SURFACE-BASED DETECTION OF NUCLEIC ACID IN A CONVECTION FLOW FLUIDIC DEVICE
20240278249 ยท 2024-08-22
Assignee
Inventors
Cpc classification
B01L2300/1805
PERFORMING OPERATIONS; TRANSPORTING
B01L3/5027
PERFORMING OPERATIONS; TRANSPORTING
C12Q2565/513
CHEMISTRY; METALLURGY
B01L2200/0663
PERFORMING OPERATIONS; TRANSPORTING
B01L7/52
PERFORMING OPERATIONS; TRANSPORTING
International classification
B01L7/00
PERFORMING OPERATIONS; TRANSPORTING
B01L3/00
PERFORMING OPERATIONS; TRANSPORTING
Abstract
The present disclosure provides methods, composition and devices for performing convection-based PCR and non-enzymatic amplification of nucleic acid sequences. Techniques and reagents employed in these methods include toehold probes, strand displacement reactions, Rayleigh-Benard convection, temperature gradients, multiplexed amplification, multiplexed detection, and DNA functionalization, in open and closed systems, for use in nucleic tests and assays.
Claims
1-35. (canceled)
36. A method of amplifying a target nucleic acid comprising (a) providing a fluidic reaction chamber comprising: a first surface, a second surface that does not contact the first surface, wherein the first and second surfaces face each other, a material contacting the first surface and the second surface and that forms an outer boundary of the reaction chamber, and a material contacting the first surface and the second surface and that forms an inner boundary of the reaction chamber, wherein the first surface comprises a plurality of oligonucleotide complexes, wherein the oligonucleotide complexes each comprise: a first oligonucleotide comprising a first DNA sequence and a linking moiety for irreversibly linking the first oligonucleotide to the surface, and a second oligonucleotide comprising a second DNA sequence and a third DNA sequence, wherein the second DNA sequence is complementary to the first DNA sequence and is hybridized thereto, wherein said second DNA oligonucleotide is not irreversibly linked to the first surface, and optionally does not comprise a fluorescent moiety, wherein the fluidic reaction chamber is in operable relationship to a first and a second heat source, wherein the first and second heat sources are capable of applying differing first and second heat levels to the fluidic reaction chamber, wherein the first and second heat levels are not the same; (b) introducing into the fluidic reaction chamber a fluid comprising a target nucleic acid sequence, a DNA polymerase, dNTPs, and a polymerase chain reaction (PCR) buffer; and (c) applying first and second heat levels to the fluidic reaction chamber.
37. The method of claim 36, further comprising detecting amplification of the target nucleic acid.
38. (canceled)
39. The method of claim 36 wherein each of the second DNA sequences are not identical.
40. (canceled)
41. The method of claim 37, wherein each of the plurality of the oligonucleotide complexes are located in spatially discrete regions on the surface.
42. The method of claim 36, wherein each of the first oligonucleotides comprise a fluorescent moiety.
43. The method of claim 42, wherein each of the second oligonucleotides comprise a fluorescence quencher moiety.
44. The method of claim 42, wherein each of the spatially discrete regions further comprises a third oligonucleotide comprising a fourth DNA sequence and a fifth DNA sequence, wherein the fourth DNA sequence is complementary to the third DNA sequence, wherein each of the third oligonucleotides comprises a fluorescence quencher moiety.
45-46. (canceled)
47. The method of claim 36, wherein each of the oligonucleotides has a length of between about 5 and about 120 nucleotides.
48-50. (canceled)
51. The method of claim 36, wherein said fluid further comprises a non-specific nucleic acid staining dye.
52. The method of claim 36, wherein the fluidic reaction chamber is circular, oval, square, triangular, rectangular, hexagonal, octagonal, rhomboid, or trapezoid.
53. The method of claim 36, wherein the fluidic reaction chamber is not at a uniform temperature, and wherein the warmest region of the reaction chamber is between about 80? C. and about 100? C., and the coldest region of the reaction chamber is between about 45? C. and about 75? C.
