Apparatuses, methods and systems for automated processing of nucleic acids and electrophoretic sample preparation
10131901 ยท 2018-11-20
Assignee
Inventors
- Ezra S. Abrams (Newton, MA)
- Danny YUN (S. Hamilton, MA, US)
- Todd J. BARBERA (Marblehead, MA, US)
- Douglas Grosvenor SABIN (Marblehead, MA, US)
- T. Christian BOLES (Bedford, MA, US)
Cpc classification
G01N27/44773
PHYSICS
C12N15/101
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12N15/1017
CHEMISTRY; METALLURGY
International classification
C12Q1/6806
CHEMISTRY; METALLURGY
Abstract
Methods, systems and apparatus for automated extraction, purification, and processing of nucleic acids from biological samples are presented. In some embodiments, hydrogel supports are used to immobilize particulate biological input samples and extract nucleic acids during operations. The use of hydrogel facilitates automated sample processing on robotic liquid handling systems. Devices, methods, and systems are also provided for electrophoretic sample preparation.
Claims
1. An electrophoresis system, comprising: an electrophoresis gel matrix having a first end, a second end, a length, a width, a first lengthwise side and a second lengthwise side; a reagent well containing a lysis reagent configured within the electrophoresis gel matrix portion proximate the first end; a sample well containing a sample of biological cells and configured within the electrophoresis gel matrix proximate the first end and between the reagent well and the second end; a first negative electrode of a pair of electrophoretic electrodes arranged at the first end; a first positive electrode of the pair of electrophoretic electrodes arranged at the second end; and wherein: upon application of a first biasing voltage across the pair of electrophoretic electrodes, reagent is driven from the reagent well into and/or through the sample well.
2. The electrophoresis system of claim 1, wherein the sample well includes a cell suspension.
3. The electrophoresis system of claim 1, wherein the lysis reagent is a negatively charged lysis reagent.
4. The electrophoresis system of claim 3, wherein upon application of the first biasing voltage, the negatively charged lysis reagent is driven into a sample well including a cell suspension to produce DNA molecules of the cells contained in the cell suspension.
5. The electrophoresis system of claim 4, wherein the produced DNA molecules are configured on at least one side of the sample well.
6. The electrophoresis system of claim 5, wherein upon application of a second biasing voltage across the pair of electrophoretic electrodes, the accumulated DNA electrophoreses out of the sample well.
7. The electrophoresis system of claim 6, further comprising: a plurality of elution receiving areas or channels arranged along the first lengthwise side of the gel, each receiving area having a first side arranged adjacent the first lengthwise side of the gel and second side spaced apart from the first side of the receiving area; and a plurality of pairs of elution electrodes corresponding to each elution receiving channel, wherein a first negative elution electrode of a first pair of elution electrodes is arranged proximate the second lengthwise side of the gel across from the first side of a first elution receiving channel and a first positive elution electrode of the first pair arranged proximate to the second side of the first elution receiving channel; wherein upon application of the second biasing voltage, DNA fragments of the electrophoresed DNA accumulate proximate one and/or another of the elution receiving channels; and upon application of a biasing voltage across one and/or another of the pairs of elution electrodes, the DNA fragments are driven into one and/or another of respective elution channels.
8. An electrophoresis method comprising: providing the system of claim 1; loading a cell suspension comprising the sample of biological cells into the sample well; loading the reagent into the reagent well; applying a first voltage bias across the pair of electrophoretic electrodes, wherein application of the first voltage bias causes the reagent to move from the reagent well to the sample well, wherein the reagent is configured to cause the cells in the suspension to lyse, and DNA molecules from the cells accumulate on at least one side of the sample well.
9. The method of claim 8, further comprising incubating the cell suspension within the sample well.
10. The method of claim 8, further comprising breaking down the DNA molecules into fragments.
11. The method of claim 8, wherein: the system further comprises a plurality of elution receiving areas or channels arranged along the first lengthwise side of the gel, each receiving area having a first side arranged adjacent the first lengthwise side of the gel and second side spaced apart from the first side of the receiving area, and the method further comprises electrophoretically driving the DNA fragments from the sample well to the plurality of elution channels.
12. The method of claim 9, wherein incubation comprises: adding a first additive to the sample well and incubating with the contents of the sample well the cells therein; and/or adding a second additive to the sample well and incubating with the cells therein; and/or adding a third additive to the sample well and incubating with the cells therein.
13. The method of claim 12, wherein the first additive, the second additive, and the third additive, and corresponding incubations thereof, are performed sequentially.
14. The method of claim 12, wherein: the first additive comprises at least one adapter; the second additive is T4 DNA polymerase, dNTPs, E. coli ligase, and nicotinamide adenine dinucleotide; and the third additive is Exonuclease T5.
15. The method of claim 12, wherein the first additive comprises a transposase assembled with oligonucleotides comprising a first portion which has at least one transposase recognition region and a second portion which has a sequencing library adapter region.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22) One of ordinary skill in the art will understand and appreciate that the drawings of the subject disclosure are primarily for illustrative purposes and are not intended to limit the scope of the inventive subject matter described herein. The drawings are not necessarily to scale; in some instances, various aspects of the inventive subject matter disclosed herein may be shown exaggerated or enlarged in the drawings to facilitate an understanding of different features. In the drawings, like reference characters generally refer to like features (e.g., functionally similar and/or structurally similar elements).
DETAILED DESCRIPTION OF SOME OF THE EMBODIMENTS
(23) In some embodiments, hydrogels can be used in some of the processes of preparing HMW nucleic acids. In some embodiments, hydrogel supports (e.g., agarose gels) are utilized for automated extraction and processing of HMW nucleic acids. The gels may be formed on solid supports of various kinds that simplify handling and enable automated processing of the gel-embedded samples. Examples of particulate biological samples comprise animal, plant, fungal, or bacterial cells. Further, in some embodiments, the particulate samples comprise non-living biological particles, including viruses, and non-cellular membrane-delimited vesicles containing nucleic acids.
