METHOD AND COMPOSITION FOR MEASUREMENT OF NITRIC OXIDE
20230055931 · 2023-02-23
Inventors
Cpc classification
C12Q2565/525
CHEMISTRY; METALLURGY
C12N15/115
CHEMISTRY; METALLURGY
International classification
C12N15/115
CHEMISTRY; METALLURGY
Abstract
A method for determining nitric oxide concentration in biological samples. The method includes for determining nitric oxide concentration in a sample including: (i) providing a nucleic acid complex comprising a first single-stranded nucleic acid molecule comprising a fluorophore crosslinked to the first strand, the fluorophore comprising diaminorhodamine-4-methylamine (DAR-4M) conjugated, to dibenzocyclooctyne-polyethylene glycol (DBCO-PEGn) linker, wherein n equals 4-12 and a second single-stranded nucleic acid molecule that is partially or fully complementary to the first single-stranded molecule, wherein the nucleic acid complex further comprises a first label and a targeting moiety conjugated to the first single-stranded nucleic acid molecule or the second single-stranded nucleic acid molecule, the first label is capable of producing a signal, wherein the intensity of the signal is dependent at least on concentration of the nucleic acid complex in the sample; (ii) contacting the sample with the nucleic acid complex; (iii) measuring the intensity of the signal: and (iii) determining the nitric oxide concentration from the measured signal. Compositions for determining nitric oxide concentrations in biological samples are also included.
Claims
1. A method for determining nitric oxide concentration in a sample comprising: providing a nucleic acid complex comprising a first single-stranded nucleic acid molecule comprising a fluorophore crosslinked to the first strand, the fluorophore comprising diaminorhodamine-4-methylamine (DAR-4M) conjugated to dibenzocyclooctyne-polyethylene glycol (DBCO-PEG.sub.n) linker, wherein n equals 4-12; and a second single-stranded nucleic acid molecule that is partially or fully complementary to the first single-stranded molecule, wherein the nucleic acid complex further comprises a first label and a targeting moiety conjugated to the first single-stranded nucleic acid molecule or the second single-stranded nucleic acid molecule, the first label is capable of producing a signal, wherein the intensity of the signal is dependent at least on concentration of the nucleic acid complex in the sample; contacting the sample with the nucleic acid complex; measuring the intensity of the signal; and determining the nitric oxide concentration from the measured signal.
2. The method of claim 1, wherein determining nitric oxide concentration is in plasma membrane, trans Golgi network, phagosome, macrophage or microglia.
3. The method of claim 1, wherein n=10.
4. The method of claim 1, wherein the first label is a normalizing fluorophore.
5. The method of claim 1, wherein the first label is Alexa488 or Alexa647.
6. The method of claim 1, wherein the first label is crosslinked to the second strand.
7. The method of claim 1, wherein the targeting moiety is crosslinked to the second strand.
8. The method of claim 1, wherein the targeting moiety comprises a cholesterol moiety, a DNA aptamer, oligodeoxynucleotide phosphorothioate, or oligoribonucleotide phosphorothioate.
9. The method of claim 1, wherein the first label and the targeting label are crosslinked to the second strand.
10. The method of claim 1, wherein the first label is Alexa488 and the targeting label is a cholesterol moiety.
11. The method of claim 1, wherein the first label is Alexa647 and the targeting label is a DNA aptamer.
12. The method of claim 1, wherein the first and/or second single-stranded nucleic acid molecule is less than 200 nucleotides; or less than 100 nucleotides; or less than 50, 45, 40, 35, 30, 25 or 20 nucleotides.
13. A nucleic acid complex comprising: a first single-stranded nucleic acid molecule comprising a fluorophore crosslinked to the first strand, wherein the fluorophore, the fluorophore comprising diaminorhodamine-4-methylamine (DAR-4M) conjugated to dibenzocyclooctyne-polyethylene glycol (DBCO-PEG.sub.n) linker, wherein n equals 4-12; and a second single-stranded nucleic acid molecule that is partially or fully complementary to the first single-stranded molecule, wherein the nucleic acid complex further comprises a first label and a targeting moiety conjugated to the first single-stranded nucleic acid molecule or the second single-stranded nucleic acid molecule, the first label is capable of producing a signal, wherein the intensity of the signal is at least dependent on concentration of the nucleic acid complex in the sample.
14. The nucleic acid complex of claim 13, wherein n=10.
15. The nucleic acid complex of claim 13, wherein the first label is a normalizing fluorophore.
16. The nucleic acid complex of claim 13, wherein the first label is Alexa488 or Alexa647.
17. The nucleic acid complex of claim 13, wherein the first label is crosslinked to the second strand.
18. The nucleic acid complex of claim 13, wherein the targeting moiety is crosslinked to the second strand.
19. The nucleic acid complex of claim 13, wherein the targeting label comprises a cholesterol moiety, a DNA aptamer oligodeoxynucleotide phosphorothioate (ODP), or oligoribonucleotide phosphorothioate (ORP).
20. The nucleic acid complex of claim 13, wherein the first label and the targeting label are crosslinked to the second strand.
21. The nucleic acid complex of claim 13, wherein the first label is Alexa488 and the targeting label is a cholesterol moiety.
22. The nucleic acid complex of claim 13, wherein the first label is Alexa647 and the targeting label is a DNA aptamer.
71. The nucleic acid complex of claim 13, wherein the first strand has the following sequence: TABLE-US-00012 (SEQ ID NO: 01) 5′-/5AzideN/ATC AAC ACT GCA CAC CAG ACA GCA-3′.
24. The nucleic acid complex of claim 13, wherein the second strand has the following sequence: TABLE-US-00013 (SEQ ID NO: 02) 5′-/Alexa488N/TGC TGT CTG GTG TGC AGT GTT GAT/ 3-CholTEG/-3′ or (SEQ ID NO: 03) 5′-GGC TAT AGC ACA TGG GTA AAA CGA CTT TGC T/ Alexa647N/G TCT GGT GTG CAG TGT TGA T-3′
25. The nucleic acid complex of claim 13, wherein the first label is ATTO647N and the targeting moiety is ODP or ORP.
26. The nucleic acid complex of claim 25, wherein the first strand has the following sequence: TABLE-US-00014 (SEQ ID NO: 04) 5′-/DAR-PEG10/ATC AAC ACT GCA CAC CAG ACA GCA-3′.
27. The nucleic acid complex of claim 26, wherein the second strand has the following sequence: TABLE-US-00015 (S2-strand) (SEQ ID NO: 05) 5′-/ATTO647N/TGC TGT CTG GTG TGC AGT GTT GAT-3′; (NOckout1826CpG) (SEQ ID NO: 06) 5′-/ATTO647N/TGC TGT CTG GTG TGC AGT GTT GAT tttccatgacgttcctgacgtt-3′; (NOckout1826GC) (SEQ ID NO: 07) 5′-/ATTO647N/TGC TGT CTG GTG TGC AGT GTT GAT tttccatgagcttcctgacctt-3′; (NOckout2007CpG) (SEQ ID NO: 08) 5′-/ATTO647N/TGC TGT CTG GTG TGC AGT GTT GAT tttcgtcgttgtcgttttgtcgtt-3′; (NOckout2007GC) (SEQ ID NO: 09) 5′-/ATTO647N/TGC TGT CTG GTG TGC AGT GTT GAT tttgctgctgtgcttttgtgctt-3′; (NOckoutRNA); (SEQ ID NO: 10) 5′-/ATTO647N/TGC TGT CTG GTG TGC AGT GTT GAT tttggacggaaaagaccccgugg-3′ (NOckoutRNA) (SEQ ID NO: 11) 5′-/ATTO647N/TGC TGT CTG GTG TGC AGT GTT GAT tttggacgggaagaccccgugg-3′; or (pHlicker-SH) (SEQ ID NO: 12) 5′-HS-ATC AAC ACT GCA CAC CAG ACA GCA-3′.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
DETAILED DESCRIPTION OF THE DISCLOSURE
[0078] Before the disclosed methods and materials are described, it is to be understood that the aspects described herein are not limited to specific embodiments, and a.s such can, of course. vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and, unless specifically defined herein, is not intended to be limiting. In view of the present disclosure, the methods described herein can be configured by the person of ordinary skill in the art to meet the desired need.
[0079] Nitric oxide synthase 3 (NOS3) produces the gasotransmitter, nitric oxide (NO) that. drives. critical cellular signaling pathways by S-nitrosylating target proteins. Endogenous NOS3 resides at two distinct sub-cellular locations—the plasma membrane and the trans Golgi network. However, NO generation arising from the activities of both these pools of NOS3 and its relative contribution to physiology or disease is not yet resolvable. A fluorescent DNA-based probe technology, NOckout, is described to quantitatively map the activities of endogenous NOS3 at both sub-cellular locations in live cells. It was found that although NOS3 at the Golgi is ten-fold less active than at. the plasma membrane, its activity is essential for the structural integrity of the Golgi. The newfound ability to spatially map NOS3 activity provides a platform to discover selective regulators of the distinct pools of NOS3.
[0080] Here, a novel DNA-based fluorescent probe technology is disclosed which can quantitatively map NOS3 activity in real time while providing subcellular spatial resolution. DNA-based fluorescent probes are a fairly recent development that combine the sensitivity and photophysical advantages of small molecule probes with the stable localization provided by proteins. They have been successfully deployed to quantitatively map second messengers such as pH, chloride and calcium with sub-cellular resolution in living systems. The 1:1 stoichiometry of DNA hybridization facilitates the integration of these multiple functions with stoichiometric precision onto a single probe. Thus, the DNA-based fluorescent probes for NO, denoted NOckout include (i) an NO sensitive fluorophore possessing the specificity and sensitivity of small molecule probes (ii) an internal reference dye for ratiometric quantitation and (iii) a targeting function that stably localizes the reporter at either the plasma membrane or the Golgi.
[0081] In this disclosure, the NOckout probes were found to be useful for quantitating NOS3 activity simultaneously at the two relevant sub-cellular locations: the plasma membrane and the TGN. This was achieved using two spectrally different NOckout probes, one localized at the plasma membrane (NOckout.sup.PM or 1) and the other localized at the TGN (NOckout.sup.TGN or 2). It was found that when NOS3 is activated, NO production due to enzymatic activity at the plasma membrane was ˜7-fold higher than at the TGN. It was also found that the high activity of the NOS3 fraction at the plasma membrane was due to this population being selectively phosphorylated at S1177. Interestingly, low activity of NOS3 at the TGN is critical for Golgi integrity. This is because, despite the low NOS3 activity at the TGN, the Golgi is highly enriched fin S-Nitrosylated proteins. Reducing S-nitrosylation at the TGN by inhibiting NOS3 led to fragmentation of the Golgi and subsequent cell senescence in breast cancer cells through a Src kinase mediated pathway. This reveals that the Golgi apparatus in breast cancer cells is a hotspot for S-Nitrosylation and is critical for the structural integrity of this organelle.
[0082] The NOckout probes combines the advantages of small molecule probes, with the stable spatial localization afforded by proteins. The DNA scaffold can be molecularly programmed to display a well-defined nucleic acid-based PAMP, simultaneously display NO detection chemistry, as well as a reference fluorophore, which can be used for ratiometric imaging since the latter is insensitive to ROS, NO, pH and other ions. All three functionalities can be integrated in a well-defined stoichiometry onto a single assembly by hybridizing complementary DNA strands, each bearing one of the functionalities. Thus the resultant assembly is a DNA duplex that is recognized in the living brain as fragmented self-DNA, packaged into apoptotic bodies, which are then ingested by microglia resident in the brain and targeted to their phagosomes.
[0083] When specific PAMPs are displayed on NOckout probes, it was found that they triggered NOS2 activation by binding a cognate endosomal TLR. in macrophages in cell culture as well as microglia in live zebrafish brains. The modular nature of DNA-based assemblies allows us to create a series of NOckout probes, each displaying a. different nucleic-acid based PAMP, but having identical NO detection characteristics. This was achieved by simply replacing the PAMP-bearing DNA strand in a given NOckout variant with another DNA/RNA sequence bearing a different PAMP. Using this plug and play strategy, assay of phagosomal NO production due to NOS2 activation as a result of engaging a specific TLR through the PAMP on the NOckout probe can be performed. Using these “trigger and detect” NOckout probes it was found that single stranded RNA (ssRNA) of microbial origin can act as PAMPs in zebrafish. This reveals that zebrafish have the capacity to detect ssRNAs derived from pathogenic sources as PAMPs to induce phagosomal NO production.
[0084] The oligonucleotides and nucleic acid molecules in the compositions and methods described herein may include one or more labels. Nucleic acid molecules can be labeled by incorporating moieties detectable by one or more means including, but not limited to, spectroscopic, photochemical, biochemical, immunochemical, or chemical assays. The method of linking or conjugating the label to the nucleotide or oligonucleotide depends on the type of label(s) used and the position of the label on the nucleotide or oligonucleotide.
[0085] As used herein, “labels” are chemical or biochemical moieties useful for labeling a nucleic acid. “Labels” include, for example, fluorescent agents, chemiluminescent agents, chromogenic agents, quenching agents, radionucleotides, enzymes, substrates, cofactors, inhibitors, nanoparticles, magnetic particles, and other moieties known in the art. Labels are capable of generating a measurable signal and may be covalently or noncovalently joined to an oligonucleotide or nucleotide. The labels can be conjugated to the nucleic acid molecules directly or indirectly by a variety of techniques. Depending on the precise type of label used, the label can be located at the 5′ or 3′ end of the oligonucleotide or located internally in the oligonucleotide's nucleotide sequence. For instance, using commercially available phosphoramidite reagents, one can produce nucleci acid molecules containing functional groups (e.g., thiols or primary amines) at either terminus, for example by coupling of a phosphoramidite dye to the 5′ hydroxyl of to 5′ base by the formation of a phosphate bond, or internally, via an appropriately protected phophoramidite.
[0086] A “normalizing fluorophore” is generally a NO target insensitive fluorophore. Any suitable normalizing fluorophore may be used such as the ones described in WO 2016/187284, which is incorporated by reference in its entirety. Representative examples of suitable normalizing fluorophores as the first label include Alexa488 or Alexa647. In some embodiments, the normalizing fluorophore is crosslinked to the second strand. In embodiments the ratio of the NO sensitive fluorophore to the normalizing fluorophore is 1:1.
[0087] In embodiments, the nucleic acid complex further comprises a targeting moiety which targets a specific location or region of the cell such as the plasma membrane, trans golgi network, pahagosome, macrophage and microglia. Representative examples of a targeting moiety include a cholesterol moiety, an oligodeoxynucleotide phosphorothiolate or oligoribonucleotide phosphorothiate. In some embodiments, the targeting moiety is a nucleic acid sequence. In some embodiments, the targeting moiety has a cognate artificial protein receptor. The artificial receptor may be, for example, a single chain variable fragment (scFv), transcription factor, Zn-fingered protein, leucine zipper, or DNA binding immunoglobulin, In some embodiments, the targeting moiety is encoded on the same nucleic acid strand as the first and/or second single-stranded nucleic acid molecule. In some embodiments, the targeting moiety is selected from an aptamer, a duplex domain targeted to an artificial protein receptor, a nucleic acid sequence that binds an anionic-ligand binding receptor, and an endocytic ligand. In some embodiments, the targeting moiety comprises a peptide directly or indirectly conjugated to the nucleic acid molecule. In some embodiments, the targeting moiety peptide comprises one or more of a fusogenic peptide, a membrane-permeabilizing peptide, a sub-cellular localization sequence, or a cell-receptor ligand. In some embodiments, the sub-cellular localization sequence targets the nucleic acid complex to a region of the cell where spatial localization of a targeted protein is present. In some embodiments, the sub-cellular localization sequence targets the nucleic acid complex to a region of the cell selected from the group consisting of: the medial trans Golgi. cistemae or trans Golgi network, lysosome, endosome, phagosome, and a specific spatial location on the plasma membrane. In some embodiments, the sub-cellular organelle is one that exchanges membrane directly or indirectly with the plasma membrane.