54-90. (canceled)
91. A method of amplifying a target nucleic acid comprising: (a) providing a fluidic reaction chamber comprising: a first surface, a second surface that does not contact the first surface, wherein the first and second surfaces face each other, a material contacting the first surface and the second surface and that forms an outer boundary of the reaction chamber, and a material contacting the first surface and the second surface and that forms and inner boundary of the reaction chamber, wherein (i) the first surface comprises a plurality of oligonucleotide complexes, wherein the oligonucleotide complexes are located in spatially discrete locations of the first surface region and each comprise: a first oligonucleotide comprising a first DNA sequence and a linking moiety for irreversibly linking the first oligonucleotide to the first surface region, and a second oligonucleotide comprising a second DNA sequence and a third DNA sequence, wherein the second DNA sequence is complementary to the first DNA sequence, and the second surface region comprises a plurality of oligonucleotide complexes, wherein the oligonucleotide complexes are located in spatially discrete locations of the second surface region and each comprise: a third oligonucleotide comprising a fourth DNA sequence and a linking moiety for irreversibly linking the third oligonucleotide to the second surface region, and wherein the fourth DNA sequence is complementary to the second DNA sequence, the third DNA sequence, or a combination of at least six continuous nucleotides of the second DNA sequence and six continuous nucleotides of the third DNA sequence; or (ii) the first surface region comprises a plurality of oligonucleotide complexes, wherein the oligonucleotide complexes are located in spatially discrete locations of the first surface region and each comprise: a first oligonucleotide comprising a first DNA sequence and a linking moiety for irreversibly linking the first oligonucleotide to the first surface region, and a second oligonucleotide comprising a second DNA sequence and a third DNA sequence, wherein the second DNA sequence is complementary to the first DNA sequence, and the second surface region comprises a plurality of oligonucleotide complexes, wherein the oligonucleotide complexes are located in spatially discrete locations of the second surface region and each comprise: a third oligonucleotide comprising a fourth DNA sequence and a linking moiety for irreversibly linking the third oligonucleotide to the second surface region, and a fourth oligonucleotide comprising a fifth DNA sequence and a sixth DNA sequence, wherein the fifth DNA sequence is complementary to the fourth DNA sequence, and wherein the second DNA sequence is complementary to the fifth DNA sequence or is complementary to the sixth DNA sequence, wherein the fluidic reaction chamber is in operable relationship to a first and a second heat source, wherein the first and second heat source are capable of applying differing first and second heat levels to the fluidic reaction chamber, wherein the first and second heat levels are not the same; (b) introducing into the fluidic reaction chamber a fluid comprising a target nucleic acid sequence; and (c) applying first and second heat levels to the fluidic reaction chamber.
92. The method of claim 91, further comprising detecting amplification of the target nucleic acid.
93. The method of claim 91, wherein the first or second oligonucleotide comprises a fluorescent moiety.
94. The method of claim 91, wherein the first or second oligonucleotide comprises a fluorescence quencher.
95. (canceled)
96. The method of claim 91, wherein each of the second DNA sequences are not identical.
97. The method of claim 91, wherein each of the plurality of the oligonucleotide complexes are located in spatially discrete regions on the surface.
98-99. (canceled)
100. The method of claim 91, wherein each of the oligonucleotides has a length of between about 5 and about 120 nucleotides.
101-105. (canceled)
106. The method of claim 91, wherein the fluidic reaction chamber is circular, oval, square, rectangular, triangular, hexagonal, octagonal, rhomboid, or trapezoid.
107. The method of claim 91, wherein the fluidic reaction chamber is not at a uniform temperature, and wherein the warmest region of the reaction chamber is between about 80? C. and about 100? C., and the coldest region of the reaction chamber is between about 45? C. and about 75? C.