(24) In some embodiments, the particulate biological sample is embedded in a hydrogel matrix for subsequent processing. Examples of hydrogel matrices are those that are useful for biomedical applications, such as those discussed in Hoffman, Allan S. Advanced Drug Discovery Reviews, Vol. 54, pp. 3-12, 2002, and food and microbiological applications, such as those discussed in Food Polysaccharides and their Applications, Ed. By A. M. Stephenson and G. O. Philips, 2006. The entire contents of these publications, and the references cited therein, are expressly incorporated by reference herein. In some embodiments, hydrogel matrix is agarose. Although much of the discussion in the instant description deals with hydrogel supports comprising agarose, the use of agarose in the following description should be considered exemplary and non-limiting.
(25) In some embodiments, the hydrogel matrix may have substituent groups that can be selectively bound by one or more of the sample constituents. Such interactions may cause selective retention of one or more sample constituents during processing of the sample, or during elution of the processed nucleic acids.
(26) In some embodiments, with reference to
(27) The final mixture comprising gel and biological sample may be maintained just above the gelling temperature in the container 101, and a carrier 107 may be immersed in the molten mixture. After the carrier is immersed in the molten mixture, the temperature of the support 102 is reduced to a temperature below the gelling temperature, allowing the mixture comprising gel and biological sample to solidify (e.g., on the carrier). In some embodiments, the carrier may be an injection molded plastic part, and may have a shape that is designed to interdigitate with the gelled sample plug 108. For example, the carrier may provide fins or projections for good mechanical support for the gel, and thereby allow the sample plug to remain attached to the carrier. In some embodiments, the sample plug 108 may be removed from the original container 101 using the upper portion of the carrier as a handle for manual manipulation, or alternatively, using the upper portion of the carrier as an attachment point for automated robotic handling of the sample plug.
(28) In some embodiments, the sample plug may be immersed in a reagent mixture 110 in a second container 109. Further, the carrier 107, and/or second container 109 may be agitated, to facilitate mixing between the reagent mixture 110 and the sample plug 108. In some embodiments, the sample plug formed on the solid carrier may be very thin, preferably less than 1 millimeter in thickness (e.g., 0.5 mm, 0.4 mm, 0.3 mm, 0.2 mm, 0.1 m, 0.05 mm, 0.01 mm), to facilitate diffusion of processing reagents into the gel support. In some embodiments, the thickness of the gel layer is less than 200 micrometers. Supports with sub-millimeter thickness are useful for allowing diffusion of enzymatic processing reagents, such as proteases, in and out of the gel support.
(29) In some embodiments, addition of processing reagents to the sample plug may be accomplished by remelting the sample plug in a container holding a reagent, mixing the molten gel and reagent to disperse the reagent throughout the mixture comprising the gel and the biological sample, and regelling the mixture. In such embodiments, the reagent may be added to the container in liquid form, or may be added in gel-embedded form. If the reagent is added in liquid form, the reagent addition may not dilute the mixture so that subsequent gelation is prevented, or so that the sample plug becomes fragile. If reagent is added in gel-embedded form, the gel used may melt and re-gel under the same conditions used for the sample plug. In embodiments where the addition of processing reagents are added by remelting the sample plug, hydrogel matrices which can be melted or liquefied at low temperature may be used. For example, the matrices may be low melting temperature agarose (such as SeaPlaque? agarose from Lonza). In embodiments where addition of processing reagents is performed by remelting the sample plug, the mixing step may be done as gently as possible to avoid shear damage to the nucleic acids.
(30) In some embodiments, with reference to
(31) With reference to
(32) With reference to
(33) In some embodiments, the system described herein may be used to perform sequential chemical and/or enzymatic processes on a sample plug, as shown, for example, in
(34) In some embodiments, the system may be configured so that a series of reagents are serially added and removed from a single reagent container 109. The addition and removal of the reagents may be accomplished via fluidic channels within the container, said channels connecting to a one or more liquid handling means (e.g., reagent container) external to the container. In other embodiments, the reagents may be added and removed from the top of the container by standard liquid handling means (such as, for instance, a gantry-style liquid handling robots sold by Beckman, Agilent, Tecan, Hamilton, etc.). In both such embodiments, the carrier with sample plug could remain resident inside, or close to, the reagent container during reagent exchange.
(35) In some embodiments, the sample plug may be formed with a higher concentration of agarose to facilitate processing workflows that generate smaller DNA fragments. A non-limiting example of such a workflow would be transposase-mediated generation construction of short-read next-generation libraries (e.g., using Nextera from Ilumina?, MuSeek from Thermo Fermentas, etc., chemistries). In some such workflows, DNA is fragmented into sizes ranging from several hundred to several thousand bp in length. In such workflows, a higher concentration of agarose in the sample plug will restrict diffusion of the library products from the plug, but would still allow the transposase and free adaptors to be removed efficiently.
(36) With reference to
(37) When performing a series of reagent exchanges into and out of the sample plug, gel concentration, voltage, and/or electrophoresis duration may be chosen so that the reagent components are efficiently exchanged, and/or so that the DNA is remains in the sample plug. Since HMW DNA migrates so slowly in agarose, usually, such conditions are fulfilled for very HMW DNA. Higher concentration gels, lower voltages, and more optimization may be used when generating short read libraries (e.g., about 500 bp fragment size).
