Method for measuring quality of therapeutic cell through real-time glutathione measurement

Abstract

The present invention provides a method of measuring the quality of therapeutic cells through real-time glutathione monitoring.

Claims

1. A method of measuring cell quality, comprising: isolating desired cells; measuring a glutathione (GSH) level in the isolated cells; and determining cell quality according to the glutathione level, wherein determining cell quality according to the glutathione level is performed according to one or more selected from the group consisting of the following evaluation parameters: i) glutathione mean or median level (GM) of cells; ii) glutathione heterogeneity (GH) of cells; iii) glutathione regeneration capacity (GRC) of cells; and iv) oxidative stress resistance capacity (ORC), wherein the GM is calculated as the mean or median value of a cellular FreSH-tracer ratio (FR) or F510, the GH is calculated as the coefficient of variation or the robust coefficient of variation of cellular FR or F510, the GRC is a value obtained by real-time monitoring of FR or F510 after living cells are treated with an oxidizing agent, and is calculated by dividing a value obtained by subtracting a second area under the curve (AUC) of a group treated with a second oxidizing agent from a first AUC of a group treated with a first oxidizing agent by a value obtained by subtracting the second AUC of the group treated with the second oxidizing agent from a third AUC of a naive control and multiplying the resulting value by 100, and the ORC is a value of cell counts with the variation in GSH expression, obtained by comparing the GSH levels quantified after living cells are treated with a first oxidizing agent with the GSH levels quantified in control cells which are not treated with an oxidizing agent or in control cells which have not been treated with an oxidizing agent yet, and wherein the measurement of a glutathione level is performed by contacting the cells with a compound of any of Formulae B-4, B-5, B-6, B-7, and B-8 below: ##STR00013## ##STR00014##

2. The method according to claim 1, wherein FR is a ratio between a fluorescence intensity (F510) at 430-550 nm and a fluorescence intensity (F580) at 550-680 nm.

3. The method according to claim 1, wherein the quality of cells is determined as good when GM of cells increases before or after treatment with oxidative stress.

4. The method according to claim 1, wherein the quality of cells is determined as good when GH of cells decreases before or after treatment with oxidative stress.

5. The method according to claim 1, wherein the quality of cells is determined as good when GRC of cells increases.

6. The method according to claim 1, wherein, in terms of ORC, the quality of cells is determined as good when there are a small number of cells with lower GSH levels quantified after treatment with an oxidizing agent, compared with the GSH levels quantified in control cells which are not treated with an oxidizing agent or have not been treated with an oxidizing agent yet, or there are a large number of cells with higher or the same GSH levels quantified after treatment with an oxidizing agent, compared with the GSH levels quantified in control cells which are not treated with an oxidizing agent or have not been treated with an oxidizing agent yet.

7. The method according to claim 1, wherein the first oxidizing agent is selected from hydroperoxides; thiol oxidizing agents; glutathione reductase inhibitors; thioredoxin inhibitors; mitochondrial electron transport chain inhibitors; NADPH oxidase activators; system x.sup.−.sub.c inhibitors; inducers for reducing GPX4 protein and CoQ10 levels; glutamate-cysteine ligase (GCL) inhibitors; GSH reduction inducers; DPI2, cisplatin, cysteinase, statin, iron ammonium citrate, trigonelline, carbon tetrachloride, silica-based nanoparticles and specific heat plasma.

8. The method according to claim 1, wherein the second oxidizing agent includes maleimide, 4-maleimidobutyric acid, 3-maleimidopropionic acid, ethylmaleimide, N-ethylmaleimide, iodoacetamide, 5,5′-dithiobis(2-nitrobenzoic acid), or iodoacetamidopropionic acid.

9. The method according to claim 1, wherein the desired cells are any one type of cell line selected from the group consisting of adult stem cells, embryonic stem cells and induced pluripotent stem cells; any one type of immune cells selected from the group consisting of dendritic cells, natural killer cells, T cells, B cells, regulatory T cells (Treg cells), natural killer T cells, innate lymphoid cells, macrophages, granulocytes, chimeric antigen receptor-T (CAR-T) cells, lymphokine-activated killer (LAK) cells and cytokine induced killer (CIK) cells; any one type of somatic cells selected from the group consisting of fibroblasts, chondrocytes, synovial cells, keratinocytes, adipocytes, osteoblasts, osteoclasts and peripheral blood mononuclear cells; any one type of cell line used in production of a protein agent selected from the group consisting of CHO cells, NS0 cells, Sp2/0 cells, BHK cells, C127 cells, HEK293 cells, HT-1080 cells, and PER.C6 cells; or any one type of a human microbiome selected from the group consisting of microorganisms originating from the mouth, nasal cavity, lung, skin, gastric intestinal tract and urinary tract of a human or animal.

10. The method according to claim 9, wherein the T cells are not regulatory T cells (Treg cells).

11. The method according to claim 1, wherein the first oxidizing agent is selected from H.sub.2O.sub.2, tert-butyl peroxide, diamide, GSSG (oxidized GSH), 5,5′-dithiobis(2-nitrobenzoic acid), maleimide, N-ethyl maleimide, 4-maleimidobutyric acid, 3-maleimidopropionic acid, iodoacetamide, bis-chloroethylnitrozourea, PX-12, antimycin A, rotenone, oligomycin, carbonyl cyanide m-chlorophenyl hydrazine, phorbol 12-myristate 13-acetate, 1S,3R-RAS-selective lethal 3 (1S,3R-RSL3), DPI19, DPI18, DPI17, DPI13, DPI12, DPI10 (ML210), DPI7 (ML162), altretamine, erastin, sulfasalazine, sorafenib, glutamate, piperazine erastin, imidazole ketone erastin, an erastin analog, ferroptosis inducer 56 (FIN56), caspase-independent lethal 56 (CIL56), endoperoxide (FINO.sub.2), buthionine-(S,R)-sulfoximine, diethyl maleate, DPI2, cisplatin, cysteinase, statin, iron ammonium citrate, trigonelline, carbon tetrachloride, silica-based nanoparticles and specific heat plasma.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 illustrates a reaction scheme in which FreSH-Tracer of the present invention reversibly reacts with glutathione (GSH) (FIG. 1A), a result of measuring the reversible reaction of FreSH-Tracer by UV-visible absorption spectrometry (FIG. 1B), a result of monitoring the fluorescence emission spectra of FreSH-Tracer, generated by excitation at 430 nm and 520 nm, respectively, at 510 nm (F510) and 580 nm (F580), respectively (FIG. 1C), a graph showing the result of FIG. 1C (FIG. 1D), and an emission ratio which is calculated by dividing the F510 value by the F580 value, i.e., (F510/F580 (FR)) and adjusting the resulting value to an increased concentration of GSH (FIG. 1E).

(2) FIG. 2 illustrates graphs illustrating a step for FACS sorting of hBM-MSCs by F510/F580 (FR).

(3) FIG. 3 illustrates graphs showing that FreSH-Tracer can be removed from cells, in which FIG. 3A illustrates a result of FACS analysis over time after FreSH-Tracer-stained cells are washed and then cultured in a new culture medium, and FIG. 3B illustrates a graph obtained by quantifying the result.

(4) FIG. 4 illustrates the CFU-F of hBM-MSCs sorted by FACS based on FreSH-Tracer (FIG. 4A) and a result of measuring migration capacities by SDF-1α and PDGF-AA (FIG. 4B).