108-110. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0098] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0099]
[0100]
[0101]
[0102]
[0103]
TABLE-US-00001 Alk-TMR-1 (SEQIDNO:1) /5Hexynyl/tttt/i6-TAMN/tggatgctgaatacttgtgataa taca 32-RQ (SEQIDNO:2) ccgtagaggtgtattatcacaagtattcagcatcca/3IAbRQSp/ 54 (SEQIDNO:3) tggatgctgaatacttgtgataatacacctctacgg
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
Primers
[0111]
TABLE-US-00002 h_ppia_fp (SEQIDNO:4) gttaacagattggaggtagtagcatttt h_ppia_rp (SEQIDNO:5) tctatcaccaccccccaact r_b2m_fp (SEQIDNO:6) caggtattttggggtatgattatggtt r_b2m_rp (SEQIDNO:7) ccaacagaatttaccaggaaacaca m_gadph_fp (SEQIDNO:8) caatacggccaaatctgaaagacaa m_gadph_rp (SEQIDNO:9) ctgcaggttctccacacctat
Arms
[0112]
TABLE-US-00003 h_ppia_arm (SEQIDNO:10) agcagtgcttgctgttccttagaattttgccttgtgcgatgctgaata cttgtgataatacacctctacgggtcagg r_b2m_arm (SEQIDNO:11) ctggttcttactgcagggcgtgggaggagcgcgatgctgaatacttgt gataatacacctctacgggtcagg m_gadph_arm (SEQIDNO:12) gatagcctggggctcactacagacccatgagggcgatgctgaatactt gtgataatacacctctacgggtcagg
Quenchers
[0113]
TABLE-US-00004 h_ppia_q (SEQIDNO:13) /5IAbRQ/acaaggcaaaattctaaggaacagcaagcactgctgcacg atcaggggt r_b2m_q (SEQIDNO:14) /gctcctcccacgccctgcagtaagaaccagaccccagcctttacac m_gadph_q (SEQIDNO:15) /5IAbRQ/cctcatgggtctgtagtgagccccaggctatctcatgttc ttcagagtgga
Anchor
[0114]
TABLE-US-00005 (SEQIDNO:16) /DBCO/tttttcctgacccgtagaggtgtattatcacaagtattcagc atcgc/ATTO-550/
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
DETAILED DESCRIPTION
[0123] Here, the inventors present devices, systems, and methods for DNA amplification assay. The disclosure employs solid-phase separation of reagents to prevent unintended molecular events resulting in false positives, and uses convection flow circulation to enable spontaneous dissociation of double-stranded amplicons. Three related prior art technologies and their limitations compared to the present invention are described below.
1. CONVECTION FLOW PCR
[0124] Liquid, when held at a non-uniform temperature and confined in a volume, will circulate via a process known as Rayleigh-Benard convection flow [.sup.1]. Rayleigh-Benard convection has been used for molecular diagnostics to generate low-cost devices for providing the necessary temperature cycling for PCR (convection flow PCR, cf-PCR) [.sup.2, U.S. Pat. No. 6,586,233 B2, U.S. Pat. No. 8,735,103 B2, U.S. Pat. No. 8,187,813 B2]. cf-PCR requires only a static temperature gradient maintained with a high of around 95? C. and a low of around 60? C. (annealing/extension temperature), eliminating the need for high energy consumption thermal cycling instruments.
[0125] cf-PCR has been demonstrated for both single-plex [.sup.3-5, U.S. Pat. No. 8,187,813 B2] and multiplex detection of specific DNA sequences [.sup.6]; the multiplex approach utilized end-point electrophoretic results examination. Because cf-PCR lacks the temperature uniformity of traditional qPCR assays, cf-PCR struggles in applications requiring high sequence selectivity, such as applications for detection or profiling of single nucleotide variants (SNV), therefore no SNV specific cf-PCR has yet been shown. Real-time detection of the cf-PCR has been shown solely in solution phase employing unspecific fluorescent dye (SYBR Green I) detection method [.sup.7]. This approach restricts the cf-PCR from being used in multiplex settings. Likewise, application of sequence specific real-time detection methods such as 5-nuclease assay chemistry or hybridization probes would allow detecting not more than 5-6 targets simultaneously because of fluorophore spectral overlap. The present disclosure is differentiated from cf-PCR in that the present disclosure offers spatially resolved multiplexed readout without requiring an open-tube step for subsequent analysis. Additionally, in the enzyme-free embodiment of the disclosure, no enzyme is required for amplification.
2. MICROARRAYS
[0126] Microarray technology is one of the main techniques for multiplexed screening of biological samples. Multiple probe sequences are functionalized to a surface, and the fluorescent signal of a particular spot is taken as the quantitative readout of the corresponding sequence. The technology has been successfully demonstrated for detecting of various types of biological analytes such as DNA, RNA, proteins, carbohydrates and cells [.sup.8-12]. Application of the microarray technology has found the most extensive use in the field of nucleic acid testing. Microarray technology has shown application of NA microarrays for whole genome hybridization, de novo sequencing, re-sequencing, comparative genomics, transcriptome hybridization or identification of single nucleotide variations [.sup.13-15]. All aforementioned NA applications require large amounts of NA targets for hybridization, consequently microarrays are typically used as a final readout on PCR amplification products. Microarray readouts are typically slow, requiring overnight hybridization, and also risks amplicon contamination due to the open-tube process.