[0088] A “sample” refers to a biological sample selected from a cell, cell extract, cell lysate, tissue, tissue extract, bodily fluid, serum, blood and blood product. In some embodiments, the sample is a live cell. In other embodiments, the sample is a region of the cell such as a cellular membrane or a intracellular organelle.
[0089] The nucleic acid complexes as described herein can be readily introduced into a host cell, e.g., a mammalian (optionally human), bacterial, parasite, yeast or insect cell by any method in the art. For example, nucleic acids can be transferred into a host cell by physical, chemical or biological means. It is readily understood that the introduction of the nucleic acid molecules yields a cell in which the intracellular NO may be monitored. Thus, the method can be used to measure intracellular NO in cells cultured in vitro. The nucleic acid complex of the disclosure can also be readily introduced into a whole organism to measure the NO in a cell, organelle or tissue in vivo. For example, nucleic acid complex of the disclosure can be transferred into an organism by physical, chemical or biological means, e.g., direct injection.
[0090] In certain embodiments, the methods for introducing nucleic acid complexes of the disclosure may be those disclosed in Chakraborty et al. “Nucleic Acid-Based Nanodevices in Biological imaging,” Annu. Rev. Biochem. 85:349-73 (2016), incorporated in its entirety by reference herein.
[0091] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. One colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (i.e., an artificial membrane vesicle). The preparation and use of such systems is well known in the art.
[0092] In some embodiments, the use of lipid formulations is contemplated for the introduction of the nucleic acid complex of the disclosure into host cells in vitro, ex vivo or in vivo). In some embodiments, the nucleic acid complex of the disclosure may be associated with a lipid. The nucleic acid complex of the disclosure associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide(s), entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid. The lipid, lipid/nucleic acid complex compositions are not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles, or with a “collapsed” structure. They may also simply be interspersed in a solution, possibly forming aggregates which are not uniform in either size or shape.
[0093] In some embodiments, the one or more nucleic acid complexes of the disclosure are linked to a targeting sequence that directs the nucleic acid complex to a desired cellular compartment.
[0094] As used herein,“nucleic acid,” “nucleotide sequence,” or“nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide, or any fragment thereof and to naturally occurring or synthetic molecules. The term “peptide nucleic acid” or “IRNA” as used herein generally refers to nucleic acid analogue in which the sugar phosphate backbone of natural nucleic acid has been replaced by a synthetic peptide backbone. The term “RNA equivalent” in reference to a DNA sequence, is composed of the same linear sequence of nucleotides as the reference DNA sequence with the exception that all occurrences of the nitrogenous base thymine are replaced with uracil, and the sugar backbone is composed of ribose instead of deoxyribose. It is understood to be a molecule that has a sequence of bases on a backbone comprised mainly of identical monomer units at defined intervals. The bases are arranged on the backbone in such a way that they can enter into a bond with a nucleic acid having a sequence of bases that are complementary to the bases of the oligonucleotide. The most common oligonucleotides have a backbone of sugar phosphate units. A distinction may be made between oligodeoxyribonucleotides, which do not have a hydroxyl group at the 2′ position, and oligoribonucleotides, which have a hydroxyl group in this position. Oligonucleotides also may include derivatives, in which the hydrogen of the hydroxyl group is replaced with organic groups, e.g., an allyl group. An oligonucleotide is a nucleic acid that includes at least two nucleotides.
[0095] One nucleic acid sequence may be“complementary” to a second nucleic acid sequence. As used herein, the terms“complementary” or“complementarity,” when used in reference to nucleic acids (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid), refer to sequences that are related by base-pairing rules. For natural bases, the base pairing rules are those developed by Watson and Crick. As an example, for the sequence “T-G-A”, the complementary sequence is “A-C-T.” Complementarity can be “partial,” in which only some of the bases of the nucleic acids are matched according to the base pairing rules. Alternatively, there can be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between the nucleic acid strands has effects on the efficiency and strength of hybridization between the nucleic acid strands.
[0096] Oligonucleotides as described herein may be capable of forming hydrogen bonds with oligonucleotides having a complementary base sequence. These bases may include the natural bases such as A, G, C, T and U, as well as artificial bases. An oligonucleotide may include nucleotide substitutions. For example, an artificial or modified base may be used in place of a natural base such that the artificial base exhibits a specific interaction that is similar to the natural base.
[0097] An oligonucleotide that is complementary to another nucleic acid will “hybridize” to the nucleic acid under suitable conditions (described below). As used herein,“hybridization” or “hybridizing” refers to the process by which an oligonucleotide single strand anneals with a complementary strand through base pairing under defined hybridization conditions. “Specific hybridization” is an indication that two nucleic acid sequences share a high degree of complementarity. Specific hybridization complexes form under permissive annealing conditions and remain hybridized after any subsequent washing steps. “Hybridizing” sequences which bind under conditions of low stringency are those which bind under non-stringent conditions (6×SSC/50% formamide at room temperature) and remain bound when washed under conditions of low stringency (2×SSC, 42° C.), Hybridizing under high stringency refers to the above conditions in which washing is performed at 2'3SSC, 65° C. (where SSC is 0.15M NaCl, 0.015M sodium citrate, pH 7.2).
[0098] In some embodiments, a kit comprising a nucleic acid complex for quantifying NO is contemplated.
[0099] The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”
[0100] Throughout this application, the term “about” is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.
[0101] The use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and/or.” It is also contemplated that anything listed using the term “or” may also be specifically excluded.
[0102] As used in this specification and claim(s), the words “comprising” and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
[0103] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
EXAMPLES
[0104] Certain aspects of the disclosure are illustrated further by the following examples, which are not to be construed as limiting the disclosure in scope or spirit to the specific methods and materials described in them.
Materials and Methods
[0105] Part I (DNA-Based Fluorescent Probe Mapping of NOS3 Activity with Sub-Cellular Spatial Resolution) (Examples 1-6)
[0106] Reagents. All oligonucleotides (Table 1) were purchased from Integrated DNA Technology (IDT, USA). HPLC purified DNA oligonucleotides were used without further purification, whereas fluorescently modified oligonucleotides were precipitated from ethanol prior to further use. DAR was functionalized to Si as shown in
TABLE-US-00005 TABLE 1 Name Sequence S1 5′-/5AzideN/ATC AAC ACT GCA CAC CAG ACA GCA-3′ (SEQ ID NO: 01). S2.sup.PM 5′-/5Alexa488N/TGC TGT CTG GTG TGC AGT GTT GAT/3-CholTEG/-3′ (SEQ ID NO: 02) S2.sup.TGN 5′-GGC TAT AGC ACA TGG GTA AAA CGA CTT TGC T/iAlexa647N/G TCT GGT GTG CAG TGT TGA T-3′ (SEQ ID NO: 03)
[0107] 1400W, PTIO, E.sub.2, L-NAMF and DEA-NONOate were purchased from Carnan chemicals. All other chemicals were purchased from Sigma Aldrich. Stock solutions of Methylene blue and PTIO were prepared in DMSO (50 mM). Stock solution of E.sub.2 was prepared in ethanol (10 mM), DEA-NONOate stocks were prepared in NaOH (10 mM, pH 9), and were all used within a week. For incubations lasting longer than 24 h, the aforementioned agonists or antagonists were replenished to the same concentration in new medium every 24 h. DsiRNA to knockdown NOS3 were purchased from IDT (hs.Ri.NOS3.13.1 and hs.Ri.NOS:3.13.2), NOS3 forward primer: AGC GGC TCC CAG GCC CAC GA (SEQ ID NO:22), reverse primer: CAG ACC TGC AGT CCC GGG CA (SEQ ID NO:23) and β-actin forward primer: CCT CGC CTT TGC CGA TCC (SEQ ID NO:24), reverse: primer: GAG TCC ATC ACG ATC CCA GT (SEQ ID NO:25).
[0108] In vitro fluorescence measurement. All fluorescence studies were carried out on a Fluoromax-4 (Horiba Scientific, Japan) spectrophotometer. A 10 μM stock of NOckout sensors was diluted to 100 nM final concentration with 100 mM sodium phosphate buffer, pH 6.0, unless mentioned otherwise. The emission spectra of DAR, A488 and A647 were acquired by exciting the sample at 550 nm, 488 nm and 650 nm respectively (
[0109] Cell culture. T-47D cells and MCF-7 cells were kind gifts from Prof. Geoffrey Greene (The Ben May Department for Cancer Research, The University of Chicago). Normal breast epithelial cells MCF-10A and 184A1 were a kind gift from Prof. Marsha Rosner (The Ben May Department for Cancer Research, The University of Chicago). Cells were grown according to manufacturer's protocol. Briefly, T-47D cells were grown in RPMI-1640 medium (Gibco, Life technologies) supplemented with 100 units/mL of Penicillin, 100 μg/mL of streptomycin (Life technologies), 10% final concentration of heat inactivated fetal bovine serum (Gibco, Life technologies) and 0.2 U/mL human recombinant insulin. MCF-7 cells were grown in DMEM supplemented with 100 units/mL of Penicillin, 100 μg/mL of streptomycin (Life technologies), 10% final concentration of heat inactivated fetal bovine serum (Gibco, Life technologies) and 0.01 mg/mL human recombinant insulin. MCF-10A and 184A1 cells were grown in MEBM+MEGM medium containing 0.005 mg/ML transferrin and 1 ng/mL cholera toxin. Cells were maintained at 37° C. in a humidified chamber at 5% CO.sub.2 concentration. All the experiments were performed at early passage number (after receiving, n<17) and at 60% confluency.
[0110] Immunofluorescence staining. Cells were cultured on a glass bottom 3.5 cm imaging dish to reach 60% confluency. Cells were treated with NO scavengers (100 μM PTIO, 20 μM Methylene blue, 20 μM hemoglobin) or NOS2 blocker 1400W (10 μM) or ROS scavenger TEMPOL (2 mM). Treated cells were then washed three times with 1× PBS (pH 7.4) and fixed using, 4% paraformaldehyde at room temperature (RT, 15 min). Subsequently, cells were permeabilized using 0.25% triton X-100 followed by blocking using 3% BSA in 1× PBS. Cells were then incubated with indicated primary antibodies—mouse monoclonal anti-eNOS antibody (SantaCruz Cat #sc-376751), Polyclonal Anti-S-nitrosocysteine antibody (Abeam Cat #ab94930 or Abeam Cat #ab50185), Rabbit polyclonal Anti-Giantin antibody (Abeam Cat #ab24586) or Mouse monoclonal Anti-GM130 antibody (BD Biosciences Cat #610822) in blocking buffer (3% BSA in 1× 4 PBS) for 1 hour at RT. Cells were then washed for 5 min with 1× PBS (3×). Respective secondary antibodies conjugated with either Alexafluor 488 or Alexafluor 647 were added to the cells and incubated for 1 hr at RT. Cells were washed again to remove excess secondary antibody using 1× PBS for 5 min (3×). Hoechst 33342 (5 μM) was added 10 min prior to imaging to stain nuclear DNA. Cells were then imaged on a Leica SP8 laser scanning confocal microscope using excitation wavelengths 405 nm (Hoechst), 488 nm (AlexaFluor 488) and 647 nm (AlexaFluor 647). Images were processed using Fiji and maximum z-projection of 2-3 z-planes are used in representative images.
[0111] Image acquisition. T-47D cells were maintained as mentioned above in the cell culture section. Cells were washed twice with Hank's balanced salt solution (HBSS) before incubating them with 500 nM NOckout.sup.TGN for 30 min or 500 nM NOckout.sup.PM for 10 min at 37° C. followed by 3 washes with HBSS solution to remove any unloaded sensors. For steady state imaging (
[0112] For simultaneous imaging cells were treated with 500 nM NOckout.sup.TGN for 30 min where last 10 min cells were co-incubated with 500 nM NOckout.sup.PM. In order to achieve lowest signal (PTIO,
[0113] Image analysis. Image analysis was performed using Fiji (Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682 (2012)). Auto-fluorescence was subtracted from images for ratiometric analysis. For representation, images were further processed by smooth and despeckle functions. In order to present G/B or G/R images, a mask for each image was constructed using Otsu thresholding method, and mask-multiplied images were used for division. The ROI plugin in Fiji was used to select either TGN (Alexa647 channel) or PM (Alexa488 channel) and these ROIs were recalled in DAR channel to measure intensity in all three channels. These raw values were used to plot G/B or G/R values in
[0114] Surface plots shown in
[0115] Golgi fragmentation was quantified with immunofluorescence images of Golgi structural protein Giantin. Merge images of Hoechst and Giantin allowed identification of cell numbers and enumeration of Golgi fragments per cell (≤3 Golgi fragments per cell was considered intact Golgi) (Lee, J. E. et al. Dependence of Golgi apparatus integrity on nitric oxide in vascular cells: implications in pulmonary arterial hypertension. Am. J. Physiol. Heart Circ. Physiol. 300, H1141-58 (2011)).
[0116] Sub-cellular nitric oxide quantification. DEA NONOate is a pH dependent small molecule NO donor with half-life about 9 min at pH 7.4 at 25° C. (
DEA NONOate2NO*+DEA (Reaction 1)
[0117] Each DEA NONOate molecule releases 1.5 molecules of NO effectively. (C. Maragos et al. 1992) On the other hand, lifetime of NO radical in aerobic solution depends on its reaction with O.sub.2, which is the first and rate limiting step of various reactive nitrogen species (RNS) generation (see Namin, S. M., Nofallah, S., Joshi, M. S., Kavallieratos, K. & Tsoukias, N. M. Kinetic analysis of DAF-FM activation by NO: toward calibration of a NO-sensitive fluorescent dye. Nitric Oxide 28, 39-46 (2013)).
2NO*+O.sub.22NO.sub.2 (Reaction 2)
[0118] From equation 1 and 2, rate of NO generation in DEA NONOate solution can be calculated:
[0119] Where k.sub.1=1.31×10.sup.−3 s.sup.−1 (calculated from
[0120] By solving the differential equation 2 numerically predicted time dependent traces of NO concentration given an initial NONOate concentration (
[0121] After characterizing NO releasing profile of DEA NONOate, cellular NO production was compared to NO released from DEA-NONOate. To obtain a calibration curve, NOckout.sup.PM labeled T47D cells was treated with a range of DEA NONOate concentrations in 100 mM pH 7.4 phosphate buffer at room temperature. As expected G/B intensity increases over time and the rate of increase is proportional to DEA-NONOate concentration. Then 1 μM thapsigargin was added to get the initial rate of NO production at the plasma membrane.
[0122] The following assumptions were made to directly relate rate of increase
[0123] Note this only applies to the initial phase of DAR activation where [DAR] can be considered as constant. From the predicted [NO] from DEA-NONOate, the tested concentration of NONOate, the first 30 s [NO] increases with t. The average slope is taken for first 30 s of the predicted [NO] curve as initial d[NO]/dt. In the in-cellulo experiment, an image is taken every minute and the slope is taken of the first minute after NONOate addition as initial rate of G/B increase. As FIG. 16d shows that the slope of first minute almost equal to slope of first 30 s. For every [NONOate].sub.0 initial rate of d[NO]/dt from predicted [NO] curve is plotted against initial rate of G/B from in vitro cell experiment, generating a linear fit with R.sup.2=0.97, confirming the approximation of equation 3. This is the calibration curve that allows for measurement of NO produced by NOS3.
[0124] Using the calibration curve, the initial G/B rates from thapsigargin treated cells is plugged in and the plasma membrane NO production was measured to be 576±61 nM/s (
[0125] In vitro specificity of NOckout. Fluorescence measurements in vitro were performed as mentioned above. Aqueous solution of DEA NONOate (Cayman, United States) was added to a final concentration of 50 μM. Aqueous H.sub.2O.sub.2 solution was used as H.sub.2O.sub.2 donor and concentration of H.sub.2O.sub.2 was quantified using ε=43.6 M.sup.−1cm.sup.−1 at 240 nm. Xanthine/Xanthine oxidase was used for superoxide generation, which was quantified using Cytochrome C reduction (Brandes, R. P. & Janiszewski, M. Direct detection of reactive oxygen species ex vivo. Kidney Int. 67, 1662-1664 (2005)). Fenton chemistry was used for the generation of hydroxyl radical (*OH) (Duarte, A. J. & da Silva, J. C. G. E. Reduced fluoresceinamine as a fluorescent sensor for nitric oxide. Sensors (Basel) 10, 1661-1669 (2010)). Aqueous solutions of NO.sub.2.sup.− and NO.sub.3.sup.− were prepared from their respective sodium salts.
