Fungal high-level protein production system
10072267 ยท 2018-09-11
Assignee
Inventors
- Jurian Alexander Bronkhof (Apeldoom, NL)
- Jean-Paul Meijnen (Rhenen, NL)
- CAROLA BIANCA MICHIELSE (Kranenburg, DE)
- ISMAIL ATALAY VAN DER BURGT (Wageningen, NL)
- Jacob Visser (Wageningen, NL)
- Johannes Heinrich Visser (Wijchen, NL)
Cpc classification
C12N9/2468
CHEMISTRY; METALLURGY
C12Y302/01003
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
International classification
Abstract
Provided are cells having an increased protein production characterized in that said cell comprises modified SUMOylation, a process for producing such a cell or expression system and the use of such a cell in producing a protein of interest.
Claims
1. A modified Myceliophthora thermophila cell having increased acetyl esterase, aminopeptidase, amylase, arabinase, arabinofuranosidase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, esterase, a-galactosidase, -galactosidase, a-glucanase, glucan lyase, endo--glucanase, glucoamylase, glucose oxidase, a-glucosidase, -glucosidase, glucuronidase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase, laccase, lipase, lyase, lytic polysaccharide monooxygenase, mannosidase, oxidase, oxidoreductase, pectate lyase, pectin acetyl esterase, pectin depolymerase, pectin methyl esterase, pectinolytic enzyme, peroxidase, phenoloxidase, phytase, polygalacturonase, protease, rhamno-galacturonase, ribonuclease, thaumatin, transferase, transport protein, transglutaminase, xylanase, or -xylosidase protein production, wherein said cell has been modified by a genetic modification of the ubc9 gene to reduce Ubc9 protein production and/or activity, wherein the ubc9 gene has a wild type counterpart encoding an Ubc9 protein that comprises: (i) a first motif of RLQEERKQWRKDHPFGF (SEQ ID NO: 42) or a version thereof having a T or H instead of Q at position 3 of SEQ ID NO: 42, a K instead of Q at position 8 of SEQ ID NO: 42, and/or an A instead of G at position 16 of SEQ ID NO: 42; and (ii) a second motif of KPPKCKFTPPLFHPNVYPSGTVCLSIL (SEQ ID NO:43) or a version thereof having a V instead of C at position 5 of SEQ ID NO:43, a V, P, or D instead of T at position 8 of SEQ ID NO:43, an A instead of P at position 9 of SEQ ID NO:43, an A or G instead of P at position 10 of SEQ ID NO:43, an F instead of L at position 11 of SEQ ID NO:43, a Y instead of F at position 12 of SEQ ID NO:43, and/or an I instead of V at position 22 of SEQ ID NO:43.
2. The modified cell of claim 1, wherein the increased protein production is an increase of at least 1.1 fold as compared to the production of said protein by a parental cell that lacks the reduction in Ubc9 protein production and/or activity.
3. The modified cell of claim 1, wherein the genetic modification is a modification of an expression-regulating sequence or the coding sequence of the ubc9 gene.
4. The modified cell of claim 3, wherein the genetic modification reduces Ubc9 protein production.
5. The modified cell of claim 4, wherein the genetic modification disrupts the promoter sequence of the ubc9 gene.
6. The modified cell of claim 1, wherein the ubc9 gene has a wild type counterpart that encodes a Ubc9 protein comprising SEQ ID NO:2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9) Table 4 provides an overview of SEQ ID Nos 1-7.
DETAILED DESCRIPTION
(10) As used herein, unless otherwise specified, reference to a percent (%) identity refers to an evaluation of homology which is performed using: 1) a BLAST 2.0 Basic BLAST homology search using blastp for amino acid searches and blastn for nucleic acid searches with standard default parameters, wherein the query sequence is filtered for low complexity regions by default (described in Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402); 2) a BLAST 2 alignment (using the parameters described below); 3) PSI-BLAST with the standard default parameters (Position-Specific Iterated BLAST; and/or 4) CAZy homology determined using standard default parameters from the Carbohydrate Active EnZymes database (Coutinho, P. M. & Henrissat, B. (1999) Carbohydrate-active enzymes: an integrated database approach. In Recent Advances in Carbohydrate Bioengineering, H. J. Gilbert, G. Davies, B. Henrissat and B. Svensson eds., The Royal Society of Chemistry, Cambridge, pp. 3-12) and/or applying a similar strategy using databases such as the Foly database (website: foly.esil.univ-mrs.fr) and the PeroxiBase (website: peroxibase.isb-sib.ch).
(11) It is noted that due to some differences in the standard parameters between BLAST 2.0 Basic BLAST and BLAST 2, two specific sequences might be recognized as having significant homology using the BLAST 2 program, whereas a search performed in BLAST 2.0 Basic BLAST using one of the sequences as the query sequence may not identify the second sequence in the top matches. In addition, PSI-BLAST provides an automated, easy-to-use version of a profile search, which is a sensitive way to look for sequence homologues or variants. The program first performs a gapped BLAST database search. The PSI-BLAST program uses the information from any significant alignments returned to construct a position-specific score matrix, which replaces the query sequence for the next round of database searching. Therefore, it is to be understood that percent identity can be determined by using any one of these programs.
(12) Two specific sequences can be aligned to one another using BLAST 2 sequence as described in Tatusova and Madden, (1999), Blast 2 sequencesa new tool for comparing protein and nucleotide sequences, FEMS Microbiol Lett. 174:247-250. BLAST 2 sequence alignment is performed in blastp or blastn using the BLAST 2.0 algorithm to perform a Gapped BLAST search (BLAST 2.0) between the two sequences allowing for the introduction of gaps (deletions and insertions) in the resulting alignment. For purposes of clarity herein, a BLAST 2 sequence alignment is performed using the standard default parameters as follows.
(13) For blastn, using 0 BLOSUM62 matrix:
(14) Reward for match=1
(15) Penalty for mismatch=2
(16) Open gap (5) and extension gap (2) penalties
(17) gap x_dropoff (50) expect (10) word size (11) filter (on)
(18) For blastp, using 0 BLOSUM62 matrix:
(19) Open gap (11) and extension gap (1) penalties
(20) gap x_dropoff (50) expect (10) word size (3) filter (on).
(21) Unless otherwise indicated herein, identity with a given SEQ ID NO means identity based on the full and contiguous length of said sequence (i.e. over its whole length or as a whole).
(22) As used herein, the term contiguous or consecutive, with regard to nucleic acid or amino acid sequences described herein, means to be connected in an unbroken sequence. For example, for a first sequence to comprise 30 contiguous (or consecutive) amino acids of a second sequence, means that the first sequence includes an unbroken sequence of 30 amino acid residues that is 100% identical to an unbroken sequence of 30 amino acid residues in the second sequence. Similarly, for a first sequence to have 100% identity or being 100% identical with a second sequence means that the first sequence exactly matches the second sequence with no gaps between nucleotides or amino acids.
(23) A nucleic acid molecule encoding a protein as disclosed herein refers to the nucleotide sequence of the nucleic acid strand that encodes the protein. It will be appreciated that a double stranded DNA which encodes a given amino acid sequence comprises a single strand DNA and its complementary strand having a sequence that is a complement to the single strand DNA. As such, nucleic acid molecules can be either double-stranded or single-stranded, and include those complementary strands. Methods to deduce a complementary sequence are known to those skilled in the art. It should be noted that since nucleic acid sequencing technologies are not entirely error-free, the sequences presented herein, at best, represent apparent sequences of the proteins disclosed herein.
(24) As used herein, reference to hybridization conditions refers to standard hybridization conditions under which nucleic acid molecules are used to identify similar nucleic acid molecules. Such standard conditions are disclosed, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Labs Press, 1989. Sambrook et al., ibid., (see specifically, pages 9.31-9.62). In addition, formulae to calculate the appropriate hybridization and wash conditions to achieve hybridization permitting varying degrees of mismatch of nucleotides are disclosed, for example, in Meinkoth et al., 1984, Anal. Biochem. 138, 267-284; Meinkoth et al., ibid.
(25) More particularly, moderate stringency hybridization and washing conditions, as referred to herein, refer to conditions which permit isolation of nucleic acid molecules having at least about 70% nucleotide sequence identity with the nucleic acid molecule being used to probe in the hybridization reaction (i.e., conditions permitting about 30% or less mismatch of nucleotides). High stringency hybridization and washing conditions, as referred to herein, refer to conditions which permit isolation of nucleic acid molecules having at least about 80% nucleotide sequence identity with the nucleic acid molecule being used to probe in the hybridization reaction (i.e., conditions permitting about 20% or less mismatch of nucleotides). Very high stringency hybridization and washing conditions, as referred to herein, refer to conditions which permit isolation of nucleic acid molecules having at least about 90% nucleotide sequence identity with the nucleic acid molecule being used to probe in the hybridization reaction (i.e., conditions permitting about 10% or less mismatch of nucleotides). As discussed above, one of skill in the art can use the formulae in Meinkoth et al., ibid. to calculate the appropriate hybridization and wash conditions to achieve these particular levels of nucleotide mismatch. Such conditions will vary, depending on whether DNA:RNA or DNA:DNA hybrids are being formed. Calculated melting temperatures for DNA:DNA hybrids are 10 C. less than for DNA:RNA hybrids. Preferably, stringent hybridization conditions for DNA:DNA hybrids include hybridization at an ionic strength of 6SSC (0.9 M Na.sup.+) at a temperature of between about 20 C. and about 35 C. (lower stringency), more preferably, between about 28 C. and about 40 C. (more stringent), and even more preferably, between about 35 C. and about 45 C. (even more stringent), with appropriate wash conditions. Preferably, stringent hybridization conditions for DNA:RNA hybrids include hybridization at an ionic strength of 6SSC (0.9 M Na.sup.+) at a temperature of between about 30 C. and about 45 C., more preferably, between about 38 C. and about 50 C., and even more preferably, between about 45 C. and about 55 C., with similarly stringent wash conditions. These values are based on calculations of a melting temperature (Tm) for molecules larger than about 100 nucleotides, 0% formamide and a G+C content of about 40%. Alternatively, Tm can be calculated empirically as set forth in Sambrook et al., supra, pages 9.31 to 9.62. In general, the wash conditions should be as stringent as possible, and should be appropriate for the chosen hybridization conditions. For example, hybridization conditions can include a combination of salt and temperature conditions that are approximately 20-25 C. below the calculated Tm of a particular hybrid, and wash conditions typically include a combination of salt and temperature conditions that are approximately 12-20 C. below the calculated Tm of the particular hybrid. One example of hybridization conditions suitable for use with DNA:DNA hybrids includes a 2-24 hour hybridization in 6SSC (50% formamide) at about 42 C., followed by washing steps that include one or more washes at room temperature in about 2SSC, followed by additional washes at higher temperatures and lower ionic strength (e.g., at least one wash as about 37 C. in about 0.1-0.5SSC, followed by at least one wash at about 68 C. in about 0.1-0.5SSC).
(26) Reference to a gene includes all nucleotide sequences related to a natural (i.e. wild-type) gene, such as regulatory regions that control production of the protein encoded by that gene (such as, but not limited to, transcription, translation or post-translation control regions) as well as the coding region itself. Genes can include or exclude one or more introns or any portions thereof or any other sequences which are not included in the cDNA for that protein. The phrases nucleic acid molecule and gene can be used interchangeably when the nucleic acid molecule comprises a gene as described above.
(27) Modified genes include natural genes modified by substitution, insertion, and/or deletion of single or multiple nucleotide sequences, which can occur within the coding sequence including exons of regions encoding a polypeptide, or in flanking regions, such as regulatory regions typically upstream (e.g., promoters, enhancers, and related sequences), downstream (e.g., transcriptional termination, and poly(A) signals), or internal regions (e.g., introns) that affect the transcription, translation, and/or activation of a polypeptide or regulatory molecule of interest. Activation of a polypeptide, for example, may require removal of one or more N-terminal, C-terminal, or internal polypeptide regions, and/or post-translational modification of specific amino acid residues, such as by glycosylation, amidation, etc., that may alter the targeting, degradation, catalytic activity, of an enzyme.
(28) A nucleic acid molecule as disclosed herein can be produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloning, etc.) or chemical synthesis. A nucleic acid modification can be produced using a number of methods known to those skilled in the art (see, for example, Sambrook et al.). For example, nucleic acid molecules can be modified using a variety of techniques including, but not limited to, by classic mutagenesis and recombinant DNA techniques (e.g., site-directed mutagenesis, chemical treatment, restriction enzyme cleavage, ligation of nucleic acid fragments and/or PCR amplification), or synthesis of oligonucleotide mixtures and ligation of mixture groups to build a mixture of nucleic acid molecules and combinations thereof. Another method for modifying a recombinant nucleic acid molecule encoding a protein is gene shuffling (i.e., molecular breeding) (See, for example, U.S. Pat. No. 5,605,793 to Stemmer, incorporated herein by reference; Minshull and Stemmer; 1999, Curr. Opin. Chem. Biol. 3:284-290; Stemmer, 1994, P.N.A.S. USA 91:10747-10751). This technique can be used to efficiently introduce multiple simultaneous changes in the protein.