3. TOEHOLD PROBES AND ENZYME-FREE AMPLIFICATION
[0127] Toehold-mediated strand displacement reaction [.sup.19-21] is a process of competitive hybridization that occurs in the absence of enzymes, and is relevant to the present disclosure. Using toehold-mediated strand displacement, enzyme-free amplification of DNA and RNA analyte sequences in homogeneous solutions has been demonstrated [.sup.22-27] (U.S. Pat. No. 8,043,810 B2, U.S. Pat. No. 8,110,353 B2). The enzyme-free amplification embodiment of the disclosure is different in that thermal convection flow is used to spontaneously dissociate double-stranded amplicons, and surface-functionalization is used to sequester reactive reagents from one another to reduce false positives. Toehold-mediated strand displacement has been applied to surface functionalized DNA oligonucleotides (U.S. Pat. No. 8,630,809 B2) for stoichiometric conversion of target analyte sequences to other sequences. The present disclosure differs in providing amplification of the detection target.
4. APPLICANTS' TECHNOLOGY
[0128] This disclosure describes reagents and devices for amplification and detection of specific nucleic acid target sequences. The disclosure utilizes solid-phase functionalization and sequestering of oligonucleotide reagents, in order to prevent unintended molecular events that result in false positives, and application of Rayleigh-Benard thermal convection flow for target regeneration and facilitating DNA surface hybridization kinetics (more efficient mixing of the reaction mixture). The Rayleigh-Benard convection flow regime can be realized by placing a reaction chamber, which consists of two 1 mm thick white-water glass microscope slides separated by double-sided sticky tape as a spacer with thickness of 250 ?m, between two differentially-controlled hot plates (
[0129] The hot plates are set to maintain two different temperatures (cold heater and hot heater, respectively), which cause a temperature gradient across the reaction chamber filled with a liquid reaction mixture. Liquid residing near the hot part of the chamber has a higher temperature and, therefore, is less dense than the liquid residing in the part of the chamber with lower temperature. Such distribution of liquid densities in confined volume results in a difference between buoyancy and gravity forces (near the hot and cold heaters, respectively) that in turn results in organization of circular steady-state convective flow.
[0130] All molecules dissolved in the liquid are involved in circulation between temperature zones by being dragged by the convection flow. Traveling along temperature zones the molecules experience periodic temperature variations. For example, a double stranded DNA molecule being placed in the circular convection flow experience multiple cycles of heating and cooling. If the temperature of solution in the hot zone is sufficient to melt the DNA duplex and the temperature of the cold zone is favorable to maintain given nucleic acids in a double-stranded form then the circulation of nucleic acids in this convection flow results in repeatable denaturation and annealing cycles. Observation of the multiple cycles of ds-DNA denaturation and annealing can be performed by various methods, for example using fluorescent microscopy by registering the intensity of the non-specific DNA staining dyes placed in the reaction mixture along with the DNA sample.
[0131] A prototype heating instrument consists of two resistive Kapton foil heaters glued to the aluminum plates, and can be simultaneously used to provide differential heating for up to five fluidic chips. Two low-wattage power supplies power the heaters. The proposed amplification system is tolerant to heating element temperature inaccuracies in range of ?2? C., and does not require precise computer controlled hardware.
5. ENZYME-FREE LINEAR AMPLIFICATION EMBODIMENT
[0132] The present disclosure represents an enzyme-free amplification of target nucleic acid, in which amplicon concentration increases linearly with time (
[0133] The linear amplification scheme demonstrates the benefits of simultaneously using solid-phase sequestering of oligonucleotide reactants and the temperature-driven convection flow. Immobilization of the oligonucleotide reagents on the different surface regions allows avoiding false positive signal molecule release (spurious amplification) in the absence of the target sequence, while the thermal convection flow, beside spontaneous transport and improved mass transfer, induces target regeneration via melting of the target-signal complex (T-S). In contrast, changing the temperature of the entire solution is undesirable because it would lead to spontaneous dissociation of all oligonucleotides from the surface.