(38)
(39) With reference to
(40) In some embodiments, processed nucleic acid, such as but not limited to DNA, may be eluted from the sample plug by electrophoresis. In some instances, a device of the general design shown in
(41) In some embodiments, the electric field used for electroelution may be manipulated to selectively recover certain size ranges of processed nucleic acids. For instance, pulsed field methods may be used to elute processed DNA fragments 50-500 kb in length while leaving DNA fragments greater than about 2000 kb in size in the sample plug, as has been shown by Jann Noolandi, and Chantal Turmel in In Methods in Molecular Biology Volume 12: Pulsed-field gel electrophoresis, Protocols, Methods, and Theories. Ed. Burmeister, Margit, and Ulanovsky, Levy. Humana., pp. 73-103 and 135-143, which is hereby incorporated by reference in its entirety. If the larger size fraction is desired free of the lower, the lower fraction can be eluted first under size-selective pulsed field conditions, and subsequently the higher fraction can be recovered under other pulsed field conditions or under continuous field conditions. In such embodiments, the carrier may be moved to a second elution container (e.g.,
(42) In some embodiments, the carrier containing the processed sample plug may be used to load the processed nucleic acids into other electrophoretic devices for analysis or for other sample preparation processes, such as, for example, size selection. For example, the multiplex carrier concept shown in
Exemplary Experimental Implementations According to Some Embodiments
Example: Preparation of Very High Molecular Weight DNA from Bovine Whole Blood Using an Agarose Sample Plug with Rapid Electrophoretic Purification
(43) Immobilization of Blood Cells in Agarose.
(44) Prepare 2% agarose (SeaKem Gold, Lonza) by adding 2 g agarose to 100 mL of 1?KBB/2 mM EDTA (50 mL 10?KBB, 2 mL 500 mM EDTA to 500 mL).
(45) Cool an aliquot to 45 C.
(46) Mix 2 mL of agarose with 2 mL of whole bovine blood (Lampire Biologicals), and pour into a 60 mm diameter petri dish; allow to cool.
(47) (0.5?KBB buffer is 51 mM Tris base, 28.8 mM TAPS acid, 0.08 mM EDTA acid, pH 8.7.)
(48) Electrophoretic Deproteinization
(49) Trial 1: Deproteinization from SDS Buffer.
(50) Prepare a horizontal agarose gel in a Galileo galileo 1214 gel box tray with two 12 well 1.5 mm thick combs, add 100 mL of 1% SeaKem Gold agarose (Lonza) in 0.5?KBB+0.5% SDS. From the petri plate with whole blood/agarose, punch out 6.35 mm diameter discs, and transfer to the wells of the agarose gel. Deproteinize by electrophoresis at 250V 21 min. Remove discs from wells, and transfer to a fresh petri dish with TE.
Trial 2: Deproteinization from SDS/Thiourea Buffer All steps performed as in Trial 1 above, except that the gel contains 2M thiourea in addition to components listed above; this gel requires cooling (4 C, 30 minutes) to set.
(51) Restriction Enzyme Digestion Discs are in petri dishes in TE Remove a disc from TE with plastic spatula, blot dry by tapping an edge against a paper towel, and add to a 2 mL microfuge tube with 78 uL water/16 uL 10?NEB buffer/1 uL 1M DTT/3 uL NEB BSA and enzyme as follows.
(52) TABLE-US-00001 Trial Disc Buffer Enzyme 1 0 custmart none 1 1 cutsmart XhoI 1 2 cutsmart ApaI 1 3 cutsmart HinfI 1 4 cutsmart DraI 1 5 1.1 KpnI 1 6 2 HinDIII 1 7 3.1 PuvI 1 8 R1 EcoR! 2 9 cutsmart XhoI 2 10 cutsmart HinfI 2 11 cutsmart DraI
(53) All Enzymes are from NEB and (except EcoRI and Apa) at 10 or 20 u/uL. All digests used 2 uL enzyme/well, except for EcoRI (100 u/uL) and Apal 50 u/uL), in which cases onlyluL of enzyme. All were incubated at 37 C overnight. Reactions were terminated with 8 uL of 0.5M EDTA (?25 mM) and 8 uL of 10% SDS (?0.5%)
(54) The reactions using Cutsmart have a strong ppt, probably due to the K+ in the buffer.
(55) Analytical Agarose Gel Electrophoresis
(56) Prepare a horizontal gel with 1% seakem gold and 0.5?KBB buffer; transfer discs from above to sample wells; run using the Pippin Pulse (Sage Science), at 80V, with field parameters (constants A-G) as 300, 100, 30, 10, 30, 10, 45 (MJ5 protocol) for 12 hours.
Standards include a low molecular weight marker (NEB extend ladder), lambda genomic DNA (48.5 Kbp) and NEB lambda ladder PF standard.
(57) Description of Gel Samples Loaded on Analytical Gel (
(58) TABLE-US-00002 PF Disc # gel Mol Deprot NEB Buffer Enzyme site lane Wt Std Trial Enzyme Comment (CpG sites) 1 NEB extend Ladder 2 Lambda DNA 3 Lambda Ladder 4 1 0, cutsmart, none 5 1 1, cutsmart, XhoI CTCGAG One CpG site 6 1 2, cutsmart, ApaI GGGCCC Two potential CpG sites 7 1 3, cutsmart, HinfI GANTC Two potential 8 1 4, cutsmart, DraI TTTAAA 9 1 5, 1.1, KpnI GGTACC Two potential 10 1 6, 2, HindIII AAGCTT 11 1 7, 3.1, PvuI CGATCG Two; enzyme predicted to give avg size >200 Kb on mammalian DNA 12 1 8, EcoRI, EcoRI GAATTC Two; Bovine Genome has a 1,400 bp repeat when cut with EcoRI 13 2 9, cutsmart, XhoI 14 2 10, 2, HindIII 15 2 11, cutsmart, DraI 16 1 Disc Left in TE overnight
Staining of Sample Plugs after Analytical Gel Electrophoresis
(59) After analytical gel electrophoresis, the sample plug discs were removed from the gel loading wells, and stained in 700 uL 0.5 ug/mL ethidium bromide in a 24 well microplate. Control discs which had been deproteinized, but had not been run on the analytical gel were also stained and are shown in the lower right wells.