(29) A nucleic acid molecule as disclosed herein may be a recombinant nucleic acid molecule which comprises the nucleic acid molecule described above which is operatively linked to at least one expression control sequence. More particularly, a recombinant nucleic acid molecule typically comprises a recombinant vector and any one or more of the nucleic acid molecules as described herein. As used herein, a recombinant vector is an engineered (i.e., artificially produced) nucleic acid molecule that is used as a tool for manipulating a nucleotide sequence of choice and/or for introducing such a nucleotide sequence into a host cell. The recombinant vector is therefore suitable for use in cloning, sequencing, and/or otherwise manipulating the nucleotide sequence of choice, such as by expressing and/or delivering the nucleotide sequence of choice into a host cell to form a recombinant cell. Such a vector typically contains nucleotide sequences that are not naturally found adjacent to nucleotide sequence to be cloned or delivered, although the vector can also contain regulatory nucleotide sequences (e.g., promoters, untranslated regions) which are naturally found adjacent to nucleotide sequences disclosed herein or which are useful for expression of the nucleic acid molecules disclosed herein (discussed in detail below). The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a plasmid. The vector can be maintained as an extrachromosomal element (e.g., a plasmid) or it can be integrated into the chromosome of a recombinant host cell, although it is preferred if the vector remains separate from the genome. The entire vector can remain in place within a host cell, or under certain conditions, the plasmid DNA can be deleted, leaving behind the nucleic acid molecule disclosed herein. An integrated nucleic acid molecule can be under chromosomal promoter control, under native or plasmid promoter control, or under a combination of several promoter controls. Single or multiple copies of the nucleic acid molecule can be integrated into the chromosome. A recombinant vector disclosed herein can contain at least one selectable marker.
(30) A recombinant vector used in a recombinant nucleic acid molecule disclosed herein may be an expression vector. As used herein, the phrase expression vector is used to refer to a vector that is suitable for production of an encoded product (e.g., a protein of interest, such as an enzyme as disclosed herein). A nucleotide sequence encoding the product to be produced may be inserted into a recombinant vector to produce a recombinant nucleic acid molecule. The nucleotide sequence encoding the protein to be produced is inserted into the vector in a manner that operatively links the nucleotide sequence to regulatory sequences in the vector, which enable the transcription and translation of the nucleotide sequence within the recombinant host cell. Typically, a recombinant nucleic acid molecule includes at least one nucleic acid molecule as disclosed herein operatively linked to one or more expression control sequences (e.g., transcription control sequences or translation control sequences). As used herein, the phrase recombinant molecule or recombinant nucleic acid molecule primarily refers to a nucleic acid molecule or nucleotide sequence operatively linked to a transcription control sequence, but can be used interchangeably with the phrase nucleic acid molecule, when such nucleic acid molecule is a recombinant molecule as discussed herein. As used herein, the phrase operatively linked refers to linking a nucleic acid molecule to an expression control sequence in a manner such that the molecule can be expressed when transfected (i.e., transformed, transduced, transfected, conjugated or conduced) into a host cell. Transcription control sequences are sequences that control the initiation, elongation, or termination of transcription. Particularly important transcription control sequences are those that control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in a host cell or organism into which the recombinant nucleic acid molecule is to be introduced. Transcription control sequences may also include any combination of one or more of any of the foregoing.
(31) Recombinant nucleic acid molecules can also contain additional regulatory sequences, such as translation regulatory sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell. A recombinant molecule, including those that are integrated into the host cell chromosome, preferably also contains secretory signals (i.e., signal segment nucleotide sequences) to enable an expressed protein to be secreted from the cell that produces the protein. Suitable signal segments include a signal segment that is naturally associated with the protein to be expressed or any heterologous signal segment capable of directing the secretion of the protein as disclosed herein. A recombinant molecule may comprise a leader sequence to enable an expressed protein to be delivered to and inserted into the membrane of a host cell. Suitable leader sequences include a leader sequence that is naturally associated with the protein, or any heterologous leader sequence capable of directing the delivery and insertion of the protein to the membrane of a cell.
(32) The term transfection is generally used to refer to any method by which an exogenous nucleic acid molecule (i.e., a recombinant nucleic acid molecule) can be inserted into a cell. The term transformation can be used interchangeably with the term transfection when such term is used to refer to the introduction of nucleic acid molecules into microbial cells or plants and describes an inherited change due to the acquisition of exogenous nucleic acids by the microorganism that is essentially synonymous with the term transfection. Transfection techniques include, but are not limited to, transformation, particle bombardment, electroporation, microinjection, lipofection, adsorption, infection and protoplast fusion.
(33) The term co-transfection refers to the simultaneous transfection with two separate nucleic acid molecules. For instance, co-transfection may refer to the simultaneous transfection with one nucleic acid molecule comprising a particular gene, and another nucleic acid molecule comprising a particular marker-gene.
(34) A transgene is understood herein as a gene or modified gene that has been introduced in a cell preferably via recombinant technologies known to the skilled person. The transgene may be either homologous, i.e. normally occurring in the cell, or heterologous, i.e. not normally occurring in the cell. Preferably, the transgene encodes a protein of interest as part of an expression construct and is or is to be transduced in a cell or host cell for the recombinant production of said protein of interest. A transgene may encode a heterologous or a homologous protein. It will be appreciated that a transgene encoding a homologous protein as part of an expression construct that does not normally occur in the cell (eg. comprising a different promoter than that normally associated with the protein coding sequence) is a heterologous transgene.
(35) A reporter transgene or marker gene is to be understood herein as a transgene encoding an indicator protein, i.e. a protein to be detected as indicator for instance for protein expression levels.
(36) A heterologous sequence is to be understood herein as a sequence at a particular position that does not occur at said position in nature. In other words, a specific nucleic acid sequence comprising a heterologous sequence is a nucleic acid sequence that does not normally occur in nature but is introduced therein via random or targeted genetic modification.
(37) A heterologous protein is understood herein as a protein which is not naturally produced by a particular cell for which the protein is indicated as being heterologous.
(38) A homologous protein is understood herein as a protein that is naturally produced by a particular cell for which the protein is indicated as being homologous. A homologous protein may be either an endogenous protein of a cell or exogenous protein, i.e. being recombinantly produced by a cell in case the cell has been transduced with an expression vector encoding the homologous protein.
(39) It will be appreciated that engineered may be used herein to refer to artificially produced cells (eg. genetically modified cells) or nucleic acid or protein sequences.
(40) The word approximately or about when used in association with a numerical value (approximately 10, about 10) preferably means that the value may be the given value of more or less 10% of the value.
(41) In this document and in its claims, the verb to comprise and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article a or an does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article a or an thus usually means at least one.
(42) All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.
(43) A microbial production system able to produce and secrete high amounts of a specific enzyme, particularly without the presence of high levels of other proteins, including proteins which have a negative impact on the activity of the desired protein, would have utility for both research and industrial applications. It may enable simplified screening of hosts functionally expressing a desired enzyme. It may furthermore enable production of relatively pure enzyme. It may also enable simplified large scale purification of the desired enzyme. These advantages would greatly contribute to e.g. easy generation of artificial enzyme mixes tailored for different applications, e.g. for, but not limited to plant biomass hydrolysis (biofuels and chemicals), textile finishing, applications in paper and pulp, and feed and food industry. Relatively pure enzymes, produced using the methods described, are also enabling the design of efficient processes for, but not limited to biocatalysis, bioconversion and bioremediation, either in solution (e.g. in water or mixed solvents) or in immobilized formats.
(44) Mutants of a fungal strain with unexpectedly high protein production capacity, while maintaining good growth characteristics and amenability to genetic modification were identified. These mutants are useful as a microbial production system. Disclosed herein is the discovery that modification of an enzyme in the SUMOylation machinery is responsible for the increase in protein production. Protein or enzyme SUMOylation is a post-translational modification mechanism involving the covalent attachment of a member of the SUMO-(small ubiquitin-like modifier)-proteins to lysine residues of the protein or enzyme to be modified (SUMOylated) via enzymatic cascade analogous to, but distinct from, the ubiquitination pathway (Wilkinson and Henley, Biochem. J. 2010, 428(2): 133-145). Examples of SUMO-proteins are Smt3, SUMO-1, SUMO-2, SUMO-3 and SUMO-4. It has been reported that the effect of protein SUMOylation of the substrate protein may result in altered (increased or decreased) activity, functionality and/or protein interaction of the substrate protein. SUMO-conjugation proceeds via E1, E2 and E3 enzymes. Via the E1 activating enzyme, SUMO proteins are activated in an ATP-dependent manner. The activated SUMO protein is then transferred to the substrate protein via an E2 conjugating enzyme, often in conjugation with an E3 ligase enzyme. SUMO proteases play a role in both de-SUMOylation of the SUMOylated substrate proteins and in activation of precursor SUMO proteins. Multiple E1 activating enzymes, E3 ligases and SUMO proteases are known, however, Ubc9 is the only known E2 conjugating enzyme and is highly conserved across organisms (see, for example,
(45) Therefore, provided is a modified cell having an increased protein production, wherein said cell has been modified to result in altered SUMOylation. SUMOylation may be altered by modification of a protein of the SUMOylation machinery and/or its encoding gene, or by exposure, incubation or insertion of SUMOylation modifying agents, preferably resulting in a reduction of SUMOylation within the cell. Examples of SUMOylation modifying agents are ginkgolic acid, kerriamycin B, spectomycin B1, chaetochromin A, viomellein and/or a derivative therefrom. Spectomycin B1 and related natural products disclosed in the paper of Hirohama et al., (ACS Chem, Biol. 2013, 8, 2635-2642) inhibit SUMOylation by inhibition of Ubc9.
(46) Modification of SUMOylation in a cell may be confirmed using commercially available kits (eg. from Abcam, Cambridge, Mass.) and/or methods known in the art. Methods known in the art include, for example, ATP:PPi isotope exchange assay, determination of E1-catalyzed ATP:AMP exchange rates with thin layer chromatography, or determination of E1-SUMO conjugates by gel-based assay (Alontaga, et al., July 2012, Biochemical Analysis of Protein SUMOylation in Curr Protoc Mol Biol, Chapter 10: Unit 10.29).
(47) In embodiments, the modified cell shows an increased protein production as compared to its parental cell as detected under substantially the same or comparable conditions. The increase in protein production may be an increase in total or overall protein production. In embodiments, the modified cell shows an increased protein production of at least 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45 or at least 50 fold as compared to the parental cell. The parental cell is to be understood herein as the ancestor wherefrom the modified cell is directly derived by altering SUMOylation as defined herein. Preferably, the modified cell is directly derived from the parental cell (i) by genetic modification of at least one gene encoding an endogenous protein of the SUMOylation machinery, and/or (ii) by exposure, incubation or insertion of at least one SUMOylation modifying agents, preferably an inhibitor of at least one endogenous protein of the SUMOylation machinery.
(48) Increase in protein production can be measured by any suitable technique known in the art. Protein production can be measured by detecting total or a particular type of protein produced and/or secreted by the cell during a particular period of cell culture. Total or overall protein production can be measured using commercially available assays such as the colorimetric Bradford and Lowry method and the method using commercially available colorimetric methods such as the BCA assay (e.g. Pierce; Biorad). The increase in protein production may be measured by detecting the amount of extracellular protein encoded by detecting the amount of protein present in the culture or fermentation medium of the cell after a defined time. The increase in protein production may be measured by detecting the amount or activity of a particular protein (cellular or extracellular) via methods known in the art.
(49) One of skill in the art will also appreciate that an increase in protein production may enable desirable alterations in production processes. Such improvements may be demonstrated by improvements in production parameters measured by methods known to those of skill in the art. For example, increased protein production may result in increased titer, increased volumetric productivity, increased specific productivity, and/or increased yield. Increased titer may be measured, for example, by amount of protein or enzyme activity per volume of fermentation broth or fermentation supernatant (e.g. gram protein/liter or activity units/liter) at a given time point during fermentation. Increased volumetric productivity may be measured, for example by rate of protein or enzyme activity per volume of fermentation broth or fermentation supernatant (e.g. gram protein/liter/hour or activity units/liter/hour). Increased specific productivity (including, for example, maximum specific productivity) may be measured, for example, by rate of protein or enzyme activity produced per cell mass (e.g., gram protein/gram dry cell weight/hour or activity units/gram dry cell weight/hour). Increased yield may be measured, for example, by amount of protein or enzyme activity produced per amount of carbon or carbon source (e.g., glucose) consumed during fermentation (e.g. gram protein/gram glucose or activity units/gram glucose or gram of carbon in protein/gram carbon fed). Accordingly, provided herein are production processes comprising fermentation of the modified cells herein to produce a product wherein at least one production parameter is increased. Such increase may be at least about 1%, at least about 5%, at least about 10%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%.
(50) The increase in protein production may be an increase production of a protein of interest of at least 1.1 fold as compared to the production of said protein by the parental cell that lacks the modification of SUMOylation. Preferably, the modified cell shows an increased production of the protein of interest of at least about 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45 or at least about 50 fold as compared to the parental cell. Such protein of interest may be a protein encoded by a transgene acting as a reporter (denominated herein as the reporter protein) that has been introduced in the modified cell in order to detect protein production capacity of the modified cell. In establishing the increase in protein production caused by modification of SUMOylation, both the parental cell and the modified cell comprise the reporter gene, and production of the encoded protein is compared between these cells are kept under substantially the same cultural conditions. Reporter gene production can be measured by a suitable method in the art to identify the amount of reporter gene produced, e.g. fluorescence may be measured in case the reporter gene is a fluorescent protein or enzyme activity may be measured in case the reporter gene is an enzyme.