(5) FIGS. 5A to 5F illustrate the anti-aging activity of fibroblasts sorted by FreSH-Tracer.

(6) FIG. 6 illustrates the activity of dendritic cells sorted by FreSH-Tracer.

(7) FIG. 7 illustrates the activity of Treg cells in T cells sorted by FreSH-Tracer.

(8) FIG. 8 schematically illustrates four glutathione parameters for evaluating the quality of therapeutic cells, deduced formulas, and the resulting examples.

(9) FIG. 9 illustrates a result of CFU-F analysis according to subculture of hBM-MSCs (FIG. 9A) and migration capacity by SDF-1α and PDGF-AA (FIG. 9B).

(10) FIGS. 10A to 10C illustrate results of analyzing GM and GH based on FreSH-Tracer, GolgiFreSH-Tracer, or MitoFreSH-Tracer according to subculture of hBM-MSCs.

(11) FIG. 11 illustrates results of analyzing GRC based on FreSH-Tracer, GolgiFreSH-Tracer or MitoFreSH-Tracer according to subculture of hBM-MSCs.

(12) FIG. 12 illustrates results of analyzing GM and GH based on MitoFreSH-Tracer after rat bone marrow cells are isolated according to lineage.

(13) FIG. 13 illustrates results of analyzing CFU-F (FIG. 13A) or a cell migration capacity by PDGF-AA (FIG. 13B) after hES-MSCs sorted by FACS using FreSH-Tracer (FIG. 13A) or hES-MSCs cultured without sorting (FIG. 13B) are treated with BSO or GSH-EE.

(14) FIGS. 14A to 14C illustrate results of analyzing GRC based on FreSH-Tracer after hUC-MSCs are subcultured three times in a culture medium containing AA2G.

(15) FIGS. 15A and 15B illustrate results of analyzing ORC based on FreSH-Tracer after hUC-MSCs are subcultured three times in a culture medium containing AA2G.

(16) FIG. 16A is image showing the result of a CFU-F assay after hUC-MSCs are treated with 125 μg/mL of AA2G (left image) or 250 μg/mL of AA2G (right image) for three days.

(17) FIG. 16B is a graph showing the result of a CFU-F assay (n=3) after hUC-MSCs are treated with 125 or 250 μg/mL of AA2G for three days.

(18) FIG. 17A illustrates images showing migration capacity by PDGF-AA after hUC-MSCs are treated with 125 or 250 μg/mL of AA2G for three days.

(19) FIG. 17B illustrates a graph showing a result of analyzing migration capacity (n=3) by PDGF-AA after hUC-MSCs are treated with 125 or 250 μg/mL of AA2G for three days.

(20) FIG. 18A illustrates a graph showing an effect of reducing the proliferation capacity (n=3) of T cells after hUC-MSCs are treated with 125 or 250 μg/mL of AA2G for three days.

(21) FIG. 18B illustrates a graph showing an effect of reducing the differentiation capacity (n=3) of T cells after hUC-MSCs are treated with 125 or 250 μg/mL of AA2G for three days.

(22) FIG. 18C illustrates a graph showing an effect of promoting the differentiation (n=3) of Treg cells after hUC-MSCs are treated with 125 or 250 μg/mL of AA2G for three days.

(23) FIG. 19 illustrates a graph showing a result of CFU-F assay (n=3) after hUC-MSCs are treated with 0.1, 0.25 and 0.5 mM γ-glutamyl cysteine (GGC) for 2 hours.

(24) FIG. 20A is a graph showing a result of analyzing migration capacity (n=3) by SDF1α and PDGF-AA without treatment of hUC-MSCs with GGC. STI571 is used as a PDGFR kinase inhibitor.

(25) FIG. 20B is a graph showing a result of analyzing migration capacity (n=3) by SDF1α and PDGF-AA after hUC-MSCs are treated with 0.1 mM GGC. STI571 is used as a PDGFR kinase inhibitor.

(26) FIG. 20C is a SDF1α showing a result of analyzing migration capacity (n=3) by SDF1α and PDGF-AA after hUC-MSCs are treated with 0.25 mM GGC. STI571 is used as a PDGFR kinase inhibitor.

(27) FIG. 21 is a diagram illustrating procedures of an experiment of screening for a material for regulating GSH of cells through GM, GH, and ORC analyses.

(28) FIGS. 22A and 22B illustrate results of analyzing ORC of liproxstatin-1 in hUC-MSCs.

(29) FIGS. 23A to 23C illustrate results of analyzing GM, GH and ORC of vitamin D3 in hUC-MSCs.

(30) FIG. 24 illustrates results of analyzing GM, GH and ORC of vitamin E in hUC-MSCs.

(31) FIGS. 25A to 25E illustrate results of analyzing GM, GH and ORC of a flavonoid in hUC-MSCs, where

(32) FIG. 25A illustrates results of analyzing GM, GH and ORC of baicalin in hUC-MSCs,

(33) FIG. 25B illustrates results of analyzing GM, GH and ORC of baicalein in hUC-MSCs,

(34) FIG. 25C illustrates results of analyzing GM, GH and ORC of luteolin in hUC-MSCs,

(35) FIG. 25D illustrates results of analyzing GM, GH and ORC of quercetin in hUC-MSCs, and

(36) FIG. 25E illustrates results of analyzing GM, GH and ORC of butein in hUC-MSCs.

(37) FIGS. 26A to 26F illustrate results of analyzing GM, GH and ORC of plant extracts in hUC-MSCs, where

(38) FIG. 26A illustrates results of analyzing GM, GH and ORC of a flower extract of Chrysanthemum morifolium Ramat in hUC-MSCs,

(39) FIG. 26B illustrates results of analyzing GM, GH and ORC of a leaf extract of Cedela sinensis A. Juss in hUC-MSCs,

(40) FIG. 26C illustrates results of analyzing GM, GH and ORC of an extract of Oenothera stricta Ledeb. in hUC-MSCs,

(41) FIG. 26D illustrates results of analyzing GM, GH and ORC of an extract of Equisetum arvense L. in hUC-MSCs,

(42) FIG. 26E illustrates results of analyzing GM, GH and ORC of a leaf extract of Ipomoea batatas in hUC-MSCs, and

(43) FIG. 26F illustrates results of analyzing GM, GH and ORC of a tomato extract (LYCOBEADS®) in hUC-MSCs.

(44) FIG. 27 is a graph showing a result of CFU-F assay (n=3) after hUC-MSCs are treated with 0.2, 1, 2 and 4 μM ferrostatin-1 and 0.1, 0.5, 1 and 2 μM liproxstatin-1 for 24 hours.

(45) FIG. 28A is a graph showing an effect of reducing the proliferation capacity (n=3) of T cells after hUC-MSCs are treated with 1 μM ferrostatin-1 for 24 hours, or treated with 0.2 mM GGC or 2 mM GSH-EE for 2 hours.

(46) FIG. 28B is a graph showing an effect of reducing the differentiation capacity (n=3) of T cells after hUC-MSCs are treated with 1 μM ferrostatin-1 for 24 hours, or treated with 0.2 mM GGC or 2 mM GSH-EE for 2 hours.

(47) FIG. 28C is a graph showing an effect of promoting the differentiation (n=3) of Treg cells after hUC-MSCs are treated with 1 μM ferrostatin-1 for 24 hours, or treated with 0.2 mM GGC or 2 mM GSH-EE for 2 hours.