[0126] ROS/RNS generators were added to 100 nM of NOckout in pH 6.0 100 mM sodium phosphate buffer, to a final concentration of 100 μM each of H.sub.2O.sub.2, *OH, O.sub.2*.sup.−, NO.sub.2.sup.− and NO.sub.3.sup.−. 10 μM NaOCl was added to generate 10 μM HOCl. Samples were incubated for 15 minutes at 37° C. and fluorescence spectra were recorded in A488 and DAR channels. Fold change of G/B in each case was normalized to that of NOckout with DEA NONOate.
[0127] Intracellular Calcium Imaging. T-47D cells were maintained as described above. Fluo-4, AM was purchased from Invitrogen (ThermoFisher, #F-14201) and 1 mM stock solutions were made in dry DMSO. For efficient intracellular loading of the probe, cells were washed three times with HBSS (pH 7.4), followed by incubation with 10 μM Fluo-4, AM in HBSS for 40 minutes. Subsequently, cells were washed with HBSS 3 times and treated with Thapsigargin (100 mM) or 17-β-Estradiol (300 nM) (
[0128] Apoptosis detection assay. Cells were treated with either DMSO or NO scavenger PTIO for 48 hours before staining for apoptotic cells with Annexin V-Cy5 (Biovision 1013-200) as per manufacturer's protocol. Briefly, T-47D cells cultured under indicated treatments were washed twice with HBSS before incubating them with 1× Annexin V binding buffer for 5 minutes. 1 of Annexin V-Cy5 was added on to the cells and imaging dishes were incubated for 5 minutes in dark. Cells were trashed three times with HBSS before image acquisition.
[0129] Cell senescence assay. Cells were treated with either DMSO or NO scavenger PTIO (200 μM) for 48 hours were stained for senescence associated β-galactosidase (SA-b-Gal) activity (see Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J. & Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat. Protoc. 4, 1798-1806 (2009)). Briefly, sub confluent cells were washed twice with HBSS for 30 s per wash. Cells were fixed in 4% para formaldehyde solution for 4 min and washed twice with HBSS. Cells were incubated with staining solution (40 mM citric acid/Na phosphate buffer, 5 nM K.sub.4 [Fe(CN).sub.6] 3H.sub.2O, 5 mM K.sub.3 [Fe(CN).sub.6], 150 mM sodium chloride, 2 mM magnesium chloride and 1 mg/ml X-gal in distilled water) for 16 hours at 37° C. Cells were washed three times with HBSS before image acquisition.
[0130] Part 2 (DNA nanodevices for mapping nitric oxide in the living brain) (Examples 7-11)
[0131] Reagents: All functionalized DNA oligonucleotides were purchased from Integrated DNA Technologies (IDT) as a lyophilized powder. Oligonucleotides were dissolved in milli-Q water and quantified using a UV-Vis spectrophotometer (Shimadzu UV-3600, Japan) and subsequently stored in a refrigerator at -20° C. Immunostimulatory ATTO647N labeled DNA and RNA containing phosphorothioate backbone were custom synthesized by IDT. All the chemicals used for the synthesis of DAR-N.sub.3 were purchased from Acros Organics (USA) and Sigma (USA). Nitric oxide donor (DEANONOate), NOS2 inhibitor (1400W), NADPH-oxidase inhibitor (VAS2870), Myeloperoxidase inhibitor (ABAH) and V-ATPase inhibitor (Bafilomycin A1) was purchased from Cayman Chemicals (USA). Diamino polyethylene glycol linker (10 kDa) was purchased from Creative PEGWorks (USA). Annexin V-Cy5 apoptosis kit was purchased from BioVision (Cat No: K103) and pHrodo maleimide was purchased from Thermo Fisher Scientific (Cat. No: P35371). NOS2 antibody was obtained from Novus Biologicals (NB300-605). LAMP1 antibody was obtained from Abeam (ab62562). Morpholino sequences were purchased from Gene Tools (USA). DAR-N.sub.3 was synthesized as known in the art.
[0132] Image acquisition: Wide field microscopy was carried out on an IX83 inverted microscope (Olympus Corporation of the Americas, Center Valley, Pa., USA) using either a 100× or 60×, 1.4 NA, DIC oil immersion objective (PLAPON, Olympus) equipped with an Evolve Delta 512 EMCCD camera (Photometrics, USA). Filter wheel, shutter and CCD camera were controlled using MetaMorph software (Molecular Devices, USA). For NOckout stability assay J774A.1 cells were excited simultaneously in the DAR (546 nm) and A647N (650 nm) channels. Volume images were maximum intensity projected to calculate whole cell intensities from individual channels. Images were background subtracted using intensities from a cell-flee area in respective Channels.
[0133] Confocal images from1774A.1 cells and primary microglia were captured with a. Leica TCS SP5 II STED laser scanning confocal microscope (Leica Microsystems, Inc. Buffalo Grove, Ill., USA) equipped with a 63×, 1.4 NA, Oil immersion objective. DAR was excited using a diode-pumped solid-state laser with 561 nm wavelength. A647N was excited using a He—Ne laser with 633 nm wavelength. Acousto-Optical Beam Splitter (AOBS) with settings suitable for each fluorophore and recorded using hybrid detectors (HyD).
[0134] Zebrafish brain was imaged in the optic tectum using an upright Zeiss LSM-710 confocal microscope equipped with water immersion objectives (20×, or 40×). Zebrafish larvae (3-4 dpf were mounted dorsally in a 1.5% low-melting point agar-bed on a confocal imaging dish (3.5 cm glass bottom). E3-containing 0.003% MS-222 was present in the imaging dish though out the imaging section. For NOckout injected samples, images were acquired simultaneously in GFP, DAR, and A647N channels using excitation wavelengths 488 nm, 560 nm and 645 nm from Argon-ion (488 nm), Helium-Neon (543 nm & 632 nm) laser sources respectively. pHrodo was imaged using the same settings as that of DAR.
[0135] Image analysis: A MATLAB based program called Findosome was used to calculate the (G/R) values of individual endosomes from the acquired images. Maximum Z-projected images created using Fiji (NIH) were fed to Findosome to pick endosomal compartments as ROI corresponding to individual endosomes based on the A647 channel intensity. For each ROI, the program calculates fluorescence intensities both in the normalizing channel (A647, R) as well as in the DAR (G) channel. The results were exported as an excel file. From the results, (G/R) value for individual endosomes can be calculated. Phagosomal (G/R) values from the zebrafish microglia are calculated using Fiji software. Images were imported to Fiji and maximum Z-projected images were created. ROI were manually drawn around clearly identifiable phagosomes using the normalizing channel A647 intensity. Fluorescence intensities in A647 and DAR channels were calculated. G/R values are either represented as heat map images using Fiji or as bar graph using Origin software. Intracellular measurements of (G/R) values was performed in GFP colocalized microglia. For (G/R) ratio quantification experiments, only those vesicles that are present in both green (G) and red (R) channels were considered. This was because the cell had ˜2 to 5% of vesilves that were highly autofluorescent in the green channel This percentage can be estimated by labeling cells with a dsDNA carrying only an Atto647N label. Autofluorescent vesicles can be identified as puncta in the green channel (in such samples) that do riot show up in the red chapel and typically correspond to <5%. Therefore, the autofluorescent vesicles were identified and removed during our analysis.
[0136] Cell culture protocol: J774A.1 cells were cultured in Dulbecco's Modified Eagle's Medium (Gibco, USA, 11960044) with 10% Fetal bovine serum (Gibco, USA, 26140079) containing 100 U/mL penicillin and 100 μg/mL streptomycin and maintained at 37° C. under 5% CO.sub.2. For all the experiments cells passage number less than thirty was employed.
[0137] Adult microglia isolation protocol: Adult microglia were isolated from 7-week C5BL/6 female mice as described previously with few modifications (Underhill, D. M. & Ozinsky, A. Phagocytosis of microbes: complexity in action. Annu. Rev. Immunol. 20, 825-852 (2002); Dupré-Crochet, S., Erard, M. & Nüße, O. ROS production in phagocytes: why, when, and where? J. Leukoc. Biol. 94, 657-670 (2013)). Briefly, after perfusion with ice-cold HBBS, brains were dissected and subjected to mechanical digestion by homogenization in HBBS, to prepare single cell suspension. Tissue debris were removed by passing the cell suspension through a 40 μm cell strainer. The brain cell suspension was re-suspended in 37% isotonic Percoll and underlayed with 70% Percoll. This was followed by overlaying of 30% Percoll and HBBS before centrifugation at 600 g for 30 min at 4° C. The top myelin layer was removed and the cells at the interface of 70/30 were collected and washed thrice with. HBBS and pelleted at 300 g. The cells were counted and approximately 4000 cells were seeded in 35 mm cell culture dishes in RPMI media without FBS and used for microglial experiment with NOckout sensors.
[0138] Neonatal primary microglia isolation: Mouse primary mixed cortical and hippocampal glial culture were isolated and cultured as described previously (Wink, D. A. et al. Nitric oxide and redox mechanisms in the immune response. J. Leukoc. Biol. 89, 873-891 (2011)). Briefly, brains from postnatal day 1-2 C57BL/6 mice were isolated. After removing of striatum and meninges, the remaining cortical and hippocampal tissue was mechanically dissociated and enzymatically digested in trypsin (Gibco, USA, 59418C) and DNAse-I (10 mg/mL, Sigma, USA, D5025) in HBSS for 30 minutes at 37° C. 1:1 (v/v) Dulbecco's modified Eagle's medium (DMEM, Gibco, USA, 11965092) with 10% fetal bovine serum (FBS, Gibco USA, 26140079) was added to terminate digestion. Tissue was harvested by centrifugation and plated at a density of 5×10.sup.5 cells/mL in T-75 cm.sup.2 tissue culture flasks. Media was changed the next day and every 3 days until a cellular monolayer had formed after 2 weeks.
[0139] Microglia cells were isolated from mixed glial culture after overnight serum-starvation using mild trypsinization as previously described (Takeuchi, O. & Akira, S. Pattern recognition receptors and inflammation. Cell 140, 805-820 (2010). Media was removed from established mixed glial culture. Cell monolayers were washed with Dulbecco's phosphate buffered saline (DPBS, Gibco, USA, 14040133) to remove residual FBS. Trypsin-EDTA (Gibco, USA, 25200056) diluted 1:4 (v/v) in DMEM was added for mid trypsinization for 45 minutes at 37° C. Detached astrocytic cells were removed and adherent microglia was washed with DPBS followed by supplement of DMEM containing 10% FBS. Isolated microglia cultures were sequentially serum-starved from 10% to 5% to 2.5% to 0% FBS concentration via daily media changes. Purity of microglia cultures was assessed before experiments (
[0140] Immunocytochemistry: Primary microglia cells were treated with 1 μM NOckout 1826 CpG/GpC for 3 hours. Cells were then washed three times with 1× PBS (pH 7.4) and fixed using 2.5% paraformaldehyde at room temperature for 15 min. The cells were subsequently washed 3 times with 1× PBS and followed by incubation with 3% bovine serum albumin (BSA) for blocking in PBS (1×) for 1 hour at room temperature. Then the cells were incubated with anti-mouse NOS2 antibody (Novus, NB300-605, 1:30 dilution) in blocking solution (3% BSA in PBS) for 1 hour at room temperature. To remove excess primary antibody cells were washed three times with 1× PBS. Cells were then treated with Alexa Fluor 488 conjugated goat anti-rabbit secondary antibody (Invitrogen, a11008, 1:2000 dilution) for 1 hour followed by three washes with 1× PBS. Cells were incubated with Hoechst 33342 (5 μM) for 10 minutes to stain the nucleus. Cells were imaged on a confocal microscope as described elsewhere. LPS (1 μg/mL) treated J774A.1 cells (for 12 h) were immunostained for NOS2 using a similar protocol as described above for the microglial cells. (
[0141] Pharmacological inhibition: Pharmacological inhibition of different enzymes were performed by employing known inhibitors. NOS2 inhibition was achieved using a specific and irreversible inhibitor, 1400W (10 μM) (K.sub.1 value against NOS2 is 7 nM) (Mogensen, T. H. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev. 22. 240-73, Table of Contents (2009)). ROS produced in J774A.1 cells by NADPH-oxidase was inhibited by using a selective inhibitor VAS2870 (10 μM) (West, A. P., Koblansky, A. A. & Ghosh, S. Recognition and signaling by toll-like receptors. Annu. Rev. Cell Dev. Biol. 22, 409-437 (2006)). Myeloperoxidase activity to produce HOCl was blocked by using 4-aminobenzoic acid hydrazide (ABAH, 50 μM) (Li, Y., Li, Y., Cao, X., Jin, X. &. Jin, T. Pattern recognition receptors in zebrafish provide functional and evolutionary insight into innate immune signaling pathways. Cell Mol Immunol 14, 80-89 (2017)). Vacuolar H.sup.+-ATPases (V-ATPases) were blocked by using a selective and reversible inhibitor Bafilomycin A.sub.1 (300 nM). Cells were bathed in inhibitors 1 h prior to the addition of NOckout probes during the specificity experiment performed in J774A.1 cells. (
[0142] TNF-α Quantification: To quantify the immunogenicity NOckout probes and the corresponding immunogen alone, ELISA for TNF-αwas performed in J774A.1 cells. Briefly, J774A.1 cells cultured in DMEM were incubated with 500 nM NOckout sensors, CpG nucleotides, RNA, or LPS at 37° C. for 2 h. Postincubation 100 μL of extracellular medium from the culture was used to perform TNF-α quantification using ELISA kit (Cayman, catalog number 500850) according to manufacturers instructions. The calibration curve for TNF-α was generated using recombinant. TNF-α as per the vendor's instructions.
[0143] In vitro specificity of NOckout to NO: In vitro specificity experiment of NOckout was performed in the presence of NO* and various ROS (O.sub.2*.sup.−, H.sub.2O.sub.2, HOCl etc.). NO* was generated from corresponding NO* donor, DEANONOate (30 μM). H.sub.2O.sub.2 (100 μM) was used directly from its aqueous stock solution and it was quantified by using UV-Vis spectroscopy (ε=43.6 M.sup.−1cm.sup.−1 at 240 nm). Xanthine/Xanthine oxidase was used for superoxide generation and it was quantified using Cytochrome C reduction as described earlier (Gao, J. J. et al. Cutting edge: bacterial DNA and LPS act in synergy in inducing, nitric oxide production in RAW 264.7 macrophages. J. Immunol. 163. 4095-4099 (1999)). Hydroxyl radical (*OH, 100 μM) was generated using Fenton chemistry of H.sub.2O.sub.2. NaOCl (5 uM) used directly as received (Sigma). Aqueous solutions of NO.sub.2.sup.− and NO.sub.3.sup.− (100 μM) were prepared from their respective sodium salts. NOckout (100 nM, pH 6, 50 mM phosphate buffer) was allowed to react with individual ROS and RNS at 37° C. for 15 minutes and fluorescent spectra was recorded by exciting DAR (G) and A647N (R) fluorophores. The sensitivity of NOckout against different reactive species were expressed as G/R value, where a high G/R indicate high reactivity.