(51) A suitable reporter transgene comprises a coding sequence of a reporter protein, operably linked to a promoter sequence that allows for expression of the coding sequence of the reporter transgene in the modified cell and its parental cell. For instance, in case the modified cell is a fungal cell of the strains Myceliophthora thermophila, the promoter sequence may be a promoter sequence as disclosed in WO2010/107303 A2, which is incorporated herein by reference. The reporter protein may be a secreted protein, and protein levels can be measured by detecting the levels of extracellular protein. The reporter gene may be linked, e.g., physically linked, to a gene encoding a selectable marker such as, but not limited to the amdS selectable marker. A reporter gene exemplified herein and suitable for use in a fungal host cell, such as a fungal host cell of the strain M. thermophila, is represented by SEQ ID NO: 4, which comprises a chi1 promoter sequence and a cellulase (Eg2) encoding sequence. A further reporter gene exemplified herein and suitable for use in a fungal host cell, such as a fungal host cell of the strain M. thermophila, is represented by SEQ ID NO: 5, which comprises a chi1 promoter sequence or a cbh1 promoter sequence and a polygalacturonase (AnPGII) encoding sequence. A further reporter gene exemplified herein and suitable for use in a fungal host cell, such as a fungal host cell of the strain M. thermophila, is represented by SEQ ID NO: 6, which comprises a chi1 promoter sequence and a -xylosidase (Bxl1) encoding sequence. A further reporter gene exemplified herein and suitable for use in a fungal host cell, such as a fungal host cell of M. thermophila, comprises a chi1 promoter sequence or a cbh1 promoter sequence and a sequence encoding a glucoamylase, such as a T. reesei glucoamylase. A further reporter gene exemplified herein and suitable for use in a fungal host cell, such as a fungal host cell of M. thermophila, comprises a chi1 promoter sequence or a cbh1 promoter sequence and sequence encoding phytase, for example a Buttiauxella sp. phytase variant (SEQ ID Nos 53 and 54, respectively). An example sequence encoding a phytase suitable for expression in a fungal cell may comprise the sequence of nucleotides 1905-3184 of SEQ ID NO: 40. Accordingly, suitable proteins of interest include, but are not limited to, Eg2, Bxl1, AnPGII, T. reesei glucoamylase, and Buttiauxella sp. phytase variant.
(52) It will be appreciated that a protein of interest can also be measured using an assay specific to the protein. Such assays are known to those of skill in the art and may include, for example, binding assays, HPLC, ELISA, gel densitometry, or methods useful for determination of total protein levels. Also, as demonstrated in the Examples, increase in production of an enzyme protein of interest may be measured using an activity assay appropriate for the protein of interest. One of ordinary skill in the art will readily be able to select an appropriate measurement method for the desired protein.
(53) In an embodiment, SUMOylation has been altered in the modified cell by genetic modification of at least one gene of the SUMOylation pathway, such as a gene encoding an endogenous SUMOylation enzyme or a gene encoding an endogenous SUMO protein. In embodiments, the genetic modification may be a targeted genetic modification of at least one gene of the SUMOylation pathway, such as a gene encoding an endogenous SUMOylation enzyme or a gene encoding an endogenous SUMO protein. Examples of proteins of the SUMOylation machinery are: Ubc9, Smt3, SUMO-1, SUMO-2, SUMO-3 and SUMO-4, Siz1, Siz2, Cst9, Mms21, PIAS1, PIAS3, PIAS4, PIASx, PIASx, PIASy, RanBP2, Pc2, Mms21, HDAC4, HDAC7, MUL1, Rhes, TOPORS, TLS, FUS, RSUME, ZMIZ1, NSE2, TRAF7, Ulp1, Ulp2, Aos1, Uba2, SENP-1, SENP-2, SENP-3, SENP-4, SENP-5, SENP-6, SENP-7, DESI-1, DESI-2 and USPL1. The genetic modification may encompass one or more point mutations, one or more insertions of a heterologous sequence and/or one or more deletions of (part of) the endogenous sequence of the gene encoding said SUMOylation enzyme or protein. The point mutations(s), insertion(s) and/or deletion(s) may be located in the coding sequence and/or in a regulating sequence. Examples of an expression regulation sequence are a promoter sequence, a terminator sequence, a promoter activating sequence and a sequence encoding transcription factors. The modification may result in removal or disruption of the whole or part of the gene encoding the endogenous SUMOylation enzyme or protein, or replacing all or part of the gene for instance with a gene encoding a selection marker. An example of a suitable selection marker is the AmdS selectable marker. The modification may encompass knocking out the endogenous copy of the gene. A knock out of a gene refers to a molecular biological technique by which the gene in the organism is made inoperative, so that the expression of the gene is substantially reduced or eliminated. Further encompassed are point mutations resulting in a reduced or eliminated enzyme or protein production and/or activity.
(54) The genetic modification may result in altered production, activity or both an altered production and activity of the encoding SUMOylation enzyme or protein. The genetic modification may result in a reduced or even abolished production and/or activity of the encoded SUMOylation enzyme or protein, and may result in reduced or abolished SUMOylation.
(55) Such genetic modification can be made using methods known to those of skill in the art equipped with the sequence of a gene encoding a SUMOylation enzyme or protein. Expression regulating sequences are readily identifiable by those of skill in the art. Suitable methods for genetic modification include those known to those of skill in the art and include, but are not limited to, those exemplified herein, homologous recombination, RNA silencing, and CRISPR/Cas systems (Timberlake, et al. 1989, Science 244(4910):1313-1317.; Moore, p. 36-66, in Biotecnology Vol III: Fundamentals in Biotechnol. Eds. Doelle, Robek, Berovic (2009); Singh, et al. 2017, Gene 599: 1-18). Suitable reagents and methods are likewise known in the art and/or are commercially available (see, for example, WO2016100568A1, WO2016100272A1 and WO2016100571A1, each of which is incorporated herein by reference). For example, purified Cas9 protein and guide RNAs, or kits to make guide RNAs, can be obtained from PNA BIO (www.pnabio.com; Newbury Park, Calif.), NEB (www.neb.com; Ipswich, Mass.), ThermoFisher (www.thermofisher.com; Waltham, Mass.), and IDT (www.idtdna.com or www.idtdna.com/site/order/oligoentry/index/crispr/2 nm; Coralville, Iowa).
(56) Production of endogenous SUMOylation enzymes or protein can be detected by techniques known in the art. The genetic modification of the modified cell may result in a reduction of total amount of transcripts of the modified SUMOylation enzyme or protein as can be detected by a suitable assay known in the art, for instance via RNA-seq as exemplified herein (referred is to Example 1 of this disclosure). The amount of said transcripts in the modified cell may be reduced by at least about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8. 0.9, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 45, 50, 60, 70, 80, 90, or at least 100 fold as compared to the amount of said transcripts in the parental cell. In combination with the indicated reduction defined above, the genetic modification may be such that the amount of said transcripts is not reduced to zero, but the residual amount of said transcripts is at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% of the amount of said transcripts present in the parental cell.
(57) The genetically modified cell structurally differs from the parental cell in that it comprises a genetic modification. The modified cell may have been directly obtained from the parental cell by introducing the genetic modification. The modified gene may be any one of the genes encoding the proteins selected from the group consisting of Ubc9, Smt3, SUMO-1, SUMO-2, SUMO-3 and SUMO-4, Siz1, Siz2, Cst9, Mms21, PIAS1, PIAS3, PIAS4, PIASx, PIASx, PIASy, RanBP2, Pc2, Mms21, HDAC4, HDAC7, MUL1, Rhes, TOPORS, TLS, FUS, RSUME, ZMIZ1, NSE2, TRAF7, Ulp1, Ulp2, SENP-1, SENP-2, SENP-3, SENP-4, SENP-5, SENP-6, SENP-7, DESI-1, DESI-2 and USPL1, and homologs of any of these proteins or enzymes. Homologs can be identified in a particular cell of interest using methods known in the art, for example, sequence alignments, generation of phylogenetic trees and analysis. The genetic modification may encompass random or site-directed mutation, deletion, disruption, silencing of coding sequences and/or expression regulatory sequences of genes encoding one or more SUMOylation proteins that result in an increase in protein production by the cell comprising the modification as defined herein, i.e. as compared to protein production by its parental cell when tested under substantially the same conditions.
(58) The genetic modification may comprise or consist of a modification of the gene encoding Ubc9. The endogenous ubc9 gene may any one known to one of skill in the art, for example, the ubc9 gene encoding Ubc9 of Myceliophthora thermophila (SEQ ID NO: 2), Neurospora crassa Ubc9 (nucleic acid SEQ ID NO: 8; protein SEQ ID NO: 9; Accession Nos.: NCU04302; XM_955999), Aspergillus nidulans Ubc9 (nucleic acid SEQ ID NO: 10; protein SEQ ID NO: 11; Accession No.: AN_4399), Cryptococcus neoformans (nucleic acid SEQ ID NO: 12; protein SEQ ID NO: 13; Accession No: CNAG_04328), Saccharomyces cerevisae Ubc9 (nucleic acid SEQ ID NO: 14; protein SEQ ID NO: 15; Accession Nos: YDL064W; Z74112.1), Aspergillus niger Ubc9 (nucleic acid SEQ ID NO: 45; protein SEQ ID NO: 46), and Trichoderma reesei Ubc9 (promoter sequence SEQ ID NO: 47; coding SEQ ID NO: 48; cDNA SEQ ID NO: 49, protein SEQ ID NO: 50). Sequence information may be found, for example, in public databases, such as in JGI MycoCosm (genome.jgi.doe.gov/programs/fungi/index.jsf); National Center for Biotechnology Information (NCBI; www.ncbi.nlm.nih.gov); Aspergillus Genome Database (AsGD; www.aspergillusgenome.org); or Saccharomyces Genome Database (SGD; www.yeastgenome.org). The genetic modification may be in a gene encoding a protein having comprising at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to, or comprising, the sequence of one or more or both of the following sequence motifs: RLQEERKQWRKDHPFGF (SEQ ID NO: 42) and KPPKCKFTPPLFHPNVYPSGTVCLSIL (SEQ ID NO: 43). The genetic modification may be a modification of a regulating region of the ubc9 gene, for example in the promoter sequence of the ubc9 gene, for example by an expression cassette insertion in the ubc9 promoter region, upstream of the protein coding sequence. An example of an insertion cassette for disruption of the ubc9 promoter sequence in M. thermophila is represented by SEQ ID NO: 3. Examples of target sequences for disruption of the ubc9 promoter sequence in T. reesei are represented by SEQ ID Nos: 30, 31, and 32. An example of an insertion cassette for disruption of the ubc9 promoter sequence in A. niger is represented by SEQ ID NO: 26. Also contemplated herein are other genetic modifications resulting in modification of ubc9 expression, Ubc9 production or activity, such as inactivating mutants of Ubc9 or gene disruptions in the ubc9 coding sequence, preferably resulting in reduced or abolished Ubc9 production and/or activity.
(59) The modified cell may be characterized in that it comprises an endogenous ubc9 (ubiquitin conjugating enzyme or E2 enzyme) gene that has been modified to increase protein production. The endogenous ubc9 gene comprising the modification in the modified cell may have a wild type (unmodified) counterpart that has at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1 over its whole length, or that has at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1 delimited by the nucleotides on positions 1070 and 2195 (i.e. SEQ ID NO: 1 (1070-2195)) over its whole length, or that has at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the sequence of SEQ ID NO: 1 delimited by the nucleotides on positions 1302 and 1994 (i.e. SEQ ID NO: 1 (1302-1994) representing the open reading frame) over its whole length. The endogenous ubc9 gene comprising the modification in the modified cell may have a wild type counterpart comprising a sequence that has at least the modified cell may have a wild type (unmodified) counterpart that has at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 47 or to SEQ ID NO: 48 over its whole length. The endogenous ubc9 gene comprising the modification in the modified cell may have a wild type counterpart comprising a sequence that has at least the modified cell may have a wild type (unmodified) counterpart that has at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the promoter or coding portion of SEQ ID NO: 45.
(60) The endogenous ubc9 gene comprising the genetic modification in the modified cell may encode an Ubc9 protein having a sequence that has at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2 over its whole length. The endogenous ubc9 gene comprising the genetic modification in the modified cell may encode an Ubc9 protein having a sequence that has at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 50 over its whole length. The endogenous ubc9 gene comprising the genetic modification in the modified cell may encode an Ubc9 protein having a sequence that has at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 46 over its whole length.
(61) Equipped with this disclosure, one of skill in the art can readily identify a ubc9 sequence in an organism of interest. For example, an alignment of over 600 publicly available Ubc9 orthologs revealed two prominent stretches of extended and strong sequence conservation, named herein motif 1 (17 aa; SEQ ID NO: 42) and motif 2 (27 aa; SEQ ID NO: 43) (see
(62) The modified cell may have an insertion or disruption of an endogenous ubc9 gene promoter sequence. The ubc9 promoter sequence may be disrupted by insertion of an expression cassette, for example, the ubc9 promoter sequence is disrupted by insertion of an expression cassette on a position that is analogous to nucleotides within the promoter sequence of the ubc9 gene of M. thermophila that are represented by the nucleotides on position 1257 and 1258 of SEQ ID NO: 1. Promoter sequence disruption at this position was found to result in an unexpected increase in overall protein production, more in particular in expression of transduced reporter genes that encode extracellularly secreted proteins. Without wishing to be bound by any theory, disruption of the promoter sequence is likely to impair functional expression of the encoded Ubc9 protein, which, possibly via its crucial role in post-translational modification-pathways, results in an increase in net protein production. It will be appreciated that endogenous ubc9 gene modification is not limited to promoter sequence disruption. Contemplated herein are ubc9 gene modifications resulting in impairing or abolishing functional expression of the encoded ubc9 protein. Moreover, contemplated herein are SUMOylation enzyme, protein or gene modifications resulting in an overall increase in protein production.