(48) FIG. 29 illustrates histograms obtained by flow cytometry for mGSH expression levels in cells at passage 4, 7 and 15.

(49) FIG. 30 illustrates histograms obtained by confocal imaging for mGSH expression levels in cells at passage 4, 7 and 15.

(50) FIG. 31 illustrates distribution patterns of mGSH.sup.High cells and mGSH.sup.Low cells according to a passage number of stem cells and an RSL3 concentration.

(51) FIG. 32 illustrates the lipid oxide dependency of the effect of treatment of MSCs with RSL3, confirmed through ferrostatin-1 treatment.

(52) FIG. 33 illustrates a result of comparing CD146 surface expression of mGSH.sup.High and mGSH.sup.Low cells after RLS3 treatment.

(53) FIG. 34 illustrates distribution patterns of mGSH.sup.High and mGSH.sup.Low cells according to a passage number of fibroblasts.

MODES OF THE INVENTION

(54) By using FreSH-Tracer and evaluation parameters according to the present invention in real-time monitoring of an intracellular GSH level in living stem cells and differentiation of cells according to a GSH level, the quality of a cell therapeutic agent may be measured, and its quality may be evaluated.

EXAMPLES

(55) Hereinafter, the present invention will be described in further detail with reference to examples. The examples are merely provided to more fully describe the present invention, and it will be obvious to those of ordinary skill in the art that the scope of the present invention is not limited to the following examples.

(56) <Preparation of Compounds>

(57) To be used as FreSH-Tracer, a composition including a compound represented by Formula A below or a salt thereof was prepared:

(58) ##STR00005##

(59) In Formula A above, R.sub.1 and R.sub.2 are each independently hydrogen, C.sub.1-4 linear or branched alkyl, or heterocycloalkyl or heterocycloalkenyl with a 5-membered or 6-membered ring, which is formed of R.sub.1, R.sub.2 and X; R.sub.3 is hydrogen or C.sub.1-4 linear or branched alkyl; R.sub.4 and R.sub.5 are each independently hydrogen, C.sub.1-5 linear or branched alkyl, or —(CH.sub.2).sub.m—COO—C.sub.1-5 linear or branched alkyl (m is an integer of 1 to 5), or R.sub.4, R.sub.5 and Y form C.sub.3-7 heterocycloalkyl, and the heterocycloalkyl is unsubstituted or Re-substituted heterocycloalkyl; R.sub.6 is —COO(CH.sub.2).sub.n—OCO—C.sub.1-5 linear or branched alkyl (n is an integer of 1 to 5), —(CONH)—(CH.sub.2).sub.o—PPh.sub.3.sup.+Cl.sup.− (o is an integer of 1 to 5) or —(CONH)—CHR.sub.7—COO(CH.sub.2).sub.p—OCO—C.sub.1-5 linear or branched alkyl (p is an integer of 1 to 5); R.sub.7 is —(CH.sub.2).sub.q—COO(CH.sub.2).sub.r—OCO—C.sub.1-5 linear or branched alkyl (each of q and r is an integer of 1 to 5); and X and Y are each independently N or O.

(60) More preferably, to be used as FreSH-Tracer, the compound represented by Formula A was a compound selected from the group consisting of a compound represented by Formulas A-1 to A-6:

(61) ##STR00006##

(62) More preferably, as FreSH-Tracer, the compound of Formula A-1 was used.

(63) Subsequently, to be used as MitoFreSH-Tracer, a composition including a compound represented by Formula B below or a salt thereof was prepared:

(64) ##STR00007##

(65) In Formula B above, R.sub.1 is heterocycloalkyl, which is a 3 to 7-membered cycle including one or more N atoms, wherein the heterocycloalkyl has a R.sub.2 substituent; wherein R.sub.2 is —(C(═O)NH)—(CH.sub.2).sub.m—PPh.sub.3.sup.+Cl.sup.− (m is an integer of 1 to 4), —(CH.sub.2).sub.n—PPh.sub.3.sup.+Cl.sup.− (n is an integer of 1 to 6), or —(C(═O))—(CH.sub.2).sub.p—R.sub.3 (p is an integer of 1 to 4); and wherein R.sub.3 is —C(NHC(═O)—R.sub.4), wherein R.sub.4 is a substituent represented by Formula B-1 below.

(66) ##STR00008##

(67) In Formula B-1 above, x is an integer of 1 to 4.

(68) In addition, R.sub.1 of the present invention is a 6-membered heterocycloalkyl ring including one or two N atoms. In the present invention, the term “6-membered ring” included in the term “6-membered heterocycloalkyl ring” refers to a single 6-membered ring, which is a monocyclic compound, rather than a ring compound in the form of several conjugated rings, such as a bicyclic compound or a spiro compound, and the “heterocycloalkyl” refers to non-aromatic cyclic alkyl, in which at least one of carbon atoms included in the ring is substituted with a heteroatom, for example, nitrogen, oxygen or sulfur. Preferably, R.sub.1 is a 6-membered heterocycloalkyl ring, including one or two nitrogen atoms as heteroatoms included in the ring.

(69) More preferably, to be used as MitoFreSH-Tracer, the compound represented by Formula B was a compound selected from the group consisting of compounds represented by Formulas B-2 to B-4:

(70) ##STR00009##

(71) More preferably, as MitoFreSH-Tracer, the compound of Formula B-4 was used.

(72) Subsequently, to be used as GolgiFreSH-Tracer, a composition including a compound represented by Formula B-5 below or a salt thereof was prepared:

(73) ##STR00010##

(74) In Formula B-5 above, R.sub.4 is a compound of —(CH.sub.2)p-(OCH.sub.2CH.sub.2O)q-(CH.sub.2)r- or —(CH.sub.2CH.sub.2)s- (each of p, q, r and s is an integer of 1 to 5). More specifically, in Formula B-5 above, R.sub.4 is any one of (OCH.sub.2CH.sub.2O)—, —(CH.sub.2CH.sub.2)—, and —(CH.sub.2 (OCH.sub.2CH.sub.2).sub.2OCH.sub.2)—.

(75) More preferably, to be used as GolgiFreSH-Tracer, the compound represented by Formula B-5 was a compound selected from the group consisting of compounds represented by Formulas B-6 to B-8:

(76) ##STR00011##

(77) More preferably, as GolgiFreSH-Tracer, the compound of Formula B-8 was used.

(78) By using Compound A or B according to the present invention, or a composition including the same, the antioxidation capacity of a cell organelle such as the mitochondria or the Golgi complex of all cells including stem cells was measured, thereby accurately measuring cell activity related to the antioxidation capacity, and thus cells with high activity can be selected. The cell activity measurement using the composition of the present invention includes measurement of antioxidation capacity, but the present invention is not limited thereto.

(79) In addition, a composition for measuring the antioxidation capacity of a cell organelle, which includes a compound represented by Formula A or B; a racemate thereof, an enantiomer thereof, a diastereomer thereof, a mixture of enantiomers thereof, or a mixture of diastereomers thereof; and a pharmaceutically acceptable salt thereof as an active ingredient, was provided.

EXAMPLES

Example 1: Establishment of Experimental Conditions Using FreSH-Tracer and Confirmation of Intracellular Expression Pattern

(80) Cell activity of living cells was measured using FreSH-Tracer, and to isolate cells with high cell activity, experimental conditions were established as follows.

