to the above-mentioned target nucleic acid sequence as well as a loopback sequence (D-Dc′) including two nucleic acid sequences hybridizable with each other on an identical strand on the 5′ side of the above-mentioned sequence (Cc′). SMAP can be performed according to Mitani et al., Nat. Methods, 4(3): 257 (2007). SMAP methods have been described in U.S. Patent Application Publication Nos. 2006/0160084, 2007/0190531 and 2009/0042197.

    [0353] The amplification reaction can be designed to produce a specific type of amplified product, such as nucleic acids that are double stranded; single stranded; double stranded with 3′ or 5′ overhangs; or double stranded with chemical ligands on the 5′ and 3′ ends. The amplified PCR product can be detected by: (i) sequencing; (ii) hybridization of the amplified product to magnetic particle bound complementary oligonucleotides, where two different oligonucleotides are used that hybridize to the amplified product such that the nucleic acid serves as an interparticle tether promoting particle agglomeration; (iii) hybridization mediated detection where the DNA of the amplified product must first be denatured; (iv) hybridization mediated detection where the particles hybridize to 5′ and 3′ overhangs of the amplified product; and/or (v) binding of the particles to the chemical or biochemical ligands on the termini of the amplified product, such as streptavidin functionalized particles binding to biotin functionalized amplified product.

    [0354] Analytes

    [0355] Embodiments of the invention include methods and systems for detecting and/or measuring the concentration of one or more analytes (e.g., analytes associated with biothreat pathogens (e.g., Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei and/or B. pseudomallei), Yersinia pestis, and/or Rickettsia prowazekii)) in a complex biological sample containing cells and/or cell debris, including but not limited to blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), tissue samples (e.g., a tissue biopsy (e.g., a skin biopsy, muscle biopsy, or lymph node biopsy), including homogenized tissue samples), urine, cerebrospinal fluid (CSF), synovial fluid (SF), or sputum. In several embodiments, the analyte may be a nucleic acid derived from an organism. In some embodiments, the nucleic acid is a target nucleic acid derived from the organism that has been amplified to form an amplicon. In some embodiments, the organism is a plant, a mammal, or a microbial species. The nucleic acid can be detected by sequencing. In some embodiments, the nucleic acid may further be detected by other approaches, including T2MR. In other embodiments, the analyte may be a biothreat pathogen-associated analyte such as a toxin.

    [0356] In some embodiments, the analyte includes a drug resistance gene such as an antibiotic resistance gene, e.g., an antibiotic resistance gene selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC.

    [0357] In some embodiments, the analyte may be derived from a microbial pathogen (e.g., Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei and/or B. pseudomallei), Yersinia pestis, and/or Rickettsia prowazekii). In such embodiments, the biological sample may include cells and/or cell debris from the host mammalian subject as well as one or more microbial pathogen cells. For example, in some embodiments, the analyte is derived from a Gram-negative bacterium, a Gram-positive bacterium, a fungal pathogen (e.g., a yeast (e.g., Candida spp.) or Aspergillus spp.), a protozoan pathogen, or a viral pathogen. In some embodiments, the analyte is derived from a bacterial pathogen, including Bacillus spp. such as Bacillus anthracis, Francisella spp. (e.g., Francisella tularensis (including Francisella tularensis subspp. holarctica, mediasiatica, and novicida))), Burkholderia spp. (e.g., B. mallei or B. pseudomallei), Yersinia spp. (e.g., Yersinia pestis), Rickettsia (e.g., Rickettsia prowazekii), Acinetobacter spp. (e.g., Acinetobacter baumannii, Acinetobacter pittii, and Acinetobacter nosocomialis), Enterobacteriaceae spp., Enterococcus spp. (e.g., Enterococcus faecium (including E. faecium with resistance marker vanA/B) and Enterococcus faecalis), Klebsiella spp. (e.g., Klebsiella pneumoniae (e.g., K. pneumoniae with resistance marker KPC) and Klebsiella oxytoca), Pseudomonas spp. (e.g., Pseudomonas aeruginosa), Staphylococcus spp. (e.g., Staphylococcus aureus (e.g., S. aureus with resistance marker mecA), Staphylococcus haemolyticus, Staphylococcus lugdunensis, Staphylococcus maltophilia, Staphylococcus saprophyticus, coagulase-positive Staphylococcus species, and coagulase-negative (CoNS) Staphylococcus species), Streptococcus spp. (e.g., Streptococcus mitis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus anginosa, Streptococcus bovis, Streptococcus dysgalactiae, Streptococcus mutans, Streptococcus sanguinis, and Streptococcus pyogenes), Escherichia spp. (e.g., Escherichia coli), Stenotrophomonas spp. (e.g., Stenotrophomonas maltophilia), Proteus spp. (e.g., Proteus mirabilis and Proteus vulgaris), Serratia spp. (e.g., Serratia marcescens), Citrobacter spp. (e.g., Citrobacter freundii and Citrobacter kosen), Haemophilus spp. (e.g., Haemophilus influenzae), Listeria spp. (e.g., Listeria monocytogenes), Neisseria spp. (e.g., Neisseria meningitidis), Bacteroides spp. (e.g., Bacteroides fragilis), Campylobacter (e.g., Campylobacter jejuni and Campylobacter coli), Clostridium spp. (e.g., Clostridium perfringens), Kingella spp. (e.g., Kingella kingae), Morganella spp. (e.g., Morganella morgana), Prevotella spp. (e.g., Prevotella buccae, Prevotella intermedia, and Prevotella melaninogenica), Propionibacterium spp. (e.g., Propionibacterium acnes), Salmonella spp. (e.g., Salmonella enterica), Shigella spp. (e.g., Shigella dysenteriae and Shigella flexnen), Borrelia spp., (e.g., Borrelia burgdorferi sensu lato (Borrelia burgdorferi, Borrelia afzelii, and Borrelia garinii) species), Ehrlichia spp. (including Ehrlichia chaffeensis, Ehrlichia ewingii, and Ehrlichia muris-like), Coxiella spp. (including Coxiella burnetii), Anaplasma spp. (including Anaplasma phagocytophilum), and Enterobacter spp. (e.g., Enterobacter aerogenes and Enterobacter cloacae).

    [0358] In some embodiments, the analyte is derived from a fungal pathogen, for example, Candida spp. (e.g., Candida albicans, Candida glabrata, Candida krusei, C. parapsilosis, Candida auris, Candida lusitaniae, Candida haemulonii, Candida duobushaemulonii, Candida pseudohaemulonii, Candida guilliermondii, and C. tropicalis) and Aspergillus spp. (e.g., Aspergillus fumigatus). In some embodiments, the analyte is derived from a protozoan pathogen such as a Babesia spp. (e.g., Babesia microti and Babesia divergens). In some embodiments, the analyte is derived from a viral pathogen (e.g., a retrovirus (e.g., HIV), an adeno-associated virus (AAV), an adenovirus, Ebolavirus, hepatitis (e.g., hepatitis A, B, C, or E), herpesvirus, human papillomavirus (HPV), rhinovirus, influenza, parainfluenza, measles, rotavirus, West Nile virus, zika virus, a coronavirus (e.g., a SARS-CoV or a SARS-CoV-2) and the like). In some embodiments, the analyte is derived from a coronavirus (e.g., a SARS-CoV or a SARS-CoV-2). In some embodiments, the analyte is derived from a biothreat species e.g., Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei or B. pseudomallei), Yersinia pestis, or Rickettsia prowazekii. In some embodiments, the analyte is a toxin gene, e.g., Bacillus anthracis toxin genes protective antigen (pagA), edema factor (cya), or lethal factor (lef); enteropathogenic E. coli translocated intimin receptor (Tir); Clostridium difficile toxins TcdA and TcdB; or Clostridium botulinum toxins BoNT/A, BoNT/B, BoNT/C, BoNT/D, BoNT/E, BoNT/F, or BoNT/G.

    [0359] In some embodiments, a pathogen-associated analyte may be a nucleic acid derived from any of the organisms described above, for example, DNA or RNA (e.g., mRNA). In some embodiments, the nucleic acid is a target nucleic acid derived from the organism that has been amplified to form an amplicon. In some embodiments, the target nucleic acid may be a multi-copy locus. Use of a target nucleic acid derived from a multi-copy locus, in particular in methods involving amplification, may lead to an increase in sensitivity in the assay. Exemplary multi-copy loci may include, for example, ribosomal DNA (rDNA) operons and multi-copy plasmids. In other embodiments, the target nucleic acid may be a single-copy locus. In particular embodiments, the target nucleic acid may be derived from an essential locus, for example, an essential house-keeping gene. In particular embodiments, the target nucleic acid may be derived from a locus that is involved in virulence (e.g., a virulence gene). In any of the above embodiments, a locus may include a gene and/or an intragenic region, for example, an internally transcribed sequence (ITS) between rRNA genes (e.g., ITS1, between the 16S and 23S rRNA genes, or ITS2, between the 5S and 23S rRNA genes). In some embodiments, the target nucleic acid is a 16S rRNA target nucleic acid.

    [0360] In some embodiments, a target nucleic acid may be (a) species-specific, (b) species-inclusive (in other words, present in all strains or subspecies of a given species), (c) compatible with an amplification/detection protocol, and/or (d) present in multiple copies. In some embodiments, a target nucleic acid may be group-specific or group-inclusive, e.g., genus-specific or genus inclusive. In particular embodiments, a target nucleic acid is chromosomally-encoded.

    [0361] For example, in some embodiments, the B. anthracis pX01 plasmid target nucleic acid is characteristic of protective antigen (pag), lethal factor (lef), or edema factor (cya). In some embodiments, the B. anthracis pX01 plasmid target nucleic acid is characteristic of protective antigen (pag). An exemplary nucleic acid encoding pag is provided in GenBank Accession No. M22589.1, which is incorporated by reference herein in its entirety.

    [0362] In another example, in some embodiments, the B. anthracis pX02 plasmid target nucleic acid is characteristic of capB, capC, capA, capD, capE, AcpA, or AcpB. In some embodiments, the B. anthracis pX02 plasmid target nucleic acid is characteristic of capB. An exemplary nucleic acid encoding capB is provided in GenBank Accession No. CP001597.1, which is incorporated by reference herein in its entirety.

    [0363] In another example, in some embodiments, the Francisella tularensis target nucleic acid is characteristic of lipoprotein. An exemplary nucleic acid encoding F. tularensis lipoprotein is provided in GenBank Accession No. AM233362, which is incorporated herein by reference in its entirety, at position: 388817-389266.

    [0364] In another example, in some embodiments, the Burkholderia spp. target nucleic acid is characteristic of B. mallei and B. pseudomallei. In some embodiments, the Burkholderia spp. target nucleic acid characteristic of B. mallei and B. pseudomallei is a braG gene or a 16S ribosomal RNA (rRNA) gene. An exemplary B. pseudomallei 16S rRNA gene is provided in GenBank Accession No. CP018415.1, which is incorporated herein by reference in its entirety, at position: 1161197-1161762. An exemplary B. mallei 16S rRNA gene is provided in GenBank Accession No. CP010066.1, which is incorporated herein by reference in its entirety, at position: 1617484-1618049. In some embodiments, the Burkholderia spp. target nucleic acid is a braG gene. An exemplary nucleic acid encoding braG is provided in GenBank Accession No. BX571966, at position: 787037-787738, which is incorporated by reference herein in its entirety.

    [0365] In another example, in some embodiments, the Yersinia pestis target nucleic acid is characteristic of plasminogen. An exemplary nucleic acid encoding Y. pestis plasminogen is provided in GenBank Accession No. KJ361945.1, which is incorporated by reference herein in its entirety.

    [0366] In another example, in some embodiments, the Rickettsia prowazekii target nucleic acid is characteristic of cytochrome c oxidase assembly protein or citrate synthase. An exemplary nucleic acid encoding Rickettsia prowazekii citrate synthase is provided in GenBank Accession No. CP014865.1, which is incorporated herein by reference in its entirety, at position: 1062793-1064103. In some embodiments, the Rickettsia prowazekii target nucleic acid is characteristic of cytochrome c oxidase assembly protein.

    [0367] Panels

    [0368] The methods and compositions (e.g., systems, devices, kits, or cartridges) described herein can be configured to detect and/or sequence target nucleic acids from a predetermined panel of targets. The panels can be configured to detect and/or sequence biothreat pathogen target nucleic acids and/or drug resistance markers (e.g., antibiotic resistance genes). Any of the biothreat pathogen target nucleic acids and/or drug antibiotic resistance genes described herein can be amplified, detected, and/or sequenced using the panels described herein. For example, any of the panels described in Example 1 or Example 2 may be amplified, detected, and/or sequenced.

    [0369] For example, in some embodiments, the panel includes one or more (e.g., 1, 2, 3, 4, 5 or all 6) of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii. In some embodiments, the panel includes at least three, at least four, at least five, or all six of the following: Bacillus anthracis pX01 plasmid, Bacillus anthracis pXO2 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, and Rickettsia prowazekii.

    [0370] For example, in some embodiments, the panel includes one or more (e.g., 1, 2, 3, 4, 5 or all 6) of the following: protective antigen of Bacillus anthracis pX01 plasmid, capB of Bacillus anthracis pX02 plasmid, lipoprotein of Francisella tularensis, braG of Burkholderia spp., plasminogen of Yersinia pestis, and cytochrome c oxidase assembly protein of Rickettsia prowazekii, as described, e.g., in Example 2 (see, e.g., Table 8).

    [0371] In some embodiments, the panel includes two or more (e.g., 2, 3, 4, 5 or all 6) of the following: protective antigen of Bacillus anthracis pX01 plasmid, capB of Bacillus anthracis pX02 plasmid, lipoprotein of Francisella tularensis, braG of Burkholderia spp., plasminogen of Yersinia pestis, and cytochrome c oxidase assembly protein of Rickettsia prowazekii.