(63) In another embodiment, or in combination with the embodiment defined above, the modified cell is exposed to one or more biological or chemical agents that alter SUMOylation, such as SUMOylation enzyme inhibitors or activators. The modified cell may be exposed to at least one inhibitor of a SUMOylation enzyme at a concentration effective to inhibit activity of said enzyme. The inhibitor may be any one selected from the group consisting ginkgolic acid, kerriamycin B, spectomycin B1, chaetochromin A, viomellein and/or a derivative therefrom. Spectomycin B1 and related natural products disclosed in the paper of Hirohama et al., (ACS Chem, Biol. 2013, 8, 2635-2642) inhibit SUMOylation by inhibition of Ubc9. Therefore, the modified cell may be exposed to Spectomycin B1 and/or related natural products disclosed in the paper of Hirohama et al., (ACS Chem, Biol. 2013, 8, 2635-2642) at a concentration effective to inhibit activity of said enzyme. The modified cell may be exposed to an agent that alters SUMOylation in a concentration of said agent that results in an increase in protein production as defined herein, i.e. as compared to its parental cell when tested under substantially the same conditions. The modified cell exposed to one or more SUMOylation enzyme inhibitors or activators as defined herein may be structurally similar to the parental cell and only differs therefrom in that it is exposed to said inhibitor(s) or activator(s). The modified cell may be exposed to an inhibitor to result in a reduced enzyme activity by at least about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8. 0.9, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 45, 50, 60, 70, 80, 90, or at least about 100 fold as compared to the enzyme activity of the parental cell. In combination with the indicated reduction defined above, the resulting enzyme activity may be such that the amount of enzyme activity is not reduced to zero, but the residual enzyme activity is at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% of the activity in the parental cell.
(64) As modified cells provided herein show high protein production capacity, modified cells provided herein may be used in industrial protein production, such as, but not limited to, production of pharmaceutical proteins and/or industrial enzymes (also denominated herein proteins of interest). A protein of interest may be an endogenous protein or an exogenous protein, i.e. encoded by a transgene. The transgene may encode a homologous or a heterologous protein. The modified cell encoding and producing a protein of interest (or a protein mixture of interest) is also denominated herein as an expression system.
(65) In the embodiment of the invention wherein the protein of interest is a transgene, the modified cell comprises an exogenous expression construct or vector that encodes at least one protein of interest, encoded by a transgene comprised on the expression construct or vector. The expression construct may comprise portions of a gene or polynucleotide encoding the protein of interest that are not part of the coding region for the protein (e.g., introns or regulatory regions of a gene encoding the protein) and may be double stranded, single stranded and can include DNA, RNA, or derivatives of either DNA or RNA, including cDNA, probes and primers, including guide sequences. Optionally, the expression construct encodes for one or more industrial enzymes. The expression construct may be a chimeric expression construct or vector encoding at least two proteins of interest.
(66) It will be appreciated by one skilled in the art that use of recombinant DNA technologies can affect control of expression of transfected expression vectors (encoding either homologous or heterologous proteins) by manipulating, for example, the number of copies of sequences encoding the protein of interest within the host cell, the efficiency with which those sequences encoding the protein of interest are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of posttranslational modifications. The transgene may comprise translation enhancing and/or regulating sequences such as promoter sequences suitable for expression in the host cell of interest. Such promoter sequence may be a promoter sequence for expression of proteins in Myceliophthora thermophila, such as Myceliophthora thermophila C1, are disclosed in WO2010/107303 A2, which is incorporated herein by reference. For example, such promoter sequence may comprise a Myceliophthora thermophila chit promoter sequence, such as SEQ ID NO: 51, or a Myceliophthora thermophila cbh promoter sequence, such as SEQ ID NO: 52, or a promoter sequence having at least about 85%, at least about 90%, at least about 95% or at least about 99% identity to SEQ ID NO: 51 or 52. Suitable promoter sequences for expression of proteins in Trichoderma may include, but are not limited to, a T. reesei cbh1, cbh2, egl1, egl2, egl3, egl4, egl5, pki1, gpd1, xyn1, or xyn2 promoter. Additionally, the promoter sequence may be genetically engineered to improve the level of expression as compared to the native promoter. Recombinant techniques useful for controlling the expression of nucleic acid molecules include, but are not limited to, integration of the nucleic acid molecules into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites), modification of nucleic acid molecules to correspond to the codon usage of the host cell, and deletion of sequences that destabilize transcripts.
(67) The protein or proteins of interest may be an enzyme mixture or multi-enzyme composition. In other words, the modified cell may be further modified to produce further enzymes or enzyme mixtures or multi-enzyme compositions that are beneficial for industrial purposes.
(68) The protein of interest may be, for example, a hemicellulase, a peroxidase, a protease, a cellulase, a xylanase, a lipase, a phospholipase, an esterase, a cutinase, a pectinase, a keratinase, a reductase, an oxidase, a phenol oxidase, a lipoxygenase, a ligninase, a pullulanase, a tannase, a pentosanase, a mannanase, a beta-glucanase, an arabinosidase, a hyaluronidase, a chondroitinase, a laccase, an amylase, a glucoamylase, a mixture thereof, a functional fragment thereof, or a mixture of one or more of the enzymes or functional fragments thereof. Non-limiting examples of proteins may further include proteins or enzymes involved in starch metabolism, proteins or enzymes involved in glycogen metabolism, acetyl esterases, aminopeptidases, amylases, arabinases, arabinofuranosidases, carboxypeptidases, catalases, cellulases, chitinases, chymosin, cutinase, deoxyribonucleases, epimerases, esterases, -galactosidases, -galactosidases, -glucanases, glucan lysases, endo--glucanases, glucoamylases, glucose oxidases, a-glucosidases, -glucosidases, glucuronidases, hemicellulases, hexose oxidases, hydrolases, invertases, isomerases, laccases, lipases, lyases, mannosidases, oxidases, oxidoreductases, pectate lyases, pectin acetyl esterases, pectin depolymerases, pectin methyl esterases, pectinolytic enzymes, peroxidases, phenoloxidases, phytases, polygalacturonases, proteases, rhamno-galacturonases, ribonucleases, thaumatin, transferases, transport proteins, transglutaminases, xylanases, hexose oxidase (D-hexose: 02-oxidoreductase, EC 1.1.3.5), variants thereof, functional fragments thereof, or combinations thereof. The protein of interest may also be a peptide hormone, a growth factor, a clotting factor, a chemokine, a cytokine, a lymphokine, an antibody, a receptor, an adhesion molecule, a microbial antigen (e.g., HBV surface antigen, HPV E7, etc.), or a variant, functional fragment, or a mixture of two or more, three or more, four or more, five or more, or six or more of the above substances. Mixtures of enzymes may include, for example, combinations disclosed in PCT Application Publication Nos WO2008/153903, WO2012/125951 and/or WO2012/125937, each of which is incorporated herein by reference.
(69) The modified cell may be a cell that encodes (either endogenous and/or transgenically) and produces a multi-enzyme composition suitable for degrading a lignocellulosic and/or hemicellulosic material. Such multi-enzyme composition may comprise at least one cellobiohydrolase, at least one xylanase, at least one endoglucanase, at least one -glucosidase, at least one -xylosidase, and at least one accessory enzyme. In embodiments, the multi-enzyme composition may lack enzymes which lead to the formation of cellobionolactone/cellobionic acid and/or gluconolactone/gluconic acid. A xylanase may be an endoxylanase, an exoxylanase, or a -xylosidase. An accessory enzyme can have the same or similar function or a different function as an enzyme or enzymes in a core set of enzymes. Suitable accessory enzymes have been described elsewhere herein, and can generally include cellulases, xylanases, ligninases, amylases, lipidases, or glucuronidases, for example. Some accessory enzymes for example can include enzymes that when contacted with biomass in a reaction, allow for an increase in the activity of enzymes (e.g., hemicellulases) in the multi-enzyme composition. An accessory enzyme or enzyme mix may be composed of enzymes from (1) commercial suppliers; (2) cloned genes expressing enzymes; (3) complex broth (such as that resulting from growth of a microbial strain in media, wherein the strains secrete proteins and enzymes into the media); (4) cell lysates of strains grown as in (3); and, (5) plant material expressing enzymes capable of degrading lignocellulose. In some embodiments, the accessory enzyme is a glucoamylase, a pectinase, or a ligninase. Accessory enzymes include an enzyme selected from the group consisting of: cellulase, glucosidase, lytic polysaccharide monooxygenase (or GH61 or polypeptide having cellulolytic enhancing activity), xylanase, xylosidase, ligninase, glucuronidase, arabinofuranosidase, arabinase, arabinogalactanase, ferulic acid esterase, lipase, pectinase, glucomannase, amylase, laminarinase, xyloglucanase, galactanase, galactosidase, glucoamylase, pectate lyase, chitosanase, exo--D-glucosaminidase, cellobiose dehydrogenase, and acetyl xylan esterase. In embodiments, the accessory enzymes are present in an enzyme mixture in the absence of enzymes which lead to the formation of cellobionolactone/cellobionic acid and/or gluconolactone/gluconic acid. The multi-enzyme composition may further comprise at least one hemicellulase. A hemicellulase may be selected from the group consisting of a xylanase, an arabinofuranosidase, an acetyl xylan esterase, a glucuronidase, an endo-galactanase, a mannanase, an endo-arabinase, an exo-arabinase, an exo-galactanase, a ferulic acid esterase, a galactomannanase, a xyloglucanase, and mixtures thereof. A xylanase may be selected from the group consisting of endoxylanases, exo-xylanases, and -xylosidases. The multi-enzyme composition may further comprise at least one cellulase.
(70) Multi-enzyme compositions contemplated herein may be obtained from the modified cell as a crude fermentation product optionally subjected to a purification step. The multi-enzyme composition may further comprise one or more accessory enzymes. Accessory enzymes may include at least one enzyme selected from the group consisting of: cellulase, glucosidase, lytic polysaccharide monooxygenase (or GH61 or polypeptide having cellulolytic enhancing activity), xylanase, xylosidase, ligninase, glucuronidase, arabinofuranosidase, arabinase, arabinogalactanase, ferulic acid esterase, lipase, pectinase, glucomannanase, amylase, laminarinase, xyloglucanase, galactanase, galactosidase, glucoamylase, pectate lyase, chitosanase, exo--D-glucosaminidase, cellobiose dehydrogenase, acetylxylan esterase and acetylesterase. In some embodiments, the accessory enzyme is produced by culturing the modified cell on a substrate to produce the enzyme. The multi-enzyme composition may further comprise at least one protein for degrading an arabinoxylan-containing material or a fragment thereof that has biological activity. The multi-enzyme composition may further comprise at least one endoxylanase, at least one -xylosidase, and at least one arabinofuranosidase. An arabinofuranosidase may comprise an arabinofuranosidase with specificity towards single substituted xylose residues, an arabinofuranosidase with specificity towards double substituted xylose residues, or a combination thereof.
(71) Multi-enzyme compositions may also include cellulases, hemicellulases (such as xylanases, including endoxylanases, exoxylanases, and -xylosidases; mannanases, including endomannanases, exomannanases, and -mannosidases), ligninases, amylases, glucuronidases, proteases, esterases (including ferulic acid esterase), lipases, glucosidases (such as -glucosidase), and xyloglucanases.
(72) Also contemplated is a modified cell that produces mixtures that comprise enzymes that are capable of degrading cell walls and releasing cellular contents. Such cell may be a bacterial cell, or a cell of an alga, fungus, or a plant which produces the enzymes naturally or by virtue of being genetically modified to express the enzyme or enzymes.
(73) In an embodiment, the multi-enzyme composition is employed in a process to obtain fermentable products, such as sugars, from degrading biomass and/or lignocellulosic material, such as biomass rich in hemicellulose, as defined herein. Said lignocellulosic material may be, for example, agro-waste or a residue produced by agriculture and forestry. The lignocellulosic material may be, for example, corn stover, bagasse, or wheat straw. The lignocellulosic material may be pretreated lignocellulosic material. Pretreated lignocellulosic material may be produced, for example, by subjecting a biomass material to elevated temperature and the addition of dilute acid, concentrated acid or dilute alkali solution. Pretreated lignocellulosic material may be produced, for example, by subjecting a biomass material to low ammonia concentration under conditions of high solids. The lignocellulosic material may be partially or completely degraded to fermentable sugars. Economical levels of degradation at commercially viable costs are contemplated. Due in part to the many components that comprise biomass and lignocellulosic materials, enzymes or a mixture of enzymes capable of degrading xylan, lignin, protein, and carbohydrates are needed to achieve saccharification. The one or more additional enzymes may include enzymes or compositions thereof with, for example, oxidoreductases, cellobiohydrolase, endoglucanase, -glucosidase, xylanase and other hemicellulase activities. These enzyme compositions are suitable for degrading biomass, such as biomass rich in hemicellulose, such as pulp, as defined herein.
(74) The multi-enzyme composition is to dissolve pulp for the production of chemicals such as, but not limited to, rayon, cellophane and several chemicals such as cellulose esters (acetates, nitrates, propionates and butyrates) and cellulose ethers (carboxymethyl cellulose and methyl and ethyl cellulose) and ethanol (for instance as bioethanol biofuel). Also contemplated is a multi-enzyme composition for paper and pulp bleaching. The multi-enzyme composition may be used to improve bleachability of pulp in the pulp and paper industry.
(75) The modified cell (e.g., a host cell or production organism) may include any microorganism such as a protist, an alga, a fungus, or other eukaryotic microbe, plant, insect, or animal cell and may be a yeast or a filamentous fungus. The modified cell may be any fungal (e.g., filamentous fungi or yeast or mushrooms), alga, plant, insect, or animal cell that can be transfected. The modified cell is may be a cultured cell. Suitable genera of yeast include, but are not limited to, Saccharomyces, Schizosaccharomyces, Candida, Hansenula, Pichia, Kluyveromyces, and Phaffia. Suitable yeast species include, but are not limited to, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida albicans, Hansenula polymorpha, Pichia pastoris, Pichia canadensis, Kluyveromyces marxianus and Phaffia rhodozyma.