(81) Human bone marrow mesenchymal stem cells (hBM-MSCs, purchased from Lonza), human umbilical cord-derived mesenchymal stem cells (hUC-MSCs, derived from an umbilical cord sample provided by the Obstetrics and Gynecology Department of Seoul National University), and human embryonic stem cell-derived mesenchymal stem cells (hES-MSCs, provided by Prof. Hyung-Min Chung, Konkuk University, Korea) were used.

(82) Here, the compound of Formula A-1 below was used as FreSH-Tracer, the compound of Formula B-4 below was used as MitoFreSH-Tracer, and the compound of Formula B-8 below was used as GolgiFreSH-Tracer.

(83) A buffer mixture (10 mM phosphate, 150 mM NaCl, pH 7.4, H2O:DMSO=98:2) was prepared by mixing GSH (0 to 200 mM) and FreSH-Tracer (10 μM), and time-dependent changes of the UV-visible light absorption spectrum and the fluorescence emission spectrum of the solution were measured using Scinco S-3100 and Hitachi F-7000 spectrophotometers, respectively. Specifically, when GSH was added to FreSH-Tracer while increasing the concentration thereof, absorbances with respect to UV and visible light increased at λmax=430 nm and decreased at λmax=520 nm (FIG. 1A), and a fluorescence emission intensity increased at approximately 510 nm (F510, λex=430 nm; λem=510 nm) and decreased at approximately 580 nm (F580, λex=520 nm; λem=580 nm) (FIGS. 1B and 1C). In addition, it was confirmed that a fluorescence emission intensity ratio of F510 to F580 (F510/F580, FR) of FreSH-Tracer is proportionally changed in a wide range of GSH concentrations (FIG. 1D). A regression curve obtained from the FR fluorescence ratio showed linearity (R2=0.9938) in a concentration range (0 to 50 mM) wider than the range of concentrations of GSH present in cells (FIG. 1E).

(84) Moreover, absorbances with respect to UV and visible light of various derivatives (Compound A or B above) included in FreSH-Tracer also increased at λmax=430 nm and decreased at λmax=520 nm, and the fluorescence emission intensities thereof increased at F510, and decreased at F580. Likewise, it was confirmed that F510/F580 (FR) was also proportionally changed in a wide range of GSH concentrations, as in the case with Formula B-1 (data not shown). Detailed data can be referenced from Korean Patent Application Nos. 10-2015-0161745 and 10-2017-0107429.

(85) ##STR00012##

(86) Therefore, such results show that FreSH-Tracer can monitor GSH changes induced by ROS in a cell homogenate.

Example 2: Isolation of Living Cells According to FreSH-Tracer-Based GSH Concentration Using FACS

2-1. Isolation of hBM-MSCs

(87) The hBM-MSCs were seeded in a culture medium (MSCGM Bullet Kit; Lonza #PT-3001) at a density of 1×10.sup.3 cells/cm.sup.2, and three days later, labeled in a culture medium containing 2 μM FreSH for 1.5 hours. The cells were washed with DPBS (WELGENE #LB 001-02) twice and detached with a TrypsinLE (Gibco #12604-013) solution, and trypsin was inactivated with a fresh medium containing 2 μM FreSH. Afterward, after centrifugation at 4° C. and 1800 rpm for 10 minutes, the cells were resuspended in a fresh medium containing 2 μM FreSH. The resulting suspension was diluted 1/5 with PBS containing 2 μM FreSH immediately before loading for FACS (diluted by approximately 1 mL at a time to maintain a temperature of 4° C.

(88) Afterward, under the following conditions, FACS Instruction (BD ARIAIII, laser at wavelengths of 405 (for measuring F510) and 488 (for measuring F580), nozzle size: 100 μm, 2,000-3,000 events/sec), FACS analysis was performed by gating the cells corresponding to the upper 3.9-35% and the lower 3.9-35% of total cells according to the F510/F580 ratio.

(89) The cells were sorted into GSH.sup.High (cell population in the upper 1.9-35%)), GSH.sup.Middle (GSH.sup.Mid, cell population in the upper 30.2-62.5%) and GSH.sup.Low (cell population in the lower 1.9-35%), and then the culture medium was replaced with a fresh medium to remove FreSH-Tracer (FIG. 2). Since FreSH-Tracer reversibly binds to GSH, FreSH-Tracer is removed from the cells by replacing the culture medium (FIG. 3).

2-2. Isolation of Human Diploid Fibroblasts

(90) HDFs isolated from the foreskin of a human penis were prepared as old cells (p32) [replicative aging models according to passage], seeded in 150 pi tissue culture media, and labeled with phenol red-free Dulbecco's Modified Eagle's Medium (DMEM) containing 10% fetal bovine serum containing 2 μM FreSH and 1% penicillin-streptomycin for 2 hours. After the 2 hours, the cells were washed with PBS twice, treated with a TrypsinLE solution (Invitrogen) to detach cells, treated with a fresh medium to inactivate trypsin, and then placed on ice for 5 minutes. Afterward, the cells were centrifuged at 4° C. and 1000 rpm for 10 minutes, and resuspended in a fresh medium containing 2 μM FreSH to have a density of 2×10.sup.7 cells/mL.

(91) Subsequently, under the following conditions, FACS Instruction (BD ARIAIII, laser at wavelengths of 405 (for measuring F510) and 488 (for measuring F580), nozzle size: 100 μm), FACS analysis was performed by gating the cells corresponding to GSH.sup.High (cell population in the upper 0.2-30.2%) and GSH.sup.Low (cell population in the lower 0.2-30.3%) of total cells according to the F510/F580 ratio. Afterward, FreSH was removed by replacing a culture medium with a fresh medium (FIG. 4). Since FreSH reversibly binds to GSH, FreSH is immediately removed from the cells by replacing the culture medium (data not shown).

2-3. Culture of Monocyte-Derived Human Dendritic Cells

(92) Human blood was collected and diluted with DPBS (WELGENE #LB 001-02) to a 3-fold volume, and then only the nucleated cells were isolated by a density difference isolation method using a Ficoll-Paque Plus (GE Healthcare, 17-1440-02) solution. The number of the isolated cells was determined, 90 μL of 2% FBS-containing DPBS and 10 μL of CD14 MicroBead (Milteny Biotech #130-050-201) were added per 1×10.sup.7 cells to allow a reaction for 15 minutes at 4° C., and then CD14+ monocytes were isolated using an LS column. The isolated cells were seeded in a 6-well plate at 1×10.sup.6 cells/well to perform differentiation in 2 mL of dendritic cell differentiation medium (RPMI 1640, 2 mM L-Glutamine, 10% FBS, 1% penicillin-streptomycin, 100 μM β-mercaptoethanol, 20 ng/mL hGMCSF, 20 ng/mL IL-4) for 6 days. After the 6 days, the differentiation-completed dendritic cells were considered as immature dendritic cells, and treated with 0.5 μg/mL LPS for 24 hours to culture mature dendritic cells.

(93) As described in Example 2-1, the cells were labeled with a FreSH-containing medium.