    [0372] In some embodiments, the panel includes three or more (e.g., 3, 4, 5 or all 6) of the following: protective antigen of Bacillus anthracis pX01 plasmid, capB of Bacillus anthracis pX02 plasmid, lipoprotein of Francisella tularensis, braG of Burkholderia spp., plasminogen of Yersinia pestis, and cytochrome c oxidase assembly protein of Rickettsia prowazekii.

    [0373] In some embodiments, the panel includes four or more (e.g., 4, 5 or all 6) of the following: protective antigen of Bacillus anthracis pX01 plasmid, capB of Bacillus anthracis pX02 plasmid, lipoprotein of Francisella tularensis, braG of Burkholderia spp., plasminogen of Yersinia pestis, and cytochrome c oxidase assembly protein of Rickettsia prowazekii.

    [0374] In some embodiments, the panel includes five or more (e.g., 5 or all 6) of the following: protective antigen of Bacillus anthracis pX01 plasmid, capB of Bacillus anthracis pX02 plasmid, lipoprotein of Francisella tularensis, braG of Burkholderia spp., plasminogen of Yersinia pestis, and cytochrome c oxidase assembly protein of Rickettsia prowazekii.

    [0375] In some embodiments, the panel includes protective antigen of Bacillus anthracis pX01 plasmid, capB of Bacillus anthracis pXO2 plasmid, lipoprotein of Francisella tularensis, braG of Burkholderia spp., plasminogen of Yersinia pestis, and cytochrome c oxidase assembly protein of Rickettsia prowazekii.

    [0376] In some embodiments, the panel includes one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17) of the following: KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC.

    [0377] In any of the above embodiments, the panel may be configured to detect a marker that is characteristic of a genus, for example, a pan-bacterial marker. In any of the above panels, the analyte may be a nucleic acid (e.g., an amplified target nucleic acid, as described above), or a polypeptide (e.g., a polypeptide derived from the pathogen or a pathogen-specific antibody produced by a host subject, for example, an IgM or IgG antibody). In some embodiments, multiple analytes (e.g., multiple amplicons) are used to detect a target, e.g., a biothreat pathogen or a drug resistance (e.g., antibiotic resistance) marker (e.g., an antibiotic resistance gene). In any of the above panels, the biological sample may be a biological sample containing cells and/or cell debris including but not limited to blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), tissue samples (e.g., tissue biopsies, including homogenized tissue samples), BAL, urine, or sputum. In some embodiments, the biological sample is blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma). Such panels may be used, for example, to diagnose bloodstream infections and/or to select an optimized therapy, e.g., by selecting an antimicrobial agent for which the pathogen is predicted to be sensitive rather than resistant. In some embodiments, the biological sample may be a tissue sample, for example, a homogenized tissue sample. Such panels may be used, for example, to detect drug-resistant infections present in tissue.

    [0378] In some embodiments, the panel can be further configured to detect one or more toxin genes. For example, in some embodiments, the toxin gene panel can include one or more of Bacillus anthracis toxin genes protective antigen (pagA), edema factor (cya), and lethal factor (lef); enteropathogenic E. coli translocated intimin receptor (Tir); Clostridium difficile toxins TcdA and TcdB; and Clostridium botulinum toxins BoNT/A, BoNT/B, BoNT/C, BoNT/D, BoNT/E, BoNT/F, and BoNT/G.

    [0379] Medical Conditions

    [0380] The methods of the invention can also be used diagnose and monitor diseases and other medical conditions. In some embodiments, the methods of the invention may be used diagnose and monitor diseases in a multiplexed, automated, no sample preparation system.

    [0381] The methods and systems of the invention can be used to identify and monitor the pathogenesis of disease in a subject, to select therapeutic interventions, and to monitor the effectiveness of the selected treatment. For example, for a patient having or at risk of bacteremia and/or sepsis, the methods and systems of the invention can be used to identify the infectious biothreat pathogen, pathogen load, and to monitor white blood cell count and/or biomarkers indicative of the status of the infection. The presence or expression level of one or more drug resistance markers (e.g., antibiotic resistance genes) can be used to select an appropriate therapy. The identity of the pathogen (e.g., at a group-level and/or a species-level) can be used to select an appropriate therapy. In some embodiments, the methods may further include administering a therapeutic agent following monitoring or diagnosing an infectious disease. The therapeutic intervention (e.g., a particular antibiotic agent) can be monitored as well to correlate the treatment regimen to the circulating concentration of antibiotic agent and pathogen load to ensure that the patient is responding to treatment.

    [0382] Exemplary diseases that can be diagnosed and/or monitored by the methods and systems of the invention include diseases caused by or associated with biothreat pathogens, e.g., sepsis, bloodstream infections (BSIs) (e.g., bacteremia, fungemia (e.g., Candidemia), and viremia), anthrax, botulism, plague, tularemia, viral hemorrhagic fevers, melioidosis, Q fever, brucellosis, glanders, Psittacosis, tickborne hemorrhagic fever viruses Lyme disease, septic shock, and diseases that may manifest with similar symptoms to diseases caused by or associated with biothreat pathogens, e.g., systemic inflammatory response syndrome (SIRS). In any of the methods, the causative pathogen may be a drug-resistant pathogen (e.g., an antibiotic-resistant biothreat pathogen).

    [0383] For example, the methods and systems of the invention may be used to diagnose and/or monitor a disease caused by the following non-limiting examples of pathogens: bacterial pathogens, including Bacillus spp. such as Bacillus anthracis, Francisella spp. such as Francisella tularensis (including Francisella tularensis subspp. holarctica, mediasiatica, and novicida)), Burkholderia spp. (e.g., B. mallei or B. pseudomallei), Yersinia spp. such as Yersinia pestis, Rickettsia spp. such as Rickettsia prowazekii, Acinetobacter spp. (e.g., Acinetobacter baumannii, Acinetobacter pittii, and Acinetobacter nosocomialis), Enterobacteriaceae spp., Enterococcus spp. (e.g., Enterococcus faecium (including E. faecium with resistance marker vanA/B) and Enterococcus faecalis), Klebsiella spp. (e.g., Klebsiella pneumoniae (e.g., K. pneumoniae with resistance marker KPC) and Klebsiella oxytoca), Pseudomonas spp. (e.g., Pseudomonas aeruginosa), Staphylococcus spp. (e.g., Staphylococcus aureus (e.g., S. aureus with resistance marker mecA), Staphylococcus haemolyticus, Staphylococcus lugdunensis, Staphylococcus maltophilia, Staphylococcus saprophyticus, coagulase-positive Staphylococcus species, and coagulase-negative (CoNS) Staphylococcus species), Streptococcus spp. (e.g., Streptococcus mitis, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus anginosa, Streptococcus bovis, Streptococcus dysgalactiae, Streptococcus mutans, Streptococcus sanguinis, and Streptococcus pyogenes), Escherichia spp. (e.g., Escherichia coli), Stenotrophomonas spp. (e.g., Stenotrophomonas maltophilia), Proteus spp. (e.g., Proteus mirabilis and Proteus vulgaris), Serratia spp. (e.g., Serratia marcescens), Citrobacter spp. (e.g., Citrobacter freundii and Citrobacter kosen), Haemophilus spp. (e.g., Haemophilus influenzae), Listeria spp. (e.g., Listeria monocytogenes), Neisseria spp. (e.g., Neisseria meningitidis), Bacteroides spp. (e.g., Bacteroides fragilis), Campylobacter (e.g., Campylobacter jejuni and Campylobacter coli), Clostridium spp. (e.g., Clostridium perfringens), Kingella spp. (e.g., Kingella kingae), Morganella spp. (e.g., Morganella morgana), Prevotella spp. (e.g., Prevotella buccae, Prevotella intermedia, and Prevotella melaninogenica), Propionibacterium spp. (e.g., Propionibacterium acnes), Salmonella spp. (e.g., Salmonella enterica), Shigella spp. (e.g., Shigella dysenteriae and Shigella flexnen), and Enterobacter spp. (e.g., Enterobacter aerogenes and Enterobacter cloacae); and fungal pathogens including but not limited to Candida spp. (e.g., Candida albicans, Candida glabrata, Candida krusei, C. parapsilosis, Candida auris, Candidalusitaniae, Candida haemulonii, Candida duobushaemulonii, Candida pseudohaemulonii, Candida guilliermondii, and C. tropicalis) and Aspergillus spp. (e.g., Aspergillus fumigatus). In some embodiments, the pathogen may be a Borrelia spp., including Borrelia burgdorferi sensu lato (Borrelia burgdorferi, Borrelia afzelii, and Borrelia garinii) species, Borrelia americana, Borrelia andersonii, Borrelia bavariensis, Borrelia bissettii, Borrelia carolinensis, Borrelia californiensis, Borrelia chilensis, Borrelia genomosp. 1 and 2, Borrelia japonica, Borrelia kurtenbachii, Borrelia lusitaniae, Borrelia myomatoii, Borrelia sinica, Borrelia spielmanii, Borrelia tanukii, Borrelia turdi, Borrelia valaisiana and unclassified Borrelia spp. In other embodiments, the pathogen may be selected from the following: Rickettsia spp. (including Rickettsia rickettsii and Rickettsia parken), Ehrlichia spp. (including Ehrlichia chaffeensis, Ehrlichia ewingii, and Ehrlichia muris-like), Coxiella spp. (including Coxiella burnetih), Babesia spp. (including Babesia microti and Babesia divergens), Anaplasma spp. (including Anaplasma phagocytophilum), Francisella spp., (including Francisella tularensis (including Francisella tularensis subspp. holarctica, mediasiatica, and novicida)), Streptococcus spp. (including Streptococcus pneumonia), and Neisseria spp. (including Neisseria meningitidis). In some embodiments, the pathogen is a viral pathogen (e.g., a retrovirus (e.g., HIV), an adeno-associated virus (AAV), an adenovirus, Ebolavirus, hepatitis (e.g., hepatitis A, B, C, or E), herpesvirus, human papillomavirus (HPV), rhinovirus, influenza, parainfluenza, measles, rotavirus, West Nile virus, zika virus, a coronavirus (e.g., SARS-CoV or SARS-CoV-2) and the like). In some embodiments, the pathogen is a biothreat species, e.g., Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei or B. pseudomallei), Yersinia pestis, or Rickettsia prowazekii.

    [0384] Treatment

    [0385] In some embodiments, the methods further include administering a therapeutic agent (e.g., an antimicrobial agent (e.g., an antibiotic agent)) or a composition thereof (e.g., a pharmaceutical composition) to a subject following a diagnosis or identification of a biothreat pathogen. Typically, the identification of a particular biothreat pathogen, and/or the presence of a drug resistance marker (e.g., an antibiotic resistance gene) and/or a pathogen in a biological sample obtained from the subject (e.g., a complex sample containing host cells and/or cell debris, e.g., blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), tissue samples (e.g., tissue biopsies (e.g., skin biopsies, muscle biopsies, or lymph node biopsies), including homogenized tissue samples), urine, BAL, CSF, SF, or sputum) will guide the selection of the appropriate therapeutic agent (e.g., antimicrobial agent, e.g., an antibiotic, an anti-fungal agent, and the like).

    [0386] For example, for a bacterial infection (e.g., bacteremia), a therapy may include an antibiotic. In some instances, an antibiotic may be administered orally. In other instances, the antibiotic may be administered intravenously. Exemplary non-limiting antibiotics that may be used in the methods of the invention include but are not limited to, acrosoxacin, amifioxacin, amikacin, amoxycillin, ampicillin, aspoxicillin, azidocillin, azithromycin, aztreonam, balofloxacin, benzylpenicillin, biapenem, brodimoprim, cefaclor, cefadroxil, cefatrizine, cefcapene, cefdinir, cefetamet, ceftmetazole, cefoxitin, cefprozil, cefroxadine, ceftarolin, ceftazidime, ceftibuten, ceftobiprole, cefuroxime, cephalexin, cephalonium, cephaloridine, cephamandole, cephazolin, cephradine, chlorquinaldol, chlortetracycline, ciclacillin, cinoxacin, ciprofloxacin, clarithromycin, clavulanic acid, clindamycin, clofazimine, cloxacillin, colistin, danofloxacin, dapsone, daptomycin, demeclocycline, dicloxacillin, difloxacin, doripenem, doxycycline, enoxacin, enrofloxacin, erythromycin, fleroxacin, flomoxef, flucloxacillin, flumequine, fosfomycin, gentamycin, isoniazid, imipenem, kanamycin, levofloxacin, linezolid, mandelic acid, mecillinam, meropenem, metronidazole, minocycline, moxalactam, mupirocin, nadifloxacin, nafcillin, nalidixic acid, netilmycin, netromycin, nifuirtoinol, nitrofurantoin, nitroxoline, norfloxacin, ofloxacin, oxacillin, oxytetracycline, panipenem, pefloxacin, phenoxymethylpenicillin, pipemidic acid, piromidic acid, pivampicillin, pivmecillinam, polymixin-b, prulifloxacin, rufloxacin, sparfloxacin, sulbactam, sulfabenzamide, sulfacytine, sulfametopyrazine, sulphacetamide, sulphadiazine, sulphadimidine, sulphamethizole, sulphamethoxazole, sulphanilamide, sulphasomidine, sulphathiazole, teicoplanin, temafioxacin, tetracycline, tetroxoprim, tigecycline, tinidazole, tobramycin, tosufloxacin, trimethoprim, vancomycin, and pharmaceutically acceptable salts or esters thereof.