(60) Gel was stained with ethidium bromide and photographed with a UV transillumination, and images were analyzed with CaptureNX software (Nikon).
(61) Results:
(62) The sample plugs that were electrophoretically deproteinized but remained in TE buffer without restriction enzyme treatment remained brightly stained by ethidium after analytical gel electrophoresis (
(63) All other restriction enzyme treatments, liberated large amounts of DNA from the sample plugs as seen from the stained plugs. There was some trace nuclease activity left over from the samples as seen in the plug treated with restriction buffer but no enzyme (
Example: Rapid Removal of Protein from Agarose-Embedded Whole Blood Samples by Electrophoresis
(64) Goal:
(65) Demonstrate that when whole blood is mixed with agarose, that all of the protein can be removed by electrophoresis in the presence of SDS, and compare the resulting protein profile of agarose plug samples to the protein profile of agarose plugs treated with Proteinase K.
Experimental
(66) Mix Whole Blood with Agarose
(67) To 2 mL of 1.5% seakem gold agarose, in 0.5?KBB buffer (Sage Science) plus 1 mM EDTA, at 48? C., add 2 mL of whole blood, and after rapid swirling to mix, pour the mixture into a 60 mm diameter petri dish and allow to cool.
(68) Deproteinize by Treating with Proteinase K
(69) Run 1: From the petri dish, use a punch to make a 6.35 mm diameter disc; incubate the disc overnight, with rocking, in a 2 mL microfuge tube with 1 mL of SarE buffer.
(70) (SarE buffer: To make 1 mL, mix 375 uL water, 100 uL 10% wt/v N lauryl sarcosine, 500 uL Na2EDTA, and 25 uL of 20 mg/mL proteinase K solution (Fisher Scientific, catalog # FP2500150))
(71) Run 2: Incubate a 6.35 mm disc as above, but with 1 mL of STCP buffer
(72) STCP buffer: To make 1 mL, mix 890 uL water, 50 uL 10% wt/v SDS, 50 uL 1M Tris HCl, pH 7.5; 1 uL 1M CaCl2; 5 uL 20 mg/mL Proteinase K
(73) Run 3: (no protease control): Incubate a disc as above, but with a buffer containing 0.5?KBB/0.5% SDS
(74) Deproteinize by Electrophoresis in the Presence of SDS
(75) Run 4: transfer a 6.35 mm disc to the well of an agarose gel (1% seakem gold, 0.5?KBB, 0.5% SDS, 1 mM EDTA). The running buffer is the same (0.5?KBB/0.5% SDS/1 mM EDTA). Gels (50 mL total volume of agarose) are poured in a Galileo bioscience model 0708 gel box, with a 1.5 mm thick comb with 6 well formers.
Electrophorese at 220V for 5 minutes; this time is sufficient for the dark brown hemoglobin band to completely clear the agarose disc.
Transfer the disc to a 2 mL microfuge tube with 1 mL of fresh running buffer.
Run 5: As run 4, but electrophorese for 8 minutes at 220V.
Run 6: As run 4, but after 4 minutes, fill the agarose gel well (containing the now colorless disc) with 5 mM TCEP solution; wait 5 minutes; electrophorese for 4 min at 220V.
Run 7: As run 6, but electrophorese for 8 minutes after TCEP addition.
Run 8: Control (no treatment) A 6.35 mm disc (bright red from the whole blood) without further treatment.
Determine the Extent of Deproteinization by Solubilizing Agarose Discs, and Running Soluble Material on Analytical SDS PAGE
Discs from runs were solubilixed by mixing with 80 uL of TUS buffer, 10 uL of 4?LDS sample buffer for SDS PAGE (invitrogen) and 1 uL of 500 mM TCEP solution, and heating for 85? C. for 6 minutes.
(TUS buffer is made by combining 3 gr thiourea; 260 uL 50?TE (USB biochemicals); 2.6 mL 10% SDS; and water to 13 mL; this solution is soluble at 42? C. This buffer is approximately 3M in thiourea, 1?TE and 2% in SDS.)
20 uL of the solubilized material was loaded on a 4-20% gradient SDS gel (Genscript, ExpressPlus PAGE Gel, 4-20%, 15 wells; Catalog No: M42015).
Controls for Gel Analysis
A: 5 uL whole blood+80 uL TUS, 10 uL 4?LDS, 1 uL TCEP
B: 1 uL whole blood+80 uL TUS, 10 uL 4?LDS, 1 uL TCEP
C: 2 uL 20 mg/mL proteinase K++80 uL TUS, 10 uL 4?LDS, 1 uL TCEP
The gel was run in at 19 watts constant power until the tracking dye reached the bottom; the gel was rinsed with water and stained with Coomassie Blue (Thermo fisher catalog #24620, PageBlue Protein Staining Solution), destained with water, and photographed using a lightbox (transllumination). Images were analyzed with Capture NX software (Nikon).
(76) Loading of samples in
(77) TABLE-US-00003 Lane Sample, 20 uL of TUS solubilized protein/agarose, except as noted 1 None 2 10 uL of Lonza catalog # 193837 quadcolor protein marker 3 Run 1, disc incubated with SarE buffer 4 Run 2, disc incubated with STCP buffer 5 Run 4, disc deproteinized 4 min @220 V 6 Run 5, disc deproteinized 8 min @220 V 7 Run 6, disc deproteinized with 8 min @220 V + TCEP 8 Run 7, disc deproteinized with 12 min @220 V + TCEP 9 10 uL loading control B, equivalent to ~0.11 uL of whole blood 10 20 uL of loading control C, ~9 ug proteinase K 11 10 uL of Lonza catalog # 193837 quadcolor protein marker 12 10 uL of Run 3, disc incubated with SDS 13 None 14 5 uL of Run8, disc with no deproteinization 15 5 uL of loading control A, ~0.26 uL whole blood
(78)
(79) Lane 9 is ?0.1 uL untreated whole blood. Lane 14 is a whole blood/agarose disc with no treatment (gel loading equivalent to ?0.26 uL of whole blood).