2-4. Isolation of Rat T Lymphocytes

(94) A 24-well plate was coated with 5 μg/mL of CD3 antibodies (Biolegend #100340) at 37° C. for 4 hours, and washed with DPBS. T lymphocytes isolated from the spleen and lymph node of a rat using Mouse Pan T Cell Isolation Kit II (Milteny Biotech #130-095-130) were added at 2×10.sup.6 cells/well, and cultured in a 10% FBS-containing RPMI 1640 medium along with 1 μg/mL of CD28 antibodies (Biolegend #102112) for 3 days. FreSH was added to the culture medium to have a final concentration of 2 μM to label the cells for 2 hours, and the resulting culture solution was centrifuged at 4° C. and 1500 rpm for 5 minutes and resuspended in a fresh medium containing 2 μM FreSH to have a density of 2×10.sup.7 cells/mL. Afterward, under the following conditions FACS Instruction (BD ARIAIII, laser at wavelengths of 405 (for measuring F510) and 488 (for measuring F580) and a nozzle size of 70 μM), the cells were sorted into three types of cell populations according to a F510/F580 ratio.

2-5. Isolation of hES-MSCs

(95) Twelve hours after hES-MSCs were seeded in 150 pi tissue culture media at a density of 3×10.sup.6 cells/mL, the cells were washed two times with 30 mL of PBS, and labeled with an EGM-2 MV culture solution containing 2 μM FreSH for 2 hours. After the two hours, the cells were washed with 2 μM FreSH-containing PBS twice and treated with a TrypsinLE (Invitrogen) solution to detach the cells, and then trypsin was inactivated with a fresh EGM-2 MV medium containing 2 μM FreSH. Afterward, the cells were centrifuged at 4° C. and 2000 rpm for 20 minutes, and resuspended in a fresh EGM-2 MV medium containing 2 μM FreSH to have a density of 5×10.sup.7 cells/mL. The suspension was diluted 1/5 with PBS containing 2 μM FreSH immediately before loading for FACS (diluted by approximately 1 mL at a time to maintain a temperature of 4° C.

(96) Afterward, under the following conditions FACS Instruction (BD ARIAIII, laser at wavelengths of 405 (for measuring F510) and 488 (for measuring F580), nozzle size: 100 μm, 2,000-3,000 events/sec), FACS analysis was performed by gating the cells corresponding to the upper 3.9-35% and the lower 3.9-35% of total cells according to the F510/F580 ratio.

(97) After the cells were sorted into GSH.sup.High (cell population in the upper 3.9-35%) and GSH.sup.Low (cell population in the lower 3.9-35%), the culture medium was replaced with a fresh culture medium (EGM-2-MV media, LONZA) to remove FreSH (FIG. 4). Since FreSH reversibly binds to GSH, FreSH was immediately removed from the cells by replacing the culture medium (data not shown).

Example 3: Analysis of Characteristics of Sorted Cells

3-1: Analysis of Cytological Characteristic of FreSH-Tracer-Based Sorted Stem Cells

(98) Main factors for determining the therapeutic efficacy of hBM-MSCs, namely a colony forming unit-fibroblast (CFU-F) and a graft survival rate, were evaluated in cell culture models. Cells were seeded at 200 cells/100 pi dish and cultured for 14 days, and by subsequent crystal violet staining, it was confirmed that GSH.sup.High cells exhibit a considerably higher CFU-F level than GSH.sup.Mid or GSH.sup.Low cells (FIG. 4A). In addition, chemotaxis for SDF-1 (150 ng/mL) or PDGF-AA (10 ng/mL)±STI571 (0.5 μg/mL) was measured using Transwell culture, confirming that the GSH.sup.High cells exhibit a considerably higher cell migration than the GSH.sup.Low cells (FIG. 4B).

3-2: Analysis of Aging Characteristic in FreSH-Tracer-Based Sorted Fibroblasts

(99) Human diploid fibroblasts (HDFs) isolated from the foreskin of a human penis were prepared as young cells (p6) and old cells (p32) [replicative aging models according to passage], and afterward, when a GSH level was measured using a GSH/GSSG-Glo™ analysis kit produced by Promega, it was confirmed that the GSH level of the young cells, compared with the old cells, was decreased by approximately 44% (FIG. 5A).

(100) The HDFs were sorted into GSH.sup.High and GSH.sup.Low fibroblasts by the method described in Example 2-2. As a result of measuring a cell size, it was confirmed that the GSH.sup.Low cells have a 1.5-fold larger size compared with the GSH.sup.High cells, and it was confirmed that the result corresponds to a previous report (see Reference 1) in that as aging progresses, the cell size (forward scattering (FSC)) becomes larger (FIG. 5B). When the cells were treated with 5 μM dihydrorhodamine 123 (DHR123) and cultured for 30 minutes at 37° C. to measure an intracellular ROS level, it was confirmed that the GSH.sup.Low cells are better stained than the GSH.sup.High cells (FIG. 5C).

(101) In addition, when a lipofuscin level was measured and quantified by autofluorescence using an Alexa488 fluorescence filter, the GSH.sup.Low cells were more strongly measured than the GSH.sup.High cells (FIG. 5D), and the GSH.sup.Low cells exhibited a lower ki67 mRNA expression level than the GSH.sup.High cells, but exhibited a higher mRNA expression level of p21 (FIG. 5E). In addition, when the expression level of SASP-related genes was analyzed by RQ-PCR as described above, it was confirmed that the GSH.sup.Low cells were increased in the expression of the IL-1A gene and IL-1B gene, compared with the GSH.sup.High cells (FIG. 5F). It has been known that, according to aging of the cells, the lipofuscin level increases (see Reference 2), the ki67 expression level decreases, the p21 expression level increases (see Reference 3), and the expression level of senescence-associated secretory phenotype (SASP)-related genes increases (see Reference 4), and in accordance therewith, the GSH.sup.High cells have higher anti-aging activity than the GSH.sup.Low cells. The gene expression in this example was measured using the above-described RQ-PCR analysis, and all primers used in this analysis were designed using QuantPrime (http://www.quantprime.de/), and the sequences of the primers are shown in Table 1 below.

(102) TABLE-US-00001 TABLE 1 Name of primer Primer sequence (5′ .fwdarw. 3′) IL1A_For TGTGACTGCCCAAGATGAAGACC IL1A Rev TTGGGTATCTCAGGCATCTCCTTC IL1B For GAACTGAAAGCTCTCCACCTCCAG IL1B_Rev AAAGGACATGGAGAACACCACTTG Ki67 For AGCACCTGCTTGTTTGGAAGGG Ki67_Rev ACACAACAGGAAGCTGGATACGG p21 For GGCAGACCAGCATGACAGATTTC p21_Rev AGATGTAGAGCGGGCCTTTGAG

3-3: Analysis of Immune Activity in FreSH-Tracer-Based Sorted Dendritic Cells

(103) After antibodies against various surface proteins related to immune activity of human monocyte-derived dendritic cells and FreSH-Tracer were simultaneously stained, flow cytometry was performed by gating GSH.sup.High (cell population in the upper 0.2-30.2%), GSH.sup.Mid (cell population in the upper 30.2-62.5%) and GSH.sup.Low (cell population in the lower 0.3-32.7%), and an expression level of the surface protein in each cell population was confirmed. As a result, it was confirmed that an expression level of CD80, which has been known to play a critical role in T-lymphocyte activation, was highest in GSH.sup.High, then GSH.sup.Mid, and lowest in GSH.sup.Low, regardless of maturation of dendritic cells (FIG. 6). Through this, it can be expected that the immune activity of the dendritic cells with a high level of GSH will be high. The surface protein antibodies used in this experiment are shown in Table 2 below.