    [0387] In some embodiments, a method of treatment may include administering a treatment to an asymptomatic patient, for example, based on the detection and/or identification of a pathogen present in a biological sample derived from the patient by the methods of the invention. In other embodiments, a method of treatment may include administering a treatment to a symptomatic patient based on the detection of identification of a pathogen present in a biological sample derived from the patient by the methods of the invention. In several embodiments, the biological sample may contain cells, cell debris, and/or nucleic acids (e.g., DNA or RNA (e.g., mRNA)) derived from both the host subject and a pathogen, including but not limited to blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), tissue samples (e.g., tissue biopsies (e.g., skin biopsies, muscle biopsies, or lymph node biopsies), including homogenized tissue samples), CSF, SF, urine, BAL, or sputum (e.g., purulent sputum or bloody sputum). In some embodiments, the biological sample is blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma) or a bloody fluid (e.g., wound exudate, phlegm, bile, and the like). In particular embodiments, the biological sample is whole blood. In other particular embodiments, the biological sample is a crude whole blood lysate.

    [0388] In some embodiments, the treatment selected for a patient is based on the detection and/or identification of a pathogen by the methods of the invention. Appropriate treatments for different pathogen species are known in the art. In one example, if a Gram positive bacterium is detected in a biological sample derived from a patient, a method of treatment may involve administration of vancomycin. In another example, if a Gram negative bacterium is detected in a biological sample derived from a patient, a method of treatment may involve administration of pipercillin-tazobactam. In another example, in some embodiments, if an Acinetobacter spp. (e.g., Acinetobacter baumannii) is detected in a biological sample derived from a patient, a method of treatment may involve administration of colistin, meropenem, and/or gentamicin. In another example, in some embodiments, if a Klebsiella spp. (e.g., Klebsiella pneumoniae) is detected in a biological sample derived from a patient, a method of treatment may involve administration of meropenem. In yet another example, in some embodiments, if a Pseudomonas spp. (e.g., Pseudomonas aeruginosa) is detected in a biological sample derived from a patient, a method of treatment may involve administration of pipercillin-tazobactam. In a further example, in some embodiments, if an Escherichia spp. (e.g., Escherichia coli) is detected in a biological sample derived from a patient, a method of treatment may involve administration of meropenem. In another example, in some embodiments, if an Enterococcus spp. (e.g., Enterococcus faecium) is detected in a biological sample derived from a patient, a method of treatment may involve administration of daptomycin.

    [0389] Table C below shows exemplary biothreats, FDA-approved therapies, and associated plasmid-based resistance gene(s). Any of the therapies listed in Table C may be used in the context of the invention. The presence of a resistance gene may indicate that the patient may benefit from a different therapy.

    TABLE-US-00003 TABLE C Exemplary Biothreats, FDA approved therapies, and associated resistance gene(s) Associated plasmid-based Biothreat FDA approved therapy resistance gene(s) B. anthracis Penicillin KPC, NDM, VIM, IMP, OXA-48, CMY, CTX-M, SHV, TEM Doxycycline and other tetracyclines tet Ciprofloxacin qnr Burkholderia spp. None, carbapenems clinically KPC, NDM, VIM, IMP, OXA-48, recommended CMY Yersinia pestis Doxycycline and other tetracyclines tet Ciprofloxacin/levofloxacin/moxifloxacin qnr Francisella tularensis Doxycycline and other tetracyclines tet Rickettsia prowazekii None, doxycycline clinically recommended tet

    [0390] Exemplary therapies for the treatment of carbapenem-resistant infections may include treatment with a core therapy, either as the sole therapeutic agent (monotherapy) or in combination with one or more adjunct drugs (combination therapy). Treatments can be delivered using any suitable administration route, for example, per os, by intramuscular injection, or intravenously by traditional infusion, prolonged infusion (e.g., over 4 hours), or continuous infusion.

    [0391] In general, monotherapies or core therapies for carbapenem-resistant infections that can be used include but are not limited to high-dose meropenem or doripenem, polymyxin B, colistin, tigecycline, ceftazidime-avibactam, meropenem-vaborbactam, aztreonam, and fosfomycin. Exemplary adjunct drugs include one or more of aminoglycosides, colistin, tigecycline, fosfomycin, gentamicin, tobramycin, amikacin, plazomicin, rimfampin, meropenem, doripenem, ertapenem, and imipenem.

    [0392] Exemplary monotherapies or core therapies for carbapenem-resistant infections of the bloodstream include high-dose meropenem or doripenem and polymyxin B. Suitable exemplary adjunct drugs for carbapenem-resistant infections of the bloodstream include one or more of an aminoglycoside, tigecycline, fosfomycin, and rimfampin.

    [0393] Exemplary monotherapies or core therapies for carbapenem-resistant infections of the lung include high-dose meropenem or doripenem and polymyxin B. Suitable exemplary adjunct drugs for carbapenem-resistant infections of the lung include one or more of an aminoglycoside, tigecycline, fosfomycin, and rimfampin.

    [0394] Exemplary monotherapies or core therapies for carbapenem-resistant infections of the gastrointestinal and/or biliary tract include high-dose meropenem or doripenem, polymyxin B, and high-dose tigecycline. Suitable exemplary adjunct drugs for carbapenem-resistant infections of the gastrointestinal and/or biliary tract include one or both of fosfomycin and rimfampin.

    [0395] Exemplary monotherapies or core therapies for carbapenem-resistant infections of the urinary tract include high-dose meropenem or doripenem, an aminoglycoside, and fosfomycin. Suitable exemplary adjunct drugs for carbapenem-resistant infections of the urinary tract include one or both of colistin and an aminoglycoside.

    [0396] High-dose meropenam can be defined as, e.g., 2000 mg q8h over 4 h by IV. High-dose doripenam can be defined as, e.g., 1000-2000 mg q8h over 4 h by IV. Ertapenem can be administered at, e.g., 1000 mg q24 h by IV. Gentamicin can be administered at., e.g., 5-10 mg/kg daily dose by IV. Tobramycin can be administered at., e.g., 5-10 mg/kg daily dose by IV. Amikacin can be administered at., e.g., 10-15 mg/kg daily dose by IV. Tigecycline can be administered at., e.g., 100-200 mg loading dose, then 50 mg q12 h mg/kg daily dose by IV. Fosfomycin can be administered at, e.g., 3 grams once or every 2-3 days per orum or 1-16 g daily by IV. Colistin can be administered at, e.g., 5 mg colistin base activity (CBA) per kg followed by maintenance doses of, e.g., 2.5-3 mg/kg per day. Polymyxin B can be administered at, e.g., 2-2.5 mg/kg followed by maintenance doses of, e.g., 2.5-3 mg/kg per day.

    [0397] In one example, the invention provides a method for identifying a patient infected with an antibiotic resistant biothreat pathogen, the method including: (a) providing a biological sample obtained from the subject; and (b) detecting the presence of an antibiotic resistance gene in the biological sample according to any of the methods described herein, wherein the presence of an antibiotic resistance gene in the biological sample obtained from the subject identifies the subject as one who may be infected with an antibiotic resistant biothreat pathogen. In some embodiments, the method further includes selecting an optimized anti-bacterial therapy for the patient based on the presence of the antibiotic resistance gene. In some embodiments, the method further includes administering the optimized anti-bacterial therapy to the patient. In some embodiments, the optimized anti-bacterial therapy includes one or more antibiotic agents are selected from the group consisting of an aminoglycoside, a beta-lactam (e.g., penicillin), a fluoroquinolone (e.g., ciprofloxacin, levofloxacin, or moxifloxacin), amikacin, streptomycin, a carbapenem, ceftazidime, amoxicillin/clavulanic acid, piperacillin, chloramphenicol, sulfathiazole, or a tetracycline antibiotic (e.g., doxycycline). The antibiotic agent may be administered as a monotherapy or as a combination therapy. The optimized antibacterial therapy may be administered to the patient by any suitable route, e.g., orally, intravenously, intramuscularly, intra-arterially, subcutaneously, or intraperitoneally.

    [0398] In another aspect, provided herein is a method of treating a patient infected with a biothreat pathogen, the method comprising: administering an optimized anti-bacterial therapy to a patient who has been identified by detection of the presence of a biothreat pathogen target nucleic acid in the biological sample according to any one of the methods disclosed herein.

    [0399] Systems and Cartridges

    [0400] The invention provides systems for carrying out the methods of the invention. The invention features methods and systems that may involve one or more cartridge units to provide a convenient method for placing all of the assay reagents and consumables onto the system. For example, the system may be customized to perform a specific function, or adapted to perform more than one function, e.g., via changeable cartridge units containing arrays of micro wells with customized magnetic particles contained therein. The system can include a replaceable and/or interchangeable cartridge containing an array of wells pre-loaded with magnetic particles, and designed for detection and/or concentration measurement of a particular analyte. Alternatively, the system may be usable with different cartridges, each designed for detection and/or concentration measurements of different analytes, or configured with separate cartridge modules for reagent and detection for a given assay. The cartridge may be sized to facilitate insertion into and ejection from a housing for the preparation of a liquid sample which is transferred to other units in the system (e.g., a magnetic assisted agglomeration unit, or an NMR unit). The cartridge unit itself can interface directly with manipulation stations as well as with the MR reader(s). The cartridge unit can be a modular cartridge having an inlet module that can be sterilized independent of the reagent module. The systems may include one or more NMR units, MAA units, cartridge units, and agitation units, as described in WO 2012/054639. Any of the systems described in WO 2012/054639 may be used for embodiments that involve T2MR detection, e.g., for providing group-level information to focus or narrow subsequent sequencing. For example, FIG. 42 of WO 2012/054639 depicts a system that can be used for embodiments involving T2MR detection. In some embodiments, the system stores a sample containing one or more amplified target nucleic acids for downstream sequencing.

    [0401] For example, in some embodiments, the systems include one or more sequencing units. In other embodiments, the system results in production of a sample that can be sequenced separately, for example, a sample that requires one or more further steps for sequencing (e.g., adaptor ligation and tagging). Such systems may further include other components for carrying out an automated assay of the invention, such as a thermocycling unit for the amplification of oligonucleotides; a centrifuge, a robotic arm for delivery an liquid sample from unit to unit within the system; one or more incubation units; a fluid transfer unit (i.e., pipetting device) for combining assay reagents and a biological sample (e.g., a biological sample containing cells and/or cell debris including but not limited to blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), tissue samples (e.g., tissue biopsies, including homogenized tissue samples), urine, BAL, CSF, SF, or sputum) to form the liquid sample; a computer with a programmable processor for storing data, processing data, and for controlling the activation and deactivation of the various units according to a one or more preset protocols; and a cartridge insertion system for delivering pre-filled cartridges to the system, optionally with instructions to the computer identifying the reagents and protocol to be used in conjunction with the cartridge.

    [0402] The sequencing unit may include any system or device that is known in the art for sequencing, e.g., massively parallel sequencing, long-read sequencing, or Sanger sequencing. Exemplary sequencing devices include but are not limited to ILLUMINA® systems (e.g., the ILLUMINA® iSeq 100 system, MiniSeq® system, MiSeq® systems, NextSeq® series platforms, HiSeq® series platforms, HiSeq X® series platforms, and NovaSeq® 6000 system); the BGISEQ-500 system; the 10× Genomics Chromium™ system; Ion Torrent sequencing systems (e.g., Ion PGM™, Ion Proton™, Ion S5™, and Ion S5 XL); Oxford Nanopore systems (e.g., MinION and PromethION); Pacific Biosystems systems (e.g., PacBio RS II or PacBio Sequel); and the Roche 454 system. Other sequencing systems are known in the art.

    [0403] The systems of the invention can provide an effective means for high throughput detection and/or sequencing of analytes present in sample, e.g., an environmental sample or a biological sample from a subject. The detection methods may be used in a wide variety of circumstances including, without limitation, sequencing of nucleic acids, identification and/or quantification of analytes that are associated with specific biological processes, physiological conditions, disorders or stages of disorders. As such, the systems have a broad spectrum of utility in, for example, disease diagnosis, identification of biothreat pathogens and/or drug resistance (e.g., antibiotic resistance), disease onset and recurrence, individual response to treatment versus population bases, and monitoring of therapy. The devices and systems can provide a flexible system for personalized medicine. The system of the invention can be changed or interchanged along with a protocol or instructions to a programmable processor of the system to perform a wide variety of assays as described herein. The systems of the invention offer many advantages of a laboratory setting contained in a desk-top or smaller size automated instrument.

    [0404] The invention provides methods and systems that may involve one or more cartridge units to provide a convenient method for placing all of the assay reagents (e.g., sequencing reagents) and consumables onto the system. For example, the cartridge units can include reagents for sequencing.

    [0405] Such reagents include, e.g., library preparation reagents (e.g., tagmentation reagents such as NEXTERA® XT library preparation reagents), buffers, adaptors, primers, enzymes (e.g., thermostable polymerases), and the like. The system can include a replaceable and/or interchangeable cartridge containing an array of wells pre-loaded, e.g., with sequencing reagents or magnetic particles, and designed for detection and/or sequencing of a particular analyte, e.g., a particular target nucleic acid. Alternatively, the system may be usable with different cartridges, each designed for detection and/or concentration measurements of different analytes, or configured with separate cartridge modules for reagent and detection for a given assay. The cartridge may be sized to facilitate insertion into and ejection from a housing for the preparation of a liquid sample which is transferred to other units in the system (e.g., a sequencing unit or an NMR unit). Any of the cartridges described in WO 2012/054639 can be used in the methods and systems described herein.