(80) Lanes 3 and 4 show discs deproteinized by incubation with detergent and proteinaseK only (no electrophoretic removal of protein); the proteinase K mixture used for digestion by itself is in lane 10.
(81) Lanes 5-8 show disc deproteinized with electrophoresis.
(82)
(83) Results
(84)
(85) It is important to recognize that the electrophoretic conditions used for deproteinization were similar to those used for the Trial 1 sample in Example 1. As shown above in Example 1, the DNA from the unrestricted electrophoretically deproteinized samples (TE samples in
(86) Electrophoretic Sample Preparation
(87) In some embodiments, a method is provided for sample preparation which decreases the cost by physically subtracting human DNA from the sample before library construction. In such embodiments, up to 90% or more of the nucleic acid from the sample may be removed, resulting a reduction in the amount of sequencing per sample required (and therefore, decreasing the sequencing cost per sample proportionally). Accordingly, in some embodiments provide a fast and scalable method for subtraction of WBC DNA from whole blood samples.
(88) Rapid Purification of HMW DNA from Whole Blood Using an Electrophoretic Lysis Method
(89)
(90) Gel materials may include starch, agar, agarose, and polyacrylamide, although many other matrices with similar properties may also be used. In some embodiments, the gel material is agarose.
(91) In general, electrophoresis buffers that are commonly used for DNA and protein electrophoresis within the pH range of 7-9 may be used. For specific embodiments (described below) that involve enzymatic processing of samples, buffers with specific pHs and ionic compositions may be used.
(92) For embodiments using pre-filled gel cassettes, buffers that have high buffer capacity at relatively low ionic strength may be used. In this aspect, the buffers (and buffer design principles) described by Liu, Li, and Sommer (Anal. Biochem. 1999, v270, pp 112-122) are among the formulations.
(93) The electrophoresis buffer may have EDTA as a chelating agent, which may limit the nuclease activity during the purification process. In some embodiments, high concentrations of EDTA (5-50 mM) may be beneficial to quickly kill nucleases in cell lysates, however, at least 1 mM EDTA may be used in the electrophoresis buffers. In some embodiments, less than 1 mM EDTA may be used.
(94) To apply an electrophoretic voltage across the cassette, electrodes (4) may be inserted into the buffer chambers on either side of the gel. The electrodes may be disposable components of the cassette, or they may be reusable parts of an instrument designed to hold and run the disposable cassettes. Examples can be found in U.S. Pat. Nos. 8,361,298 and 8,361,299, as well as U.S. Patent Publication Nos. 2014/0284213 and 2015/0101932, all of which are herein incorporated by reference in their entireties.
(95) A sample may include a liquid suspension of cells. The cell suspension is loaded into the sample well (6) as shown in
(96) The sample composition may be configured to be isoosmotic for the cell sample so that lysis of the cells does not occur prior to electrophoretic induction of lysis. In addition, the ionic strength of the sample may be kept low so that electrophoretic heating can be kept to a minimum during processing. In some embodiments, the ionic strength of the sample may be approximately equal to that of the electrophoresis buffer.
(97) Prior to initiating the purification process, lysis reagents (8,
(98) In some embodiments, the lysis reagents may be added after sample loading and just prior to initiation of the electrophoresis process, so that the lysis reagents will not have time to diffuse across the gel barrier between the electrophoresis buffer chamber and the sample well. This order of processing helps ensure that sample lysis and electrophoretic purification of the HMW DNA occur in a rapid, synchronous fashion.
(99) To initiate the purification process, electrophoresis voltage is applied across the cassette as shown in
(100) As electrophoresis continues, the extremely HMW DNA molecules accumulate and become entangled in the wall of the sample well distal to the (?) electrode. The HMW DNA molecules are too large to enter the gel under continuous or alternating field conditions, and remain on the sample well wall. Under the conditions used for the examples below, the entangled, immobilized HMW DNA molecules appear to be >2 megabases in size, as estimated by analytical pulsed field gel electrophoresis.
(101) During the electrophoretic lysis process, all other charged species, including cellular proteins, lysis reagents, lipids in detergent micelles, and salts are electrophoresed rapidly out of the sample well. Most will be moved to the (+) electrode as complexes with anionic lysis detergents such as SDS, as shown in
(102) There are several ways to recover the purified HMW DNA fraction, including the method shown in
(103) Processes and Devices for Automated Electrophoretic DNA Extraction and Enzymatic Processing
(104) The disposable cassette of
(105)
(106) The enzymatic treatment shown in
(107) In some embodiments, reagents for release of immobilized HMW DNA from the sample well include non-specific double-stranded endonucleases, such as DNase I in the presence of Mn++ ions, and Fragmentase (New England Biolabs). Other reagents may also be used, such as transposases that have been loaded with synthetic oligonucleotide adapter duplexes, examples of which include the mutant Tn5 transposase, Nextera (Illumina), the mutant Tn5 transposase produced by Kapa Biosystems, and the mutant Mu transposase reagent, MuSeek, (Thermo Life). Other reagents include restriction endonucleases. When using restriction endonucleases, digestion conditions may only allow a very limited extent of digestion, so that the released DNA products are extremely large. Especially preferred DNA cleavage reagents are restriction enzymes such as CviKI-1 (New England Biolabs), which have very low sequence specificity and are insensitive to the methylation status of the genomic DNA. Limited digestion by CviKI-1 and similar low specificity enzymes may produce a nearly random set of cleavage sites.