[0144] In cellulo specificity of NOckout to NO: In cellulo specificity of the NOckout probe towards NO* was validated in J774A.1 cells. J774A.1. cells were chosen due to the known expression of NOS2, NADPH-oxidase and MPO in those cells and they are also known to produce NO*, O.sub.2*.sup.− and HOCl respectively (Utaisincharoen, P., Anuntagool, Chaisuriya, P., Pichyangkul, S. & Sirisinha, S. CpG ODN activates NO and NOS2 production in mouse macrophage cell line (RAW 264.7). Clin. Exp. Immunol. 128, 467-473 (2002); Pacelli, R. et al. Nitric oxide potentiates hydrogen peroxide-induced killing of Escherichia coli. J. Exp. Med. 182, 1469-1479 (1995)). J774A.1 cells were treated with 1 μg/mL LPS for 12 h prior to the addition of NOckout (500 nM in HBSS) either in the presence or in absence of specific inhibitors. LPS addition was employed to induce the expression of NOS2NOX and MPO. This would induce the production of NO* and ROS in the same cells, thus allowing to probe their reactivity towards NOckout by using a single and a robust assay. Pharmacological inhibitors of NOX (VAS2870, 10 μM), MPO (ABAH, 50 μM) and NOS2 (1400W, 10 μM) were added to the media 1 hour before the addition of 500 nM of NOckout to J774A.1 cells. After 90 minutes of incubation with the NOckout culture media was removed from the cells and three washes were performed using HBSS to remove extracellular NOckout before proceeding to the fluorescence imaging. Inhibitors were present during all the washing steps and in the imaging solution (HBSS). Cells were imaged in live at room temperature using confocal microscopy as described above (
[0145] In cellulo stability of NOckout: NOckout (500 nM in pH 6 phosphate buffer) was treated with DEANONOate (30 μM) until reaching a maximum G/R value as validated by performing in vitro fluorescence measurements. J774A.1 cells pretreated with LPS (1 μg/mL) for 12 h and untreated J774A.1 cells were incubated with 500 nM of NOckout in HBSS for 30 min. Excess NOckout was washed two times with HBSS solution and subsequently complete DMEM was added to the cells. Followed by this, cells were incubated at 37° C. in a tissue culture incubator for 30 min, 60 min, and 120 min. After the respective incubation period, cells were washed two times with HBSS and subsequently imaged on a wide-field epifluorescence microscope to record fluorescence intensity in DAR (G) and A647N (R) channels. The integrity of the NOckout inside cells can be compromised in endosomes or phagosomes due to the presence of DNAases in those compartments. Potentially, DNAase can degrade dsDNA backbone of NOckout and A647N fluorophore of the NOckout could escape due to this degradation from the endosomal compartments to the cytoplasm. On the contrary, DAR attached to the DNA through a 10 kDa PEG spacer will retain in the endosomes even after DNA degradation due to its polymeric nature. Thus, a dramatic increase in G/R signal would indicate an active DNA degradation process due to the loss of A647N (R) signal. The experiments with NOckout in cells are completed within 2 hours and no degradation of the probes were observed with in this time period (
[0146] Endosomal pH perturbation using Bafilomycin Bafilomycin A.sub.1: Bafilomycin A.sub.1 (BAF) is a macrolide antibiotic that selectively inhibits the vacuolar type H.sup.+-ATPase (V-ATPase) and prevents the acidification of endosomal organelles. It has been known from previous studies that TLR-mediated signaling is dependent on acidification of endosomal/lysosomal compartments (Kaplan, S. S., Lancaster, J. R., Basford, R. E. & Simmons, R. L. Effect of nitric oxide on staphylococcal killing and interactive effect with superoxide. Infect. Immun. 64, 69-76 (1996); Gregory, S. H., Wing, E. J., Hoffman, R. A. & Simmons, R. L. Reactive nitrogen intermediates suppress the primary immunologic response to Listeria. Immunol. 150, 2901-2909 (1993)). 200 nM of BAF were added one hour prior to and during the addition of NOckout.sup.mCpG (500 nM, for 120 min) in primary microglial cells. NOckout.sup.mCpG signals in DAR (G) and A647N (R) channels were collected using the image settings described above. The G/R values for individual endosomes were calculated using Findosome, a MATLAB software developed to locate and calculate intensities from endosomes. NOckout.sup.mCpG incubated samples showed a high population endosomes with a high G/R value compared to that of the (NOckout.sup.mCpG+BAF) treated sample (SI
[0147] Zebrafish breeding and maintenance: Zebrafish (Danio rerio) were maintained as described (Westerfield, 1995). Zebrafish were kept at 26° C.-27° C. in a 14-hr light and 10-hr dark cycle. Embryos were collected by natural spawning and raised at 28° C. in E3 buffer. To avoid pigmentation, 0.003% 1-phenyl-2-thiourea (PTU) was added at 1 dpf. All the transgenic lines used in this study Tg(mpeg:EGFP), Tg(apoe: EGFP), Tg(HuC:Kaede) have been described previously (Miller, B. H. et al. Mycobacteria inhibit nitric oxide synthase recruitment to phagosomes during macrophage infection. Infect. Immun. 72, 2872-2878 (2004); Davis, A. S. et al. Mechanism of inducible nitric oxide synthase exclusion from mycobacterial phagosomes. PLoS Pathog. 3, e186 (2007); Cambier, C. J. et al. Mycobacteria manipulate macrophage recruitment through coordinated use of membrane lipids. Nature 505, 218-222 (2014)). Tg(apoe:EGFP) fish was a kind gift from Prof. William Talbot laboratory (Stanford). For microinjection of NOckout probes, embryos were obtained from wild type AB, Tg(mpeg: EGFP), Tg(apoe: EGFP), and Tg(HuC:Kaede). Animals were housed in Dr. Melina Hale's fish facility according to the IACUC regulation of University of Chicago (Protocol number: 72468).
[0148] Protein homology modelling: The SWISS-MODEL server was used in order to perform zTLR-7 homology modelling (Giustarini, D., Rossi, R., Milzani, A. & Dalle-Donne, I. in Nitric Oxide, Part F 440, 361-380 (Elsevier, 2008): Kojima, H. et al. Detection and imaging of nitric oxide with novel fluorescent indicators: diaminofluoresceins. Anal. Chem. 70, 2446-2453 (1998)). Fully automated workflow on the UniProt provided zTLR-7 sequence gave us following modelling results.
TABLE-US-00006 TABLE 2 Model Query # Template Description coverage QMEAN* 1 5gmf.1.A Macaca TLR-7 0.77 −2.23 2 3j0a.1.A Human TLR-5 0.75 −8.82 3 2a0z.1.A Human TLR-3 0.62 −6.93 *QMEAN is a composite scoring function, which is able o derive both global (i.e. for the entire structure), and local (i.e. per residue) error estimates baser on one single model. Scores of −4.0 or below are an indication of models with low quality.
[0149] Model #1 shows the QMEAN value of −2.23, which depicts good global and local homology between, sequences as evident from
[0150] Microinjection of NOckout and NOckout.sup.Fn in the brain of larval zebrafish: About 20-30 nL NOckout or NOckout.sup.Fn (20 μM stock solution in HBSS) were injected to the optic tectum area of MS-222 treated 3 dpf zebrafish using a microinjector. Post injection of the probes, fish were allowed to recover from anesthesia by placing them in fresh E3 medium. Subsequently fish were re-anesthetized and embedded in agar for confocal imaging. Coninjection experiments of TMF-labeled NOckout.sup.UN and Cy5-annexin V were performed by employing a similar protocol to that used for the NOckout injections. Briefly, dsDNA.sup.TMR (20 μM in HBSS) and annexin V-Cy5 (10 μM) were mixed in a microfuge tube by vortexing. About 20 nL of the mixed solution was injected in the optic tectum of 3-dpf-old fish. Injected fish were allowed to recover from anesthesia by placing them in a fresh E3 medium, and the fish were further incubated for 1 h in E3 medium before imaging their brains using a confocal mixroscope (LSM-710) in the TMR and Cy5 hannels. MorpholNOS2 (Gene Tools) were dissolved in HBSS and injected at one cell stage.
[0151] Co-injection experiments: Co-injection experiments of dsDNA.sup.TMR and Cy-5 annexin V was performed by employing a similar protocol that is used for the NOckout injections. Briefly, dsDNA.sup.TMR (20 μM in HBSS) and AnnexinV-Cy5 (10 μM) was mixed in a microfuge tube by vortexing. About 20 nL of the mixed solution was injected in the optic tectum of 3 dpf old fish. Injected fish was allowed to recover from anesthesia by placing them in a fresh E3 medium and the fish was further incubated for 1 hour in E3 medium before imaging its brain using a confocal microscope (LSM-710) in the TMR and Cy5-channels.
[0152] Morpholino injections and RT-PCR: MorpholNOS2 were purchased from Gene Tools, Philomath, USA were dissolved in E3 medium and injected at one cell stage as described earlier. 1 pmol of NOS2a morpholino was used as per the previous literature (McQuade, L. E. & Lippard, S. J. Fluorescent probes to investigate nitric oxide and other reactive nitrogen species in biology (truncated form: fluorescent probes of reactive nitrogen species). Curr. Opin. Chem. Biol. 14, 43-49 (2010)). Morpholino sequences and primer used for RT-PCR are listed in SI Table 4 and 5 respectively. Total RNAs were extracted from embryos and larvae using TRIzol. reagent (Invitrogen) as per the manufacturer's instructions. cDNAs were then generated using Superscript III reverse. cDNAs were used to generate gene-specific amplicon using primers listed in SI table 5. Reverse transcription was performed at 50° C. for 1 h. PCR conditions were 2 min of initial denaturation at 94° C., 45 cycles of denaturation at 94° C. for 20 s. annealing at 52-58° C. for 45 s and extension at 72 for 1 min, followed by a final extension step at 72° C. for 10 min (.sup.Y u, H., Xiao, Y. &. Jin, L. A lysosome-targetable and two-photon fluorescent probe for monitoring endogenous and exogenous nitric oxide in living cells. J. Am. Chem. Soc. 134, 17486-17489 (2012)).
TABLE-US-00007 TABLE 3 Morpholino sequences employed Morpho- lino Name Sequence (5′-3′) TLR3 TCATTAGATCCATATTTTCCTTCCT (SEQ ID NO: 26) TLR7 TCATGGTCTTCTCAGTCATCTGAAA (SEQ ID NO: 27) TLR9 TCAAGGACACCATTGGTCCAAACAT (SEQ ID NO: 28) TLR18 AGTACCAGCGGAACAAGCATTTTCA (SEQ ID NO: 29) TLR22 GCTTTCTCTTGATTTCCTTTTCATT (SEQ ID NO: 30) NOS2a ACAGTTTAAAAGTACCTTAGCCGCT.sup.19(SEQ ID NO: 31)
TABLE-US-00008 TABLE 4 RT-PCR primer sequences used Forward Primer Reverse Primer Gene (5′-3′) (5′-3′) zTLR3 GGTACACTTCCAGG TTCTAGTTGACCTT GATGGAGA GTTTGTAGAG (SEQ ID NO: 32 (SEQ ID NO: 33 zTLR7 CTCTGTATTTTCCA CCTGATCACAGAGT AACCACTCTG CTCCTGAAAG (SEQ ID NO: 34 (SEQ ID NO: 35 zTLR9 GGGGAAGATGGCGC CCA GAA GAG CG T TTCAG GCTG CACTC (SEQ ID NO: 36 (SEQ ID NO: 37 zTLR18 TTTAGGTCAAGGGG CTACTATGTCGGCT TGGATTAC GATTGTTCTC (SEQ ID NO: 38 (SEQ ID NO: 39 zTLR21 GGAGAACAG TGGC GTTCTT TTG CAC GTCGCTTAC TGTTTGGATCAG (SEQ ID NO: 40 (SEQ ID NO: 41 ZTLR22 GTTTGCAGCAGTAT GTTCTCTGATTTAT TTTG GTCATC GGCTGTCTTTG (SEQ ID NO: 42 (SEQ ID NO: 43 zActin CGAGCAGGAGATGG CAACGGAAACGCTC GAACC ATTGC (SEQ ID NO: 44 (SEQ ID NO: 45
Example 1
Preparation of DAR-N.SUB.3
[0153] DAR-4 was synthesized by methods used in Kojima, et al. (Kojima H. at al. Bioimaging of nitric oxide with fluorescent indicators based on the rhodamine chromophore. Anal. Chew. 73, 1967-1973 (2001)) and 3-azido-1-iodopropane was synthesized by methods used in Yao, et al. (Yao, L., Smith, B. T. & Aubé, J. Base-promoted reactions of bridged ketones and 1,3- and 1,4-haloalkyl azides: competitive alkylation vs azidation reactions of ketone enolates. J. Org. Chem. 69, 1720-1722 (2004)).
##STR00001##
[0154] Synthesis of 1-azido-3-iodopropane: 1-azido-3-iodopropane (5) was synthesized from 1-bromo-3-chloropropane (3) as described in Yao et al. (J. Org. Chem. 2004, 69, 5, 1720-1722). And DAR-4M (6) was synthesized according to Kojima et al. (Anal. Chem. 2001, 73, 1967-1973).
[0155] (a) Synthesis of DAR-N.sub.3: 3-azide-1-iodopropane (50 mg, 0.23 mmol) was added in two equal portions at 2 h and 4 h to a refluxing solution of DAR-4M (28 mg, 0.067 mmol) in dry ethanol (4 mL). Reaction was monitored by TLC and LC-MS every hour. After 7 h, the reaction mixture was cooled to room temperature and solvent was evaporated under vacuum. The product was purified by silica gel chromatography with methanol/dichloromethane (1:9 v/v) to yield DAR-N.sub.3(2.7 mg, 8.0%).
[0156] DAR-N.sub.3: 1H NMR(CDCl.sub.3, 500 MHz, ppm) δ=1.98 (m, 2H), 2.97 (s, 12H), 3.27 (t, 2H, J=6.5 Hz), 3.52 (t, 2H, J=6.5 Hz), 6.41 (dd, 2H, J=2.5 Hz, 8.5 Hz), 6.43 (d, 1H, J=3.0 Hz), 6.47 (d, 2H, J=2.5 .sub.Hz), 6.76 (d, 2H, J=4.0 Hz), 6.85 (d, 1H, J=8.0 Hz);
[0157] 13C NMR (CDCl.sub.3, 125 MHz, ppm) δ=33.0, 40.5, 42.2, 49.7, 98.6, 108.5, 108.8, 111.9, 113.3, 118.1, 129.2, 135.7, 135.9, 152.2, 153.2, 171.4
[0158] HRMS: predicted 499.2332, observed 499.2631
Example 2
NOckout Sensors Assembly
[0159] (a) Appending of DBCO group: Mono-protected amine functionalized 10 kDa polyethyleneglycol (3 mg, Creative PEG works) was dissolved in 150 μL of dry DMSO. To achieve basic pH. 2 μL of triethylamine was added. DBCO-NHS ester was added to a final concentration of 20 mM. Reaction was stirred for 3 h at room temperature. The reaction mixture was diluted by a factor of 100 with milli-Q water to make DMSO content less than 1%. Extra DBCO-NHS ester was excluded by centrifugation on Amicon 3 kDa filters. The reaction mixture was continually diluted with milli-Q water and tested for DBCO-NHS ester by taking UV spectra of each Amicon flow through. This purification step was performed until there was no detectable absorbance at 309 nm in the flow through. Purified product was lyophilized and can be stored at −80° C. up to 3 months.
[0160] (b) Deprotection of Boc: 5 mg oft was dissolved in 200 μL trifluoroacetic acid/dichloromethane (5:95 v/v). The reaction mixture was stirred overnight at room temperature. The solvent was evaporated using a gentle nitrogen flow until most of the liquid evaporated. 100 μL milli Q water was added, and the solution was neutralized with triethylamine. The product concentration was determined by UV (λ.sub.ex=309 nm). Product was lyophilized and can be stored at −80° C. up to 3 months.
[0161] (c) DNA-PEG conjugation: A 24-mer ssDNA with a 5′-azido group (Strand S1, See Table 1 for sequence) was dissolved in 50 mM potassium phosphate buffer, pH 7.4, to a final concentration of 50 μM. Compound 2 was added to a final concentration of 75 μM. The reaction was stirred overnight. Reaction completion was checked by 15% native PAGE gel shift assay. Compound 3 will migrate much slower than 24-mer DNA. Amicon purification was applied as described using 10 kDa MW Amicon tubes and pH 7.4, 100 mM phosphate buffer as exchange buffer. DBCO group was added to terminal primary amine as described above with solvent changed to phosphate buffer.