[0134] Labeling of the signal strand S with a fluorescent dye represent one approach for real-time monitoring of the linear amplification process. A decrease of the intensity of fluorescence registered form the of the surface region 1, as well as an increase of the intensity of fluorescence registered from the surface region 2 can effectively reflects how the reaction amplification reaction proceeds.
6. STOICHIOMETRIC DETECTION EMBODIMENT
[0135] To demonstrate that the enzyme-free amplification method exhibits multiple turnover, the inventors constructed a corresponding stoichiometric detection system using the convection device (
[0136] Real-time observation of the stoichiometric detection system can also be performed via simple labeling of the signal strand Ss with a fluorescent dye and registering the change surface region 2 fluorescence intensity.
7. ENZYME-FREE EXPONENTIAL AMPLIFICATION EMBODIMENT
[0137]
[0138] Convection flow carries the duplex to the 85? C. zone where the duplex melts. Now two single-stranded oligonucleotides, the initial target T and released strand S1 flows back to the 35? C. zone where each of them triggers new release of oligonucleotide species from the surface. In particular, target oligonucleotide T catalytically releases second strand S1 from the surface region 1, while the initially released strand S1 triggers the release of the strand S2 from the second surface region. Thus, at the end of each convection flow cycle the amount of oligonucleotide species present in solution doubles, resulting in exponential accumulation of the amplicon species in solution phase.
8. ALTERNATIVE DETECTION METHODS
[0139]
[0140] Application of the FRET-based detection technique is illustrated on the example of exponential amplification (
9. REAL-TIME DETECTION OF CONVECTION FLOW PCR
[0141] Another application the composition claimed in the present disclosure is that the composition can be used as an efficient mean for surface-based real-time monitoring of an enzymatic nucleic acid amplification process proceeding in the solution. There are no reported examples of real-time monitoring of convection-based PCR using surface functionalized probes.
10. SIMULTANEOUS MONITORING OF MULTIPLE TARGET SEQUENCES
[0142] The proposed compositions and methods in this disclosure allow for simultaneous monitoring of the amplification (either enzyme-free or enzyme-based) of multiple nucleic acid target sequences. Spatial patterning of different oligonucleotide probes at different surface regions allows an array- or camera-based readout to provide independent information on the amplicon concentrations of each target amplification reaction.
11. EXEMPLARY OLIGONUCLEOTIDES
[0143] The following oligonucleotide sequences are provided by way of example, but not limitation:
Linear Amplification System Oligonucleotides
[0144]
TABLE-US-00006 1 (SEQIDNO:17) /5Hexynyl/TTTTTCCGTAGAGGTGTATTATCACAAGTATT 2-3 (SEQIDNO:18) /56-TAMN/TGGATGCTG-AATACTTGTGATAATACACCTCTACGG 4-5 (SEQIDNO:19) /5Hexynyl/TTTTTCCGTAGAGGTGTATTATCACAAGTATT- CAGCATCCA 6-7 (SEQIDNO:20) CCGTAGAGGTGTATTATCACAAGTATT-CAGCATCCA
TABLE-US-00007 11-12 (SEQIDNO:21) /5Hexynyl/TTTTTTGTCAACC-ATCATCGTTCGTACCACAGTGTTC AG 13 (SEQIDNO:22) /56-TAMN/TGGATGCTGAATACTTGTGATAATACACCTCTACGG 14-15 (SEQIDNO:23) CCGTAGAGGTGTATTATCACAAGTATTCAGCATCCA- CTGAACACTGTGGTACGAACGATGA 16 (SEQIDNO:24) /5Hexynyl/TTTTTCCGTAGAGGTGTATTATCACAAGTATTCAGCAT CCA 17-18 (SEQIDNO:25) CTGAACACTGTGGTACGAACGATGAT-GGTTGACA