(76) Suitable fungal genera include, but are not limited to, Chrysosporium, Thielavia, Neurospora, Aureobasidium, Filibasidium, Piromyces, Corynascus, Cryptococcus, Acremonium, Tolypocladium, Scytalidium, Schizophyllum, Sporotrichum, Penicillium, Gibberella, Myceliophthora, Mucor, Aspergillus, Fusarium, Humicola, and Trichoderma, Talaromyces, Rasamsonia and anamorphs and teleomorphs thereof. Suitable fungal species include, but are not limited to, Aspergillus niger, Aspergillus oryzae, Aspergillus nidulans, Aspergillus japonicus, Absidia coerulea, Rhizopus oryzae, Myceliophthora thermophila, Neurospora crassa, Neurospora intermedia, Trichoderma reesei, Trichoderma longibrachiatum, Penicillium canescens, Penicillium solitum, Penicillium funiculosum, Acremonium alabamense, Thielavia terrestris, Sporotrichum thermophile, Sporotrichum cellulophilum, Chaetomium globosum, Corynascus heterothallicus, Talaromyces emersonii, Rasamsonia emersonii and Talaromyces flavus.
(77) The modified cell may be a (further) genetically modified cell or microorganism, i.e. comprising (further) genetic modifications in addition to the possible modification of the gene encoding a SUMOylation enzyme or SUMO-protein and introduction of transgenes encoding one or more proteins of interest as detailed herein. The cell may be further modified in order to produce reduced amounts or to lack the production of enzymes that interfere/compete with the expression and/or secretion of the protein of interest and/or with the production or enzymatic activity of the protein of interest. For instance, such cell may be modified in order to downregulate the interfering enzyme activity. Downregulation may be achieved, for example, by introduction of inhibitors (chemical or biological) of the enzyme activity, by manipulating the efficiency with which those nucleic acid molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications, or by gene mutation, disruption or deletion. Alternatively, the activity of the enzyme production or activity may be upregulated in case the enzyme production or activity has a positive effect on the production or activity of the enzyme of interest. Such enzymes may be accessory enzymes, for instance in case the enzyme of interest is for degrading lingo-cellulosic material. Also contemplated herein is downregulating activity of one or more enzymes while simultaneously upregulating activity of one or more enzymes to achieve the desired outcome.
(78) The modified cell may be a fungal cell, or even a filamentous fungal cell. The modified cell may be a fungal cell from the genus selected form the group consisting of Chrysosporium, Thielavia, Neurospora, Aureobasidium, Filibasidium, Piromyces, Corynascus, Cryptococcus, Acremonium, Tolypocladium, Scytalidium, Schizophyllum, Sporotrichum, Penicillium, Gibberella, Myceliophthora, Mucor, Aspergillus, Fusarium, Humicola, Trichoderma, Talaromyces and Rasamsonia. The modified cell may be a Myceliophthora thermophila cell, such as of the strain CI (VKM F-3500 D) or a mutant strain derived therefrom (e.g., UV13-6 (Accession No. VKM F-3632 D); NG7C-19 (Accession No. VKM F-3633 D); UV18-25 (VKM F-3631D), UV18#100f (CBS122188), W1L (CBS122189), or W1L#100L (CBS122190)). The strain may be a strain with reduced expression of protease and (hemi-)cellulase, and may even be free of protease and (hemi-)cellulase expression. The strain may be W1 L#100.lpyr5alp1, also denominated as the LC strain (Visser H, et al., Ind. Biotechnol. 7:214-222, 2011 and WO2010/107303, which is incorporated herein by reference. As described in U.S. Pat. No. 6,015,707 or U.S. Pat. No. 6,573,086 a strain called C1 (Accession No. VKM F-3500 D), was isolated from samples of forest alkaline soil from Sola Lake, Far East of the Russian Federation. This strain was deposited at the All-Russian Collection of Microorganisms of Russian Academy of Sciences (VKM), (www.vkm.ru; Bakhurhina St. 8, Moscow, Russia, 113184; Prospekt Nauki No. 5, Pushchino, Moscow Region, 142290, Russia) under the terms of the Budapest Treaty on the International Regulation of the Deposit of Microorganisms for the Purposes of Patent Procedure on Aug. 29, 1996 (by A. P. Sinitsyn, O. N. Okunev, I. V. Solov'eva, V. M. Chernoglasov, M. A. Emalfarb, A. Ben-Bassat; FermTech LTD Acad. Kapitsky str. 32-2, Moscow, 117647, Russia), as Chrysosporium lucknowense Garg 27K, VKM F-3500 D. Various mutant strains of C1 have been produced and these strains have also been deposited at the All-Russian Collection of Microorganisms of Russian Academy of Sciences (VKM) (Bakhurhina St. 8, Moscow, Russia, 113184; Prospekt Nauki No. 5, Pushchino, Moscow Region, 142290, Russia), under the terms of the Budapest Treaty on the International Regulation of the Deposit of Microorganisms for the Purposes of Patent Procedure on Sep. 2, 1998 (by O. N. Okunev, A. P. Sinitsyn, V. M. Chernoglasov, and M. A. Emalfarb; FermTech LTD, Acad. Kapitsy str., 32-2, Moscow, 117647, Russia) or at the Centraal Bureau voor Schimmelcultures (CBS), (Uppsalalaan 8, 3584 CT Utrecht, The Netherlands) for the purposes of Patent Procedure on Dec. 5, 2007 (by Dyadic Nederland B. V., Nieuwe Kanaal 7s, 6709 PA Wageningen, Nederland). For example, Strain C1 was mutagenised by subjecting it to ultraviolet light to generate strain UV13-6 (Accession No. VKM F-3632 D; deposited with VKM on Sep. 2, 1998). This strain was subsequently further mutated with N-methyl-N-nitro-N-nitrosoguanidine to generate strain NG7C-19 (Accession No. VKM F-3633 D; deposited with VKM on Sep. 2, 1998). This latter strain in turn was subjected to mutation by ultraviolet light, resulting in strain UV18-25 (Accession No. VKM F-3631 D; deposited with VKM on Sep. 2, 1998). UV18-25 has been mutated with ultraviolet light and selected for low protease activity, denoted herein as UV18#100f (CBS122188; deposited with CBS Dec. 5, 2007). Strain UV18-25 has also been mutated with ultraviolet light and selected for low cellulose activity resulting in strain W1L (Accession No. CBS122189; deposited with CBS Dec. 5, 2007), which was subsequently subjected to mutation by ultraviolet light, and selected for low protease activity resulting in strain W1L#100L (Accession No. CBS122190; deposited with CBS Dec. 5, 2007). Strain C1 was initially classified as a Chrysosporium lucknowense based on morphological and growth characteristics of the microorganism, as discussed in detail in U.S. Pat. No. 6,015,707, U.S. Pat. No. 6,573,086 and patent PCT/NL2010/000045, each incorporated herein by reference. The C1 strain was subsequently reclassified as Myceliophthora thermophila based on genetic tests. C. lucknowense has also appeared in the literature as Sporotrichum thermophile. In a further embodiment, the modified cell is a strain showing high levels of cellulose production (HC strain), such as, but not limited to, C1, UV13-6, NG7C-19, UV18-25 or UV18#100f (Accession No. CBS122189), or derivatives thereof. A modified cell derived from UV18#100f and having a modified SUMOylation machinery as further detailed herein, such as a promoter insertion in the ubc9 gene as defined herein, is in particular of interest in the production of cellulase. The cell of the HC strain as detailed herein having a modified SUMOylation machinery may further be genetically modified to reduce protease expression. The modified cell may further be genetically modified resulting in a reduced or eliminated activity of enzymes that cause the formation of cellobionolactone/cellobionic acid and/or gluconolactone/gluconic acid. Such further genetically modified cell or microorganism may be a fungal cell lacking functional genes encoding enzymes causing the formation of cellobionolactone/cellobionic acid and/or gluconolactone/gluconic acid e.g., may be generated by gene deletion, gene disruption, gene silencing or mutation; or by deletion, disruption or mutation of gene expression regulatory sequences such as promoter sequences, terminator sequences, promoter activating sequences and sequences encoding transcription factors; or by random or site-directed mutation of the genes encoding the enzymes causing the formation of cellobionolactone/cellobionic acid and/or gluconolactone/gluconic acid. The further modified fungus may be a modified fungus wherein the one or more genes encoding enzymes responsible for the production of one or more products selected from cellobionolactone, cellobionic acid, gluconolactone, and gluconic acid encode a cellobiose dehydrogenase (CDH) is deleted, disrupted or mutated. The one or more genes may encode an enzyme having an amino acid sequence of the cellobiose dehydrogenase (CDH) selected from a group of polypeptides having at least 90%, 95%, or 99% identity with any of the endogenous CDH1, CDH2 and CDH3 of Myceliophthora thermophila C1 as disclosed in WO2013/159005A2, which is incorporated herein by reference. The further modified fungus may be a further modified fungus wherein the gene encoding the cellobiose dehydrogenase (CDH) CDH1, CDH2, or CDH3 is deleted, disrupted or mutated. The further modified fungus may be a fungus wherein CDH activity is reduced from about 50% to about 100%, or at least 75%, 90%, or 95%, when measured by a ferricyanide reduction assay as disclosed in WO2013/159005A2, incorporated by reference. The gene encoding CDH1 or encoding CDH2 in Myceliophthora thermophila CI may be knocked out. The genes encoding CDH1 and CDH2 in Myceliophthora thermophila C1 may be both knocked out (double knock out), such as described in WO2013/159005A2 and WO2012/061432A1 which are incorporated herein by reference.
(79) In embodiments, the host cell is a modified Trichoderma reesei cell. The modified cell may comprise a deletion of one or more or all of the cbh1, cbh2, egl1 and egl2 genes (as described in US2015/0030717A1, incorporated herein by reference). The modified cell may comprise deletion of an endo-glucosaminidase gene. In embodiments, the deletion prevents deglycoslylation of secreted proteins.
(80) Further suitable cells include insect cells (most particularly Drosophila melanogaster cells, Spodoptera frugiperda Sf9 and Sf21 cells and Trichoplusia High-Five cells), nematode cells (particularly C. elegans cells), avian cells, amphibian cells (particularly Xenopus laevis cells), reptilian cells, and mammalian cells (most particularly human, simian, canine, rodent, bovine, or sheep cells, e.g. NIH3T3, CHO (Chinese hamster ovary cell), COS, VERO, BHK, HEK, and other rodent or human cells).
(81) The present invention also contemplates genetically modified organisms such as algae, and plants having a modified SUMOylation machinery as detailed herein. The plants may be used for production of the enzymes, and/or as the lignin, lignocellulosic, cellulosic and/or hemicellulosic material used as a substrate for saccharification processes. Methods to generate recombinant plants are known in the art. For instance, numerous methods for plant transformation have been developed, including biological and physical transformation protocols. See, for example, Miki et al., Procedures for Introducing Foreign DNA into Plants in Methods in Plant Molecular Biology and Biotechnology, Glick, B. R. and Thompson, J. E. Eds. (CRC Press, Inc., Boca Raton, 1993) pp. 67-88. In addition, vectors and in vitro culture methods for plant cell or tissue transformation and regeneration of plants are available. See, for example, Gruber et al., Vectors for Plant Transformation in Methods in Plant Molecular Biology and Biotechnology, Glick, B. R. and Thompson, J. E. Eds. (CRC Press, Inc., Boca Raton, 1993) pp. 89-119.
(82) The most widely utilized method for introducing an expression vector into plants is based on the natural transformation system of Agrobacterium. See, for example, Horsch et al., Science 227:1229 (1985). Descriptions of Agrobacterium vector systems and methods for Agrobacterium-mediated gene transfer are provided by numerous references, including Gruber et al., supra, Miki et al., supra, Moloney et al., Plant Cell Reports 8:238 (1989), and U.S. Pat. Nos. 4,940,838 and 5,464,763, both incorporated by reference.
(83) Another generally applicable method of plant transformation is microprojectile-mediated transformation, see e.g., Sanford et al., Part. Sci. Technol. 5:27 (1987), Sanford, J. C., Trends Biotech. 6:299 (1988), Sanford, J. C., Physiol. Plant 79:206 (1990), Klein et al., Biotechnology 10:268 (1992). Another method for physical delivery of DNA to plants is sonication of target cells. Zhang et al., Bio/Technology 9:996 (1991). Alternatively, liposome or spheroplast fusion have been used to introduce expression vectors into plants. Deshayes et al., EMBO J., 4:2731 (1985), Christou et al., Proc Natl. Acad. Sci. USA 84:3962 (1987). Direct uptake of DNA into protoplasts using CaCl.sub.2 precipitation, polyvinyl alcohol or poly-L-ornithine have also been reported. Hain et al., Mol. Gen. Genet. 199:161 (1985) and Draper et al., Plant Cell Physiol. 23:451 (1982). Electroporation of protoplasts and whole cells and tissues have also been described. Donn et al., In Abstracts of VII.sup.th International Congress on Plant Cell and Tissue Culture IAPTC, A2-38, p. 53 (1990); D'Halluin et al., Plant Cell 4:1495-1505 (1992) and Spencer et al., Plant Mol. Biol. 24:51-61 (1994).