(104) TABLE-US-00002 TABLE 2 Surface Cat. protein Fluorescence Manufacturer No. CD40 AlexaFluor ®700 Biolegend 334328 CD80 APC Biolegend 305220 HLA-DR BV650 BD 564231 CD86 PE/Cy7 Biolegend 305422 HLA-A, B, C APC/Cy7 Biolegend 311426 CD11c BrilliantViolet711 ™ Biolegend 301630

3-4: Analysis of Treg Cell Activity in FreSH-Tracer-Based Sorted T Cells

(105) Mouse T lymphocytes were activated using CD3 and CD28 antibodies, and then sorted into three experimental groups according to GSH concentration using FreSH-Tracer. The sorted T lymphocytes were subjected to mRNA extraction using TRIzol (Invitrogen #15596026), the mRNA level of foxp3, which is a Treg cell-specifically-expressed transcription factor, was analyzed through RQ-PCR, confirming that the mRNA level of GSH.sup.Low was approximately 4-fold higher than GSH.sup.High and GSH.sup.Mid (FIG. 7). Through this, it can be expected that the ratio of the Treg cells in the T cell population with a high level of GSH will be lower.

Example 4: Establishment of Evaluation Parameters for Evaluating Cell Therapeutic Agent Quality Based on FreSH-Tracer

(106) To evaluate the quality of therapeutic cells, four evaluation parameters based on a real-time glutathione measurement method using FreSH-Tracer to be described below were developed and analyzed (FIG. 8). The four parameters are a glutathione mean value (or median value; glutathione mean or median level; GM) and glutathione heterogeneity (GH), glutathione regeneration capacity (GRC), and oxidative stress resistance capacity (ORC) of cells, respectively.

(107) As shown in FIG. 8, GM is calculated as the mean or median of cellular FR. In addition, GH is calculated as the coefficient of variation or robust coefficient of variation of cellular FR.

(108) GRC refers to a value obtained by real-time monitoring of FR after living cells are treated with an oxidizing agent, as calculated by dividing a value obtained by subtracting AUC of a group treated with 0.1-100 mM N-ethylmaleimide (NEM) from FR AUC of an oxidizing agent (diamide, H.sub.2O.sub.2, etc.)-treated group by a value obtained by subtracting the AUC of NEM-treated group from AUC of the untreated control, and multiplying the resulting value by 100. The FR of the NEM-treated group is a value for increasing the sensitivity of a GRC value by treating it as the blank value of the FR of the cells of interest. In addition, to calculate ORC, hUC-MSCs were treated with a 0.5 or 1 μM oxidizing agent such as a glutathione peroxidase 4 (GPX4) inhibitor, RSL3, and cultured at 37° C. for 2 hours. After the removal of an RSL3-containing medium, 15 μM MitoFreSH-Tracer was added per 100 μl, followed by culturing at 37° C. for 1 hour. Here, the medium used in the culture was 10 mM HEPES-containing HBSS. To remove the MitoFreSH-Tracer from the medium before measurement, the medium was exchanged with fresh 10 mM HEPES-containing HBSS(Hanks' Balanced Salt Solution), and a fluorescence image was obtained using a confocal imaging system, Operetta. By comparing GSH levels quantified from control cells not treated with RSL3 or control cells before treated with RSL3, the distribution of GSH expression-changed cells was calculated. Based on the point where the distribution histogram is divided into two peaks, the cells were divided into GSH.sup.High cells (right peak) and GSH.sup.Low cells (left peak), and then a ratio of corresponding cells was expressed as a percentage (%).

(109) To confirm the relationship between the above-described glutathione evaluation parameters and the quality of stem cells, colony-forming unit-fibroblasts (CFU-F) according to the number of passages (P) of hBM-MSCs and migration capacity were analyzed. The analysis result showed that hBM-MSCs of p4.5 exhibited a considerably higher CFU-F (FIG. 9A), and a greater SDF-1α (angiogenic factor) or platelet-derived growth factor-AA (PDGF-AA)-dependent migration capacity than hBM-MSCs of p9.5 (FIG. 9B). Under these conditions, glutathione evaluation parameters of stem cells were comparatively analyzed using FreSH-Tracer for monitoring glutathione in entire cells, and the Golgi complex-specific GolgiFreSH-Tracer and mitochondria-specific MitoFreSH-Tracer (FIG. 10A). In terms of GM, as a passage number was higher, a FR mean value and a Mito-FR mean value were significantly reduced in hBM-MSCs, but there was no significant change in a Golgi-FR mean value (FIG. 10B). In terms of GH, as a passage number was higher, an FR rCV value and a Mito-FR rCV value were significantly increased in hBM-MSCs, but there was no significant change in a Golgi-FR rCV value (FIG. 10C). In terms of GRC, as a passage number was higher, FR-based % GRC and Mito-FR-based % GRC were reduced by treatment of hBM-MSCs with diamide, but there was no change in Golgi-FR-based % GRC (FIG. 11). From these results, it can be demonstrated that the quality of stem cells was proportionally related with FreSH-Tracer or MitoFreSH-Tracer-based GM and GRC, and correlated with FreSH-Tracer or MitoFreSH-Tracer-based GH in an inversely proportional manner. Particularly, it can be confirmed that the MitoFreSH-Tracer-based glutathione evaluation parameters have a higher sensitivity to stem cell quality.

(110) Subsequently, the change of the MitoFreSH-Tracer-based glutathione evaluation parameters according to the degree of the differentiation of bone marrow stem cells were observed. Lineage+ cells and Lin− cells isolated from mice were stained using MitoFreSH-Tracer, and subjected to FR measurement using Operetta (PerkinElmer), and MitoFreSH-Tracer-based glutathione evaluation parameters were confirmed per cell population. As a result, it was confirmed that, compared with differentiated Lineage+ cells, in undifferentiated Lin− cells, mitochondrial GM is high and GH is low (FIG. 12). This means that the stemness of bone marrow cells can be distinguished as a glutathione evaluation parameter.

Example 5: Detection of Material for Enhancing Quality of Cell Therapeutic Agent Using FreSH-Tracer

(111) In order to test whether direct control of a GSH level in stem cells leads to change in cell functions, hES-MSCs sorted by FreSH-Tracer were treated with buthionine sulfoximine (BSO; glutathione synthesis inhibitor) and glutathione ethyl ester (GSH-EE). When GSH was decreased in cells by treating GSH.sup.High cells with BSO (80 μM, 24 h), it was confirmed that CFU-F increased, and on the other hand, when GSH was increased by treating GSH.sup.Low cells with GSH-EE (1 mM, 2 h), it was confirmed that CFU-F decreased (FIG. 13A). In addition, it was confirmed that, when hES-MSCs which were not sorted by FreSH-Tracer were treated with BSO or GSH-EE, PDGF-AA-induced cell migration capacity was decreased or increased, respectively (FIG. 13B).

(112) Meanwhile, when hUC-MSCs were subcultured three times in medium containing the antioxidant ascorbic acid 2-glucoside (AA2G, 250 μg/mL), compared with a naive cell group, it was confirmed that FreSH-Tracer-based GRC was increased by treatment with a low concentration of diamide (FIG. 14). Therefore, it was demonstrated that a material for enhancing a glutathione evaluation parameter improves cell functions.