12. REFERENCES
[0145] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0146] 1. Eckert K, Bestehorn M, Thess A. Square cells in surface-tension-driven Benard convection: experiment and theory. J Fluid Mech. 1998; 356:155-197. [0147] 2. Krishnan M, Ugaz V M, Burns M a. PCR in a Rayleigh-B?nard convection cell. Science. 2002; 298(5594):793. doi:10.1126/science.298.5594.793. [0148] 3. Hennig M, Braun D. Convective polymerase chain reaction around micro-immersion heater. Appl Phys Lett. 2005; 87(18):1-3. doi:10.1063/1.2051787. [0149] 4. Hsieh Y-F, Yonezawa E, Kuo L-S, Yeh S-H, Chen P-J, Chen P-H. Polymerase chain reaction with phase change as intrinsic thermal control. Appl Phys Lett. 2013; 102(May 2015):2013-2016. doi:10.1063/1.4803442. [0150] 5. Priye A, Hassan Y A, Ugaz V M. Microscale Chaotic Advection Enables Robust Convective DNA Replication. Anal Chem. 2013; 85(21):10536-10541. doi:10.1021/ac402611s. [0151] 6. Agrawal N, Hassan Y a., Ugaz V M. A pocket-sized convective PCR thermocycler. Angew Chemie-Int Ed. 2007; 46(23):4316-4319. doi:10.1002/anie.200700306. [0152] 7. Hsieh Y F, Lee D S, Chen P H, et al. A real-time convective PCR machine in a capillary tube instrumented with a CCD-based fluorometer. Sensors Actuators, B Chem. 2013; 183:434-440. doi:10.1016/j.snb.2013.04.003. [0153] 8. Chen J, Lozach J, Garcia E W, et al. Highly sensitive and specific microRNA expression profiling using BeadArray technology. Nucleic Acids Res. 2008; 36(14):e87. doi:10.1093/nar/gkn387. [0154] 9. Anzai Y, Saito S, Fujimoto K, Kinoshita K, Kato F. Detection and Identification of Species with Bacterial Cells Using a Plastic DNA Array. J Heal Sci. 2008; 54(2):229-234. doi:10.1248/jhs.54.229. [0155] 10. Andresen H, Gr?tzinger C, Zarse K, Kreuzer O J, Ehrentreich-F?rster E, Bier F F. Functional peptide microarrays for specific and sensitive antibody diagnostics. Proteomics. 2006; 6(5):1376-1384. doi:10.1002/pmic.200500343. [0156] 11. Chung M Y, Kim Y-W, Bae S M, et al. Development of a bead-based multiplex genotyping method for diagnostic characterization of HPV infection. PLoS One. 2012; 7(2):e32259. doi:10.1371/journal.pone.0032259. [0157] 12. Dai X, Yang W, Firlar E, Marras S a. E, Libera M. Surface-patterned microgel-tethered molecular beacons. Soft Matter. 2012; 8(11):3067. doi:10.1039/clsm06702h. [0158] 13. Hoheisel J D. Microarray technology: beyond transcript profiling and genotype analysis. Nat Rev Genet. 2006; 7(3):200-210. doi:10.1038/nrg1809. [0159] 14. Gitan R S, Shi H, Chen C M, Yan P S, Huang T H M. Methylation-specific oligonucleotide microarray: A new potential for high-throughput methylation analysis. Genome Res. 2002; 12(1):158-164. doi:10.1101/gr.202801. [0160] 15. Iwasaki H. Accuracy of Genotyping for Single Nucleotide Polymorphisms by a Microarray-Based Single Nucleotide Polymorphism Typing Method Involving Hybridization of Short Allele-Specific Oligonucleotides. DNA Res. 2002; 9(2):59-62. doi:10.1093/dnares/9.2.59. [0161] 16. Jenison R, Jaeckel H, Klonoski J, Latorra D, Wiens J. Rapid amplification/detection of nucleic acid targets utilizing a HDA/thin film biosensor. Analyst. 2014; 3763-3769. doi:10.1039/c4an00418c. [0162] 17. Chudinov A V., Kolganova N a., Egorov A E, et al. Bridge DNA amplification of cancer-associated genes on cross-linked agarose microbeads. Microchim Acta. 2014; 182(3-4):557-563. doi:10.1007/s00604-014-1357-8. [0163] 18. Quan J, Saaem I, Tang N, et al. Parallel on-chip gene synthesis and application to optimization of protein expression. Nat Biotechnol. 