    [0406] For example, provided herein is a system for the detection of one or more antibiotic resistance genes, the system including: (a) a first unit including (i) a permanent magnet defining a magnetic field; (ii) a support defining a well holding a liquid sample including magnetic particles having a mean particle diameter between 700 and 1200 nm, preferably between 650 and 950 nm, and the one or more antibiotic resistance genes and having an RF coil disposed about the well, the RF coil configured to detect a signal produced by exposing the liquid sample to a bias magnetic field created using the permanent magnet and an RF pulse sequence; and (iii) one or more electrical elements in communication with the RF coil, the electrical elements configured to amplify, rectify, transmit, and/or digitize the signal; and (b) a second unit including a removable cartridge sized to facilitate insertion into and removal from the system, wherein the removable cartridge is a modular cartridge including (i) a reagent module for holding one or more assay reagents, (ii) a detection module including a detection chamber for holding a liquid sample including the magnetic particles and the one or more analytes, and, optionally, (iii) a sterilizable inlet module, wherein the reagent module, the detection module, and, optionally, the sterilizable inlet module, can be assembled into the modular cartridge prior to use, and wherein the detection chamber is removable from the modular cartridge, preferably, wherein the system further includes a system computer with processor for implementing an assay protocol and storing assay data, and wherein the removable cartridge further includes (i) a readable label indicating the analyte to be detected, (ii) a readable label indicating the assay protocol to be implemented, (iii) a readable label indicating a patient identification number, (iv) a readable label indicating the position of assay reagents contained in the cartridge, or (v) a readable label including instructions for the programmable processor.

    [0407] A modular cartridge can provide a simple means for cross contamination control during certain assays, including but not limited to distribution of amplification (e.g., PCR) products into multiple detection or sequencing aliquots. In addition, a modular cartridge can be compatible with automated fluid dispensing, and provides a way to hold reagents at very small volumes for long periods of time (in excess of a year). Finally, pre-dispensing these reagents allows concentration and volumetric accuracy to be set by the manufacturing process and provides for a point of care use instrument that is more convenient as it can require much less precise pipetting.

    [0408] The modular cartridge can be designed for a multiplexed assay. The challenge in multiplexing assays is combining multiple assays which have incompatible assay requirements (i.e., different incubation times and/or temperatures) on one cartridge. The cartridge format depicted in FIGS. 14A-14C of WO 2012/054639 allows for the combination of different assays with dramatically different assay requirements. The cartridge features two main components: (i) a reagent module (i.e., the reagent strip portion) that contains all of the individual reagents required for the full assay panel (for example, a panel as described below), and (ii) the detection module. In some embodiments, a cartridge may be configured to detect and/or sequence from 2 to 24 or more target nucleic acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or more target nucleic acids), such as drug (e.g., antibiotic) resistance genes. In some embodiments, a cartridge may be configured to detect and/or sequence target nucleic acids from 2 to 24 or more pathogens (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or more pathogens). The detection modules contain only the parts of the cartridge that carry through the incubation, and can carry single assays or several assays, as needed.

    [0409] The cartridge units can further include one or more populations of magnetic particles, either as a liquid suspension or dried magnetic particles which are reconstituted prior to use. For example, the cartridge units of the invention can include a compartment including from 1×10.sup.6 to 1×10.sup.13 magnetic particles (e.g., from 1×10.sup.6 to 1×10.sup.8, 1×10.sup.7 to 1×10.sup.9, 1×10.sup.8 to 1×10.sup.10, 1×10.sup.9 to 1×10.sup.11, 1×10.sup.10 to 1×10.sup.12, 1×10.sup.11 to 1×10.sup.13, or from 1×10.sup.7 to 5×10.sup.8 magnetic particles) for assaying a single liquid sample.

    [0410] Magnetic Particles and T2MR

    [0411] In some embodiments, the methods and systems of the invention may involve use of magnetic particles and NMR (e.g., T2MR). For example, T2MR can be used, for example, to rapidly and sensitively detect a target nucleic acid (e.g., an antibiotic resistance gene) and/or to obtain group-level information regarding a target nucleic acid, which can be used to narrow or focus sequencing analysis. The magnetic particles can be coated with a binding moiety (e.g., oligonucleotide, antibody, and the like) such that in the presence of analyte, or multivalent binding agent, aggregates are formed. Aggregation depletes portions of the sample from the microscopic magnetic non-uniformities that disrupt the solvent's T.sub.2 signal, leading to an increase in T.sub.2 relaxation (see, e.g., FIG. 3 of International Patent Application Publication No. WO 2012/054639, which is incorporated herein by reference in its entirety). Any NMR-based detection approach described in WO 2012/054639 may be used in the methods and systems described herein.

    [0412] The T.sub.2 measurement is a single measure of all spins in the ensemble, measurements lasting typically 1-10 seconds, which allows the solvent to travel hundreds of microns, a long distance relative to the microscopic non-uniformities in the liquid sample. Each solvent molecule samples a volume in the liquid sample and the T.sub.2 signal is an average (net total signal) of all (nuclear spins) on solvent molecules in the sample; in other words, the T.sub.2 measurement is a net measurement of the entire environment experienced by a solvent molecule, and is an average measurement of all microscopic non-uniformities in the sample.

    [0413] The observed T.sub.2 relaxation rate for the solvent molecules in the liquid sample is dominated by the magnetic particles, which in the presence of a magnetic field form high magnetic dipole moments. In the absence of magnetic particles, the observed T.sub.2 relaxation rates for a liquid sample are typically long (i.e., T.sub.2 (water)=approximately 2000 ms, T.sub.2 (blood)=approximately 1500 ms). As particle concentration increases, the microscopic non-uniformities in the sample increase and the diffusion of solvent through these microscopic non-uniformities leads to an increase in spin decoherence and a decrease in the T.sub.2 value. The observed T.sub.2 value depends upon the particle concentration in a non-linear fashion, and on the relaxivity per particle parameter.

    [0414] In embodiments that involve NMR detection, e.g., to provide rapid and sensitive detection and/or to obtain initial group-level information, the number of magnetic particles, and if present the number of agglomerant particles, remain constant during the assay. The spatial distribution of the particles changes when the particles cluster. Aggregation changes the average “experience” of a solvent molecule because particle localization into clusters is promoted rather than more even particle distributions. At a high degree of aggregation, many solvent molecules do not experience microscopic non-uniformities created by magnetic particles and the T.sub.2 approaches that of solvent. As the fraction of aggregated magnetic particles increases in a liquid sample, the observed T.sub.2 is the average of the non-uniform suspension of aggregated and single (unaggregated) magnetic particles. The assays of the invention are designed to maximize the change in T.sub.2 with aggregation to increase the sensitivity of the assay to the presence of analytes, and to differences in analyte concentration.

    [0415] In one example, provided herein is a magnetic particle conjugated to a nucleic acid probe, wherein the nucleic acid probe is specific for a biothreat pathogen target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, or Rickettsia prowazekii. In some embodiments, the magnetic particle further includes an additional nucleic acid probe, wherein the second nucleic acid probe is specific for a second biothreat pathogen target nucleic acid characteristic of Bacillus anthracis pX01 plasmid, Bacillus anthracis pX02 plasmid, Francisella tularensis, Burkholderia spp., Yersinia pestis, or Rickettsia prowazekii.

    [0416] In some embodiments, the nucleic acid probe and, optionally, the additional nucleic acid probe, comprises a nucleic acid sequence selected from SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24, or a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs:13-24.

    [0417] In another aspect, provided herein is a magnetic particle or population of magnetic particles which is conjugated to one or more of the following: (i) a probe pair comprising a 5′ probe comprising the nucleotide sequence CCGCTATCCGCCTTTCTACCAG (SEQ ID NO: 13) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 13 and a 3′ probe comprising the nucleotide sequence GTATCCACCCTCACTCTTCCATTTTC (SEQ ID NO: 14) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 14; (ii) a probe pair comprising a 5′ probe comprising the nucleotide sequence CATTTGCTTGAATCATTTTATTTTGGAAG (SEQ ID NO: 15) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 15 and a 3′ probe comprising the nucleotide sequence TTAATCGGTTGCTCCTCGTCAGTA (SEQ ID NO: 16) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 16; (iii) a probe pair comprising a 5′ probe comprising the nucleotide sequence AACCTTCTGGAGCCTGCCATT (SEQ ID NO: 17) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 17 and a 3′ probe comprising the nucleotide sequence GCAGCAGCAGTATCTTTAGCTGA (SEQ ID NO: 18) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 18; (iv) a probe pair comprising a 5′ probe comprising the nucleotide sequence TCGCCGCGGTAAAGAACCGTAC (SEQ ID NO: 19) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 19 and a 3′ probe comprising the nucleotide sequence GACCGTCAGGGCCGCACG (SEQ ID NO: 20) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 20; (v) a probe pair comprising a 5′ probe comprising the nucleotide sequence AAATACCGGCAGCATCTCCG (SEQ ID NO: 21) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 21 and a 3′ probe comprising the nucleotide sequence GGTTAATTACGGTACCATAATAACGTG (SEQ ID NO: 22) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 22; and/or (vi) a probe pair comprising a 5′ probe comprising the nucleotide sequence GCATCAAACTCAATAATTATAGCTTTAGTACC (SEQ ID NO: 23) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 23 and a 3′ probe comprising the nucleotide sequence CGGACGCAAAACTCAATAACACCATAC (SEQ ID NO: 24) or a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 24.

    [0418] In some embodiments, the magnetic particle or the population of magnetic particles is conjugated to one or more of the following: (i) a probe pair comprising a 5′ probe comprising the nucleotide sequence CCGCTATCCGCCTTTCTACCAG (SEQ ID NO: 13) and a 3′ probe comprising the nucleotide sequence GTATCCACCCTCACTCTTCCATTTTC (SEQ ID NO: 14); (ii) a probe pair comprising a 5′ probe comprising the nucleotide sequence CATTTGCTTGAATCATTTTATTTTGGAAG (SEQ ID NO: 15) and a 3′ probe comprising the nucleotide sequence TTAATCGGTTGCTCCTCGTCAGTA (SEQ ID NO: 16); (iii) a probe pair comprising a 5′ probe comprising the nucleotide sequence AACCTTCTGGAGCCTGCCATT (SEQ ID NO: 17) and a 3′ probe comprising the nucleotide sequence GCAGCAGCAGTATCTTTAGCTGA (SEQ ID NO: 18); (iv) a probe pair comprising a 5′ probe comprising the nucleotide sequence TCGCCGCGGTAAAGAACCGTAC (SEQ ID NO: 19) and a 3′ probe comprising the nucleotide sequence GACCGTCAGGGCCGCACG (SEQ ID NO: 20); (v) a probe pair comprising a 5′ probe comprising the nucleotide sequence AAATACCGGCAGCATCTCCG (SEQ ID NO: 21) and a 3′ probe comprising the nucleotide sequence GGTTAATTACGGTACCATAATAACGTG (SEQ ID NO: 22); and/or (vi) a probe pair comprising a 5′ probe comprising the nucleotide sequence GCATCAAACTCAATAATTATAGCTTTAGTACC (SEQ ID NO: 23) and a 3′ probe comprising the nucleotide sequence CGGACGCAAAACTCAATAACACCATAC (SEQ ID NO: 24).

    [0419] For example, provided herein is a magnetic particle conjugated to a nucleic acid probe, wherein the nucleic acid probe is specific for an antibiotic resistance gene selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC. In some embodiments, the magnetic particle further includes an additional nucleic acid probe, wherein the additional nucleic acid probe is specific for a second antibiotic resistance gene selected from the group consisting of KPC, NDM, VIM, IMP, OXA-48-like, CMY, CTX-M 14, CTX-M 15, Qnr, Tet, otr, tcr3, qepAB, opxAB, gyrA, gyrB, and parC.

    [0420] In some embodiments, the methods of the invention involve contacting a solution (e.g., a sample, e.g., a liquid sample, that includes whole blood or a crude whole blood lysate) with between from 1×10.sup.6 to 1×10.sup.13 magnetic particles per milliliter of the liquid sample (e.g., from 1×10.sup.6 to 1×10.sup.8, 1×10.sup.7 to 1×10.sup.8, 1×10.sup.7 to 1×10.sup.9, 1×10.sup.8 to 1×10.sup.10, 1×10.sup.9 to 1×10.sup.11, or 1×10.sup.10 to 1×10.sup.13 magnetic particles per milliliter).

    [0421] In some embodiments, the magnetic particles used in the methods and systems of the invention have a mean diameter of from 150 nm to 1200 nm (e.g., from 150 to 250, 200 to 350, 250 to 450, 300 to 500, 450 to 650, 500 to 700 nm, 700 to 850, 800 to 950, 900 to 1050, or from 1000 to 1200 nm). For example, in some embodiments, the magnetic particles used in the methods of the invention may have a mean diameter of from 150 nm to 699 nm (e.g., from 150 to 250, 200 to 350, 250 to 450, 300 to 500, 450 to 650, or from 500 to 699 nm). In other embodiments, the magnetic particles used in the methods of the invention may have a mean diameter of from 700 nm to 1200 nm (e.g., from 650 to 850, 650 to 950, 650 to 1050, 650 to 1200, 700 to 850, 800 to 950, 900 to 1050, or from 1000 to 1200 nm). In particular embodiments, the magnetic particles may have a mean diameter of from 700 nm to 950 nm (e.g., from 700 to 750, 700 to 800, 700 to 850, or from 700 to 900 nm).

    [0422] In some embodiments, the magnetic particles used in the methods of the invention may have a T.sub.2 relaxivity per particle of from 1×10.sup.8 to 1×10.sup.12 mM.sup.−1s.sup.1 (e.g., from 1×10.sup.8 to 1×10.sup.9, 1×10.sup.8 to 1×10.sup.10, 1×10.sup.9 to 1×10.sup.10, 1×10.sup.9 to 1×10.sup.11, or from 1×10.sup.10 to 1×10.sup.12 mM.sup.−1s.sup.1). In some embodiments, the magnetic particles have a T.sub.2 relaxivity per particle of from 1×10.sup.9 to 1×10.sup.12 mM.sup.−1s.sup.−1 (e.g., from 1×10.sup.9 to 1×10.sup.10, 1×10.sup.9 to 1×10.sup.11, or from 1×10.sup.10 to 1×10.sup.12 mM.sup.−1s.sup.−1).