(84) Further provided is a process for producing a modified cell as defined herein. As detailed herein above, the modified cell is modified to have modified SUMOylation machinery, either by genetic modification of at least one enzyme or protein of the SUMOylation machinery or by exposing the cell to a SUMOylation enzyme modifier, to increase protein production. Said process may comprise the step of disruption of an expression regulating sequence or the coding sequence of a SUMOylation machinery protein, for example, the ubc9 promoter sequence, by insertion, deletion, or point mutation. Said process may comprise at least one step of targeted genetic modification, wherein said step may be a step in inserting an expression cassette. It will be appreciated that a targeted genetic modification utilizes the sequence information of the gene so targeted to create the modification. For example, a targeted genetic modification may employ introduction of an insertion cassette sequence or an antisense sequence or a guide sequence having a sufficient degree of complementarity or homology (as appropriate for the modification strategy) to the targeted gene sequence to direct the modification to the unique gene of interest. Said process may comprise the step of disruption of an expression regulating sequence or the coding sequence of a SUMOylation machinery protein, for example, the ubc9 promoter sequence, by insertion of an expression cassette, wherein the ubc9 promoter sequence is disrupted by insertion of an expression cassette on a position that is homologous to position within the promoter sequence of the ubc9 gene of M. thermophila that is represented by the nucleotides on position 1257 and 1258 of SEQ ID NO: 1. A homologous position is to be understood herein as a position within a consecutive sequence or stretch of at least 10, 11, 12, 13, 14, 15, or 20 nucleotides that shares at least 50%, 60%, 70%, 80%, 90 or at least 100% sequence identity to SEQ ID NO: 1, wherein said position may be a position in the middle or centre of the consecutive stretch. Cells or host cells for use as a starting material in the process detailed herein and optional genes to be modified in this process are detailed herein above. The method of the invention may also comprise the step of incubating or exposing the cell to one or more modifiers, such as inhibitors, of at least one SUMOylation enzyme or SUMO protein, such as detailed herein above.
(85) Also provided is a composition comprising the modified cell as defined herein above. Such composition may be a fermentation broth that may be a crude fermentation broth. The fermentation broth may further comprise an endogenous or exogenous (homogenous or heterogenous) protein or mixture of proteins of interest. Such protein or mixture of proteins may be enzyme(s) for degrading lingo-cellulosic material as detailed herein above.
(86) Also provided is a process for producing an expression system comprising the step of transducing a modified cell as defined herein, or a cell obtained by a process for producing such modified cell as defined herein, comprising at least one exogenous expression construct encoding at least one protein of interest. The protein of interest may be a secreted protein, i.e. a protein that is secreted in the extracellular environment after production by the cell. The cell transduced with multiple different expression constructs each expressing different proteins of interest and/or the cell be transduced with a single expression construct encoding multiple different proteins of interest. Optionally, process results in a cell that comprises multiple exogenous expression constructs and/or comprises expression construct or expression constructs encoding for more than one protein. The encoded proteins may be heterologous or homologous. Optionally, the process result is a cell that is capable of producing a mixture of proteins of interest. It will be appreciated by one skilled in the art that use of recombinant DNA technologies can improve control of expression of transfected nucleic acid molecules by manipulating, for example, the number of copies of the nucleic acid molecules within the host cell, the efficiency with which those nucleic acid molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of posttranslational modifications. Additionally, the promoter sequence might be genetically engineered to improve the level of expression as compared to the native promoter. Recombinant techniques useful for controlling the expression of nucleic acid molecules include, but are not limited to, integration of the nucleic acid molecules into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites), modification of nucleic acid molecules to correspond to the codon usage of the host cell, and deletion of sequences that destabilize transcripts.
(87) The present invention is not limited to fungi and also contemplates genetically modified organisms such as algae and plants transformed with one or more nucleic acid molecules disclosed herein. The plants may be used for production of the enzymes, and/or as the lignocellulosic material used as a substrate in the methods of the invention. Methods to generate recombinant plants are known in the art. For instance, numerous methods for plant transformation have been developed, including biological and physical transformation protocols. References thereof are indicated herein above.
(88) The protein or protein mixture of interest may be an industrial applicable protein or protein mixture as further detailed herein above.
(89) Also provided is a process for producing a protein or protein mixture of interest, comprising the step of culturing a modified cell as defined herein, or a modified cell obtained by a process for producing such modified cell or an expression system as defined herein, under conditions effective to produce the protein. The protein may be an endogenous protein or endogenous protein mixture or a protein or protein mixture encoded by an exogenous expression construct as further detailed herein above. When the cell has been transduced with multiple different expression constructs each expressing different proteins of interest and/or the cell has been transduced with a single expression construct encoding multiple different proteins of interest, the process for producing a protein or protein mixture of interest as defined herein would result in the production of protein mixtures.
(90) In some instances, the protein may be recovered (i.e. isolated and/or purified), and in others, the cell may be harvested in whole, either of which can be used in a composition. The invention also provides for a composition comprising the modified cell. In case the cell is a microorganism, the cell may be cultured in the appropriate fermentation medium, i.e. a fermentation medium in which the microorganism is capable of producing the proteins of interest. The microorganisms can be cultured by any fermentation process which includes, but is not limited to, batch, fed-batch, cell recycle, and continuous fermentation. In general the fungal strains are grown in fermenters, optionally centrifuged or filtered to remove biomass, and optionally concentrated, formulated, and dried to produce a protein or a multi-protein composition that is a crude fermentation product. Suitable conditions for culturing filamentous fungi are described, for example, in U.S. Pat. No. 6,015,707 and U.S. Pat. No. 6,573,086, which are herein incorporated by reference.
(91) Protein recovering refers to the process of collecting the whole culture medium containing the protein and need not imply additional steps of separation or purification. Proteins produced can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential precipitation or solubilization. Proteins may be retrieved, obtained, and/or used in substantially pure form. As used herein, substantially pure refers to a purity that allows for the effective use of the protein in any method according to the present invention. For a protein to be useful in further applications, it may be substantially free of contaminants, other proteins and/or chemicals that might interfere or that would interfere with its use in a further application. A substantially pure protein, as referenced herein, may be a protein that can be produced by any method (i.e., by direct purification from a natural source, recombinantly, or synthetically), and that has been purified from other protein components such that the protein comprises at least about 80% weight/weight of the total protein in a given composition (e.g., the protein of interest is about 80% of the protein in a solution/composition/buffer), at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% weight/weight of the total protein in a given composition.
(92) Further provided is a use of a modified cell as defined herein in a process for producing at least one protein of interest as defined herein.
(93) The invention is further explained in the following examples. These examples do not limit the scope of the invention, but merely serve to clarify.
EXAMPLES
Example 1: Improved Protein Production of M. thermophila C1 Strains: Disrupting the Ubc9 Promoter Region
(94) The inventors found an unexpectedly high protein producing Myceliophthora thermophila C1 strain after two rounds of subsequent co-transformation starting with W1L#100.lalp1chi1pyr5 (yielding a second generation transformant) using a specific cellulase expression cassette (as described in EP patent application 2408910). Genetic analysis of the transformant revealed an integration event into the promoter region of the gene annotated as ubiquitin-conjugating enzyme, E2 (ubc9) (NCBI accession number XP_003662268.1, Interpro ID IPR000608, Prosite Accession PS50127, containing the Pfam domain PF00179) represented herein by SEQ ID NO: 1, which likely impairs functional expression. Ubc9 was shown to play a role in SUMOylation of target proteins
(95) In order to gain more insight into the high-protein-production phenotype of the second generation transformant, differential gene expression (RNA-seq) analysis was performed with the second generation transformant and compared to W1L#100.lalp1chi/pyr5. Carbon-limited fed-batch cultivations with both strains were performed using glucose as carbon feed. From these cultivations, mycelium samples were taken at 4 hours, 90 hours and 162 hours after starting the feed. From these samples, total RNA was isolated with the SV Total RNA Isolation System (Promega Corporation, USA) using ground mycelium as starting material. Isolated total RNA was subsequently sent for sequencing using the Illumina platform. Paired-end stranded RNA sequencing data was analysed and visualized using a combination of standard tools (TopHat, Cuffdiff) and custom-made scripts. Expression as measured in FPKM (Fragments per Kilobase Million) and obtained from 126 nt long, paired-end Illumina RNA-seq reads (total library size 4.7-8.2M mate-pairs each) is presented in Table 1. The results from the differential gene expression analysis, revealed a downregulation of gene ubc9, a SUMO-conjugating enzyme involved in the SUMO-conjugation pathway. Reduction of expression of ubc9 is consistently shown in all time-points, with reduction levels of 95.4 to 99%, corresponding to a reduction of at least 4.3 fold (at t=4 h).
(96) TABLE-US-00001 TABLE 1 FPKM values obtained with differential gene expression analysis using RNA-sequencing. Second generation W1L#100.1alp1chi1pyr5 transformant 4 hours 83.0 3.8 90 hours 126.3 1.3 162 hours 95.4 2.9
Example 2: Targeted Disruption of the Ubc9 Gene Promoter Region of M. thermophila C1 Strains
(97) To test the effect of the integration event on protein production, the amdS selection marker was inserted at the same locus in a Myceliophthora thermophila C1 strain, i.e. inserted in ubc9 promoter region between the nucleotides on position 1257 and 1258 of SEQ ID NO: 1. More in particular the strain used was derived from W1L#100.lalp1chi1pyr5. W1L#100.lalp1chi1pyr5 is derived from W1L#100.1 (deposited under no CBS122190) by disruption of the alp1 and chit gene as described in WO2010/107303, incorporated herein by reference (more in particular, in Example 5 of WO2010/107303.
(98) Transformants were produced by co-transfection of W1L#100.l alp1chi1pyr5 with an expression cassette encoding Eg2 (represented herein by SEQ ID NO: 4) and a pyr5 selection marker (represented herein by SEQ ID NO: 7). The obtained transformant is denominated W1L#100.lalp1chi1pyr5[eg2/pyr5]. Subsequently, the Ubc9-amdS insertion cassette represented by SEQ ID NO: 3 was targeted to the specific ubc9 locus in W1L#100.lalp1chi1pyr5[eg2/pyr5] analogous to the procedure to make gene deletions that was described previously by Visser et al. (2011). The amdS insertion cassette was constructed consisting of the acetamidase (amdS) selection marker gene (including its own promoter and terminator sequences) from Aspergillus nidulans, flanked by sequences of 1257 and 1380 bp (upstream and downstream flanks, respectively) of the ubc9 insertion site (nucleotide position 1257-1258 of SEQ ID NO: 1). The insertion cassettes further comprise cbh repeats which are not relevant for the present Examples but can be used for optional selection marker sequence removal in future applications. The insertion of amdS occurs upon homologous recombination of the flanking sequences carrying the same sequence as the insertion site in the genome. This way, the amdS selection marker was inserted into the W1L#100.lalp1chi1pyr5[eg2/pyr5] genome at the specified locus.
(99) Transformants were screened using colony PCR, which was set up to amplify part of the amdS gene combined with a part of the insertion site. Only when the amdS gene was properly inserted at the correct locus, amplification was possible. This way, transformants carrying a correctly inserted amdS could be distinguished from transformants having the selection marker integrated elsewhere in the genome.
(100) Confirmed transformant strains were grown in microtiter plates and shake flasks to test the effect of the insertion of amdS on extracellular protein production. Improved protein production and secretion was confirmed by visual observation with SDS-PAGE. Subsequent fermentation experiments (carbon-limited fed-batch cultivations using glucose as the carbon feed) further confirmed the improved protein production. Protein concentration measurements with the BCA assay (Pierce BCA Protein Assay kit (ThermoFisher Scientific)) on extracellular protein content showed higher protein production levels of the transformant strain, with protein levels increasing from 15.6 to 35.5 g/L (
(101) TABLE-US-00002 TABLE 2 Total protein and Qp with and without disruption in the ubc9 promoter region Qp max Total (gram protein/ protein gram biomass/ Strain (g/L) hour) W1L#100.lalp1chi1pyr5[eg2/pyr5] 15.6 0.011 W1L#100.lalp1chi1pyr5[eg2/pyr5] 35.5 0.015 ubc9::amdS
Example 3: Improved Heterologous Protein Production with M. thermophila C1 Strains: Disrupting the Ubc9 Promoter Region
(102) In order to demonstrate that the genetic modification of ubc9 promoter (Pubc9) results in improved production levels of proteins from microorganisms other than M. thermophila C1, the Pubc9 mutationas described in Example 1was introduced into strain W1L#100.lalp1chi1pyr5 expressing the heterologous protein Bxl1 (-xylosidase) from Talaromyces wortmanii W1L#100.lalp1chi1pyr5[TwBxl1/pyr5] and PGII (polygalacturonase) from Aspergillus niger (W1L#100.lchi1pyr5 [AnPGII/pyr5]).
(103) Transformants were produced by co-transfecting a pyr5 selection marker (represented herein by SEQ ID NO: 7) with the expression cassette encoding TwBxl1 or AnPGII in W1 L#100.lalp1chi1pyr5, thereby producing transformant W1L#100.lalp1chi1pyr5[TwBxl1/pyr5] or W1L#100.lalp1chi1pyr5[AnPGII/pyr5]. This expression cassette (represented herein by SEQ ID NO: 6 and 5, respectively) further comprised a chit gene promoter, and the cbh1 terminator sequence, which are commonly used to obtain high expression levels of the corresponding genes (Visser et al., 2011). Subsequently, Ubc9-amdS insertion cassette represented by SEQ ID NO: 3 was targeted to the ubc9 promoter in strains W1 L#100.lalp1chi1pyr5[TwBxl1/pyr5] and W1 L#100.lalp1chi1pyr5[AnPGII/pyr5] as further detailed in Example 2.
(104) Transformants were screened using colony PCR, which was set up to amplify part of the amdS gene combined with a part of the insertion site. Only when the amdS gene was properly inserted at the correct locus, amplification was possible. This way, a transformant carrying a correctly inserted amdS could be distinguished from transformants having the selection marker integrated elsewhere in the genome.
(105) Confirmed transformant strains were grown in microtiter plates and shake flasks to test the effect of the insertion of amdS on extracellular protein production. Improved protein production and secretion was confirmed by visual observation with SDS-PAGE (
Example 4: Improved Protein Production of M. thermophila HC C1 Strains: Disrupting the Ubc9 Promoter Region
(106) In order to demonstrate that the genetic modification of Pubc9 (the promoter region of ubc9) in another M. thermophila lineage also results in improved production levels, the Pubc9 mutationas described in Example 1was introduced into HC-strain UV18-25.