(113) In addition, when hUC-MSCs were subcultured three times in the AA2G (250 μg/mL)-containing medium, compared with the naive cell group (NC), it was confirmed that the FreSH-Tracer-based ORC was higher in GSH.sup.High cells (FIGS. 15A and 15B).

(114) The inventors observed an effect of the material on stem cells by treating each stem cells with a material for enhancing a glutathione evaluation parameter. When hUC-MSCs were subcultured in a L-AA2G-containing medium, CFU-F, migration capacity, and an anti-inflammatory effect were observed. A CFU-F assay (n=3) was performed by treating hUC-MSCs with 125 or 250 μg/mL of AA2G for three days. As shown in FIGS. 16A and 16B, it was confirmed that, when AA2G was treated, CFU-F increased. In addition, as hUC-MSCs were treated with 125 or 250 μg/mL of AA2G for three days, PDGF-AA-induced migration capacity (n=3) was analyzed. As shown in FIGS. 17A and 17B, it was confirmed that the migration capacity was increased by AA2G treatment. In addition, the reduction in T cell proliferation, the reduction in T cell differentiation, and the promotion of Treg cell differentiation were observed by treating hUC-MSCs with 125 or 250 μg/mL of AA2G for three days. As shown in FIGS. 18A to 18C, it was confirmed that an anti-inflammatory effect of stem cells was exhibited by treating AA2G.

(115) Meanwhile, hUC-MSCs were cultured with a glutathione precursor such as γ-glutamyl cysteine (GGC, 0.1, 0.25, and 0.5 mM). A CFU-F assay (n=3) was performed by treating hUC-MSCs with each concentration of GGC for 2 hours. As a result, as shown in FIG. 19, it was confirmed that CFU-F increased. In addition, SDF1α and PDGF-AA-induced migration capacities (n=3) were analyzed for hUC-MSCs without treatment with GGC, and SDF1α and PDGF-AA-induced migration abilities (n=3) were analyzed by treating hUC-MSCs with the increasing concentrations of GGC. STI571 was used as a PDGFR kinase inhibitor. As shown in FIGS. 20A to 20C, it was confirmed that, according to an increase in GGC treatment concentration, SDF1α- and PDGF-AA-induced migration capacities were enhanced.

(116) In addition, for ORC analysis, as shown in FIG. 21, living cells were prepared, and 3×10.sup.3 of the cells were seeded in each well. 10% fetal bovine serum, and 1× penicillin-streptomycin were added to an α-MEM medium. A material for increasing a glutathione level was treated. Subsequently, a glutathione peroxidase 4 (GPX4) inhibitor, RSL3, was treated. After 2-hour culture, a RSL3-containing medium was removed, 15 μM MitoFreSH-Tracer was added per 100 μl, followed by culturing at 37° C. for 1 hour. The medium used in the culture was 10 mM HEPES-containing HBSS.

(117) The inventors analyzed ORC by treating hUC-MSCs with a material for increasing a glutathione level, such as liproxstatin-1, vitamin D3, vitamin E, flavonoid-type baicalin, baicalein, luteolin, quercetin, butein, or a plant extract such as a flower extract of Chrysanthemum morifolium Ramat, a leaf extract of Cedela sinensis A. Juss, an extract of Oenothera stricta Ledeb., an extract of Equisetum arvense L., a leaf extract of Ipomoea batatas or a tomato extract (LYCOBEADS®) (see FIGS. 22A to 26F). For example, as shown in FIG. 22A, 0, 2.5, 5 or 10 μM liproxstatin-1 was treated, and 0, 0.5 or 1 μM RSL3 was also treated. It was observed that, even if the quality of the cells is degraded by RSL3, the higher the concentration of liproxstatin-1, the higher the quality of cells. That is, it was confirmed that a ratio of the GSH.sup.High cells was increased.

(118) A CFU-F assay (n=3) was performed by treating hUC-MSCs with 0.2, 1, 2, and 4 μM ferrostatin-1 and 0.1, 0.5, 1, and 2 μM liproxstatin-1 for 24 hours. As shown in FIGS. 27, and 28A to 28C, there was no change in anti-inflammatory effect with GGC treatment.

(119) In addition, hUC-MSCs were cultured with ferrostatin-1 (0.2, 1, 2 and 4 μM) and liproxstatin-1 (0.1, 0.5, 1 and 2 μM), which control a glutathione level in cells by inhibiting lipid oxidation. As shown in FIG. 27, it can be confirmed that CFU-F was improved. Meanwhile, the hUC-MSCs were treated with 1 μM ferrostatin-1 for 24 hours, 0.2 mM GGC for 2 hours, and 2 mM GSH-EE for 2 hours. As a result, the reduction in T cell proliferation ability and the reduction in T cell differentiation capacity were observed, and promotion of Treg cell differentiation was observed. Materials such as ferrostatin-1 and liproxstatin-1 did not alter an anti-inflammatory effect of the hUC-MSCs as shown in FIGS. 27, and 28A to 28C. This showed that a material for improving a glutathione evaluation parameter can enhance therapeutic stem cell functions.

(120) In addition, the inventors confirmed a cartilage regeneration effect according to the antioxidation activity of stem cells in an osteoarthritis animal model. An osteoarthritis-induced rat's joint was prepared by rupturing the anterior cruciate ligament (ACL). The hES-MSCs (2×10.sup.5) subcultured three times in an AA2G (250 μg/mL)-containing culture medium were injected into the joint. As a result, as shown in FIG. 29A, compared with general stem cells, in transplantation of stem cells with increased antioxidation capacity (high GSH MSC), it can be confirmed that cartilage regeneration efficacy is considerably excellent. In addition, the hES-MSC (2×10.sup.5)-injected joint tissue as described above was prepared, and stained with H&E and safranin-O (FIG. 29B). In addition, the hES-MSC (2×10.sup.5)-injected joint tissue as described above was prepared, and stained with type II collagen (FIG. 29C). It was confirmed that the expression of GAG and Type II collagen was excellent. This showed that a material for improving a glutathione parameter improves the therapeutic efficacy of stem cells.

(121) All data was analyzed using one-way ANOVA or two-way ANOVA with Bonferroni post-hoc tests for non-parametric tests. All analyses were performed with GraphPad Prism 5.0 (GraphPad Software, Canada), and determined to be statistically significant when p<0.05 or p<0.01.

Example 6: Measurement of GSH Expression Level Using Lipid Oxidizing Agent

(122) After the cultured human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) at passage 4, 7 or 15 were treated with various concentrations of RSL3 and stained with MitoFreSH, the distribution pattern of mitochondrial GSH (mGSH) in the cells was confirmed by histograms using flow cytometry and confocal imaging.