[0162] (d) PEG-DAR conjugation: DARN.sub.3 was dissolved in DMSO to make 3 mM stock. Exact concentration was determined by UV (λ.sub.ex=571 nm, ε=7.8×10.sup.4 M cm.sup.−1). DAR-N.sub.3 was added to a final concentration of 1.5 equivalence of 4. Reaction was stirred overnight at room temperature and purified with 3 kDa MW Amicon tube and pH 7.4, 100 mM phosphate buffer as exchange buffer. Filtrate from Amicon was tested by UV until no absorbance from DAR-N.sub.3 was observed.
[0163] (e) Annealing: Above mentioned DAR-S1 and S2.sup.PM/S2.sup.TGN (Table 1) were mixed in equimolar ratios to a final concentration of 10 μM in 20 mM potassium phosphate buffer, pH 7.4 containing 100 mM KCl. Annealing was performed by heating to 90° C. for 5 min, cooling to room temperature over 3 hr at 5° C./15 min and equilibrating at 4° C. overnight.
[0164] Formation of Nockout was confirmed by a gel mobility shift assay using 15% native PAGE (ran in 1×TBE buffer, constant 100V at room temperature for 120 min). The gel was imaged using BIO-RAD ChemiDoc MP imaging system (
Example 3
Imaging NOS3 Activity with Sub-Cellular Spatial Resolution
[0165] The working principle and characterization of the two NOckout variants NOckout.sup.PM and NOckout.sup.TGN can be described as follows. Both variants comprise a 24-base pair DNA duplex comprising two strands S1 and S2 bearing three functionalities (
[0166] The response characteristics of both NOckout probes was studied by monitoring the fluorescence emission spectra as a function of time in the presence of the NO donor DEA-NONOate (50 μM, pH 6.0). DAR fluorescence (G) of NOckout.sup.PM increased rapidly, with >80% response in <1 min, while the fluorescence of Alexa488 (B) remained constant (
[0167] Next, the sensitivity of NOckout probes to various reactive oxygen species (ROS) was studied to determine their specificity to NO because, under metabolic stress, NOS3 can get uncoupled to produce ROS (Yang, Y.-M., Huang, A., Kaley, G. & Sun, D. eNOS uncoupling and endothelial dysfunction in aged vessels. Am. J. Physiol. Heart Circ. Physiol. 297, H1829-36 (2009)). NADPH oxidase is the major source of ROS in breast cancer cells. The sensor response to other metabolites of NO such as NO.sub.2.sup.− and NO.sub.3.sup.− was also studied (Lundberg, J. O., Weitzberg, E. & Gladwin, M. T. The nitrate-nitrite-nitric oxide pathway in physiology and therapeutics. Nat. Rev. Drug Discov. 7, 156-167 (2008)). The G/B ratios of NOckout.sup.PM revealed high selectivity towards NO and negligible reactivity to other reactive species consistent with the parent NO sensing molecule DAR (
[0168] Despite ample evidence for NOS3 localization at the plasma membrane as well as the TGN, its relative activity at either location is still unknown (Sowa, G. et al. Trafficking of endothelial nitric-oxide synthase in living cells. Quantitative evidence supporting the role of palmitoylation as a kinetic trapping mechanism limiting membrane diffusion. J Biol. Chem. 274, 22524-22531 (1999); Sessa, W. C. et al. The Golgi association of endothelial nitric oxide synthase is necessary for the efficient synthesis of nitric oxide. J. Biol. Chem. 270, 17641-17644 (1995); Fulton, D., Gratton, J. P. & Sessa, W. C. Post-translational control of endothelial nitric oxide synthase: why isn't calcium/calmodulin enough? J. Pharmacol. Exp. Ther. 299. 818-824 (2001); Fulton, D. et al. Localization of endothelial nitric: oxide synthase phosphorylated serine 1179 and nitric oxide in Golgi and plasma membrane defines the existence of two pools of active enzyme. J Biol. Chem. 277, 4277-4284 (2002)). In this disclosure, mapping NOS3 activity at both locations by targeting spectrally distinct NOckout probes to either location was sought. NOckout.sup.PM robustly labeled the plasma membrane of T-47D, MCF-7 and diverse cancer cell lines as revealed by co-localization with the plasma membrane marker CellMask™ (
[0169] Next, endogenous, basal NOS3 activity was estimated at each of these sub-cellular locations in T-47D cells without explicitly activating NOS3. To do this, the ratiometric NOckout.sup.PM response, i.e. the G/B ratio, was first measured under conditions where cells were depleted of NO using the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl 3-oxide (PTIO, 300 μM) (Goldstein, S., Russo, A. & Samuni, A. Reactions of PTIO and carboxy-PTIO with *NO, *NO2, and O2−*. J Biol. Chem. 278, 50949-50955 (2003)). Then, the G/B ratio was measured upon saturating the cell with DEA-NONOate (500 μM) which is expected to completely turn on the NOckout probe. These two extreme cases provide the minimum and maximum G/B signals afforded by NOckout.sup.PM in the cell (
[0170] Next, NOS3 was pharmacologically activated by two different pathways, both of which are associated with cancer etiology and probed the steady state activity of NOS3 at the plasma membrane and at the TGN. ATP addition activates Akt kinase through P2Y2 receptors which phosphorylates NOS3 thereby increasing its activity (Zhang. Q. et al. Functional relevance of Golgi- and plasma membrane-localized endothelial NO synthase in reconstituted endothelial cells. Arterioscler. Thromb. Vasc. Biol. 26, 1015-1021 (2006); Fulton, D. et al. Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature 399, 597-601 (1999)). In contrast, 17 β-Estradiol (E.sub.2) increases cytosolic Ca.sup.2+ and activates NOS3 by recruiting calmodulin (
Example 4
Quantitative, Sub-Cellular Imaging of Enzymatic Rate
[0171] Given that the NOckout probes could report NOS3 activity at steady state, mapping NOS3 activity in real-time was sought. Cytosolic Ca.sup.2+ elevation is considered to activate both pools of NOS3 in the cell (Fulton, D. et al. Targeting of endothelial nitric-oxide synthase to the cytoplasmic face of the Golgi complex or plasma membrane regulates Akt- versus calcium-dependent mechanisms for nitric oxide release. J. Biol. Chem. 279, 30349-30357 (2004)). Although NOS3 has been suggested to be more active at the plasma membrane, this is based on available NO.sub.2.sup.− and NO.sub.3.sup.−, that are by-products of the resultant NO produced, in the extracellular milieu (Zhang, Q. et al. Functional relevance of Golgi- and plasma membrane-localized endothelial NO synthase in reconstituted endothelial cells. Arterioscler Thromb. Vasc. Biol. 26, 1015-1021 (2006); Fulton, D. et al. Targeting of endothelial nitric-oxide synthase to the cytoplasmic face of the Golgi complex or plasma membrane regulates Akt- versus calcium-dependent mechanisms for nitric oxide release. J. Biol. Chem. 279, 30349-30357 (2004)). In order to be available for measurement in the extracellular milieu, any NO produced at the TGN has to cross a ˜5 mM. barrier of cytoplasmic thiols without dismutation. Therefore, the relative activity of both pools of NOS3 is still unclear and can be resolved only by measuring NOS3 activity directly on site.
[0172] Therefore, the plasma membrane and the TGN of T-47D cells were simultaneously labeled with NOckout.sup.PM and NOckout.sup.TGN as described elsewhere (
[0173] Next, in order to measure the relative activities of NOS3 at the plasma membrane and the TGN, a method was developed to quantify sub-cellular NO generated due to NOS3 activity. The concentration of a reactive species such as NO changes with time, ramping up due to enzymatic activity, reaching a maximum value, [NO].sub.max (Namin S. M., Nofallah, S., Joshi, M. S., Kavallieratos, K. &. Tsoukias, N. M. Kinetic analysis of DAF-FM activation by NO: toward calibration of a NO-sensitive fluorescent dye. Nitric Oxide 28, 39-46 (2013)). When enzyme activity stops, NO levels fall due to diffusion, chemical dismutation, or reaction with other biomolecules (
[0174] An in-cell calibration protocol was developed to measure the rate of NO production for various concentrations of DEA-NONOate using NOckout probes. A fixed concentration of DEA-NONOate was added to NOckout.sup.PM labeled cells and acquired G/B maps as a function of time. The average GB value from ˜20 cells yielded sigmoidal curves as a function of time (
[0175] NOckout.sup.TGN is localized in the lumen of the TGN, which has a pH of 6.5 (Modi, S., Halder, S., Nizak, C. & Krishnan, Y. Recombinant antibody mediated delivery of organelle-specific DNA pH sensors along endocytic pathways. Nanoscale 6, 1144-1152 (2014)). However, DAR detection of NO is pH-independent and as expected, the response characteristics of NOckout probes at pH 6 and 7.4 are identical (
[0176] A mechanistic insight into why the population at the plasma membrane showed greater activity was then sought. Akt mediated phosphorylation of Serine 1177 (S1177) on NOS3 is known to enhance its activity, presumably by recruiting Hsp90 and/or stabilizing the NOS3-calmodulin complex (Fulton, D. et al. Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature 399, 597-601 (1999); Garcia-Cardeña G. et al. Dynamic activation of endothelial nitric oxide synthase by Hsp90. Nature 392, 821-824 (1998)). However, direct evidence of location-specific S1177 phosphorylation in cells has not yet been observed. To investigate whether such a mechanism might account for the activity difference between NOS3 at either location, NOS3 was probed with two different antibodies. One of these selectively binds S1177 phosphorylated NOS3 (P-NOS3) and the other binds NOS3 irrespective of its post-translational modifications (
Example 5
Confirmation of the Golgi as a Hotspot for S-Nitrosylation
[0177] In order to address the significance of the hypoactive population of NOS3 at the TGN, T-47D cells were immunostained using an antibody specific to S-nitrosocysteine. Co-immunostaining with GM130 revealed a significant abundance of S-nitrosylated proteins at the Golgi in T-47D as well as MCF-7 cells (
[0178] Importantly, prolonged inhibition of NOS3 with L-NAME dramatically reduced 5-nitrosylation at the Golgi. Further, the Golgi underwent fragmentation as revealed by anti-GM130 immunostaining (
[0179] Small molecule inhibitors were then screened to identify the molecular pathway by which NOS3 inhibition induces Golgi fragmentation. This is based on the rationale that inhibiting a protein on this pathway should also block methylene blue-induced Golgi fragmentation. To rule out any contribution from ROS producing enzymes or from NOS2, the specific ROS scavenger TEMPOL and NOS2 inhibitor 1400W were used, and none of these treatments fragmented the Golgi (Lee, J. E. et al. Dependence of Golgi apparatus integrity on nitric oxide in vascular cells: implications in pulmonary arterial hypertension. Am. J. Physiol. Heart Circ. Physiol. 300, H1141-58 (2011)). Treatment with sildenafil citrate, a cGMP phosphodiester inhibitor, also did not fragment the Golgi ruling out the participation of cGMP synthase activation due to NO (
Example 6
Comparison of NOckout Probes with Conventional NO probes
[0180] Currently the most widely used approach to detect NOS activity relies on NO-sensitive small molecule probes (Kojima, H. et al. Detection and imaging of nitric oxide with novel fluorescent indicators: diaminofluoresceins. Anal. Chem. 70, 2446-2453 (1998): Ye, X., Rubakhin, S. S. & Sweedler, J. V. Detection of nitric oxide in single cells. Analyst 133, 423-433 (200S); Lim, M. H., Xu, D. & Lippard, S. J. Visualization of nitric oxide in living cells by a copper-based fluorescent probe. Nat. Chem. Biol. 2, 375-380 (2006)). However the reacted probe molecules diffuse rapidly, blurring out spatial information (
TABLE-US-00009 TABLE 6 Benchmarking NOckout against commercially available NO probes. DAF-2DA (Commercial NO detection kits) G-geNOp (protein Parameters (FIG. 26) sensor for NO) NOckout Ratiometric No (FIG. 26a) No (FIG. 27a) Yes (FIGS. 1b-d and FIGS. 10a-c) Mode of sensing Fluorescence turn on Fluorescence turn off Fluoresence turn on (FIGS. 26a and (FIGS. 27a and (FIGS. 10b-c and c) c) FIGS. 11a-b) Sensitive towards Yes (FIGS. 26b and Yes (FIGS. 27d-e) No (FIG. 10d and pH d) FIG. 17e) Fe.sup.2+ supplementation Not required (FIGS. Required (FIGS. Not required (FIGS. 26a and c) 27a-c) 10b-c and FIGS. 11a-b) Maximum in-cellulo 7500% (FIG. 26c) −15% (FIG. 27c) 200% (FIG. 1f) fold change Organelle No (FIG. 26a) Yes Yes (FIGS. 11c-d. targetability FIG. 12 and FIG. 13) Reversible No Quasi-reversible No (FIGS. 10b-c and FIGS. 11a-b)
[0181] Recently described protein-based reporters offer the necessary spatial resolution and are quasi-reversible but are pH and ROS sensitive, require millimolar Fe.sup.2+ supplementation, show limited sensitivity compared to small molecules and are not quantitative (
[0182] By simultaneously mapping NOS3 activity at two different locations in the same cell using NOckout probes, it was found that cytosolic Ca.sup.2+ elevation selectively activated the population of NOS3 at the plasma membrane. This is consistent with studies in endothelial cells expressing synthetic NOS3 variants targeted either to the plasma membrane or the TGN (Sessa, W. C. et al. The Golgi association of endothelial nitric oxide synthase is necessary for the efficient synthesis of nitric oxide. J. Biol. Chem. 270, 17641-17644 (1995); Zhang, Q. et al. Functional relevance of Golgi- and plasma membrane-localized endothelial NO synthase in reconstituted endothelial cells. Arterioscler. Thromb. Vasc. Biol. 26, 1015-1021 (2006)). Using NOckout to directly compare the activities of both pools without modulating NOS3 abundance at either location, it was found that NOS3 was 10-fold more active at the plasma membrane than at the TGN, suggesting that these two populations might be chemically different. Indeed, it was possible to pinpoint that the plasma membrane population had a specific post-translational modification phosphorylated S1177unlike the population at the Golgi.
[0183] Specifically in cancer, plasma membrane-associated NOS3 has been posited to mediate processes such as angiogenesis, metastasis and epithelial mesenchymal transition through players such as E-cadherin, EGFR and matrix metalloproteinases (Vahora, H., Khan, M. A., Alalami, U. & Hussain, A. The potential role of nitric oxide in halting cancer progression through chemoprevention. J. Cancer Prev. 21, 1-12 (2016)). Interestingly, Ca.sup.2+ elevation in epithelial cancer cells occurs near the plasma membrane, which could potentially selectively activate plasma membrane-associated NOS3 (Ellefsen, K. L. & Parker, I. Dynamic Ca2+ imaging with a simplified lattice light-sheet microscope: A sideways view of subcellular Ca2+ puffs. Cell Calcium 71, 34-44 (2018)). NOckout probes provide direct evidence that treatment with E.sub.2, a ligand that binds the estrogen receptor in ER.sup.+ breast cancers, selectively activates plasma. membrane-associated NOS3.
[0184] Interestingly, despite the low activity of NOS3 at the TGN, abundant S-nitrosylation at the Golgi in breast cancer cells was observed. This indicates a role for the hypoactive population of NOS3 at the TGN in terms of a slow, yet sustained release of NO. S-nitrosylation at the Golgi in these cells is essential for the maintenance of Golgi architecture through Src kinase mediated mechanism, the disruption of which leads to cell senescence. S-nitrosylation of Golgi associated proteins such as HRas, NRas and GOLPH3 regulate cell cycle progression in cancer (Lim, K.-H., Ancrile, B. B., Kashatus, D. F. & Counter, C. M. Tumour maintenance is mediated by eNOS. Nature 452, 646-649 (2008); Farber-Katz, S. E. et al. DNA damage triggers Golgi dispersal via DNA-PK and GOLPH3. Cell 156, 413-427 (2014)). In fact, impeding cell cycle progression by disrupting Golgi morphology also promotes cell survival (Farber-Katz, S. E. et al. DNA damage triggers Golgi dispersal via DNA-PK and GOLPH3. Cell 156, 413-427 (2014)). Impeding S-nitrosylation could promote such a. scenario, suggesting a possible mechanism invoked by the cell to bypass apoptosis until environmental conditions favor cell growth.