(107) Introducing the amdS selection marker represented by SEQ ID NO: 3 into the ubc9 promoter region in strain UV18-25 is further detailed in Example 2.
(108) Transformants were screened using colony PCR, which was set up to amplify part of the amdS gene combined with a part of the insertion site. Only when the amdS gene was properly inserted at the correct locus, amplification was possible. This way, transformants carrying a correctly inserted amdS could be distinguished from transformants having the selection marker integrated elsewhere in the genome.
(109) A confirmed transformant strain was grown in microtiter plates and shake flasks to test the effect of the insertion of amdS on extracellular protein production. Improved protein production and secretion was confirmed by visual observation with SDS-PAGE.
(110) The confirmed transformant strain was tested in fermentation experiments (as described in Example 2) to confirm the improved protein production. Protein concentration measurements with the BCA assay (as described in Example 2) on extracellular protein content showed higher protein production levels of the transformant strain, with protein levels increasing from 39.6 to 47.5 g/L. In addition, the maximum specific protein production rate (Qp max) was determined for both strains, as described in Example 2 (Table 3).
(111) TABLE-US-00003 TABLE 3 Total protein concentration (g/L) and Qp max (g/g/h) obtained from Labfors (2.5 L) fermentations Qp max Total (gram protein/ protein gram biomass/ (g/L) hour) UV18-25 39.6 0.016 UV18-25 ubc9::amdS 47.5 0.016
(112) Enzyme cocktails from strains UV18-25 and a UV18-25 ubc9::amdS were tested for saccharification efficiency. NREL pre-treated corn stover (Schell et al., J Appl Biochem Biotechnol, 105:69-86, 2003) was used as a substrate. Saccharification reactions were carried out in a total volume of 10 mL in 50 mL Greiner tubes using the substrate at a dry matter content of 20%. Saccharification reactions were performed at pH 5 using an acetate buffer at a final concentration of 100 mM. A predetermined amount of sodium hydroxide was added to each reaction to set the pH at 5. An additional reaction (15 mg/g) was included to monitor the pH every 24 hours. When the pH of this additional reaction deviated by more than 0.1 pH units, 2M NaOH was added to correct the pH to its initial starting pH. The volume needed to adjust the pH was subsequently added to the other reaction tubes and mixed immediately. Sodium azide was dosed at 0.02% (w/w). Enzyme mixtures were tested at enzyme loadings of 2.5-5-10 and 15 mg/g DM (dose-response). Purified Bgl1 from M. thermophila C1 (SEQ ID NO: 16) was added to each reaction (10% of the baseline loading). Enzyme loadings were applied using BCA determined values described above. The reactions were incubated at 52 C. at 300 rpm. After 24, and 68 h, 0.2 ml samples were taken and filtrated using a micro plate (pvdf), followed by analysis of the supernatants. Glucose concentrations were measured using GOPOD assay kit (Megazyme, Co. Wicklow, Ireland). All experiments have been performed in duplicate. The saccharification efficiency of the protein mixtures of UV18-25 ubc9::amdS is shown in
(113) TABLE-US-00004 TABLE4 SequenceoverviewforSEQIDONs1-7 SEQID Specificregions NO Name Name position 1 ubc9genewithflanking 5UTR 1070-1301 sequence ubc9ORF 1302-1994 3UTR 1995-2195 Integrationsite 1257-1258 2 ProteinsequenceUbc9 3 ubc9-amdSinsertioncassette ubc9upstreamflank 7-1263 cbhrepeat 1269-1860 amdS 1871-4592 cbhrepeat 4594-5184 ubcdownstreamflank 5193-6572 4 Expressioncassetteeg2 Pchi-ext: 31-1074 Pchi: 1075-1849 eg2: 1850-3467 Tcbh: 3468-4483 5 ExpressioncassetteAnPGll Pchi-ext 4-1047 Pchi 1048-1822 AnPGll 1823-2913 Tcbh 2920-3935 6 ExpressioncassetteTwBxl1 Pchi-ext 31-1074 Pchi 1075-1848 TwBxl1 1850-4245 Tcbh 4252-5267 7 pyr5selectionmarker pyr5 1173-1877
Example 5: Disruption of the Ubc9 Gene Promoter Region of M. thermophila C1 Strains Expressing Heterologous Glucoamylase
(114) Transformants were produced by co-transfection of strains W1L#100.1 alp1chi1pyr5 and strain UV18#100.falp1pyr5 with an expression cassette encoding Trichoderma reesei glucoamylase (designated as DP1), of which the DNA coding sequence was modified for expression in C1 strains (represented herein by SEQ ID NO: 17 and SEQ ID NO: 18, respectively), and a pyr5 selection marker (represented herein by SEQ ID NO: 7). The expression cassette used for the W1L#100.lalp1chi1pyr5 strain included a chit promoter sequence (SEQ ID NO: 51) and the expression cassette used for the UV18#100.falp1pyr5 strain included a cbh1 promoter sequence (SEQ ID NO: 52). Obtained transformants were screened for glucoamylase activity using the -amylase assay kit (Betamyl-3) from Megazyme (Co. Wiklow, Ireland). The transformants with the highest glucoamylase activity were selected and denominated W1L#100.lalp1chi1pyr5[DP1/pyr5] and UV18#100.falp1pyr5[DP1/pyr5], respectively. Subsequently, the ubc9 promoter region in these transformants was modified analogous to that described in Example 2.
(115) After confirming that the ubc9 promoter region was modified by colony PCR (as described in Example 2), the modified strains and their glucoamylase expressing parental strains were grown in Minifors (1 L) or Labfors (2.5 L) fermenters in carbon-limited fed-batch cultivations using glucose as the carbon source to test for extracellular glucoamylase production. Glucoamylase activity assays were performed using p-Nitrophenyl -D-glucopyranoside (pNPG; Sigma N-1377) as a substrate. The levels of glucoamylase produced by M. thermophila C1 were calculated by converting glucoamylase units (GAU) measured with the pNPG assay into gram glucoamylase per liter (g/L). To this end, a conversion factor was determined by performing the same pNPG assay on a sample of T. reesei-produced glucoamylase for which the protein concentration was known. This conversion factor was subsequently used to convert GAU measured in M. thermophila cultures to glucoamylase concentrations. The ubc9 modified M. thermophila strains showed higher glucoamylase production levels (Tables 5B and 6B).
(116) Total protein concentrations (measured with the BCA assay as described in Example 2) were higher from the W1L#100.lalp1chi1pyr5[DP1/pyr5] ubc9 modified strain (Table 5A). Total protein levels from the UV18#100.falp1pyr5[DP1/pyr5] ubc9 modified strain did not increase in Minifors (1 L) fermentations, but did show increased protein levels in Labfors (2.5 L) fermentations (Table 6A). In addition, the Qp max were calculated (as described in Example 2) which are reported in Table 7.
(117) TABLE-US-00005 TABLE 5A Total protein concentrations produced with strain W1L#100.lalp1chi1pyr5 expressing DP1 with and without ubc9 gene promoter disruption 1 liter* 2.5 liter W1L#100.lalp1chi1pyr5 6.59 g/L 20.09 g/L [DP1] W1L#100.lalp1chi1pyr5 25.55 g/L 26.57 g/L [DP1] ubc9::amdS *refers to fermentation scale used for evaluation of the strains
(118) TABLE-US-00006 TABLE 5B Glucoamylase concentrations produced with strain W1L#100.lalp1chi1pyr5 expressing DP1 with and without ubc9 gene promoter disruption 1 liter 2.5 liter W1L#100.lalp1chi1pyr5 [DP1] 4.3 g/L 16.4 g/L W1L#100.lalp1chi1pyr5 [DP1] 19.2 g/L 25.6 g/L ubc9::amdS
(119) TABLE-US-00007 TABLE 6A Total protein concentrations produced with strain UV18#100.falp1pyr5 expressing DP1 with and without ubc9 gene promoter disruption 1 liter 2.5 liter UV18#100.f alp1pyr5 [DP1] 53.37 72.61 UV18#100.f alp1pyr5 [DP1] 52.08 80.01 ubc9::amdS
(120) TABLE-US-00008 TABLE 6B Glucoamylase concentrations produced with strain UV18#100.falp1pyr5 expressing DP1 with and without ubc9 gene promoter disruption 1 liter 2.5 liter UV18#100.f alp1pyr5 [DP1] 17.0 33.1 UV18#100.f alp1pyr5 [DP1] 24.7 34.4 ubc9::amdS
(121) TABLE-US-00009 TABLE 7 Total protein concentration (g/L) and Qp max (g/g/h) based on Labfors (2.5 L) fermentations Qp max (gram protein/ Total gram protein biomass/ Strain (g/L) hour) W1L#100.lalp1chi1pyr5 [DP1] 20.09 0.004 W1L#100.lalp1chi1pyr5 [DP1] ubc9::amdS 26.57 0.006 UV18#100.f alp1pyr5 [DP1] 72.61 0.017 UV18#100.f alp1pyr5 [DP1] ubc9::amdS 80.01 0.017
Example 6: Targeted Disruption of the Ubc9 Gene Promoter Region of M. thermophila C1 Strains Expressing Heterologous Phytase
(122) In order to demonstrate that the genetic modification of Pubc9 (the promoter region of ubc9) also results in improved production levels of a heterologous phytase, the Pubc9 mutation was introducedas described in Example 2into C1 strains W1L#100.lalp1chi1pyr5 and UV18#100.falp1pyr5 expressing a Buttiauxella sp phytase variant (protein SEQ ID NO: 21).
(123) Transformants were produced by co-transfection of strains W1L#100.l alp1chi1pyr5 and UV18#100.falp1pyr5 with an expression cassette encoding phytase (represented herein by SEQ ID NO: 53 and SEQ ID NO: 54, respectively) and a pyr5 selection marker (represented herein by SEQ ID NO: 7). The expression cassette used for the W1L#100.l alp1chi1pyr5 strain included a chit promoter sequence (SEQ ID NO: 51) and the expression cassette used for the UV18#100.falp1pyr5 strain included a cbh1 promoter sequence (SEQ ID NO: 52). The obtained transformants having elevated phytase activity greater than the untransformed parent are denominated W1 L#100.lalp1chi1pyr5[phytase/pyr5] and UV18#100.falp1pyr5[phytase/pyr5], respectively. Subsequently, the ubc9 promoter region in these transformants was modified analogous to that described in Example 2.
(124) Confirmed ubc9 modified strains and their phytase expressing parental strains were grown in fermenters (carbon-limited fed-batch cultivations with both strains were performed using glucose as carbon feed) to test the effect of the ubc9 promoter modification on extracellular phytase production.
(125) Phytase activity measurements (US2015/0030717, incorporated herein by reference) showed higher activity levels of the ubc9 modified strains, with activity levels increasing from 2.1 to 5.9 kU/g for W1L#100.lalp1chi1pyr5[phytase/pyr5] and from 11.3 to 16.1 kU/g for UV18#100.falp1pyr5[phytase/pyr5] (
Example 7: Targeted Disruption of the Ubc9 Gene Promoter Region of Aspergillus niger Strains Overexpressing Heterologous Polygalacturonase II
(126) Aspergillus niger used in this study are derived from N402 (Bos et al, 1988). A. niger strains expressing pGpdA-pgaII.sup.C1 were obtained by co-transfection of strain AB4.1, a pyrG.sup. derivative of N402 (van Hartingsveldt et al., 1987) with 5 g pAB4.1 (van Hartingsveldt et al., 1987) and 50 g pGpdA-pgaII.sup.C1. Expression vector pGpdA-pgaII.sup.C1 (SEQ ID NO: 23) contains the coding sequence for polygalacturonase II from A. niger which was codon optimized for expression in M. thermophila C1 (SEQ ID NO: 24; protein SEQ ID NO: 25), and the commonly used GpdA promoter to drive gene expression. Transfection of A. niger was performed as described (Arentshorst et al., 2012). Transformants were purified by two rounds of purification on selective minimal medium (Bennet and Lasure, 1991). After purification, individual transformants were grown in microtiter plate well (200 l minimal medium) and the medium was assayed for galacturonase activity using the PAHBAH assay (see below). Strains showing PgaII expression were grown on complete medium (Arentshorst et al., 2012) and incubated for 4-5 days before conidiospore isolation. Spores were counted using a Biorad Cell counter and stored at 4 C. in 0.9% NaCl. Spore suspensions were used to inoculate shake flask cultures (50 ml minimal medium in 300 ml Erlenmeyer flasks) at a density of 1.010.sup.6 spores/ml and grown for 36 h at 37 C. at 250 rpm.
(127) Ubc9-promoter (gene identifier An04g01350 in AspGD) knock-in strains were obtained by transfection with amdS selection of the ubc9 knock-in cassette (SEQ ID NO: 26) to A. niger strains AN[PGAII]_HIGH and AN[PGAII]_LOW. The knock-in fragment was designed such that the amdS selection marker was introduced 45 base pairs upstream of the ubc9 start-ATG, which is similar to the strategy used to knock in the amdS selection marker in M. thermophila. The knock-in cassette contains the amdS marker flanked by 956 bp of the 5 ubc9 upstream region and 983 bp of the ubc9 upstream and coding region. The 5863 bp fragment was used for transfection of strains AN[PGAII]_HIGH and AN[PGAII]_LOW. Transformant strains were selected on media for amdS selection as described in Arentshorst et al., 2012. Transformants were purified twice on selective minimal acetamide plates, before selected strains were grown on complete medium to obtain spores to inoculate liquid cultures.