    [0423] In some embodiments, the magnetic particles may be substantially monodisperse. In some embodiments, the magnetic particles in a liquid sample (e.g., a biological sample containing cells and/or cell debris, including but not limited to blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), tissue samples (e.g., tissue biopsies (e.g., skin biopsies, muscle biopsies, or lymph node biopsies), including homogenized tissue samples), urine, BAL, or sputum) may exhibit nonspecific reversibility in the absence of the one or more analytes and/or multivalent binding agent. In some embodiments, the magnetic particles may further include a surface decorated with a blocking agent selected from albumin, fish skin gelatin, gamma globulin, lysozyme, casein, peptidase, and an amine-bearing moiety (e.g., amino polyethyleneglycol, glycine, ethylenediamine, or amino dextran.

    [0424] The above methods can be used with any of the following categories of detection of aggregation or disaggregation described herein, including those described in WO 2012/054639, e.g., at pages 110-111.

    [0425] Assay Reagents

    [0426] The methods and compositions (e.g., systems, devices, kits, or cartridges) described herein may include any suitable reagents, for example, magnetic particles, surfactants, buffer components, additives, chelating agents, and the like. The surfactant may be selected from a wide variety of soluble non-ionic surface active agents including surfactants that are generally commercially available under the IGEPAL® trade name from GAF Company. The IGEPAL® liquid non-ionic surfactants are polyethylene glycol p-isooctylphenyl ether compounds and are available in various molecular weight designations, for example, IGEPAL® CA720, IGEPAL® CA630, and IGEPAL® CA890. Other suitable non-ionic surfactants include those available under the trade name TETRONIC® 909 from BASF Corporation. This material is a tetra-functional block copolymer surfactant terminating in primary hydroxyl groups. Suitable non-ionic surfactants are also available under the ALPHONIC® trade name from Vista Chemical Company and such materials are ethoxylates that are non-ionic biodegradables derived from linear primary alcohol blends of various molecular weights. The surfactant may also be selected from poloxamers, such as polyoxyethylene-polyoxypropylene block copolymers, such as those available under the trade names SYNPERONIC® PE series (ICI), PLURONIC® series (BASF), Supronic, MONOLAN®, PLURACARE®, and PLURODAC®, polysorbate surfactants, such as TWEEN® 20 (PEG-20 sorbitan monolaurate), and glycols such as ethylene glycol and propylene glycol.

    [0427] Such non-ionic surfactants may be selected to provide an appropriate amount of detergency for an assay without having a deleterious effect on assay reactions. In particular, surfactants may be included in a reaction mixture for the purpose of suppressing non-specific interactions among various ingredients of the aggregation assays of the invention. The non-ionic surfactants are typically added to the liquid sample prior in an amount from 0.01% (w/w) to 5% (w/w).

    [0428] The non-ionic surfactants may be used in combination with one or more proteins (e.g., albumin, fish skin gelatin, lysozyme, or transferrin) also added to the liquid sample prior in an amount from 0.01% (w/w) to 5% (w/w).

    [0429] Furthermore, the assays, methods, and cartridge units of the invention can include additional suitable buffer components (e.g., Tris base, selected to provide a pH of about 7.8 to 8.2 in the reaction milieu); and chelating agents to scavenge cations (e.g., ethylene diamine tetraacetic acid (EDTA), EDTA disodium, citric acid, tartaric acid, glucuronic acid, saccharic acid or suitable salts thereof).

    [0430] Contamination Control

    [0431] One potential problem in the use of amplification methods such as PCR as an analytical tool is the risk of having new reactions contaminated with old, amplified products. Such contamination could potentially affect downstream sequencing results as well. Potential sources of contamination include a) large numbers of target organisms in clinical specimens that may result in cross-contamination, b) plasmid clones derived from organisms that have been previously analyzed and that may be present in larger numbers in the laboratory environment, and c) repeated amplification of the same target sequence leading to accumulation of amplification products in the laboratory environment. A common source of the accumulation of the PCR amplicon is aerosolization of the product. Typically, if uncontrolled aerosolization occurs, the amplicon will contaminate laboratory reagents, equipment, and ventilation systems. When this happens, all reactions will be positive, and it is not possible to distinguish between amplified products from the contamination or a true, positive sample. In addition to taking precautions to avoid or control this carry-over of old products, preferred embodiments include a blank reference reaction in every PCR experiment to check for carry-over. For example, carry-over contamination will be visible on the agarose gel as faint bands or fluorescent signal when TaqMan® probes, MolBeacons®, or intercalating dyes, among others, are employed as detection mechanisms. Furthermore, it is preferred to include a positive sample. As an example, in some embodiments, contamination control is performed using any of the approaches and methods described in WO 2012/054639. In some embodiments, a bleach solution is used to neutralize potential amplicons, for example, in a reaction tube of a T2Dx® device being used to perform a method of the invention. In some embodiments, contamination control includes the use of ethylene oxide (EtO) treatment, for example, of cartridge components.

    [0432] Typically, the instrumentation and processing areas for samples that undergo amplification are split into pre- and post-amplification zones. This minimizes the chances of contamination of samples with amplicon prior to amplification. For example, the T2DX® instrument design is such that the pre- and post-amplification instrumentation and processing areas are integrated into a single instrument. This is made possible as described in the sections below.

    [0433] Amplifying Multiple Amplicons Characteristic of a Target for Improved Sensitivity and/or Specificity

    [0434] In some embodiments, the methods of the invention may involve amplification and detection of more than one amplicon characteristic of a target in a biological sample containing cells and/or cell debris including but not limited to blood (e.g., whole blood, a crude whole blood lysate, serum, or plasma), bloody fluids (e.g., wound exudate, phlegm, bile, and the like), tissue samples (e.g., tissue biopsies, including homogenized tissue samples), urine, CSF, SF, or sputum. In some embodiments, amplification of more than one target nucleic acid characteristic of a target increases the total amount of amplicons characteristic of the target in an assay (in other words, the amount of analyte is increased in the assay). This increase may allow, for example, an increase in sensitivity and/or specificity of detection of the target compared to a method that involves amplification and detection of a single amplicon characteristic of a target, e.g., for T2MR detection. In some embodiments, the methods of the invention may involve amplifying 2, 3, 4, 5, 6, 7, 8, 9, or 10 amplicons characteristic of a biothreat species (e.g., Bacillus anthracis, Francisella tularensis, Burkholderia spp. (e.g., B. mallei and/or B. pseudomallei), Yersinia pestis, and/or Rickettsia prowazekii.

    [0435] In some embodiments, multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) single-copy loci from a target are amplified and detected. In some embodiments, 2 single-copy loci from a target are amplified and detected. In some embodiments, amplification and detection of multiple single-copy loci from a species may allow for a sensitivity of detection comparable with methods that involve detecting an amplicon that is derived from a multi-copy locus. In some embodiments, methods involving detection of multiple single-copy loci amplified from a microbial species can detect from about 1-10 cells/mL (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cells/mL) of the microbial species in a liquid sample. In some embodiments, methods involving detection of multiple single-copy loci amplified from a target have at least 95% correct detection when the microbial species is present in the liquid sample at a frequency of less than or equal to 5 cells/mL (e.g., 1, 2, 3, 4, or 5 cells/mL) of liquid sample.

    [0436] The invention also provides embodiments in which at least three amplicons are produced by amplification of two target nucleic acids, each of which is characteristic of a target. For example, in some embodiments, a first target nucleic acid and a second target nucleic acid to be amplified may be separated (for example, on a chromosome or on a plasmid) by a distance ranging from about 50 base pairs to about 1000 1500 base pairs (bp), e.g., about 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, or 1000, 1100, 1200, 1300, 1400, or 1500 bp base pairs. In some embodiments, a first target nucleic acid and a second target nucleic acid to be amplified may be separated (for example, on a chromosome or on a plasmid) by a distance ranging from about 50 bp to about 1000 bp (e.g., about 50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, or 1000 bp). In some embodiments the first target nucleic acid and the second target nucleic acid to be amplified may be separated by a distance ranging from about 50 bp to about 1500 bp, from about 50 bp to about 1400 bp, from about 50 bp to about 1300 bp, from about 50 bp to about 1200 bp, from about 50 bp to about 1100 bp, from about 50 bp to about 1000 bp, from about 50 bp to about 950 bp, from about 50 bp to about 900 bp, from about 50 bp to about 850 bp, from about 50 bp to about 800 bp, from about 50 bp to about 800 bp, from about 50 bp to about 750 bp, from about 50 bp to about 700 bp, from about 50 bp to about 650 bp, from about 50 bp to about 600 bp, from about 50 bp to about 550 bp, from about 50 bp to about 500 bp, from about 50 bp to about 500 bp, from about 50 bp to about 450 bp, from about 50 bp to about 400 bp, from about 50 bp to about 350 bp, from about 50 bp to about 300 bp, from about 50 bp to about 250 bp, from about 50 bp to about 200 bp, from about 50 bp to about 150 bp, or from about 50 bp to about 100 bp. In some embodiments, amplification of the first and second target nucleic acids using individual primer pairs (each having a forward and a reverse primer) may lead to amplification of an amplicon that includes the first target nucleic acid, an amplicon that includes the second target nucleic acid, and an amplicon that contains both the first and the second target nucleic acid. This may result in an increase in sensitivity of detection of the target compared to samples in which the third amplicon is not present. In any of the preceding embodiments, amplification may be by asymmetric PCR.

    [0437] The invention provides magnetic particles decorated with nucleic acid probes to detect two or more amplicons characteristic of a target. For example, in some embodiments, the magnetic particles include two populations, wherein each population is conjugated to probes such that the magnetic particle that can operably bind each of the two or more amplicons. For instance, in embodiments where two target nucleic acids have been amplified to form a first amplicon and a second amplicon, a pair of particles each of which have a mix of capture probes on their surface may be used. In some embodiments, the first population of magnetic particles may be conjugated to a nucleic acid probe that operably binds a first segment of the first amplicon and a nucleic acid probe that operably binds a first segment of the second amplicon, and the second population of magnetic particles may be conjugated to a nucleic acid probe that operably binds a second segment of the first amplicon and a nucleic acid probe that operably binds a second segment of the second amplicon. For instance, one particle population may be conjugated with a 5′ capture probe specific to the first amplicon and a 5′ capture probe specific to second amplicon, and the other particle population may be conjugated with a 3′ capture probe specific to the first amplicon and a 3′ capture probe specific to the second amplicon.

    [0438] In such embodiments, the magnetic particles may aggregate in the presence of the first amplicon and aggregate in the presence of the second amplicon. Aggregation may occur to a greater extent when both amplicons are present.

    [0439] In some embodiments, a magnetic particle may be conjugated to two, three, four, five, six, seven, eight, nine, or ten nucleic acid probes, each of which operably binds a segment of a distinct target nucleic acid. In some embodiments, a magnetic particle may be conjugated to a first nucleic acid probe and a second nucleic acid probe, wherein the first nucleic acid probe operably binds to a first target nucleic acid, and the second nucleic acid probe operably binds to a second target nucleic acid. In other embodiments, a magnetic particle may be conjugated to a first nucleic acid probe that operably binds a first target nucleic acid, a second nucleic acid probe that operably binds a second target nucleic acid, and a third nucleic acid that operably binds a third target nucleic acid. In yet other embodiments, a magnetic particle may be conjugated to a first nucleic acid probe that operably binds a first target nucleic acid, a second nucleic acid probe that operably binds a second target nucleic acid, a third nucleic acid that operably binds a third target nucleic acid, and a fourth nucleic acid probe that operably binds a fourth target nucleic acid. In still other embodiments, a magnetic particle may be conjugated to a first nucleic acid probe that operably binds a first target nucleic acid, a second nucleic acid probe that operably binds a second target nucleic acid, a third nucleic acid that operably binds a third target nucleic acid, a fourth nucleic acid probe that operably binds a fourth target nucleic acid, and a fifth nucleic acid probe that operably binds a fifth target nucleic acid. In some embodiments, one population of magnetic particles includes the 5′ capture probe for each amplicon to be detected, and the other population of magnetic particles includes the 3′ capture probe for each amplicon to be detected.

    [0440] Kits

    [0441] The invention provides kits and articles of manufacture that can be used for carrying out the methods described herein. The kit may include one or more containers for holding the components of the kit (e.g., tubes (e.g., microcentrifuge tubes), plates (e.g., microtiter plates), trays, packaging materials (e.g., boxes), and the like. The kit may also include instructions (e.g., printed instructions for using the kit).

    [0442] For example, a kit may include one or more, or all, of the following: one or more containers (e.g., tubes) that contain erythrocyte lysis buffers, one or more containers containing buffers or buffered solutions (e.g., TE buffer); one or more containers that contain primers (e.g., any of the primers described herein), one or more containers that contain control nucleic acids or total process controls, one or more containers containing lysis reagents (e.g., beads for beadbeating), and/or one or more containers containing amplification reagents (e.g., buffers, thermostable DNA polymerases, nucleotides, magnesium (e.g., MgCl.sub.2), and the like). The kit may further include reagents for sequencing (e.g., buffers, library preparation reagents, enzymes, adaptors, and the like). The kit may further include reagents for T2MR detection (e.g., magnetic particles, probes, conjugated magnetic particles, and the like).

    [0443] Primers and Probes

    [0444] The invention provides primers and/or probes that can be used, e.g., in the methods, systems, cartridges, and kits disclosed herein.

    [0445] For example, provided herein is a primer comprising a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or a sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to any one of SEQ ID NOs: 1-12.