[0185] Despite the clear significance of both sub-cellular pools of NOS3, it has proved challenging thus far to deconvolute the contribution of either pool to the modulation of cardiac function, wound healing or cancer progression (Xu, W., Liu, L. Z., Loizidou, M., Ahmed, M. & Charles, I. G. The role of nitric oxide in cancer. Cell Res. 12,311-320 (2002); Zhang, Q. et al. Functional relevance of Golgi- and plasma membrane-localized endothelial NO synthase in reconstituted endothelial cells. Arterioscler. Thromb. Vasc. Biol. 26,1015-1021 (2006); Lee, P. C. et al. Impaired wound healing and angiogenesis in eNOS-deficient mice. Am. J. Physiol. 277, H1600-8 (1999)). NOckout probes can be applied to potentially identify molecular players that selectively modulate the activity of distinct sub-cellular NOS3 pools for basic a.s well as clinical applications. This modular technology can be expanded to quantitatively map NOS activities in endothelial cells, neuronal cells or immune cells by using appropriate targeting modules and tuning the sensing fluorophore (Jani., M. S., Veetil, A. T. & Krishnan, Y. Precision immunomodulation with synthetic nucleic acid technologies. Nat. Rev. Mater. (2019). doi:10.1038/s41578-019-0105-4).
Example 7
Design, Synthesis and Determination of Sensitivity and Specificity of NOckout Probes
[0186] A series of ratiometric, fluorescent NO sensitive DNA nanodevices denoted NOckout.sup.fn were first designed where fn denotes a functional DNA or RNA sequence that can potentially be a PAMP (
[0187] The second functionality is a normalizing dye ATTO647N (A647) attached to the 5′-end of the S2 strand (
[0188] The third functionality in every NOckout variant is a dsDNA module responsible for targeting the nanodevice into phagosomes of microglia in live zebrafish brains. This is essentially the 24 base pair DNA duplex formed by the hybridization of S1 and S2. This DNA duplex also facilitates endocytosis of all NOckout variants by macrophages in culture through the scavenger receptor mediated endocytosis pathway.
[0189] The fourth functionality in all NOckout variants is a functional, immunogenic oligodeoxynucleotide (ODN) or oligoribonucleotide (ORN) phosphorothioate sequence denoted fn, and the resultant devices are denoted NOckout.sup.fn. The ODN or ORN sequence in NOckout.sup.fn devices are located at the 3′ end of S2 as single stranded overhangs in the basic NOckout device (
[0190] As shown in
[0191] Step 1. Synthesis of bifunctional PEG conjugate DBCO-PEG-NH-BOC: 10 kDa polyethylene glycol linker (3 mg, 0.0003 mmol) was dissolved in 150 μL freshly dry DMSO. 2 μL of extra dry trimethylamine (TEA) was added to the above solution to maintain a pH ˜8.0 and the mixed by constant stirring. To that mixture, DBCO-NHS (20 mM, cat no #761524, Sigma) ester dissolved in dry DMSO (50 μL) was added. The reaction mixture was stirred at room temperature for ˜3 hours and subsequently the mixture was diluted by adding of excess of (100×) water to bring down the DMSO content in the mixture less than 1% (w/v). The clear reaction mixture was then loaded to an Amicon ultra centrifugation filter (MWCO ˜3 kDa, Merck Millipore) to remove excess of DBCO-NHS ester by spinning at 12000 rpm for 10 min at 4° C. The centrifugation step was repeated using milli-Q water until no trace of DBCO-NHS was detected in the filtrate using UV-Vis spectroscopy (λ.sub.ab=309 nm, ε=12000 M.sup.−1cm.sup.−1). The product was subsequently lyophilized to obtain a white fluffy powder and it was stored at −80° C. for up to 6 months.
[0192] Step 2. Deprotection of DBCO-PEG-NH-BOC: Removal of tert-butyloxycarbonyl (t-Boc) group in DBCO-PEG-NH-BOC (2 mg) was achieved by dissolving it an Eppendorf tube (1.5 ml) containing 200 μL mixture of trifluoroacetic acid/dichloromethane (5:95 v/v). The mixture was stirred overnight at room temperature. Subsequently, the solvent mixture was evaporated by using a gentle nitrogen flow. 100 μL milli-Q water was added to the residue and followed by this trimethylamine (TEA) was added till the pH of the solution reached 7.0. The solution was further centrifuged with milli-Q water using a MWCO ˜3 kDa filter to remove excess TEA. The product was quantified by UV-Vis spectroscopy using DBCO absorption (λ.sub.ab=309 nm, ε=12000 M.sup.−1cm.sup.−1) and subsequently lyophilized to store at −80° C. for up to 6 months
[0193] Step 3. DNA-PEG conjugation: A 24-mer ssDNA containing 5′-azido group (Table 1) was dissolved in 50 mM potassium phosphate buffer pH 7.4 to a final concentration of 50 μM. DBCO-PEG-NH.sub.2 (60 μM) was added to the ssDNA solution and the reaction mixture was stirred overnight. Completion of the click reaction was monitored by musing a 15% native PAGE gel shift assay (
[0194] Step 3. Synthesis of ssDNA-PEG-DBCO: Capping of the terminal —NH.sub.2 group in ssDNA-PEG-NH.sub.2 (45 μM, dissolved in phosphate buffer, pH 7.4) with a DBCO group was achieved by reacting it with DBCO-NHS (20 mM, Cat No #761524, Sigma) dissolved in DMSO. The mixture was let to stir for 3 hours at room temperature and excess of DBCO-NHS was subsequently removed by using a 3 kDa Amicon filter a.s described above. Pure product obtained after centrifugation was quantified by using UV-Vis spectroscopy using DBCO absorbance (λ.sub.ab=309 nm, ε=12000 M.sup.−1cm.sup.−1) and was stored at −80° C. See
[0195] Step 4. Synthesis of ssDNA-PEG-DAR: An aliquot of 3.33 μL (3 mM) of DAR-N.sub.3 in DMSO was mixed with 50 μM of ssDNA-PEG-DBCO in 100 μL of phosphate buffer (pH 7.4, 50 mM). The reaction was stirred overnight at room temperature to achieve a 1:1 labeling of ssDNA with the DAR-N.sub.3. The crude reaction mixture was centrifuged multiple rounds (12000 rpm for 10 min at 4° C.) to remove unreacted DAR-N.sub.3 till no trace of it was detected in the filtrate (λ.sub.em=571 nm, ε=7.8×104 M.sup.−1cm.sup.−1). A ratio of 1:1 labeling of the DAR to the DNA was confirmed by using UV-Vis spectroscopy (
[0196] NOckout and NOckout.sup.Fn synthesis: NOckout was assembled by annealing 24-mer ssDNA-PEG-DAR (20 μM) with a 24-mer 5′-ATTO647N labeled complementary ssDNA (20 μM) in phosphate buffer (50 mM, pH 7.2). The individual ssDNA samples were mixed together and the mixture was subsequently annealed from 70° C. to room temperature by applying a temperature gradient of 5° C./15 minutes using ThermoMixer C (Eppendorf). The annealed sample was further incubated at 4° C. for 2 hours. The formation of NOckout was verified using native polyacrylamide gel electrophoresis (15%) as shown in
[0197] Gel electrophoresis: Native polyacrylamide gels containing 15% acrylamide [30:1 acrylamide/bisacrylamide] were used for the gel electrophoresis assays. Gels were run in 1× TBE buffer (90 mM Tris.HCl, 90 mM boric acid, and 2 mM EDTA, pH 8.3) at room temperature. Post run, gels were first imaged with ChemiDoc MP imaging system (Bio-rad, USA) to visualize DAR or pHrodo conjugated (605/55 filter, green epi illumination) and ATTO647N conjugated (695/55 filter, red epi illumination) DNA oligonucleotides. Ethidium bromide (1 μg/ml) was used to stain DNA duplex and it was imaged with a GelDoc-It imaging system (UVP, USA, λ.sub.ex=302 nm).
[0198] In vitro fluorescence measurements: All fluorescence studies were carried out on a Fluoromax-4 (Horiba Scientific, Japan) spectrophotometer. 10 μM stock of NOckout or NOckout.sup.Fn sensors were diluted to a 100 nM final concentration in 50 mM sodium phosphate buffer, pH 5.0, 6.0 or 7.2. The emission spectra of DAR and A647N were acquired by exciting the sample at 550 nm and 650 nm respectively. Fluorescence emission spectra were collected in the range of 560-620 nm (slit width=2 nm) for DAR and 655-700 nm (slit width=2 nm) for A647N. Diethylamine NONOate (DEA NONOate, Cayman Chemicals, United States) was used as fast NO donor. The half-life of DEA NONOate is 2 minutes and 16 minutes at 37° C. and 25° C., respectively, in 100 mM phosphate buffer (pH 7.4). DEA NONOate liberates 1.5 moles of NO per mole of parent compound. Fluorescence signal from NOckout. (100 nm) was recorded sequentially in the DAR (G) and A647N (R) channels before and after the addition of DEANONOate (30 μM) at timed intervals (30 s). Emission intensity maximum of DAR was at 571 nm before NO* addition and it shifted to 578 mu after NO* addition. In vitro fold change of all the NOckout sensors were calculated and expressed as the ratio of DAR signal to that of the A647N signal, which is represented as a G/R value.
[0199] pH Insensitivity of NOckout probes: pH insensitivity of NOckout probes are critical for error-free reporting of NO from acidic intracellular compartments. All the seven NOckout probes synthesized were validated as pH insensitive in the range of pH 5-pH 7.4 (SI
[0200] Synthesis of pHlickr: pH sensor pHlickr is a 24-mer dsDNA duplex carrying a pH sensing fluorophore pHrodo (λ.sub.ex=540 nm, λ.sub.em=580 nm) at the 5′-end of one of the ssDNA strands and ATTO647N fluorophore on the 5′-end of the complementary ssDNA (see Table 1 for the DNA sequences). pHrodo was attached to the ssDNA using a standard thiol-maleimide conjugation reaction. Briefly, 200 μL of 50 μM ssDNA (in 50 mM phosphate buffer, pH 7.4) carrying a thiol modification at the 5′-terminal was mixed with 200 μM of pHrodo maleimide (2.8 μL from a 14 mM stock in dry DMSO). The reaction mixture was stirred at room temperature for 3 hours and subsequently diluted to final volume of 1 mL using milli-Q water. This solution was then centrifuged using a 3 kDa MWCO ultracentrifugation filter to remove unreacted pHrodo-maleimide. The presence of pHrodo in the filtrate was negated by using UV-Vis spectroscopy (λ.sub.ab=560 nm, ε=65,000). The ratio of ssDNA to the conjugated pHrodo was conformed to be 1:1 before proceeding to the annealing step. Annealing of 20 μM ssDNA-pHrodo (in 50 mM of phosphate buffer, pH 7.2) with 20 μM of ssDNA-ATTO647N strand was carried in a ThermoMixer (Eppendorf) at 70° C. to room temperature by applying a temperature drop of 5° C./15 minutes. The annealed sample was further cooled at room temperature and pHlickr formation was verified using 15% polyacrylamide gel electrophoresis (SI
[0201] pH sensitivity of pHlickr was tested using 200 nM sample in acetate buffer (pH 4.5), phosphate butler (pH 6.0) and phosphate buffer (pH 7.4) as shown in in SI
Example 8
Response Characterization of NOckout Sensors
[0202] To check the response characteristics of NOckout variants to NO in vitro, the NO donor DEANONOate (20 μM) was added to 250 nM of NOckout in phosphate buffer, pH 6.0 and monitored DAR-T and A647 fluorescence intensities as a function of time. DAR fluorescence (G) increased rapidly upon NO addition and the time required for 50% reaction (t.sub.1/2) under these conditions was ˜60 s (
[0203] All NOckout variants proved highly specific to NO over other reactive species both in vitro and in cells. The response of NOckout to various reactive oxygen species (HOCl, H.sub.2O.sub.2, O.sub.2*.sup.− and OH*) was tested by measuring the in vitro fold change in G/R before and after addition of indicated reactive species. NOckout showed ˜5-fold greater specificity to NO over any other ROS in vitro (
[0204] To check the specificity of NOckout to NO, endosomes of J774A.1 macrophages primed with lipopolysaccharide (LPS) were labeled with NOckout and imaged in the DAR (G) and A647 (R) channels from where the G/R maps were obtained as described (
[0205] The in-cell specificity of NOckout can be evaluated by measuring the contribution of the reactive species produced by NOX, MPO and NOS2 to the observed fold change in G/R ratio upon LPS stimulation. It was found that if NOckout displayed no functional immunogenic sequence it showed negligible NOS2 activation. Therefore, in order to trigger NO2 activity for these experiments, the cells had to be explicitly activated by LPS treatment. J774A.1 cells primed with LPS was incubated, labelled with NOckout in the presence and absence of VAS2870. ABAH or 1400W that pharmacologically NOX, MPO and NOS2 respectively (
Example 9
NOckout.SUP.fn .Devices Trigger NOS2 Activity in Microglia
[0206] Given that NOckout did not trigger NOS2 activity, it was modified to display DNA and RNA sequences that function as pathogen associated molecular patterns (PAMPs) in order to engage the endosomal Toll-like receptors (TLRs) of the host cell and thereby activate NOS2 (
[0207] mCpG, a ligand for marine TLR-9, was displayed on NOckout to give NOckout.sup.mCpG. NOckout.sup.mCpG is internalized by macrophages from the extracellular milieu by scavenger receptor mediated endocytosis. Based on the mechanism of action of mCpG, endosomal NOckout.sup.mCpG is expected to engage TLR-9, activate NOS2 and generate NO (
[0208] Next, the immunogenicity of the various PAMPS was quantified alone and when they were displayed on NOckout.sup.fn probes by detecting TNF-α levels arising from TLR stimulation. We treated J774A.1 cells with each PAMP motif, for example mCpG, zCpG, RNA, or iRNA and their corresponding NOckout display vairent and quantified TNFα in the extracellular milieu by enzyme-linked immunisorbent assay (ELISA) (
[0209] To study whether the NOckout scaffold could be more generally programmed to display specific PAMPs that could trigger their cognate PRRs, NOckout was designed to display an immunostimulatory RNA sequence that is a ligand for the murine TLR-13 receptor (Oldenburg, M. et al. TLR13 recognizes bacterial 23S rRNA devoid of erythromycin resistance-forming modification. Science (80-) 337, 1111-1115 (2012)). TLR-13 was recently identified as the cognate receptor for a 13-base long immunogenic RNA, denoted iRNA (
[0210] As described earlier, NOckout.sup.iRNA was made which displayed iRNA that is expected to trigger NOS2 activity by engaging TLR-13 (
Example 10
Phagosomal Localization of NOckout probes in Zebrafish Microglia
[0211] Since NOckout sensors can be rationally designed to predictably trigger NOS2 activity through precise pathways in cultured cells, it was applied to study TLR signaling in vivo. Zebrafish is a powerful genetic model to dissect host-pathogen interactions, as one can image innate immune cells in live vertebrates with sub-cellular resolution. Further, the innate immune signaling component can be specifically isolated in the larval stage due to the late onset of adaptive immunity in zebrafish. Here, NOS2 activation in microglia of zebrafish was studied by microinjecting PAMP-programmed NOckout probes into the optic tectum of larvae 3-4 days post fertilization (dpf) (
[0212] First, the sub-cellular localization of extraneously introduced NOckout probes in the zebrafish brain was established. In the mammalian brain, fragmented DNA is internalized by scavenger receptors present on microglia which results in their intracellular localization in these cells. Since this information is missing in zebrafish, a 24 bp duplex DNA labeled with A647N (dsDNA.sup.A647) was injected in the optic tectum of Tg(apoe:eGFP) larvae 3 dpf where microglia are marked with GFP (
[0213] Since phagosomes of all macrophages are known to have an acidic milieu, the lumenal acidity of these compartments were checked using a GFP-compatible. DNA-based pH sensor denoted as pHlickr (
Example 11
Single Stranded RNA can Act as a PAMP in Zebrafish
[0214] Whether NOckout probes could map phagosomal NO generated by activating NOS2 through the engagement of TLR receptors in live brains was then tested. To achieve this, the well-characterized CpG ODN, zCpG, was displayed on NOckout to give NOckout.sup.zCpG (
[0215] The G/R ratios of ˜20 such phagosomes were significantly higher than those obtained with plain NOckout, indicating high levels of phagosomal NO and consistent with effective NOS2 activation (
[0216] Using NOckout technology, it was discovered that pathogenic RNA of bacterial origin can act as PAMPs in zebrafish, and its cognate Toll-like receptor was identified. Bacterial pathogens such as M. marinum and M. leprae in macrophages of zebrafish are effectively neutralized in the phagosome by NOS2 activation due to TLR engagement. Ten out of the twenty putative TLR receptors in zebrafish have human orthologs, and the cognate ligands for only a few have been pinpointed (Table 7).