(128) Genomic DNA was isolated as described previously (Meyer et al., 2010) and used in a diagnostic PCR using primers ubc9P1f and ubc9P4r. PCR was performed with Phire Hot Start II DNA polymerase or Phusion DNA polymerase (Thermo Scientific). ubc9P1f (GATAGTGCTTAGCGACACCCG; SEQ ID NO: 27) anneals to the amdS marker and ubc9P4r (TCGGCCACAAATCTCAGTGA; SEQ ID NO: 28) anneals to the 3 ubc9 region. Successful integration of the knock-in fragment in the ubc9 promoter is expected to result in a PCR fragment of 2222 bp, while no product is formed when the fragment inserts ectopically.
(129) Southern blot analysis was performed according to (Sambrook and Russell 2001). -.sup.32P-dCTP-labelled probes were synthesized using the Decalabel DNA labelling kit (Thermo Scientific, Waltham, Mass.), according to the instructions of the manufacture. Genomic DNA of A. niger strains was digested with BamHI and labeled with a 1000 nucleotide probe covering the ubc9 coding region. Restriction enzymes were obtained from Thermo Scientific and used according to instructions of the manufacturer.
(130) Bioreactor cultivations were performed as described before (Jorgensen et al., 2010; Nitsche et al., 2012, using 0.75% (w/v) glucose as a carbon source.
(131) The PAHBAH non-reducing sugar assay was performed to determine the relative polygalacturonase activity using polygalacturonic acid as a substrate (as described by M. Lever, 1972). Enzyme activity of the samples is defined as the amount of galacturonic acid per liter that is released in 5 minutes divided by the incubation time per liter reaction volume (see formula). Enzyme activity is shown in units per gram protein (U/g). Enzyme activity is determined on diluted samples which were within the range of the standard curve (0-2 mM galacturonic acid).
(132)
X=mmol galacturonic acid per liter
Vr=reaction volume in liters
De=enzyme dilution before adding to reaction mix
Ve=enzyme volume added to reaction mix in ml
Ec=enzyme/protein concentration in stock solution in mg/ml
T=incubation time
(133) Medium samples from A. niger transformants obtained after co-transfection of pAB4.1 with pGpdA-pgaII.sup.C1 were assayed for endo-polygalacturonase activity after cultivation in microtiter plates using the PAHBAH non-reducing sugar assay and PGA as a substrate. 12 transformants with activities at least 3-fold higher compared to the untransformed strains were selected and grown again in shake flask cultures for a reliable quantitative activity measurement. Based on these activity measurements two strains were selected, An[PgaII]_high (11010 AU) and An[PgaII]_low (303 AU), which displayed activities on PGA well above the parental strain N402 (41 AU). Strains An[PgaII]_high and An[PgaII]_low were selected as a high polygalacturonases and low galacturonase producing A. niger strains and used for subsequent experiments.
(134) Strain An[PgaII]_high and strain An[PgaII]_low were transformed with the ubc9::amdS promoter knock-in construct and transformants able to grow on acetamide plates were selected and purified. Genomic DNA of transformants was isolated and analyzed by diagnostic PCR and Southern blot to identify transformants in which the ubc9::amdS promoter knock-in fragment was integrated at the intended site. Two transformants in the An[PgaII]_high background (An[PgaII]_high ubc9::amdS #8 and #17) and one transformant in the An[PgaII]_low background (An[PgaII]_low ubc9::amdS #1) were found to contain the fragment at the expected site and did not contain additional inserts.
(135) The selected strains An[PgaII]_high and An[PgaII]_low and derivatives An[PgaII]_high ubc9::amdS #8 and #17 and An[PgaII]_low ubc9::amdS #1 respectively, were grown in shake flask cultures as described before and assayed for endo-polygalacturonase activity using the PAHBAH assay. The relative non-reducing activity on PGA of the five strains are given in Table 8. Enzyme production with cultivation of An[PgaII]_high and derivative An[PgaII]_high ubc9::amdS #17 in bioreactors is shown in Table 9.
(136) TABLE-US-00010 TABLE 8 Relative non-reducing activity on PGA in culture medium samples of selected transformants after shake flask cultivation (48 h, 30 C.) enzyme Fold-increase activity compared to Strain (AU) parental strain An[Pgall]_high 184 31 n.a. An[Pgall]_high 186 28 1.01 ubc9::amdS #8 An[Pgall]_high 179 27 0.97 ubc9::amdS #17 An[Pgall]_low 30.2 10.4 n.a. An[Pgall]_low 32.3 12.5 1.07 ubc9::amdS #1
(137) TABLE-US-00011 TABLE 9 Relative non-reducing activity on PGA in culture medium samples of selected transformants during bioreactor cultivation (pH 3.0, 30 C.) mid-exponential growing cells An[Pgall]_high An[Pgall]_high Ubc9::amdS Ubc9::amdS Time An[Pgall]_high_1 An[Pgall]_high_2 #17_1 #17_2 point* BR_JR1 BR_JR2 BR_JR3 BR_JR4 1 220 250 260 260 2 300 240 260 260 *to be able to compare different cultures, samples from the bioreactor were taken after addition of approximately 26 ml (time point 1) or 30 ml (time point 2) of base addition. The alkali addition is linear with the biomass accumulation.
Example 8. Disruption of the Ubc9 Promoter in Trichoderma reesei
(138) A plasmid, pLH937 (SEQ ID NO: 29), was constructed comprising the following DNA segments: 1. A bacterial vector including the E. coli ccdB gene, an ampicillin resistance gene and origin of replication for selection and amplification in E. coli. 2. A hygromycin phosphotransferase open reading frame operably fused to the Neurospora crassa cpc1 promoter and A. nidulans trpC terminator.
(139) Three different Cas9 target sites in the Trichoderma reesei ubc9 promoter were selected. These were close to the insertion site that was used in the above Examples with Myceliophthora thermophila (C1).
(140) TABLE-US-00012 Targetsite1: (SEQIDNO:30) GCAGTTCGACGCTTACCCACCGG Targetsite2: (SEQIDNO:31) CGACGCTTACCCACCGGGTGAGG Targetsite3: (SEQIDNO:32) GCGCGACTACCATCACGTCTCGG
(141) In each case, the first 20 nucleotides represent the protospacer region recognized by Cas9 and the last three nucleotides are the PAM (protospacer adjacent motif). Guide RNAs for assembly with Cas9 were generated based on these target sequences.
(142) A Trichoderma reesei strain that secretes an engineered variant (BP17) of a Buttiauxella sp. phytase (SEQ ID NO: 33) was used in these experiments. This strain had deletions of the four major secreted cellulase genes (cbh1, cbh2, egl1 and eg/2) as well as a deletion of an endo glucosaminidase gene to prevent deglycosylation of secreted proteins. Strain construction is described in US 2015/0030717A1, Examples 1 and 2. Protoplasts of this strain were prepared using the methods described in US 2015/0030717, incorporated herein by reference.
(143) Co-Transformation of Cas9.RNP Complex and Plasmid pLH937 into Trichoderma reesei Protoplasts
(144) Cas9 protein was individually mixed with each of the three different guide RNAs and incubated in buffer to allow assembly of Cas9.RNP complexes. Polyethylene glycol (PEG)-mediated transformation of T. reesei protoplasts was performed as described in WO2016100568A1 (incorporated herein by reference) to enable uptake of Cas9.RNP and plasmid DNA.
(145) 25 ul Cas9.RNP, 3 ul pLH937 plasmid (0.3 ug/uL), 1.2 ul Lipofectamine CRISPR-MAX Transfection Reagent (Thermo Fisher) were mixed and added to the protoplasts for uptake. After the transformation procedure protoplasts were plated in an overlay of Vogel's agar medium (with 1.1M sorbitol, 2% glucose and 50 ug/mL hygromycin B) poured over solidified Vogel's agar medium (with 1.1M sorbitol and 20% glucose but without hygromycin).
(146) Transformed colonies that arose on the hygromycin selection plates were transferred onto non-selective Vogel's agar without sorbitol or hygromycin and incubated for 4 days at 30 C. The colonies were then passaged twice on selective Vogel's agar with 50 ug/mL hygromycin. Those transformant colonies that grew well were considered to have a stable hygromycin-resistant phenotype. It was expected that many of these stable transformants would have pLH937, or some fragment(s) thereof, integrated at the cas9 target site in the promoter of the ubc9 gene. Genomic DNA was isolated from transformants. PCR was performed using primers nik1 2 kb F (5-gccatgaacctcaccacacag; SEQ ID NO: 34) and nik1 2 kb R(5-cggcgtggccctgttctcgag; SEQ ID NO: 35) to amplify a 2 kb region of the T. reesei nik1 locus. Agarose gel electrophoresis confirmed that all samples contained gDNA of sufficient quantity and quality to act as template in PCR.
(147) PCR was performed using primers 3078 (5-aagagatctctgccctcccaggg; SEQ ID NO: 36) and 3079 (5-gtgatggccggcttccagg; SEQ ID NO: 37) to amplify the promoter region of ubc9 spanning the cas9 target sites. PCR was with Stratagene PfuUltra II Fusion HS DNA polymerase (Agilent, Santa Clara, Calif.) according to the manufacturer's directions at an annealing temperature of 50 C and an extension time of 1 minute. Using these conditions it was expected that no PCR product would be obtained if there was a large insert at the cas9 target site in the ubc9 promoter. Those transformants that gave a PCR product of the size expected for the wild-type ubc9 locus were eliminated from further analysis. All transformants described below gave no PCR product suggesting that they all have the HygR vector inserted at the target site. PCR was performed using primers 3078 and 3145 (5-ctttgccctcggacgagtgct; SEQ ID NO: 38) to amplify between the flanking region of the ubc9 promoter and 5 end of the hygromycin phosphotransferase (HygR) gene. PCR was performed at an annealing temperature of 50 C and an extension time of 3 minutes. A PCR product would only be obtained if the HygR vector was inserted at the target site in the ubc9 promoter. Using genomic DNA as template the following transformants showed an obvious PCR product; 3140-12, 3140-34, 3141-11, 3141-25, 3141-34, 3142-15, 3142-34, 3140-2, 3140-5 and 3141-1.
(148) PCR was performed using primers 3078 and 3146 (5-ctgaactcaccgcgacgtctgtc; SEQ ID NO: 39) to amplify between the flanking region of the ubc9 promoter and 3 end of the HygR gene. PCR was performed at an annealing temperature of 50 C and an extension time of 3 minutes. A PCR product would only be obtained if the HygR vector was inserted at the target site in the ubc9 promoter. Using genomic DNA as template the following transformants showed an obvious PCR product; 3140-31, 3141-15, 3141-35, and 3142-12.
(149) PCR was performed with primers 3078 and 3148 (5-gtgtgcgacagtgcgcgtcc; SEQ ID NO: 41) to amplify between the flanking region of the ubc9 promoter and the N. crassa cpc1 promoter. Using genomic DNA from transformant 3140-15 as template, an annealing temperature of 50 C and an extension time of 2 minutes a DNA fragment of approximately 3.5 kb was amplified. A PCR product would only be obtained if the HygR vector was inserted at the target site in the ubc9 promoter. This amplified DNA fragment was sequenced in one direction using primer 3078 as sequencing primer. Sequence analysis confirmed that pLH937 DNA was inserted at the Cas9 target site in the ubc9 promoter. In summary, PCR analysis verified that 15 of the 25 transformants shown in Table 12 had pLH937 DNA inserted into the ubc9 promoter region. The other transformants presumably also had pLH937 DNA inserted into the ubc9 promoter region but, because the extent or arrangement of the inserted pLH937 DNA was unknown, this could not be verified by PCR.
(150) Transformants and the parental strain were cultured for 4 days at 28 C in triplicate in 24 well slow-release microtiter plates incorporating 20% lactose in the plate (WO2014047520A1) and using Trichoderma defined medium with 2.5% glucose/sophorose (EP1545217B1) as the liquid medium. Phytase activity was measured in supernatants using pNPP as substrate (US2015/0030717, incorporated herein by reference). The assay was run as an end-point assay and absorbance was read at 405 nm. The average absorbance from triplicate cultures of each strain is shown in Table 10 with the associated standard deviation.
(151) TABLE-US-00013 TABLE 10 Phytase activity of Trichoderma reesei transformants Average Standard Transformant absorbance Deviation 3140-12 0.4 0.022 3140-15 0.544 0.027 3140-17 0.394 0.009 3140-18 0.456 0.028 3140-31 0.397 0.006 3140-33 0.455 0.007 3140-34 0.467 0.014 3140-35 0.407 0.025 3141-11 0.309 0.061 3141-13 0.343 0.02 3141-15 0.476 0.019 3141-20 0.447 0.011 3141-25 0.418 0.01 3141-34 0.507 0.018 3141-35 0.361 0.026 3142-12 0.501 0.029 3142-15 0.206 0.005 3142-25 0.359 0.017 3142-28 0.448 0.011 3142-32 0.429 0.027 3142-34 0.478 0.028 3142-35 0.39 0.022 3140-2 0.397 0.014 3140-5 0.351 0.006 3141-1 0.399 0.013 Parent strain 0.474 0.004
(152) One transformant, 3140-15, clearly produced more secreted phytase activity than the parent strain. This transformant, as well as transformant 3142-32 and the parent strain, were again grown in triplicate in microtiter plates and the phytase activity in culture supernatant determined (see Table 11). Again, transformant 3140-15 produced approximately 15% more phytase than the parent strain.
(153) TABLE-US-00014 TABLE 11 Phytase activity of Trichoderma reesei transformants Average Standard Transformant absorbance Deviation Parent strain 0.512 0.009 3142-32 0.494 0.015 3140-15 0.588 0.038