    [0446] In another example, provided herein is a primer pair comprising a forward primer and a reverse primer selected from: (i) a forward primer comprising the nucleotide sequence CGGATCAAGTATATGGGAATATAGCAACATAC (SEQ ID NO: 1) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 1 and a reverse primer comprising the nucleotide sequence TTTTAAGGGCTTCTTTTAATGTCATATCCGG (SEQ ID NO: 2) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 2; (ii) a forward primer comprising the nucleotide sequence ACAACTGGTACATCTGCGCGAATGA (SEQ ID NO: 3) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 3 and a reverse primer comprising the nucleotide sequence GTAGGTCCCATAACATCCATATGATCTTCT (SEQ ID NO: 4) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 4; (iii) a forward primer comprising the nucleotide sequence TTTTATCTTTATCAATCGCAGGTTTAGCGAG (SEQ ID NO: 5) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 5 and a reverse primer comprising the nucleotide sequence CCCAAGTTTTATCGTTCTTCTCAGCATAC (SEQ ID NO: 6) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 6; (iv) a forward primer comprising the nucleotide sequence TTGGCGGTACAGAATCTGTCGG (SEQ ID NO: 7) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 7 and a reverse primer comprising the nucleotide sequence AGGCACATACCGAGCGCGA (SEQ ID NO: 8) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 8; (v) a forward primer comprising the nucleotide sequence ATGAGAGATCTTACTTTCCGTGAGAAG (SEQ ID NO: 9) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 9 and a reverse primer comprising the nucleotide sequence ATATTGCAGACCCGCCGTCACAGTAT (SEQ ID NO: 10) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 10; and/or (vi) a forward primer comprising the nucleotide sequence CTTGGGATAAAATGCCAAGGTAGATTTGG (SEQ ID NO: 11) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 11 and a reverse primer comprising the nucleotide sequence TCCAATAAAAATTTAGCCTTTTCATTGCTGGG (SEQ ID NO: 12) or a nucleotide sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to SEQ ID NO: 12.

    [0447] In another aspect, provided herein is a composition comprising any one of the primers or primer pairs disclosed herein. In some embodiments, the composition further comprises one or more additional reagents selected from a buffering agent, a thermostable DNA polymerase, deoxyribonucleotides (dNTPs), and MgCl.sub.2.

    [0448] In another aspect, provided herein is a probe comprising a nucleotide sequence selected from SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or a sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to any one of SEQ ID NOs: 13-24.

    [0449] Any of the primers and/or probes disclosed herein may further include a detectable label. Any suitable detectable label(s) may be used. For example, any detectable label described in U.S. Provisional Patent Application No. 63/008,379, which is incorporated by reference herein in its entirety, may be used. For example, the detectable label may include a fluorescent probe (e.g., a molecular beacon). Any suitable fluorescent probe may be used. The fluorescent probe may include a fluorescent dye, e.g., fluorescein, rhodamine, coumarin, BODIPY, Cascade Blue, Lucifer Yellow, a cyanine dye derivative, and the like. The probe may be, for example, an oligonucleotide hybridization probe, a molecular beacon, a SCORPION® probe, a hydrolysis probe, or a FRET hybridization probe.

    [0450] Any suitable molecular beacon may be used. For example, in some instances, the molecular beacon includes an organic dye fluorophore (e.g., FAM, HEX, Cy5, ROX, TAMARA, or Cy5.5). In other instances, the molecular beacon may include a quantum dot. In some instances, any of the molecular beacons may include an organic dye quencher (e.g., Black Hole Quencher 1, Black Hole Quencher 2, Iowa Black FQ, or Iowa Black RQ) or a gold nanoparticle or silica nanoparticle quencher.

    EXAMPLES

    [0451] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the devices, systems, and methods described herein are performed, made, and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention.

    Example 1: T2Biothreat Panels

    [0452] Assays for detection of important biothreat pathogens were developed to achieve detection of these pathogens at a concentration of <10 CFU/mL from human blood samples. These panels can be run, for example, on the T.sub.2DX® instrument or on other automated devices. In other examples, sequencing-based approaches can be used to detect the members of the panels. One exemplary panel is shown below in Table 1. For Bacillus anthracis, two toxin genes can be detected to specifically identify infectious, pathogenic strains.

    TABLE-US-00004 TABLE 1 Exemplary Biothreat Panel Species Comments Bacillus anthracis Toxin genes detected (on pX01 and pX02 plasmids) Francisella tularensisBurkholderia spp. — (B. mallei, B. pseudomallei) Yersinia pestisRickettsia prowazekii

    [0453] The panel may detect B. anthracis protective antigen (pag) on the pX01 plasmid. An exemplary nucleic acid encoding B. anthracis pX01 pag is provided in GenBank Accession No. M22589.1, which is incorporated by reference herein in its entirety.

    [0454] The panel may detect B. anthracis capB on the pX02 plasmid. An exemplary nucleic acid encoding capB is provided in GenBank Accession No. CP001597.1, which is incorporated by reference herein in its entirety.

    [0455] The panel may detect F. tularensis lipoprotein. An exemplary nucleic acid encoding F. tularensis lipoprotein is provided in GenBank Accession No. AM233362, which is incorporated herein by reference in its entirety, at position: 388817-389266.

    [0456] The panel may detect a 16S rRNA gene characteristic of both B. pseudomallei and B. mallei. An exemplary B. pseudomallei 16S rRNA gene is provided in GenBank Accession No. CP018415.1, which is incorporated herein by reference in its entirety, at position: 1161197-1161762. An exemplary B. mallei 16S rRNA gene is provided in GenBank Accession No. CP010066.1, which is incorporated herein by reference in its entirety, at position: 1617484-1618049.

    [0457] The panel may detect Y. pestis plasminogen. An exemplary nucleic acid encoding Y. pestis plasminogen is provided in GenBank Accession No. KJ361945.1, which is incorporated by reference herein in its entirety.

    [0458] The panel may detect R. prowazekii citrate synthase. An exemplary nucleic acid encoding R. prowazekii citrate synthase is provided in GenBank Accession No. CP014865.1, which is incorporated herein by reference in its entirety, at position: 1062793-1064103.

    [0459] We designed primers and T2MR probes against gene fragments for one exemplary panel of biothreat organisms (Tables 2 and 3), then spiked 25 to 1000 copies per reaction of synthetic DNA gene fragments into blood. Other primers and probes can be used. The panel used in this experiment did not include amplification or detection of a target characteristic of the pX02 plasmid for B. anthracis. We found 100% detection with all 5 species and at all copy levels tested in singleplex and multiplex (Table 4). This result highlights the capability of biothreat panels to rapidly detect these biothreats in complex samples (e.g., blood samples).

    TABLE-US-00005 TABLE 2 Primers for Exemplary Panel Biothreat SEQ ID Species Gene Primer Sequence NO. B. anthracis protective Forward TTAGATACGGATCAAGTATATGGGAATATAGCAA 25 antigen Reverse GTCATATCCGGTTTAGTCGTTTCTAATGGAT 26 (pX01 plasmid) capB (pX02 Forward ACAACTGGTACATCTGCGCGAATGA 3 plasmid) Reverse GTAGGTCCCATAACATCCATATGATCTTCT 4 F. tularensis lipoprotein Forward TAGGGTTAGGTGGCTCTGATGATGCA 27 Reverse TTGGGAAGCTTGTATCATGGCACT 28 Burkholderia 16S Forward TTCTGGCTAATACCCGGAGTGGATGA 29 spp. Reverse TCTCTACGCATTTCACTGCTACACGT 30 Yersinia plasminogen Forward ATGAGAGATCTTACTTTCCGTGAGAAG 9 pestis Reverse ATATTGCAGACCCGCCGTCACAGTAT 10 Rickettsia citrate Forward GGGTTTTGGTCATCGAGTATATAAAAGCTATGA 31 prowazekii synthase Reverse GGTTCTTGCTATTGCAAAAAGTACAGTGAACA 32

    TABLE-US-00006 TABLE 3 Probes for Exemplary Panel Biothreat SEQ ID Species Gene Probe Sequence NO. B. anthracis protective 5′ CCGCTATCCGCCTTTCTACCAG 13 antigen 3′ GTATCCACCCTCACTCTTCCATTTTC 14 (pX01 plasmid) capB (pX02 5′ CATTTGCTTGAATCATTTTATTTTGGAAG 15 plasmid) 3′ TTAATCGGTTGCTCCTCGTCAGTA 16 F. tularensis lipoprotein 5′ AACCTTCTGGAGCCTGCCATT 17 3′ GCAGCAGCAGTATCTTTAGCTGA 18 Burkholderia 16S 5′ CCTCTGCCATACTCTAGCCTG 33 spp. 3′ TAGTTAGCCGGTGCTTATTCTTCC 34 Yersinia plasminogen 5′ AAATACCGGCAGCATCTCCG 21 pestis 3′ GGTTAATTACGGTACCATAATAACGTG 22 Rickettsia citrate 5′ GGTATACCCATAGCTTTATAGATAATGCC 35 prowazekii synthase 3′ CAAGTTTCTTTAAGTACTGCGGCACGC 36

    [0460] Table 4: Detection of Synthetic DNA Containing Biothreat-specific Genomic Targets in Blood Samples using T2MR.

    TABLE-US-00007 TABLE 4 Detection of Synthetic DNA Containing Biothreat-specific Genomic Targets in Blood Samples using T2MR. Multiplexing Singleplex Multiplex Species No. of copies 500 50 25 1000 B. anthracis Positivity (No. Pos./Total) 100 (4/4) 100 (4/4) 100 (4/4) 100 (4/4) Burkholderia spp. Positivity (No. Pos./Total) 100 (4/4) 100 (4/4) 100 (4/4) 100 (4/4) R. prowazekii Positivity (No. Pos./Total) 100 (4/4) 100 (4/4) 100 (4/4) 100 (4/4) F. tularensis Positivity (No. Pos./Total) 100 (4/4) 100 (4/4) 100 (4/4) 100 (4/4) Y. pestis Positivity (No. Pos./Total) 100 (4/4) 100 (4/4) 100 (4/4) 100 (4/4)

    [0461] The panels can be used in a multiplexed approach to further detect key resistance genes (see Tables 5 and 6). The resistance genes listed in Table 5 are plasmid-based, widespread, and easily transferred between organisms, and therefore could be present in an engineered biothreat. Because these resistance genes are not known to naturally harbor within biothreat species, surrogate species with resistance genes can be used to validate the assay. The assay may have a throughput of 120 samples per day by using 2 PCR multiplexes per biothreat sample. Such panels would indicate to a clinician whether the biothreat may be resistant to approved therapies, and indicate that escalation to a narrow-spectrum antibiotic may be needed. These clinical actions would be facilitated by a time to result of about 3 hr from T2MR detection. Genes that provide resistance against improved therapies such as penicillin, ciprofloxacin, and doxycycline may be included in the panel. In some examples, the panel may include genes that confer penicillin resistance such as bla1, bla2, PBP-1, and/or PBP-2. In some examples, the panel may include genes that confer resistance to doxycycline (e.g., Tet genes) and/or genes that confer resistance to ciprofloxacin (e.g., Qnr genes). In some examples, the panel may include genes that confer resistance to doxycycline and ciprofloxacin, e.g., otr, tcr3, qepAB, opxAB, gyrA, and/or gyrB.

    TABLE-US-00008 TABLE 5 Exemplary Multiplexed T2Biothreat Panel with Resistance Genes Multiplex A B Group No. (Species and toxin detection) (Resistance genes) Result 1 Bacillus anthracis — (toxin gene detection) Result 2 Francisella tularensis — Result 3 Burkholderia spp. — (B. mallei, B. pseudomallei) Result 4 Yersinia pestis — Result 5 Rickettsia prowazekii — Result 6 Internal control — Result 7 — Resistance Gene #1 Result 8 — Resistance Gene #2 Result 9 — Resistance Gene #3 Result 10 — Resistance Gene #4 Result 11 — Resistance Gene #5 Result 12 — Resistance Gene #6 Result 13 — Resistance Gene #7 Result 14 — Resistance Gene #8 Result 15 — Resistance Gene #9 Result 16 — Internal control

    TABLE-US-00009 TABLE 6 Exemplary Multiplexed T2Biothreat Panel with Resistance Genes Multiplex Group ID A B Species and toxin Resistance Theme detection Genes Result 1 B. anthracis KPC Result 2 Burkholderia spp. NDM Result 3 R. prowazekii VIM Result 4 F. tularensis IMP Result 5 Y. pestis OXA Result 6 Internal control CMY Result 7 CTX Result 8 Qnr Result 9 Tet Result 10 Internal control

    [0462] Another exemplary T2Biothreat panel is shown in Table 7. This panel amplifies the following targets: B. anthracis pX01 (pag), B. anthracis pX02 (capB), Burkholderia mallei/pseudomallei (16S rRNA), Francisella tularensis (lipoprotein), Rickettsia prowazekii (citrate synthase), and Yersinia pestis (plasminogen). GenBank numbers for these targets are provided above. The primer and probe sequences used in the experiment presented in Table 7 are shown in Tables 2 and 3, respectively.

    [0463] A proof of concept of detection of model cells was performed. Given the virulence of biothreat pathogens, model cells can be used to validate the performance of sample processing, amplification, and/or detection of the panels described herein. Because the methods described herein detect intact cells and not cell free DNA, the model cells are necessary to test the functionality of the method as a whole. Small, non-virulent, internal portions of conserved target genes were cloned into model cells. Samples were spiked at low titers with model cells, processed using a manual assay, and amplified with non-optimized multi- and single-plex reaction buffers (Table 7).