TABLE-US-00010 TABLE 7 Zebrafish Zebrafish Mammalian Mammalian TLRs PAMPs TLRs PAMPs TLR1 TLR1 lipopeptides and peptidoglycan TLR2 lipopeptides; TLR2 lipoproteins, Pam3CSk4 lipoteichoic acid TLR3 dsRNA; Poly I:C TLR3 dsRNA TLR4a/b TLR4 LPS or Mannan TLR5a/b flagellin TLR5 flagellin TLR7 TLR6 lipopeptide TLR8a/b TLR7 ssRNA TLR9 CpG-ODNs TLR8 ssRNA TLR14 TLR9 CpG-ODNs TLR18 TLR10 TLR19 TLR13 rRNA TLR20a TLR21 CpG-ODNs TLR22 dsRNA; Poly I:C
[0217] For example, TLR-3 and TLR-22 of zebrafish sense dsRNA and poly (LC) while TLR-9 and TLR-21 sense CpG-ODNs. However, it is not yet frown whether ssRNA can trigger an immunogenic response, or even function as a PAMP, in zebrafish. In contrast, the highly conserved iRNA sequence, derived from the ribosomal RNA of pathogens such as S. aureas and E. coli engages murine TLR-13, eliciting NO production and is now recognized as a PAMP in mice. Interestingly, this RNA sequence is also conserved in many natural aquatic pathogens that infect zebrafish such as Edwardsiella tarda, Aeromonas hydraphila and Francisella philomiragia (
TABLE-US-00011 TABLE 8 Species 23s rRNA sequence Comments S. 2095 ACGGAAAGACCCC 2107 Used to study innate immunity in Typhimurium (SEQ ID NO: 46) zebrafish M. Marinum 2260 AAAGACCCC 2268 Widely used as a model for studying (SEQ ID NO: 47) innate immunity in zebrafish M. 2255 AAAGACCCC 2263 Tuberculosis model in zebrafish Tuberculosis (SEQ ID NO: 48) M. Leprae 2277 AAAGACCCC 2285 Used to study innate immunity in (SEQ ID NO: 49) zebrafish Aeromonas 2045 ACGGAAAGACCCC 2057 Aquatic bacterium that cause high hydrophila (SEQ ID NO: 50) mortality in zebrafish, NO/ROS production observed during infection Edwardsiella 2048 ACGGAAAGACCCC 2060 Natural pathogen of zebrafish. Induces tarda (SEQ ID NO: 51) robust NO production within 2 h in Japanese flounder. E. coli 2054 ACGGAAAGACCCC 2066 (SEQ ID NO: 52) Francisella 2047 ACGGAAAGACCCC 2059 NOS2 upregulation reported in zebrafish philomiragia (SEQ ID NO: 53)
[0218] Table 8 shows bacterial species hosting the immunogenic 13nt rRNA sequence in their 23s rRNA. Aquatic pathogens such as Aeromonas hydrophila and Edwardsiella tarda (in bold) has 100% sequence conservation. Mycobacterium has partial sequence identity.
[0219] As before, the iRNA sequence was displayed on NOckout to give NOckout.sup.iRNA and tested its capacity to generate phagosomal NO (
[0220] Since ssRNA also acts as a PAMP in zebrafish, this suggests an evolutionarily conserved mechanism to detect ssRNAs. It was therefore reasoned that the PRR responsible was also likely to be a TLR. To identify the TLR responsible, phagosomal NO in zebrafish where specific endosomal TLRs were knocked down was then imaged. Specifically, when TLR7 was knocked down, the G/R, ratio of ˜10 NOckout.sup.RNA-labeled phagosomes showed ˜40% signal reduction (
[0221] In mammals, TLR-7 is an endosomal or phagosomal PRR that is known to engage ssRNA of viral or bacterial origin and shows ˜56% sequence identity with zebrafish TLR7 (zTLR7). An homology model of the predicted structure of zTLR7 with the crystal structure of macaque TLR7 complexed with ssRNA. reveals marked structural similarity (
[0222] In summary, small molecules reporters for NO are bright, photostable, specific and pH-insensitive, yet post-reaction, the probe molecules diffuse rapidly, obscuring spatial information. Protein based NO sensors offer spatial resolution, but have comparatively poor sensing characteristics, cannot be targeted to phagosomes and are pH-sensitive. NOckout probes leverage the 1:1 stoichiometry of DNA hybridization to display an NO sensitive fluorophore, an internal reference dye and a dsDNA domain to target the phagosome. Microinjecting NOckout nanodevices in live brains resulted in them being packaged into apoptotic bodies and being exclusively targeted to phagosomes in microglia. Since NOckout nanodevices are pH-insensitive they are well-suited to map NO in the acidic phagosomal milieu.
[0223] Importantly, NOckout nanodevices can be programmed to display a specific nucleic acid PAMP with precise and uniform stoichiometries to give NOckout.sup.fn devices that engage their cognate TLR receptor to thereby activate NOS2. This leads to phagosomal NO production that is detected by the NOckout probe. This modular, “trigger and detect” design enabled us to make six different NOckout variants with identical reporting capabilities that each engage a distinct TLR receptor depending on the PAMP displayed. By displaying well characterized immunogenic sequences such as mCpG or zCpG, murine TLR-9 and zebrafish TLR-9/TLR-21 could be activated respectively. It was found that while the basic NOckout scaffold was non-immunogenic, NOckout.sup.fn devices could activate NOS2 by engaging a specific TLR in primary microglia either in culture or in live zebrafish brains. While NOS2 activation due to PAMP recognition by the cognate TLR receptor is well established in cultured murine and human cells, using NOckout, it is possible to now directly map NOS2 activity in live cells and in live brains which has not been previously possible.
[0224] NOckout can be used to map NO arising from NOS2 activation in the first few hours following PAMP-PRR association in vivo. It can be used to assay PAMP-TLR recognition, identify or validate ligands for PRRs with undetermined specificities, and potentially estimate their relative procilivities to activate NOS2. The DNA scaffold can be modified to display more than one PAMP in precise stoichiometies using three-way or four-way junctions, and the resultant combination NOckout devices can be applied to identify TLRs that could act synergistically or antagonistically. One can also envisage substituting, NO detection chemistries for various ROS detection chemistries to map the in vivo activity of phagosomal ROS-producing enzymes arising from TLR activation. A technology that can map the dynamics of NO within phagosomes of innate immune cells in vivo could thereby offer new insights into the dynamics of host-pathogen interactions. Since resistant microbes use several mechanisms to bypass phagosomal degradation, NO mapping could help identify how resistant pathogens survive the phagosome.
[0225] NOckout reporters are applicable without further modification to transparent model organisms such as Caenorhabditis elegans and Drosophila melanogaster. One can also envisage NOckout being deployed in certain regions of mouse brain, for example, cerebral cortex. One caveat of Nockout technology is that, currently, it can be used to detect NO produced due to preexisting and actively translated NOS2 and is not suitable for sustained detection NO over transcriptional time scales. This limitation can be overcome by replacing dsDNA backbone by a peptide nucleic acid or L-DNA backbone to improve its cellular stability. This highly modular imaging platform can be applied to study the early stages of the innate immune response at very high chemical resolution.
[0226] The ability of NOckout technology to deliver new biological insight is demonstrated by the identification of a new class of PAMPs zebrafish, namely ssRNA. Mammals have achieved the sophistication to discriminate between ssRNA PAMPs of different origin: ssRNA from microbes are sensed by TLR-7 or TLR-8, while rRNA from bacteria is sensed by TLR-13. Yet, similar information on ssRNA sensing was previously unknown in zebrafish. Using NOckout.sup.iRNA it was determined that ssRNAs can indeed act as PAMPs and triggers NOS2 activity in zebrafish. Using morpholino knockdowns, it is possible to identify the cognate TLR responsible for this signaling mechanism.
[0227] NOckout nanodevices combine the attractive reporter characteristics of small molecule NO sensitive dyes with the stable localization provided by DNA. They can thereby map NO in vivo arising from NOS2 activation in the first few hours following PAMP-PRR association. NOckout technology can be applied to study PAMP-TLR recognition, identify ligands for PRRs with undetermined specificities, and estimate their relative proclivities to activate NOS2. The DNA scaffold also enables the stoichiometric display of more than one PAMP through the use of 3-way or 4-way junctions, and the resultant combination NOckout devices can be applied to identify those TLRs that act synergistically or antagonistically. One can also envisage substituting NO detection chemistries for various ROS detection chemistries to map the in vivo activity of phagosomal ROS producing enzymes arising from TLR activation. A technology that can map the dynamics of NO within phagosomes of innate immune cells in vivo will therefore offer new insights into the dynamics of host-pathogen interactions. Since resistant microbes use several mechanisms to by-pass phagosomal degradation, NO mapping could help identify how resistant pathogens survive the phagosome. This highly modular imaging platform can be applied to study the early stages of the innate immune response at very high chemical resolution.
BIBLIOGRAPHY
Part 1: DNA-Based Fluorescent Probe Maps NOS3 Activity
[0228] 1. Hess, D. T., Matsumoto, A., Kim. S.-O., Marshall, H. E. &. Stamler, J. S. Protein S-nitrosylation: purview and parameters. Nat. Rev. Mol. Cell Biol. 6, 150-166 (2005). [0229] 2. Bredt D. S. & Snyder, S. H. Nitric oxide: a physiologic messenger molecule. Annu. Rev. Biochem. 63,175-195 (1994). [0230] 3. Lim, K.-H., Ancrile, B. B., Kashatus, D. F. & Counter, C. M. Tumour maintenance is mediated by eNOS. Nature 452, 646-649 (2008). [0231] 4. Xu, W., Liu. L. Z., Loizidou M., Ahmed. M. & Charles, I. G. The role of nitric oxide in cancer. Cell Res. 12, 311-320 (2002). [0232] 5. Fukumura, D., Kashiwagi, S. & Jain, R. K. The role of nitric oxide in tumour progression. Nat. Rev. Cancer 6, 521-534 (2006). [0233] 6. Lahdenranta, J. et al. Endothelial nitric oxide synthase mediates lymphangiogenesis and lymphatic metastasis. Cancer Res. 69, 2801-2808 (2009). [0234] 7. Ying, L. & Hofseth, L. J. An emerging role for endothelial nitric oxide synthase in chronic inflammation and cancer. Cancer Res. 67, 1407-1410 (2007). [0235] 8. Thomsen, L. L. et al. Nitric oxide synthase activity in human breast cancer. Br. J. Cancer 72, 41-44 (1995). [0236] 9. Tschugguel, W. et al. Expression of inducible nitric oxide synthase in human breast cancer depends on tumor grade. Breast Cancer Res. Treat. 56, 145-151 (1999). [0237] 10. Martin, J. H., Begum S., Alalami, O., Harrison, A. & Scott, K. W. Endothelial nitric oxide synthase: correlation with histologic grade, lymph node status and estrogen receptor expression in human breast cancer. Tumour Biol. 21, 90-97 (2000). [0238] 11. Choudhari, S. K., Chaudhary, M., Bagde, S., Gadbail, A. R. & Joshi, V. Nitric oxide and cancer: a review. World J Sing Oncol, 11, 118 (2013). [0239] 12. Sowa, G. et al. Trafficking of endothelial nitric-oxide synthase in living cells. Quantitative evidence supporting the role of palmitoylation as a kinetic trapping mechanism limiting membrane diffusion. J. Biol. Chem. 274, 22524-22531 (1999). [0240] 13. Sessa, W. C. et al. The Golgi association of endothelial nitric oxide synthase is necessary for the efficient synthesis of nitric oxide. J. Biol. Chem. 270, 17641-17644 (1995). [0241] 14. Zhang, Q. et al. Functional relevance of Golgi- and plasma membrane-localized endothelial NO synthase in reconstituted endothelial cells. Arterioscler. Thromb. Vasc. Biol. 26, 1015-1021 (2006). [0242] 15. Jin Z.-G. Where is endothelial nitric oxide synthase more critical: plasma membrane or Golgi? Arterioscler. Thromb. Vasc. Biol. 26, 959-961 (2006). [0243] 16. Modi, S. et al. A DNA nanomachine that maps spatial and temporal pH changes inside living cells. Nat. Nanotechnol. 4, 325-330 (2009). [0244] 17. Surana, S., Bhat, J. M., Koushika, S. P. & Krishnan, Y. An autonomous DNA nanomachine maps spatiotemporal pH changes in a multicellular living organism. Nat. Commun. 2, 340 (2011). [0245] 18. Chakraborty, K., Leung, K. & Krishnan, Y. High lumenal chloride in the lysosome is critical for lysosome function. Elife 6, e28862 (2017). [0246] 19. Narayanaswamy, N. et al. A pH-correctable, DNA-based fluorescent reporter for organellar calcium. Nat. Methods 16, 95-102 (2019). [0247] 20. Leung, K., Chakraborty, K., Saminathan, A. & Krishnan, Y. A DNA nanomachine chemically resolves lysosomes in live cells. Nat. Nanotechnol. 14, 176-183 (2019). [0248] 21. Thekkan, S. et al. A DNA-based fluorescent reporter maps HOCl production in the maturing phagosome. Nat. Chem. Biol. 15, 1165-1172 (2019). [0249] 22. Kojima, H. et al. Bioimaging of nitric oxide with fluorescent indicators based on the rhodamine chromophore. Anal. Chem. 73, 1967-1973 (2001). [0250] 23. Kojima, H. et al. Detection and imaging of nitric oxide with novel fluorescent indicators: diaminofluoresceins. Anal. Chem. 70, 2446-2453 (1998). [0251] 24. You, M. et al. DNA probes for monitoring dynamic and transient molecular encounters on live cell membranes. Nat. Nanotechnol. 12, 453-459 (2017). [0252] 25. Ferreira, C. S. M., Cheung, M. C., Missailidis, S., Bisland, S. & Gariépy, J. Phototoxic aptamers selectively enter and kill epithelial cancer cells. Nucleic Acids Res. 37, 866-876 (2009). [0253] 26. Yang, Y.-M., Huang, A., Kaley, G. & Sun, D. eNOS uncoupling and endothelial dysfunction in aged vessels. Am. J. Physiol. Heart Circ. Physiol. 297, H1829-36 (2009). [0254] 27. Lundberg, J. O., Weitzberg, E. & Gladwin, M. T. The nitrate-nitrite-nitric oxide pathway in physiology and therapeutics. Nat. Rev. Drug Discov. 