2011; 29(5):449-452. doi:10.1038/nbt.1847. [0164] 19. Yurke B, Turberfield A J, Mills A P, Simmel F C, Neumann J L. A DNA-fuelled molecular machine made of DNA. Nature. 2000; 406(6796):605-608. doi:10.1038/35020524. [0165] 20. Zhang D Y. Cooperative hybridization of oligonucleotides. J Am Chem Soc. 2011; 133(4):1077-1086. doi:10.1021/ja109089q. [0166] 21. Zhang D Y, Chen S X, Yin P. Optimizing the specificity of nucleic acid hybridization. Nat Chem. 2012; 4(3):208-214. doi:10.1038/nchem.1246. [0167] 22. Zhang Z, Zeng D, Ma H, et al. A DNA-Origami chip platform for label-free SNP genotyping using toehold-mediated strand displacement. Small. 2010; 6(17):1854-1858. doi:10.1002/smll.201000908. [0168] 23. Zhao C, Song Y, Ren J, Qu X. A DNA nanomachine induced by single-walled carbon nanotubes on gold surface. Biomaterials. 2009; 30(9):1739-1745. doi:10.1016/j.biomaterials.2008.12.034. [0169] 24. Zhang X-B, Kong R-M, Lu Y. Metal ion sensors based on DNAzymes and related DNA molecules. Annu Rev Anal Chem (Palo Alto Calif). 2011; 4:105-128. doi:10.1146/annurev.anchem.111808.073617. [0170] 25. Yan H, Zhang X, Shen Z, Seeman N C. A robust DNA mechanical device controlled by hybridization topology. Nature. 2002; 415(6867):62-65. doi:10.1038/415062a. [0171] 26. Turberfield A, Mitchell J, Yurke B, Mills A, Blakey M, Simmel F. DNA Fuel for Free-Running Nanomachines. Phys Rev Lett. 2003; 90(11):1-4. doi:10.1103/PhysRevLett.90.118102. [0172] 27. Shlyahovsky B, Li Y, Lioubashevski O, Elbaz J, Willner I. Logic Gates and Antisense DNA Devices Scaffold. ACS Nano. 2009; 3(7):1831-1843. [0173] U.S. Pat. No. 6,586,233 B2. Convectively driven PCR thermal-cycling, William J. Benett, James B. Richards, Fred P. Milanovich [0174] U.S. Pat. No. 8,735,103 B2. Natural convection-driven PCR apparatus and method using disposable polymer chip. Kwang-Hyo Chung, Dae-Sik Lee, Hyeon-Bong Pyo, Seon-Hee Park [0175] U.S. Pat. No. 8,187,813 B2. Methods and apparatuses for convective polymerase chain reaction (PCR). Pei-Jer Chen, Ping-Hei Chen, Wen-Pin Chou, Yi-Fan Hsieh, Shiou-Hwei Yeh [0176] U.S. Pat. No. 8,043,810 B2. Analyte detection using autocatalytic chain reactions. John H. Reif, Peng Yin, Thomas H. LaBean, Geetha Shetty, Erik A. Schultes [0177] 5. U.S. Pat. No. 8,110,353 B2. Engineered toehold reactions and networks. David Zhang, Andrew J. Turberfield, Erik Winfree [0178] 6. U.S. Pat. No. 8,630,809 B2. System and method for propagating information using modified nucleic acids. Daniel J. Kleinbaum [0179] 7. U.S. Pat. No. 6,300,070 B1. Solid phase methods for amplifying multiple nucleic acids. T. Christian Boles, Ezra S. Abrams [0180] 8. U.S. Pat. No. 7,399,584 B2. Method of comparing a target nucleic acid and a reference nucleic acid. Maureen T. Cronin, Charles Garrett Miyada, Earl A. Hubbell, Mark Chee, Stephen P. A. Fodor, Xiaohua C. Huang, Robert J. Lipshutz, Peter E. Lobban, MacDonald S. Morris, Edward L. Sheldon [0181] 9. U.S. Pat. No. 6,642,000 B2. PCR amplification on microarrays of gel immobilized oligonucleotides. Boris Strizhkov, Sergei Tillib, Vladimir Mikhailovich, Andrei Mirzabekov. [0182] 10. U.S. Pat. No. 7,846,656 B2. Composition for polymerizing immobilization of biological molecules and method for producing said composition. Andrei Mirzabekov, Alla Rubina, Sergei Pankov.