(123) 1. Change in mGSH Expression Levels According to RSL3 Concentration and Passage Number

(124) 1) Experimental Process

(125) <Measurement of GSH Distribution in MSCs Through Flow Cytometry>

(126) hUC-MSCs at passage 4, 7 or 15 were prepared, seeded at 70000 cells/well in a 6-well cell culture plate, and cultured at 37° C. for 24 hours. The medium used in the culture was prepared by adding 10% fetal bovine serum and 1× penicillin-streptomycin to α-MEM. After the removal of the medium, a glutathione peroxidase 4 (GPX4) inhibitor, RSL3, was added at a concentration of 0.1/0.5/1 μM, followed by culturing at 37° C. for 1.5 hours. The medium used in the culture was prepared by adding 10% fetal bovine serum and 1× penicillin-streptomycin to α-MEM. After the RSL3-containing medium was removed, 5 μM MitoFreSH-Tracer was added, followed by culturing at 37° C. for 1.5 hours. The medium used in the culture was prepared by adding 10% fetal bovine serum and 1× penicillin-streptomycin to α-MEM. After the MitoFreSH-Tracer-containing medium was removed, the cells were washed with 2 mL of DPBS twice. 250 μL of TrypLE Express was added and reacted at 37° C. for 2.5 minutes, 2% FBS-containing DPBS was added in an equivalent amount to detach the cells from the plate. The cells detached from the plate were transferred to an FACS tube and stored on ice, and a fluorescence level was measured using a flow cytometer.

(127) <Measurement of GSH Distribution Using Fluorescence Imaging>

(128) hUC-MSCs at passage 4, 7 or 15 were prepared, seeded at 7000 cells/100 μl per well in a 96-well cell culture plate, and cultured at 37° C. for 24 hours. The medium used in the culture was prepared by adding 10% fetal bovine serum and 1× penicillin-streptomycin to α-MEM. After the removal of the medium, 100 μl of a glutathione peroxidase 4 (GPX4) inhibitor RSL3 was added at a concentration of 0.1/0.5/1 μM, followed by culturing at 37° C. for 2 hours. The medium used in the culture was prepared by adding 10% fetal bovine serum and 1× penicillin-streptomycin to α-MEM. After the RSL3-containing medium was removed, 15 μM MitoFreSH-Tracer was added per 100 μl, followed by culturing at 37 for 1 hour. The medium used in the culture was 10 mM HEPES-containing HBSS. To remove MitoFreSH-Tracer from the medium before measurement, the medium was exchanged with fresh 10 mM HEPES-containing HBSS, and fluorescence images were measured using a confocal imaging system, Operetta.

(129) <Histogram Analysis Method>

(130) A F510/F580 ratio referring to a GSH mean value in cells was calculated by measuring fluorescence values of F510 (fluorescence value when MitoFreSH-Tracer was bound with SH) and F580 (fluorescence value of MitoFreSH-Tracer, which was not bound with SH) in cells and dividing the F510 value by the F580 value. A histogram was expressed with the F510/F580 ratio of the cells as the X axis and a % amount of cells corresponding to the F510/F580 ratio as the Y axis using the Prism 5 program. Alexa 430/PE (F510/F580) parameters in all samples were analyzed using FlowJo software analyzing flow cytometry, and based on the point where the histogram showing the F510/F580 distribution is divided into two peaks, the cells were divided into GSH.sup.High cells (right peak), GSH.sup.Low cells (left peak), and then a ratio of corresponding cells was expressed as a percentage (%).

(131) 2) Experimental Result

(132) When all of the cultured hUC-MSCs at passage 4, 7 or 15 were not treated with RSL3, although almost the same pattern of mGSH distribution was shown, it can be confirmed that a group in which mGSH levels were reduced depending on an RSL3 concentration and a passage number was observed (FIGS. 29, 30, and 31).

(133) As the passage number increases, the cells are known to undergo antioxidative stress, and many studies have demonstrated that these cells underwent cell senescence, and the functions of stem cells were deteriorated. Based on the studies, it can be estimated that in cells in which antioxidation capacity was deteriorated under a condition of lipid oxidative stress caused by RSL3, compared with cells in which antioxidation capacity was not deteriorated, mGSH levels cannot be normally maintained.

(134) In FIG. 32, green cells as shown in cell fluorescence images are cells that maintain mGSH, and yellow cells are cells that are decreased in mGSH. It can be observed that the higher the passage number, the higher ratio of the yellow cells, and even in the same cells, the yellow cells were observed to be larger and wider than the green cells. In addition, when Ferrostatin-1 was treated, the effect of RSL3 disappeared, and this suggests that the effect is dependent on lipid oxidative stress (FIG. 32).

(135) 2. Change in mGSH Expression Level in Human Dermal Fibroblasts

(136) As described in the experiment for MSCs, human dermal fibroblasts subcultured several times were treated with RSL3 and the cells were stained with MitoFreSH-Tracer, and a ratio between cells maintaining mGSH and cells not maintaining mGSH was represented as a percentage through confocal imaging. This result, like the result of MSCs, shows that, as the subculture continued, the proportion of cells in which mGSH decreases by treatment with RSL3 increased (FIG. 34).

(137) 3. Relationship Between mGSH Expression Level and CD146 Expression Level

(138) 1) Experimental Process

(139) To confirm whether the stem cell function of cells in which an mGSH level decreased is deteriorated under lipid oxidative stress caused by RSL3 treatment, an expression level of CD146, which is a cell surface protein known to be highly expressed in stem cells of high quality according to conventional literature, was confirmed through flow cytometry.

(140) The cells were stained by the same method as a method of measuring a mitochondria GSH level through the flow cytometry described above, and detached from the plate using trypsin. The detached cells were treated with an antibody for flow cytometry with respect to CD146 to which a fluorescent material BUV395 was bound at 4° C. for 30 minutes, and washed with PBS. Using a flow cytometer, F510 and F580 fluorescence values for measuring a GSH level and a BUV395 fluorescence value for measuring CD146 expression were measured. Afterward, based on the point at which the histogram showing the F510/F580 distribution was divided into two peaks, the cells were divided into GSH.sup.High cells (right peak) and GSH.sup.Low cells (left peak) using FlowJo software, and a CD146-positive ratio of the corresponding cells is represented as a percentage (%).

(141) 2) Experimental Result

(142) After RSL3 treatment, by staining both MitoFreSH and CD146 antibody and comparing CD146 surface expression levels in mGSH.sup.high and mGSH.sup.Low cells, compared with a CD146 mGSH level-maintaining group, it was confirmed that a CD146-positive ratio is lowered by approximately 25% in a P4 hUC-MSC group in which an mGSH level is lowered by RSL3 (FIG. 33). This was similar to a CD146-positive ratio of P15 stem cells. Since P7 has no difference in CD146-positive ratio from P4, the quality of two types of cells could not be distinguished by a such method of evaluating the quality of cells using the ratio of the expression of the surface protein, but the quality thereof could also be separately evaluated by cell type using the method of the present invention as described in FIG. 31.

(143) Hereinabove, specific parts of the present invention have been described in detail. However, it will be apparent to those of ordinary skill in the art that such detailed descriptions are just exemplary embodiments, and thus it is obvious that the scope of the present invention is not limited thereto. Therefore, the actual range of the present invention will be defined by the accompanying claims and equivalents thereof.

REFERENCES

(144) 1. E. ROBBINS et al., J Exp Med. 1970 Jun. 1;131(6):1211-22. 2. Georgakopoulou E A et al., Aging (Albany N.Y.), 2013 January;5(1):37-50. 3. Thomas Kuilman et al., Genes Dev. 2010 Nov. 15;24(22):2463-79. 4. Jean-Philippe Copp' et al., Annu Rev Pathol. 2010; 5:99-118.

INDUSTRIAL APPLICABILITY

(145) According to the present invention, by using FreSH-Tracer and evaluation parameters in real-time monitoring of an intracellular GSH level in living stem cells and differentiation of cells according to the GSH level, the quality of a cell therapeutic agent may be measured and evaluated.