7, 156-167 (2008). [0255] 28. Fulton, D., Gratton, J. P. & Sessa, W. C. Post-translational control of endothelial nitric oxide synthase: why isn't calcium/calmodulin enough? J. Pharmacol. Exp. Ther. 299, 818-824 (2001). [0256] 29. Fulton, D. et al. Localization of endothelial nitric-oxide synthase phosphorylated on serine 1179 and nitric oxide in Golgi and plasma membrane defines the existence of two pools of active enzyme. J. Biol. Chem. 277, 4277-4284 (2002). [0257] 30. Goldstein, S., Russo, A. & Samuni, A. Reactions of PTIO and carboxy-PTIO with *NO, *NO2, and O2-*. J. Biol. Chem. 278, 50949-50955 (2003). [0258] 31. Fulton, D. et al. Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature 399, 597-601 (1999). [0259] 32. Veetil, A. T., Jani, M. S. &. Krishnan, Y. Chemical control over membrane-initiated steroid signaling with a DNA nanocapsule. Proc. Natl. Acad. Sci. USA 115, 9432-9437 (2018). [0260] 33. Fulton, D. et al. Targeting of endothelial nitric-oxide synthase to the cytoplasmic face of the Golgi complex or plasma membrane regulates Akt- versus calcium-dependent mechanisms for nitric oxide release. J. Biol. Chem. 279, 30349-30357 (2004). [0261] 34. Lytton, J., Westlin, M. & Hanley, M. R. Thapsigargin inhibits the sarcoplasmic or endoplasmic reticulum Ca-ATPase family of calcium pumps. J. Biol. Chem. 266, 17067-17071 (1991). [0262] 35. Namin, S. M., Nofallah, S., Joshi, M. S., Kavallieratos, K. & Tsoukias, N. M. Kinetic analysis of DAF-FM activation by NO: toward calibration of a NO-sensitive fluorescent dye. Nitric Oxide 28, 39-46 (2013). [0263] 36. Jiang, S. et al. Real-time electrical detection of nitric oxide in biological systems with sub-nanomolar sensitivity. Nat. Commun. 4, 2225 (2013). [0264] 37. Ramamurthi, A. & Lewis, R. S. Measurement and modeling of nitric oxide release rates for nitric oxide donors. Chem. Res. Toxicol. 10, 408-413 (1997). [0265] 38. Modi, S., Halder, S., Nizak, C. & Krishnan, Y. Recombinant antibody mediated delivery of organelle-specific DNA pH sensors along endocytic pathways. Nanoscale 6, 1144-1152 (2014). [0266] 39. Garcia-Cardeña, G. et al. Dynamic activation of endothelial nitric oxide synthase by Hsp90. Nature 392, 821-824 (1998). [0267] 40. Farber-Katz, S. E. et al. DNA damage triggers Golgi dispersal via DNA-PK and GOLPH3. Cell 156, 413-427 (2014). [0268] 41. Lee, J. E. et al. Dependence of Golgi apparatus integrity on nitric oxide in vascular cells: implications in pulmonary arterial hypertension. Am. J. Physiol. Heart Circ. Physiol. 300. H1141-58 (2011). [0269] 42. Blake, R. A. et al. SU6656, a selective src family kinase inhibitor, used to probe growth factor signaling. Mol. Cell. Biol. 20, 9018-9027 (2000). [0270] 43. Skupien, A. et al. CD44 regulates dendrite morphogenesis through Src tyrosine kinase-dependent positioning of the Golgi. J. Cell Sci. 127, 5038-5051 (2014). [0271] 44. Ye, X., Rubakhin, S. S. & Sweedler, J. V. Detection of nitric oxide in single cells. Analyst 133, 423-433 (2008). [0272] 45. Lim, M. H., Xu, D. & Lippard, S. J. Visualization of nitric oxide in living cells by a copper-based fluorescent probe. Nat. Chem. Biol. 2, 375-380 (2006). [0273] 46. Eroglu, E. et al. Development of novel FP-based probes for live-cell imaging of nitric oxide dynamics. Nat. Commun 7, 10623 (2016). [0274] 47. Vahora, H., Khan, M. A., Alalami, U. & Hussain, A. The potential role of nitric oxide in halting cancer progression through chemoprevention. J. Cancer Prev. 21, 1-12 (2016). [0275] 48. Ellefsen K. L. & Parker, I. Dynamic Ca2+ imaging with a simplified lattice light-sheet microscope: A sideways view of subcellular Ca2+ puffs. Cell Calcium 71, 34-44 (2018). [0276] 49. Lee, P. C. et al. Impaired wound healing and angiogenesis eNOS-deficient mice. Am. J. Physiol. 277, H1600-8 (1999). [0277] 50. Jane, M. S, Veetil, A. T. & Krishnan, Y. Precision immunomodulation with synthetic nucleic acid technologies. Nat. Rev. Mater. (2019). doi:10.1038/s41578-019-0105-4. [0278] 51. Yao, L., Smith, B. T. & Aubé, J. Base-promoted reactions of bridged ketones and 1,3- and 1,4-haloalkyl azides: competitive alkylation vs azidation reactions of ketone enolates. J. Org. Chem. 69, 1720-1722 (2004). [0279] 52. Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676-682 (2012). [0280] 53. Awad, H. H. & Stanbury D. M. Autoxidation of NO in aqueous solution. Int. J. Chem. Kinet. 25, 375-381 (1993). [0281] 54. Lewis, R. S. & Deen, W. M. Kinetics of the reaction of nitric oxide with oxygen in aqueous solutions. Chem. Res. Toxicol. 7, 568-574 (1994). [0282] 55. Brandes R. P. & Janiszewski, M. Direct detection of reactive oxygen species ex vivo. Kidney Int. 67, 1662-1664 (2005). [0283] 56. Duarte, A. J. & da Silva, J. C. G. E. Reduced fluoresceinamine as a fluorescent sensor for nitric oxide. Sensors (Basel) 10, 1661-1669 (2010). [0284] 57. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J. & Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat. Protoc. 4, 1798-1806 (2009).
Part 2: DNA Nanodevices for Mapping Nitric Oxide in Living Brain
[0285] 58. Stuart, L. M. & Ezekowitz, R. A. B. Phagocytosis: elegant complexity. Immunity 22, 539-550 (2005). [0286] 59. Underhill, D. M. & Ozinsky, A. Phagocytosis of microbes: complexity in action. Annu. Rev. Immunol. 20, 825-852 (2002). [0287] 60. Dupré-Crochet, S., Erard, M. & Nüße, O. ROS production in phagocytes: why, when, and where? J. Leukoc. Biol. 94, 657-670 (2013). [0288] 61. Wink, D. A. et al. Nitric oxide and redox mechanisms in the immune response. J. Leukoc. Biol. 89, 873-891 (2011). [0289] 62. Takeuchi, O. & Akira, S. Pattern recognition receptors and inflammation. Cell 140, 805-820 (2010). [0290] 63. Mogensen, T. H. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev. 22, 240-73, Table of Contents (2009). [0291] 64. West, A. P., Koblansky, A. A. & Ghosh, S. Recognition and signaling by toll-like receptors. Annu. Rev. Cell Dev. Biol. 22, 409-437 (2006). [0292] 65. Li, Y., Li. Y., Cao, X., Jin, X. & Jin, T. Pattern recognition receptors in zebrafish provide functional and evolutionary insight into innate immune signaling pathways. Cell Mol Immunol 14, 80-89 (2017). [0293] 66. Ciao, J. J. et al. Cutting edge: bacterial DNA and LPS act in synergy in inducing nitric oxide production in RAW 264.7 macrophages. J. Immunol. 163, 4095-4099 (1999). [0294] 67. Utaisincharoen, P. Anuntagool, N., Chaisuriya, P., Pichyangkul, S. & Sirisinha, S. CpG ODN activates NO and NOS2 production in mouse macrophage cell line (RAW 264.7). Clin. Exp. Immunol. 128, 467-473 (2002). [0295] 68. Pacelli, R. et al. Nitric oxide potentiates hydrogen peroxide-induced killing of Escherichia coli. J. Exp. Med. 182, 1469-1479 (1995). [0296] 69. Kaplan, S. S., Lancaster, J. R., Basford, R. E. &. Simmons, R. L. Effect of nitric oxide on staphylococcal killing and interactive effect with superoxide. Infect. Immun. 64, 69-76 (1996). [0297] 70. Gregory, S. H., Wing, E. J., Hoffman, R. A. & Simmons, R. L. Reactive nitrogen intermediates suppress the primary immunologic response to Listeria. J. Immunol. 150, 2901-2909 (1993). [0298] 71. Miller, B. H. et al. Mycobacteria inhibit nitric oxide synthase recruitment to phagosomes during Macrophage infection. Infect. Immun. 72, 2872-2878 (2004). [0299] 72. L. Davis, A. S. et al. Mechanism of inducible nitric oxide synthase exclusion from mycobacterial phagosomes. PLoS Pathog. 3, e 186 (2007). [0300] 73. Cambier, C. J. et al. Mycobacteria manipulate macrophage recruitment through coordinated use of membrane lipids. Nature 505, 218-222 (2014). [0301] 74. Giustarini, D., Rossi, R., Milzani, A. & Dalle-Donne, I. in Nitric Oxide, Part F 440, 361-380 (Elsevier, 2008). [0302] 75. Kojima, H. et al. Detection and imaging of nitric oxide with novel fluorescent indicators: diaminofluoresceins. Anal. Chem 70, 2446-2453 (1998). [0303] 76. McQuade, L. E. & Lippard, S. J. Fluorescent probes to investigate nitric oxide and other reactive nitrogen species in biology (truncated form: fluorescent probes of reactive nitrogen species). Curr. Opin. Chem. Biol. 14, 43-49 (2010). [0304] 77. Yu, H., Xiao, Y. & Jin, L. A lysosome-targetable and two-photon fluorescent probe for monitoring endogenous and exogenous nitric oxide in living cells. J. Am. Chem. Soc. 134, 17486-17489 (2012). [0305] 78. Pisano, J. M. & Firestone R. A. Lysosomotropic Agents III1. Synthesis of N-Retinyl Morpholine. Synth Commun 11, 375-378 (1981). [0306] 79. Eroglu, E. et al. Development of novel FP-based probes for live-cell imaging of nitric oxide dynamics. Nat Commun 7, 10623 (2016). [0307] 80. Kojima, H. et al. Bioimaging of Nitric Oxide with Fluorescent Indicators Based on the Rhodamine Chromophore. Anal. Chem. 73, 1967-1973 (2001). [0308] 81. Veetil, A. T. et al. Cell-targetable DNA nanocapsules for spatiotemporal release of caged bioactive small molecules. Nat. Nanotechnol. 12, 1183-1189 (2017). [0309] 82. Chakraborty, K., Veetil, A. T., Jaffrey, S. R. & Krishnan, Y. Nucleic Acid-Based Nanodevices in Biological Imaging. Annu. Rev. Biochem. 85, 349-373 (2016). [0310] 83. Yeh, D.-W. et al. Toll-like receptor 9 and 21 have different ligand recognition profiles and cooperatively mediate activity of CpG-oligodeoxynucleotides in zebrafish. Proc. Natl. Acad. Sci. USA 110, 20711-20716 (2013). [0311] 84. Oldenburg, M. et al. TLR13 recognizes bacterial 23S rRNA devoid of erythromycin resistance-forming modification. Science (80-.). 337, 1111-1115 (2012). [0312] 85. Li, X.-D. & Chen, Z. J. Sequence specific detection of bacterial 23S ribosomal RNA by TLR13. Elife 1, e00102 (2012). [0313] 86. Anrather, J., Racchumi, G. & Iadecola, C. NF-kappaB regulates phagocytic NADPH oxidase by inducing the expression of gp91phox. J. Biol. Chem. 281, 5657-5667 (2006). [0314] 87. Berlato, C. et al. Involvement of suppressor of cytokine signaling-3 as a mediator of the inhibitory effects of IL-10 on lipopolysaccharide-induced macrophage activation. J. Immunol. 168, 6404-6411 (2002). [0315] 88. Wind, S. et al. Comparative pharmacology of chemically distinct NADPH oxidase inhibitors. Br. J. Pharmacol. 161, 885-898 (2010). [0316] 89. Kettle, A. J., Gedye, C. A. & Winterbourn, C. C. Mechanism of inactivation of myeloperoxidase by 4-aminobenzoic acid hydrazide. Biochem. J. 321 (Pt 2), 503-508 (1997). [0317] 90. Garvey, E. P. et al. 1400W is a slow, tight binding, and highly selective inhibitor of inducible nitric-oxide synthase in vitro and in vivo. J. Biol. Chem. 272, 4959-4963 (1997). [0318] 91. Lee, B. L. & Barton, G. M. Trafficking of endosomal Toll-like receptors. Trends Cell Biol. 24, 360 -369 (2014). [0319] 92. Dalpke, A. H. et al. Immunostimulatory C.sub.PG-DNA activates murine microglia. J. Immunol. 168, 4854-4863 (2002). [0320] 93. Iliev, A. I., Stringaris, A. K., Nau, R. & Neumann, H. Neuronal injury mediated via stimulation of microglial toll-like receptor-9 (TLR9). FASEB J. 18, 412-414 (2004). [0321] 94. To, E. E. et al. Endosomal NOX2 oxidase exacerbates virus pathogenicity and is a target for antiviral therapy. Nat Commun 8, 69 (2017). [0322] 95. Meijer, A. H. & Spaink, H. P. Host-pathogen interactions made transparent with the zebrafish model. Curr Drug Targets 12, 1000-1017 (2011). [0323] 96. Peri, F. & Nüsslein-Volhard, C. Live imaging of neuronal degradation by microglia reveals a role for v0-ATPase a1 in phagosomal fusion in vivo. Cell 133, 916-927 (2008). [0324] 97. Renshaw, S. A. & Trede. N. S. A model 450 million years in the making: zebrafish and vertebrate immunity. Dis. Model. Mech. 5, 38-47 (2012). [0325] 98. Egensperger, R., Maslim, J., Bisti, S., Holländer, H. & Stone, J. Fate of DNA from retinal cells dying during development: uptake b microglia and macroglia (Müller cells). Brain Res. Dev. Brain Res. 97, 1-8 (1996). [0326] 99. Li Y. et al. Microglial activation by uptake of fDNA via a scavenger receptor. J. Neuroimmunol. 147, 50-55 (2004). [0327] 100. Sierra, A. et al. Microglia shape adult hippocampal neurogenesis through apoptosis-coupled phagocytosis. Cell Stem Cell 7, 483-495 (2010). [0328] 101. Mazaheri F. et al. Distinct roles for BAI1 and TIM-4 in the engulfment of dying neurons by microglia. Nat Commun 5, 4046 (2014). [0329] 102. Madigan, C. A. et al. A Macrophage Response to Mycobacterium leprae Phenolic Glycolipid Initiates Nerve Damage in Leprosy. Cell 170, 973-985.e10 (2017). [0330] 103. Matsuo, A. et al. Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses. J. Immunol. 181, 3474-3485 (2008). [0331] 104. Ishibe, K. et al. Comparative analysis of the production of nitric oxide (NO) and tumor necrosis factor-alpha (TNF-alpha) from macrophages exposed to high virulent and low virulent strains of Edwardsiella tarda. Fish Shellfish Immunol. 27, 386-389 (2009). [0332] 105. Rodríguez, I., Novoa, B. & Figueras, A. Immune response of zebrafish (Danio rerio) against a newly isolated bacterial pathogen Aeromonas hydrophila. Fish Shellfish Immunol. 25, 239-249 (2008). [0333] 106. Brudal E. et al. Establishment of three Francisella infections in zebrafish embryos at different temperatures. Infect. Immun. 82, 2180-2194 (2014). [0334] 107. Jensen, S. & Thomsen, A. R. Sensing of RNA viruses: a review of innate immune receptors involved in recognizing RNA virus invasion. J. Virol. 86, 2900-2910 (7017). [0335] 108. Diebold, S. S., Kaisho, T., Hemmi, H., Akira, S. & Reis e Sousa, C. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science (80-.). 303, 1529-1531 (2004). [0336] 109. Mancuso, G. et al. Bacterial recognition by TLR7 in the lysosomes of conventional dendritic cells. Nat. Immunol. 10, 587-594 (2009). [0337] 110. Nishiya T., Kajita, E., Miwa, S. & Defranco, A. L. TLR3 and TLR7 are targeted to the same intracellular compartments by distinct regulatory elements. J. Biol. Chem 280, 37107-37117 (2005). [0338] 111. Zhang, Z. et al. Structural Analysis Reveals that Toll-like Receptor 7 Is a Dual Receptor for Guanosine and Single-Stranded RNA. Immunity 45, 737-748 (2016).