    [0464] For the manual assay, samples/specimens (whole blood or other sample matrix) were obtained. A desired number of 2.8 mL lysis tube assemblies containing erythrocyte lysis buffer and zirconium oxide beads were obtained, and centrifuged for 5 seconds at 2000×g to collect the lysis buffer and beads to the bottom of the tube. See, e.g., International Patent Application Nos. WO 2012/054639 and WO 2017/127731. The sample was inverted 5-10 times to mix, and 2 mL of the sample was added to the lysis tube by dispensing against the side of the tube. The sample was mixed by pipetting up and down. The tubes were capped and the samples were allowed to incubate for 5 minutes at room temperature (RT) to ensure complete lysis of red blood cells. The tubes were centrifuged for 5 minutes at 6000×g at RT. The cell pellet was located and the supernatant was removed. Next, 150 μL of 1×TE was added to wash the pellet, and the tubes were re-capped and pulse vortexed twice briefly to dislodge the pellet, followed by centrifuging the tube for 5 min at 6000× g at RT. All of the supernatant was removed by pipetting with the tip in the center of the bead bed without disturbing the cell pellet. Next, 100 μL of 1× TE was added to the beads and pellet, and the tubes were recapped. The tubes were loaded into a vortexer and bead beat at 3200 rpm for 5 minutes. The tubes were removed from the vortexer and centrifuged for 2 min at 6000× g to get the sample and beads to the bottom of tubes. This procedure results in a concentrated blood lysate that is a super-saturated solution of cell debris (including solid material).

    [0465] A pre-chilled 96-well cold block and desired number of EPPENDORF® 0.1 mL strip tubes and caps, 2 wells per 2.8 mL lysis tube sample were obtained; the strip tubes were labelled and placed into the cold block. Next, 50 μL of lysate was added to the corresponding well in the strip tube and 30 μL of singleplex or multiplex reaction buffer containing primers and MgCl.sub.2 buffered to pH 8.7 was added to the lysate. The samples were securely capped and placed in the PCR Block of the thermal cycler. The “denature” program on the thermal cycler was then run (95° C. for 5 minutes followed by cooling to 25° C.). The tubes were removed and placed in a centrifuge fitted with a PCR Strip Tube rotor. The samples were centrifuged for 5 minutes at 8000× g and then placed into a pre-chilled 96 well cold block. Next, 20 μL of thermostable DNA polymerase mix was added to the appropriate samples. The tubes were capped and loaded on the thermocycler (MASTERCYCLER® PRO) and the samples were amplified. The PCR cycling parameters included 1 cycle of 95° C. for 3 min, followed by 40-46 cycles of 95° C. for 20 sec, 58° C. for 30 sec, 68° C. for 30 sec, and 1 cycle of 68° C. for 1 min, followed by holding at 4° C. Upon completion of cycling, reactions were detected by the T2MR detection procedure below.

    [0466] Upon completion of cycling, the reactions were detected as follows. Prior to setting up detection reactions, tube racks were placed into a 62° C. benchtop oven and allowed to incubate for at least 1 h.

    [0467] Hybridization reactions were transferred to the pre-heated racks just before placing them into the EPPENDORF® THERMOMIXER® for the 30 minute hybridization. The appropriate number (1 per amplified sample) of individual 0.2 mL dome-capped Eppendorf PCR tubes were placed on clean racks and labelled. Appropriate volumes of each particle (B. anthracis pX01, B. anthracis pX02, Burkholderia spp., F. tularensis, R. prowazekii, and Y. pestis) were obtained from the 2-8° C. storage. The particle bulk was vortexed to ensure homogenous mixing of particles. Next, 15 μL of the specific particle bulk was added into respective individual dome-capped Eppendorf PCR tubes, 15 μL of amplicon was added to each tube, and the 0.2 mL individual PCR tubes were transferred to a 96-well metal block. The individual 0.2 mL PCR tubes were loaded into a THERMOMIXER® that was set to 62° C. to minimize cooling. The samples were hybridized for 30 min at 62° C. and 1,400 rpm in the THERMOMIXER®. After hybridization was completed, the plates were removed and transferred to a 96-well tube holding block and loaded into a T2MR unit for T2MR reading.

    [0468] T2MR detection differentiated genetic sequences from Bacillus anthracis plasmids pX01 and pX02. Burkholderia mallei and B. pseudomallei sequences were detected as a single complex and no cross-reactivity was found with B. cepacia. These data demonstrate detection of the indicated targets at low titer values less than or equal to 30 CFU/mL with single or multiplex reaction buffers. These experiments with model cells indicate that intact cells with partial sequences from Biothreat organisms can be manually processed and detected with the T2MR method, and these data support high confidence that Biothreat organisms themselves can be detected by T2MR.

    TABLE-US-00010 TABLE 7 Detection of T2Biothreat Targets in Model Cells Average Titer T2MR Standard Hit Rate Multi-or Target (CFU/mL) Signal (ms) Deviation (ms) % CV (%) Single-plex Bacillusanthracis pX01 39 534 41 7.8 100 Multi 16 493 142 28.8 100 Multi pX02 33 536 227 42 87.5 Multi 13 680 94 13.8 100 Multi Burkholderia 23 629 157 25.0 100 Single mallei/pseudomallei 9.2 155 110 71.0 62.5 Single Francisella tularensis 17 542 60 11.1 100 Single 6.7 571 53 9.3 100 Single Rickettsia prowazekii 33 545 158 29.0 100 Multi 13 632 66 10.4 100 Multi Yersinia pestis 30 686 34 5.0 100 Multi 12 503 293 58.3 75.0 Multi

    [0469] These panels are expected to contribute to preparedness and response to biothreats and provide physicians a new tool to rapidly identify infected patients, place them on appropriate therapy, and monitor their progress during treatment.

    Example 2: Additional T2Biothreat Panel

    [0470] An additional exemplary T.sub.2Biothreat panel shown in Table 8 was developed for amplification and/or detection of important biothreat pathogens at a concentration of <10 CFU/mL from complex samples such as human blood. These panels can be run, for example, on the T2DX® instrument or on other automated devices. In other examples, sequencing-based approaches can be used to detect the members of the panels.

    TABLE-US-00011 TABLE 8 Exemplary Biothreat Panel Species Comments Bacillus anthracis Protective antigen (pX01 plasmid) and capB (pX02 plasmid) Francisella tularensis lipoprotein Burkholderia spp. braG (e.g., B. mallei, B. pseudomallei) Yersinia pestis plasminogen Rickettsia prowazekii Cytochrome c oxidase assembly protein

    [0471] The panel may detect B. anthracis protective antigen (pag) on the pX01 plasmid. An exemplary nucleic acid encoding B. anthracis pX01 pag is provided in GenBank Accession No. M22589.1, which is incorporated by reference herein in its entirety.

    [0472] The panel may detect B. anthracis capB on the pX02 plasmid. An exemplary nucleic acid encoding capB is provided in GenBank Accession No. CP001597.1, which is incorporated by reference herein in its entirety.

    [0473] The panel may detect F. tularensis lipoprotein. An exemplary nucleic acid encoding F. tularensis lipoprotein is provided in GenBank Accession No. AM233362, which is incorporated herein by reference in its entirety, at position: 388817-389266.

    [0474] The panel may detect Burkholderia spp. braG. An exemplary nucleic acid encoding braG is provided in GenBank Accession No. BX571966, at position: 787037-787738, which is incorporated by reference herein in its entirety.

    [0475] The panel may detect Y. pestis plasminogen. An exemplary nucleic acid encoding Y. pestis plasminogen is provided in GenBank Accession No. KJ361945.1, which is incorporated by reference herein in its entirety.

    [0476] The panel may detect R. prowazekii cytochrome c oxidase assembly protein. An exemplary nucleic acid encoding R. prowazekii cytochrome c oxidase assembly protein is provided in GenBank Accession No. CP014865, at position: 373819-374355, which is incorporated herein by reference in its entirety.

    [0477] We designed primers and T2MR probes against gene fragments for this exemplary panel of biothreat organisms (Tables 9 and 10).

    TABLE-US-00012 TABLE 9 Primer Sequences SEQ Biothreat ID Species Gene Primer Sequence NO. B. anthracis protective Forward CGGATCAAGTATATGGGAATATAGCAACATAC 1 antigen Reverse TTTTAAGGGCTTCTTTTAATGTCATATCCGG 2 (pX01 plasmid) capB (pX02 Forward ACAACTGGTACATCTGCGCGAATGA 3 plasmid) Reverse GTAGGTCCCATAACATCCATATGATCTTCT 4 F. tularensis lipoprotein Forward TTTTATCTTTATCAATCGCAGGTTTAGCGAG 5 Reverse CCCAAGTTTTATCGTTCTTCTCAGCATAC 6 Burkholderia braG Forward TTGGCGGTACAGAATCTGTCGG 7 spp. Reverse AGGCACATACCGAGCGCGA 8 Yersinia plasminogen Forward ATGAGAGATCTTACTTTCCGTGAGAAG 9 pestis Reverse ATATTGCAGACCCGCCGTCACAGTAT 10 Rickettsia Cytochrome Forward CTTGGGATAAAATGCCAAGGTAGATTTGG 11 prowazekii c oxidase Reverse TCCAATAAAAATTTAGCCTTTTCATTGCTGGG 12 assembly protein

    TABLE-US-00013 TABLE 10 Probe Sequences SEQ Biothreat ID Species Gene Probe Sequence NO. B. anthracis protective 5′ CCGCTATCCGCCTTTCTACCAG 13 antigen 3′ GTATCCACCCTCACTCTTCCATTTTC 14 (pX01 plasmid) capB (pX02 5′ CATTTGCTTGAATCATTTTATTTTGGAAG 15 plasmid) 3′ TTAATCGGTTGCTCCTCGTCAGTA 16 F. tularensis lipoprotein 5′ AACCTTCTGGAGCCTGCCATT 17 3′ GCAGCAGCAGTATCTTTAGCTGA 18 Burkholderia braG 5′ TCGCCGCGGTAAAGAACCGTAC 19 spp. 3′ GACCGTCAGGGCCGCACG 20 Yersinia plasminogen 5′ AAATACCGGCAGCATCTCCG 21 pestis 3′ GGTTAATTACGGTACCATAATAACGTG 22 Rickettsia Cytochrome 5′ GCATCAAACTCAATAATTATAGCTTTAGTACC 23 prowazekii c oxidase 3′ CGGACGCAAAACTCAATAACACCATAC 24 assembly protein

    [0478] Multiplex Data

    [0479] Genomic DNA (gDNA) was prepared from overnight growths of Bacillus subtiis clones carrying fragments of biothreat species genes (see Example 3 for additional details). The gDNA was quantified and added to blood lysate at a final concentration of 10 copies/reaction. The reactions were amplified with the multiplex reaction buffer and detection was performed using T2MR techniques. All targets except Y. pestis were 100% positively detected; a single false positive led to 87.5% positive detection for Y. pestis (Table 11).

    TABLE-US-00014 TABLE 11 Results from Multiplex Data Positive Average T2MR Standard Coefficient of Target Hit Rate signal (ms) deviation (ms) variation (%) B. anthracis pX01 8/8 (100%) 402 53 13 B. anthracis pX02 8/8 (100%) 626 75 12 Burkholderia spp. 8/8 (100%) 429 29 7 F. tularensis 8/8 (100%) 443 37 8 R. prowazekii 8/8 (100%) 536 171 32 Y. pestis  7/8 (87.5%) 659 241 37

    [0480] Cross-Reactivity

    [0481] Cross-reactivity between T2MR detection channels was evaluated using high concentrations (1000 copies/reaction) of gDNA from a single target in blood lysate. The gDNA spiked blood lysate was amplified with the multiplex reaction buffer. Each target was tested against all 6 T2MR detection channels and the number of hits was evaluated. All expected targets were detected 100% in their respective detection channels and no cross-reactivity was observed for any of the targets (Table 12).

    TABLE-US-00015 TABLE 12 Cross-reactivity Results Detection Channel (# detected/# tested) B. B. anthracis anthracis Burkholderia F. R. Y. pX01 pX02 spp. tularensis prowazekii pestis Target No target 0/3 0/3 0/3 0/3 0/3 0/3 B. anthracis 3/3 0/3 0/3 0/3 0/3 0/3 pX01 B. anthracis 0/3 3/3 0/3 0/3 0/3 0/3 pX02 Burkholderia 0/3 0/3 3/3 0/3 0/3 0/3 spp. F. tularensis 0/3 0/3 0/3 3/3 0/3 0/3 R. prowazekii 0/3 0/3 0/3 0/3 3/3 0/3 Y. pestis 0/3 0/3 0/3 0/3 0/3 3/3

    [0482] Competitive Inhibition

    [0483] Competitive inhibition was tested by detecting a low concentration (20 copies/reaction) of each target in the presence of high concentrations (1000 copies/reaction) of all 5 remaining targets in blood lysate, for a total of 6 gDNA targets in each amplification reaction. The samples were amplified with the multiplex reaction and all targets were detected in each reaction using T2MR techniques. No competitive inhibition, or failure to detect the low concentration target, was observed in this experiment (Table 13).

    TABLE-US-00016 TABLE 13 Competitive Inhibition Results Detection Channel (# detected/# tested) B. B. anthracis anthracis Burkholderia F. R. Y. pX01 pX02 spp. tularensis prowazekii pestis Low B. anthracis 3/3 3/3 3/3 3/3 3/3 3/3 Conc. pX01 Target B. anthracis 3/3 3/3 3/3 3/3 3/3 3/3 pX02 Burkholderia 3/3 3/3 3/3 3/3 3/3 3/3 spp. F. tularensis 3/3 3/3 3/3 3/3 3/3 3/3 R. prowazekii 3/3 3/3 3/3 3/3 3/3 3/3 Y. pestis 3/3 3/3 3/3 3/3 3/3 3/3

    [0484] Testing in Manual Assay

    [0485] Gene fragments from targeted genes in biothreat species were cloned into Bacillus subtilis cells (see Example 3 below for additional details). Samples were prepared with B. subtilis clones in K.sub.2EDTA anticoagulated human whole blood at a plate quantified concentration of 20 CFU/mL. The samples were manually processed and amplified with the multiplex reaction buffer. Samples were detected using T2MR. The positive hit rate for all samples was 100%.