(108) The schematic workflow of
(109) It should be noted that HMW DNA, when immobilized on the surface of an agarose sample well by electrophoretic entanglement, can be used to perform a variety of other enzymatic and chemical modification reactions on the HMW DNA. In general, the reversible immobilization of the HMW DNA on the sample well wall provides a convenient aqueous support that is well suited to serial enzymatic treatments of the DNA. In principle, any set of treatments that does not reduce the size of the DNA so much that it becomes disentangled from the support can be performed by exchanging the reagent mixture in the sample well. In some embodiments, electrophoretic purification may be performed between reaction steps to remove residual charged reaction components out of the sample well and into the separation gel.
(110) As a non-limiting example, fluorescent labeling of DNA at sequence-specific nicking endonuclease sites, a process used in optical mapping of HMW DNA (for instance, see the Bionano Genomics workflow), may be an alternative processing workflow. After electrophoretic purification of the HMW DNA, as described above and in
(111) The schematic workflow of
(112) As shown in
(113) Improved resolution between fast moving nucleic acid fractions and SDS-protein complexes in multi-analyte applications of the cassette between can be achieved using a two-part separation gel. For instance, the upper portion of the gel column, including the region containing the reagent and sample wells can comprise a relatively low concentration agarose gel, for instance about 0.75% or lower, while the lower half of the gel can comprise a higher concentration agarose gel, for instance about 2% or higher, which will allow better discrimination in mobility between the detergent-protein complexes and the lower molecular weight nucleic acid fractions.
(114) Improved resolution in multi-analyte applications of the cassette can also be achieved by the use of electrophoretic stacking, also known as isotachophoresis. In such embodiments, embodiment cassette, such as the cassette shown in
(115) In cases where preparation of protein analytes is important, the lysis reagent may comprise chemically degradable or unstable anionic detergents. Examples of such detergents include RapiGest (Waters Corp.), and MaSDeS (Chang et al., J. Proteome Res. Vol 14, pp 1587, 2015). These detergents are inactivated by incubation of the detergent-protein fractions under acid conditions (for example 10% formic acid in 25 mM ammonium bicarbonate). Such cleavable detergents may be very useful in streamlining sample prep workflows for protein mass spectrometry.
(116) After elution and removal of the RNA and protein fractions from the cassette, the sample well and reagent well can be refilled with reagents suitable for controlled fragmentation of the HMW DNA that was left behind on the wall of the sample well. After fragmentation, the reagent well may be filled with a purification reagent, such as, for example, a buffered solution of SDS at a concentration between about 0.1% and about 10%, and a second round of purification electrophoresis may be performed to move the fragmented and purified genomic DNA out of the sample well (stage 3,
(117) While the multi-analyte purification shown in
(118) Cassette with Lysing Reagent Sample Well
(119)
(120) In some embodiments, as shown in
(121) Upon completion of the lysing process, the following is added, sequentially, to the sample well (see
In some embodiments, these incubations are performed sequentially (as indicated), however in other embodiments, the incubations may be performed concurrently and/or not all of these incubations may be used.
(122) As shown in
Other Examples According to Some Embodiments of the Disclosure
Example: Electrophoretic Extraction of Genomic DNA from Whole Goat Blood
(123) A 2% agarose gel (SeaKem Gold, Lonza) was cast in 10 mM Tris-HCl, pH 7.6. The gel was approximately 11 mm thick, with sample wells 1.5 mm thick?7 mm deep?11 mm wide. The gel was placed in a minigel box containing 0.5?KBB buffer (1?KBB=50 mM Tris, 37 mM TAPS, 0.08 mM EDTA, pH 8.7) with additional 5 mM EDTA and 1% SDS. The gel was immersed so that the surface of the gel was not submerged below the buffer (so that the sample well contents were not in fluid contact with the buffer in the reservoir); the buffer covered about 75% of the height of the gel at its edges. After the gel was placed in contact with the electrophoresis buffer, the samples were loaded as quickly as possible and the electrophoresis power was activated. Samples in each lane were 20 ul fresh whole goat blood (anticoatulated with ACD, Lampire Biologicals) mixed with 80 ul of TBSEG (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 5 mM EDTA, 10% glycerol).
(124)
(125) Lane 1Generic restriction buffer only
(126) Lane 2Generic restriction buffer+50 units of HindIII (NEB)
(127) Lane 3Generic restriction buffer+50 units of SalI (NEB)
(128) Lane 40.5?KBB (electrophoresis buffer without SDS)
(129) Generic restriction buffer is 50 mM Tris-HCl, pH 7.6, 100 mM NaCl, 10 mM MgCl2, 100 ug/ml hydroxypropyl cyclodextrin.
(130) After incubation of gel at room temp for 15 minutes, the gel was immersed (but not submerged) in 0.5?KBB and electrophoresed 10V/cm for 15 minutes. The gel was restained in ethidium bromide as before and the resulting image is shown in
Example: Rapid Electrophoretic Preparation of HMW DNA from Goat WBCs Followed by in-Well Reaction of Extracted DNA with Mutant Tn5 Transposase
(131) Preparation of Agarose Gel:
(132) An agarose solution was prepared by adding to 4 grams of SeaKem gold agarose (Lonza) 385 grams of water and 10 mL of 1M Tris Acetate, pH 7.5 and 80 uL of 0.5M disodium EDTA; the solution was microwaved until the agarose was fully dissolved, and the solution was then kept in a water bath at 70? C.
(133) A comb that creates two rows of 16 wells was made by taking two well formers from a Galileo 80-1214-C16-1.5 comb and a 0.75 mm thick piece of plastic (
(134) The comb assembly was placed in a casting tray for a Galileo 80-1214 gel box, and 80 grams of agarose was added; after gelation, the combs were removed, and the gel was submerged in buffer (25 mM Tris Acetate, pH 7.5; 0.1 mM Na.sub.2EDTA).