    TABLE-US-00017 TABLE 14 Manual T2MR Assay Results Positive Average T2MR Standard Coefficient of Target Hit Rate signal (ms) deviation (ms) variation (%) B. anthracis pX01 8/8 (100%) 177 23 13 B. anthracis pX02 8/8 (100%) 320 16 5 Burkholderia spp. 8/8 (100%) 209 29 14 F. tularensis 8/8 (100%) 374 123 33 R. prowazekii 8/8 (100%) 578 148 26 Y. pestis 8/8 (100%) 525 90 17

    [0486] T2DX® Instrument Testing

    [0487] Samples (3 mL) of B. subtilis clones at 20 CFU/mL in K.sub.2EDTA anticoagulated human whole blood were run on the fully automated T2DX® instrument. All samples were positively detected (Table 15).

    TABLE-US-00018 TABLE 15 T2DX ® Instrument Results Positive Average T2MR Standard Coefficient of Target Hit Rate signal (ms) deviation (ms) variation (%) B. anthracis pX01 4/4 (100%) 561 89 16 B. anthracis pX02 4/4 (100%) 817 167 20 Burkholderia spp. 4/4 (100%) 504 122 24 F. tularensis 4/4 (100%) 558 284 51 R. prowazekii 4/4 (100%) 695 241 35 Y. pestis 4/4 (100%) 977 248 25

    [0488] Biosafety Level 2 (BSL2) Variant Testing

    [0489] BSL2 variants of biothreat species were obtained; these variant strains have mutations or lack plasmids that render them avirulent. Samples were prepared in K.sub.2EDTA anticoagulated human whole blood and were tested manually or on the T2DX® instrument. All BSL-2 variants were detected at titers <10 CFU/mL (Table 16).

    TABLE-US-00019 TABLE 16 BSL2 Variant Testing Results Positive Titer Hit Rate Species Strain (CFU/mL) N (%) Assay B. anthracis Sterne NR- 9 20 100 Manual 9398 2.3 20 100 Manual 8 10 100 T2DX ® 2 10 100 T2DX ® 2 8 100 Manual 1 8 50 Manual 0.5 8 25 Manual 0.25 8 25 Manual 11 8 100 T2DX ® 2.1 8 60 T2DX ® Weybridge 8 8 100 Manual NR-10350 2 8 75 Manual 0.5 8 62.5 Manual Y. pestis A1122 16 8 100 Manual 11 8 100 Manual 5.3 8 100 Manual 2.1 8 87.5 Manual NR-639 10 8 100 Manual 0.5 8 12.5 Manual NR-4691 13 8 100 Manual 0.6 8 62.5 Manual NR-4694 11 8 100 Manual 0.6 8 25 Manual Burkholderia NR-51280 10 6 100 Manual pseudomallei 5.1 6 83.3 Manual F. tularensis NR-14 1.8 8 50 Manual 0.9 8 75 Manual 0.5 8 25 Manual 0.2 8 25 Manual NR-585 8.0 8 100 Manual 4.0 8 100 Manual 1.6 8 75 Manual 0.8 8 0 Manual 0.2 8 0 Manual

    [0490] Exclusivity Testing

    [0491] Closely related near neighbor species were identified through an in silico analysis of the species on the T2Biothreat Panel disclosed in this Example. The near neighbor species were tested at high concentrations of cells in blood (>1000 CFU/mL) or synthetic genomic DNA in blood lysate (1000 copies/reaction). The T2Biothreat Panel did not demonstrate cross-reactivity with any of the closely related species (Table 17).

    TABLE-US-00020 TABLE 17 Exclusivity Testing Results Positive Hit Rate Species Titer N (%) Assay Yersinia enterocolitica 1500 CFU/mL 4 0 Manual Burkholderia thailandensis 1500 CFU/mL 4 0 Manual Rickettsia parked 1000 cp/rxn 8 0 gDNA Rickettsia typhi 1000 cp/rxn 8 0 gDNA Rickettsia rickettsia 1000 cp/rxn 8 0 gDNA Bacillus cereus 1500 CFU/mL 4 0 Manual Burkholderia cepacia 1500 CFU/mL 4 0 Manual Bacillus thuringiensis 1500 CFU/mL 4 0 Manual Francisella philomragia 1500 CFU/mL 4 0 Manual Bacillus circulans 1500 CFU/mL 4 0 Manual Yersinia pseudotuburculosis 1500 CFU/mL 4 0 Manual

    [0492] Testing BSL-3 Biothreat Species

    [0493] Samples containing biothreat species were prepared in blood in a BSL-3 laboratory. Enumeration of Rickettsia prowazekii samples were performed in terms of cells/mL using an automated cell counting system, as this species is an obligate intracellular pathogen and does not form colonies. Concentrations of all other samples were verified by counting colonies on solid media. Samples were tested on the T2DX® instrument. Results from this experiment are shown in Table 18.

    TABLE-US-00021 TABLE 18 BSL-3 Biothreat Species Results Titer Positive Species Strain Classification (CFU/mL or cells/mL) N Hit Rate (%) Assay B. anthracis A0463 BSL-3 52 6 100% T2DX ® B. anthracis A0463 BSL-3 10 3 100% T2DX ® B. anthracis A1085 BSL-3 63 6 100% T2DX ® B. anthracis A1085 BSL-3 6.3 6 100% T2DX ® B. mallei NBL7 BSL-3 64 6 100% T2DX ® B. mallei NBL7 BSL-3 6.4 6  67% T2DX ® B. pseudomallei 1026 b BSL-3 12 6 100% T2DX ® B. pseudomallei 1026 b BSL-3 3.0 6  50% T2DX ® B. pseudomallei China 3 BSL-3 76 7 100% T2DX ® B. pseudomallei China 3 BSL-3 15 3 100% T2DX ® F. tularensis Scherm BSL-3 16 7 100% T2DX ® F. tularensis Scherm BSL-3 5.5 6 100% T2DX ® F. tularensis SchuS4 BSL-3 18 7 100% T2DX ® F. tularensis SchuS4 BSL-3 18 6 100% T2DX ® R. prowazekii 83-2P BSL-3 500 7 100% T2DX ® R. prowazekii 83-2P BSL-3 50 7 100% T2DX ® R. prowazekii 83-2P BSL-3 20 6  83% T2DX ® Y. pestis KIM BSL-3 23 7 100% T2DX ® Y. pestis Pestoides B BSL-3 8.5 6 100% T2DX ®

    [0494] These data demonstrate that the panels described herein can be used to rapidly amplify and/or detect sequences from biothreat targets with high sensitivity (e.g., <10 CFU/mL) and accuracy in complex samples such as whole blood. These panels are expected to contribute to preparedness and response to biothreats and provide physicians a new tool to rapidly identify infected patients, place them on appropriate therapy, and monitor their progress during treatment.

    Example 3: B. subtilis Clone Preparation

    [0495] Overview

    [0496] Fragments of the biothreat targets were integrated into the B. subtilis chromosome at thrC (threonine biosynthesis). A double target clone was also constructed with the B. anthracis pX01 target integrated into thrC and the B. anthracis pX02 target integrated into amyE (starch hydrolysis). These engineered B. subtilis clones were used as surrogate strains for BSL3 organisms during assay development. Each of the target sequences was amplified from a synthetic double stranded gene fragment, assembled into a shuttle plasmid by homologous end joining, and transformed into E. coli. The plasmid was then isolated from E. coli and transformed into the B. subtilis chromosome.

    [0497] B. subtilis Clone Preparation

    [0498] Synthetic double stranded DNA fragments, which contained a portion of the gene amplified for the T2MR assay plus short flanking regions but lacking the start or stop codons for the genes, were purchased for each biothreat target. These synthetic fragments were amplified using oligonucleotides that contained approximately 20 bp of the fragment sequence and approximately 20 bp of the shuttle plasmid sequence. Amplification was performed using the high-fidelity PHUSION® PCR Master Mix with the conditions shown in Table 19.

    [0499] Two shuttle plasmids were purchased from the Bacillus Genetic Stock Center: pDG1664 for integration in the thrC gene and pDG1730 for integration in the amyE gene. The shuttle plasmids were amplified and linearized using the PHUSION® PCR Master Mix with the conditions in Table 19. The amplification products were verified on a 1% agarose gel with SYBR® Safe DNA Gel Stain. The amplification products were purified using a QIAQUICK® PCR Purification kit and the concentration of the purified product was determined using ultraviolet-visible (UV/Vis) spectroscopy with a NANODROP™ spectrophotometer.

    TABLE-US-00022 TABLE 19 Thermocycler Programs for Target Amplification and Shuttle Plasmid Linearization Time (min:sec) Time (min:sec) Temperature for Target for Plasmid Step (° C.) Amplification Linearization 1. Initial Denaturation 98 5:00 5:00 2. Denaturation 98 0:15 0:15 3. Annealing 59 0:30 0:30 4. Extension 72 0:30 2:30 5. Cycle Repeat to — x29 x29 Step 2 6. Final Extension 72 5:00 5:00 7. Hold  4 Indefinitely Indefinitely

    [0500] Assembly of Target Fragments into Shuttle Plasmids

    [0501] Purified targets were assembled into shuttle plasmids using the NEBUILDER® HiFi Assembly and Transformation Kit (New England Biolabs) per the manufacturer's instructions. All 6 biothreat targets were assembled individually into the pDG1664 shuttle plasmid for insertion at the thrC locus. The B. anthracis pX02 target was also assembled into the pDG1730 shuttle plasmid for insertion at the amyE locus. The assembly mixtures were transformed into 5-α competent E. coli and the transformed cells were plated on Luria-Bertani (LB)/ampicillin(Amp) plates. After an overnight 37° C. incubation, colony PCR was performed to screen for colonies carrying the shuttle plasmids using Taq polymerase and the amplification conditions in Table 20.

    TABLE-US-00023 TABLE 20 Thermocycler Program for Screening E. coli Transformants with Taq Temperature Step (° C.) Time (min:sec) 1. Initial Denaturation 95 5:00 2. Denaturation 95 0:20 3. Annealing 58 0:30 4. Extension 68 0:45 5. Cycle Repeat to — x29 Step 2 6. Final Extension 68 5:00 7. Hold  4 Indefinitely

    [0502] Amplified products were screened on 1% agarose gels dyed with SYBR® Safe DNA Gel Stain. Transformants that produced a band that corresponded to the correct size amplicon were retrieved from the LB/Amp plate and grown at 37° C. overnight in a 10 mL LB Broth culture with 10 μL of 100 mg/mL ampicillin. This overnight culture was utilized to purify plasmids using the QIA SPIN® Miniprep Kit per the manufacturer's instructions. The plasmid sequences were confirmed with Sanger sequencing.

    [0503] T2Biothreat Target Transformation into B. subtilis

    [0504] To prepare single site transformed cells, frozen aliquots of B. subtilis strain 168 (Bacillus Genetic Stock Center) were thawed and added to 450 μL of pre-warmed GM2 media described by Yasbin et al. J. Bacteriol. 121:296-304, 1975, with 43 mM glucose substituted for the 22 mM glucose used by Yasbin et al. The cells were incubated in a shaking 37° C. incubator for 90 min, following which 1 μg of the pDG1664 shuttle plasmid with biothreat insert was added and the cells were incubated for another 30 min. Cells were plated on the selective agar in Table 21 and incubated overnight at 37° C.

    TABLE-US-00024 TABLE 21 Selective and Counter-selective Agar for B. subtilis Transformed with Shuttle Plasmids B. subtilis Integration Shuttle Counter-selective Site Plasmid Selective Agar Agar thrC pDG1664 Brain heart infusion Tryptic soy agar with agar with 0.5 μg/mL 50 μg/mL Erythromycin Spectinomycin amyE pDG1730 Tryptic soy agar with Starch agar plate 50 μg/mL Spectinomycin

    [0505] After the incubation, three single colonies for each transformation were selected for screening. Each of the colonies was patched and struck out their selective agar and counter-selective agar (Table 21). Plates were incubated overnight at 37° C. Growth on selective agar indicated that the plasmid has integrated into the B. subtilis chromosome. Growth on both the selective agar and the counter-selective agar indicated the target was integrated via a single crossover. Growth on the selective agar and lack of growth on the counter-selective agar indicated the target was integrated via a double homologous crossover. A colony indicating double crossover was selected for each transformation and used to inoculate a 37° C. overnight culture in Modified Nutrient Broth and prepare glycerol stocks. Integrated sequences were verified by PCR and Sanger sequencing.

    [0506] To prepare double site transformed cells, the B. subtilis strain containing the B. anthracis pX01 gene inserted at the thrC site was struck out onto a starch agar plate from a frozen glycerol stock and incubated overnight at 37° C. Cells from the plate were inoculated into 10 mL of pre-warmed GM1 medium with 43 mM glucose (Yasbin et al. supra). The cells were grown until the optical density measured at 600 nm began to stop rising, and 50 μL of the culture was added to 450 μL of pre-warmed GM2. The cells were incubated in a shaking 37° C. incubator for 90 min, following which 1 μg of the pDG1730 shuttle plasmid with the B. anthracis pX02 insert was added and the cells were incubated for another 30 min. The cells were plated on their selective media in Table 21 and incubated overnight at 37° C.

    [0507] As previously, three single colonies were patched and plated on selective and counter-selective agar in Table 21. After overnight incubation at 37° C., growth on selective agar indicated that integration into the B. subtilis chromosome had occurred. Starch hydrolysis, encoded by the amyE gene, was used to determine if colonies had been transformed through double or single crossover. A potassium iodide solution was added to the starch plates to visualize the presence of starch on the agar. A white halo around the patched colony indicated that the colony could hydrolyze starch and that the amyE gene had not been disrupted. No halo on starch agar and growth on spectinomycin plates indicated that a double crossover had occurred. As previously, a single colony with evidence of double crossover integration was grown overnight at 37° C. in Modified Nutrient Broth. Glycerol stocks were prepared and sequence was verified by PCR and Sanger sequencing.

    Other Embodiments

    [0508] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims.

    [0509] Other embodiments are within the claims.