(135) The resulting gel (
(136) The wells closest to the (+) electrode are the sample wells, and the wells closest to the (?) electrode are the reagent wells.
(137) Preparation of White Blood Cells (WBCs) from goat whole blood:
(138) Note: all steps at room temperature
(139) To 12 mL whole blood (Goat with ACD anticoagulant, Lampire) 36 mL Red Blood Cell (RBC) lysis buffer (155 mM Ammonium Cl; 10 mM NaHCO.sub.3; 1 mM Na.sub.2EDTA) was added. The solution was rocked for 3 minutes and white cells pelleted by centrifugation 400?g 4 minutes.
(140) The pink supernatant was decanted, and the red pellet resuspended by vortexing in 25 mL of RBC lysis buffer; after a second spin and decantation, the pink pellet was resuspended in 900 uL RBC lysis buffer.
(141) Measurement of WBC DNA Concentration by Qubit:
(142) A Qubit HS assay (Life Technologies) was used.
(143) WBCs were lysed by mixing 40 uL of WBCs with 160 uL of TE/50 mM NaCl/1% SDS followed by incubation at 65? C. for 3 minutes. TE (800 uL) was added, and after vortexing to reduce viscosity, 1 or 2.5 uL of the DNA was added to 199 uL of Qubit reagent, per the vendor's protocol. Using this method, the concentration of DNA in the WBC solution was estimated to be 453 ng/uL
(144) Loading the Gel with WBCs and Lysis Solution:
(145) To each reagent well in the agarose gel (
(146) High load WBC samples were prepared by mixing:
(147) 100 uL of isolated WBCs at 453 ng/ul in RBC lysis buffer.
(148) 300 uL of TBSEG (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1 mM EDTA, 5% glycerol).
(149) 5 uL of a solution with 2 mg/mL each bromophenol blue and phenol red.
(150) 20 ul of the High-load WBC samples in TBSEG (equivalent to 2,000 ng of DNA) were loaded in sample wells 3-9.
(151) Low-load WBC samples were prepared by mixing:
(152) 40 ul of isolated WBCs at 453 ng/ul in RBC lysis buffer.
(153) 300 uL of TBSEG.
(154) 5 uL of a solution with 2 mg/mL each bromophenol blue and phenol red.
(155) 17 ul of the Low-load WBC samples in TBSEG (equivalent to 800 ng DNA per well) were loaded in sample wells 9-16.
(156) To extract and purify the WBC DNA, the gel was run for 74 minutes @100V DC.
(157) In-well processing of electrophoretically extracted DNA with adapter-loaded mutant Tn5 transposase:
(158) The gel was removed from the tank; excess buffer was poured off, and the gel was placed on a flat plastic surface.
(159) To all 32 wells, 40 uL of Transposase Buffer (TB, 25 mM Tris Ac pH 7.5; 20 mM MnCl) was added.
(160) 1 mL of a modified transposase buffer (mTB) was prepared:
(161) TABLE-US-00004 Reagent Final concentration 735 uL H2O na 25 uL 1M TrisAc pH 7.5 25 mM 170 uL 117 mM MnCl 20 mM 50 uL Glycerol 5% 10 uL dye, 2 mg/mL BPB and Phenol Red 20 ug/mL 10 uL of 100 mg/mL Hydroxypropyl cyclodextrin 1 mg/ml (Acros, catalog # 297560250)
(162) As shown in the table below, sample wells were filled with 40 uL of modified transposase buffer, or 40 uL of 1?HMW buffer (Kapa Biosystems; 1?HMW buffer is 25 mM Tris Acetate pH7.5; 15% DMSO) or 25 uL of mTB or 1?HMW+mutant Tn5 transposase pre-loaded with synthetic duplex DNA adapters (Kapa Biosystems):
(163) The table below shows what was loaded into the sample wells for the enzymatic digestion step.
(164) TB is transposase buffer; all wells were filled with this buffer. Wells that received TB buffer only, with no subsequent additions, are labeled TB.
(165) After adding the TB buffer to all wells, some wells, marked mTB or HMW, received modified transposase buffer or HMW buffer containing a mutant Tn5 transposase (lanes marked TnP, 180 ng/ul, Kapa Biosystems). Prior to loading, the transposase had been preincubated with double-stranded sequencing adapters carrying transposase binding sites to generate fully loaded transposasomes, which are competent for in vitro transposition of the adapters into white cell HMW DNA targets.
(166) TABLE-US-00005 ng Sample WBC TnP, Well DNA Buffer uL 1 0 TB 0 2 0 TB 0 3 2,000 mTB 0 4 2,000 mTB 4 5 2,000 TB 0 6 2,000 HMW 0 7 2,000 HMW 4 8 2,000 TB 0 9 800 mTB 0 10 800 mTB 4 11 800 TB 0 12 800 HMW 0 13 800 HMW 4 14 800 TB 0 15 800 HMW 2 16 800 HMW 0.8 Sample Well Loading
(167) The loaded gel was incubated for one hour at room temperature.
(168) Standards were added to the sample wells in lanes 1 and 2 (lane 1, 5 uL of NEB 1 kb extend ladder (catalog # N3239S); lane 2, a slice of NEB lambda ladder (catalog # N03405).
(169) The gel was run for 30V for 30 minutes and then 100V for 90 minutes, and then stained with Ethidium Bromide and photographed with UV transllumination.
(170) Results: Transposase Activity on DNA from WBCs Loaded in a Gel
(171) Results are shown in
(172) (
(173) This demonstrates that the purified HMW DNA that was trapped on the wall of the well is accessible and readily modified by enzymatic reagents that can be loaded into the sample well following electrophoretic purification. This also demonstrates compatibility with standard NGS library preparation workflows that utilize transposase-mediated adapter addition and fragmentation reactions.
Example: Rapid Electrophoretic Workflow for Production of Pacific Biosciences SMRTbell? Sequencing Libraries Directly from Mammalian White Blood Cells
(174) A cassette of the type shown in
(175) Goat WBCs were prepared from whole blood by selective lysis of the RBCs as described in the previous example (see, e.g., paras. 127-133).
(176) Purified goat WBCs (containing 12 ug of genomic DNA) were loaded into the empty sample well of the cassette in RBC lysis buffer (see, e.g., para. 136). Total volume of the loaded sample was 80 ul. Lysis buffer (see, e.g., para. 135), 320 ul, was added to the empty reagent well. Cell lysis and DNA purification was carried out by electrophoresis in a SageELF instrument (Sage Science, Inc.) using the separation electrodes at 100V for 40 minutes.
(177) After purification electrophoresis, the reagent and sample wells were emptied. The reagent well was reloaded with 320 ul of Tris-HCl, pH 8.0, 10 mM MnCl.sub.2. The sample well was reloaded with the same buffer containing 0.72 ug of mutant Tn5 transposase (Kapa Biosystems), that had been preloaded with a hairpin adapter that carries the Tn5 transposase recognition sequence in the duplex region, and also carries the PacBio sequencing primer binding site in the single-stranded loop of the hairpin:
(178) TABLE-US-00006 5CTGTCTCTTATACACATCTTTTTCCTCCTCCTCCGTTGTTGTTGTTA GATGTGTATAAGAGACAG3/
(179) The cassette was incubated at 37 C for 30 minutes to allow the transposition reaction with the immobilized goat genomic DNA.
(180) After transposition, the reagent and sample wells were emptied, the reagent well was refilled with 50 mM Tris-HCl, pH 8.0, 10 mM MgCl.sub.2. The sample well was filled with 70 ul of the same buffer additionally containing 0.1 mM each dATP, dTTP, dCTP, dGTP, 0.06 mM NAD+, 3 units T4 DNA polymerase (New England Biolabs), and 10 units E. coli DNA ligase. The cassette was incubated at 37 C for 30 minutes to allow gap filling and nick ligation of the gaps created by transposition of the SMRTbell? hairpin adapters into the goat genomic DNA.
(181) After gap closure, 400 ng of trypsin was added to the sample well in 3 ul in order to inactivate the T4 polymerase and ligase. The contents of the sample well were mixed by pipetting and the cassette was incubated for 30 minutes at 37 C. To terminate the trypsin digestion, 1 ug of soybean trypsin inhibitor was added in a 1 ul volume. The contents of the sample well were mixed by pipetting and the cassette was incubated for an additional 15 minutes at 37 C.
(182) To remove, unreacted adapters, and unreacted goat genomic DNA, 30 units of T5 exonuclease (New England Biolabs) was added to the sample well (in a 3 ul volume), and the sample well contents were mixed by pipetting. Exonuclease digestion was carried out for 30 minutes at 37 C.
(183) After exonuclease digestion, the reagent well was emptied and refilled with lysis buffer. The cassette was electrophoresed in separation mode in a SageELF instrument using continuous 60V electophoretic field for 1 hour, followed by a 2 hour period of pulsed field electrophoresis using the waveform for resolving 5-430 kb DNA, described in the Pippin Pulse User Manual (http://www.sagescience.com/product-support/pippin-pulse-support/). After separation electrophoresis, electroelution is carried out in the ELF instrument for 45 minutes using a voltage of 50V. At the end of elution, a 25V field is applied in the reverse direction for 5 seconds to help release the eluted DNA from the ultrafiltration membrane of the elution modules. The finished SMRTbell? libraries are recovered from the elution modules in electrophoresis buffer.
(184) Any and all references to publications or other documents, including but not limited to, patents, patent applications, articles, webpages, books, etc., presented anywhere in the present application, are herein incorporated by reference in their entirety.
(185) Although a few variations have been described in detail above, other modifications are possible. For example, any logic flows depicted in the accompanying figures and/or described herein do not require the particular order shown, or sequential order, to achieve desirable results. Other implementations may be within the scope of at least some of the following exemplary claims.
(186) As noted elsewhere, these embodiments have been described for illustrative purposes only and are not limiting. Other embodiments are possible and are covered by the disclosure, which will be apparent from the teachings contained herein. Thus, the breadth and scope of the disclosure should not be limited by any of the above-described embodiments but should be defined only in accordance with claims supported by the present disclosure and their equivalents. Moreover, embodiments of the subject disclosure may include methods, systems and apparatuses/devices which may further include any and all elements from any other disclosed methods, systems, and devices, including any and all elements corresponding to isolating nucleic acid from a biological sample (e.g., containing nucleic acid and non-nucleic acid elements). For example, in some embodiments systems, devices and methods. In other words, elements from one or another disclosed embodiments may be interchangeable with elements from other disclosed embodiments. In addition, one or more features/elements of disclosed embodiments may be removed and still result in patentable subject matter (and thus, resulting in yet more embodiments of the subject disclosure). Also, some embodiments correspond to systems, devices and methods which specifically lack one and/or another element, structure, and/or steps (as applicable), as compared to teachings of the prior art, and therefore represent patentable subject matter and are distinguishable therefrom (i.e. claims directed to such embodiments may contain negative limitations to note the lack of one or more features prior art teachings).
(187) When describing the nucleic acid processing, terms such as linked, bound, connect, attach, interact, and so forth should be understood as referring to linkages that result in the joining of the elements being referred to, whether such joining is permanent or potentially reversible. These terms should not be read as requiring the formation of covalent bonds, although covalent-type bond might be formed.
(188) All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
(189) The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
(190) The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with and/or should be construed in the same fashion, i.e., one or more of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
(191) As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
(192) As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B, or, equivalently at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
(193) In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, composed of, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.