METHOD OF DIGITAL MULTIPLEX DETECTION AND/OR QUANTIFICATION OF BIOMOLECULES AND USE THEREOF

Abstract

The present invention relates to a digital multiplex method for detecting and/or quantifying multiple target biomolecules in a sample, said biomolecules being selected from DNA, RNA, and proteins. The present invention further relates to different applications of the digital multiplex method and to a kit.

Claims

1. A digital multiplex method for detecting and/or quantifying multiple target biomolecules in a sample, comprising the following steps: a) functionalizing a suspension of particles with one or more oligonucleotides selected from a first oligonucleotide which is a conversion oligonucleotide (cT), a second oligonucleotide which is a reporting oligonucleotide (rT), a third oligonucleotide which is an amplification oligonucleotide (aT), and a fourth oligonucleotide which is a leak absorption oligonucleotide (pT); b) adding to the particles functionalized in step a) barcodes allowing the discrimination of the particles targeting multiple biomolecules; c) contacting the particles obtained in step b) with a tested sample to capture the multiple target biomolecules; d) resuspending the particles having captured or not the target biomolecules in a common amplification mixture including a buffer, enzymes, deoxy-nucleoside triphosphate (dNTPs) and optionally oligonucleotides; e) separating the particles in the suspension obtained in step d) from each other so that each particle can react independently; f) incubating the particles at a constant temperature so that each target biomolecule triggers an amplification reaction which generates an amplification signal on the particle carrying the target, and g) detecting and/or measuring the signals of the particles including the barcode signal and the amplification signal of each particle.

2. The digital multiplex method of claim 1, wherein the functionalization of the suspension of particles in step a) is performed with the first oligonucleotide and with the second oligonucleotide, and wherein the third oligonucleotide and the fourth oligonucleotide are added in the amplification mixture in step d).

3. The digital multiplex method of claim 1, wherein steps a) and b) are performed concomitantly.

4. The digital multiplex method of claim 1, further comprising a step e1) of recovering the particles.

5. The digital multiplex method according claim 1, wherein the enzymes used in step d) are selected from the group consisting of polymerase, nicking enzyme or restriction enzyme, and exonuclease.

6. The digital multiplex method according to claim 1, wherein the suspension obtained in step d) is separated in step e) into droplets.

7. The digital multiplex method according to claim 1, wherein the constant temperature in step f) is between 30 and 55° C.

8. The digital multiplex method according to claim 1, wherein the functionalized particles are selected from porous or non-porous particles and hydrogel particles having a size between 10 nm and 500 μm.

9. The digital multiplex method according claim 1, wherein the step g) of detecting and/or measuring said barcode signal comprises detecting and/or measuring the barcode signal for each particle associated to the target biomolecule and the signal resulting from the amplification.

10. The digital multiplex method of claim 1, wherein the target biomolecules are of the same kind or of different kind, said biomolecules being nucleic acids or proteins.

11. The digital multiplex method according to claim 10, wherein the target biomolecules are nucleic acids selected from the group consisting of DNAs, cDNAs, RNAs, mRNAs, and microRNAs.

12. The digital multiplex method according to claim 1, wherein the target biomolecule is used as a biomarker.

13. An in vitro method for diagnosis of a disease selected from the group consisting of cancer, neuronal diseases, cardiovascular diseases, inflammatory diseases, autoimmune diseases, diseases due to a viral or bacterial infection, skin diseases, skeletal muscle diseases, dental diseases, and prenatal diseases comprising the use of the digital multiplex method according to claim 1.

14. An in vitro method for agro diagnosis of a disease selected from the group comprising: diseases caused by biotic stress, or diseases caused by abiotic stress, said method comprising the use of the multiplex digital method according to claim 1.

15. A kit for detecting and/or quantifying multiple target biomolecules comprising: a) a suspension of particles functionalized with a one or more oligonucleotides selected from a first oligonucleotide which is a conversion oligonucleotide (cT), a second oligonucleotide which is a reporting oligonucleotide (rT), a third oligonucleotide which is an amplification oligonucleotide (aT), and a forth oligonucleotide which is a leak absorption oligonucleotide (pT), to which particles are added different barcodes allowing the discrimination of the particles targeting different biomolecules; b) a mixture of enzymes, and c) a separating agent.

16. The digital multiplex method of claim 1, wherein the particles are microparticles.

17. The digital multiplex method according to claim 6, wherein the droplets are water-in-oil emulsion droplets having a size of droplet is comprised between 0.001 and 100 pL.

18. The digital multiplex method according to claim 9, wherein said barcode signal is a fluorescence signal.

19. The in vitro method for agro diagnosis according to claim 14, wherein: the diseases caused by biotic stress are from infectious and/or parasitic origin, or the diseases caused by abiotic stress are caused by nutritional deficiencies and/or unfavorable environment,

20. The kit according to claim 15, wherein the particles are microparticles and the enzymes of said mixture are selected from the group consisting of polymerase, nicking enzyme or restriction enzyme, and exonuclease.

Description

FIGURES

[0243] FIG. 1. Principle of multiplex and digital detection of microRNA. A collection of barcoded particles are functionalized with target-specific conversion oligonucleotide and a reporting oligonucleotide. The particles are mixed with the sample, leading to the random capture of the target biomolecules by the particles. After washing, the particles together with the amplification and leak absorption oligonucleotides and the enzymatic mix. are compartmentalized (e.g. in water-in-oil droplets). After incubation at constant temperature (e.g. 50° C.), the particles are analyzed by flow cytometry, giving access to absolute concentration of each target, computed from the proportion of positive/negative particles for each population.

[0244] FIG. 2. Results of the flow cytometry analysis for the detection of Let7a. a. Particle B.sub.Let7a before incubation. b. Particle B.sub.Let7a after incubation at 50° C. for 4 hours (NC=no target). c. Particle B.sub.Let7a after incubation at 50° C. for 4 hours in presence of 1 pM of target. d. Measured concentrations computed from the ratio of positive particles F.sub.pos:[Let7a]=[part] ln(1−F.sub.pos).

[0245] FIG. 3. Microscopy vs flow cytometry readout. a. Fluorescence images of the encapsulated particles after incubation. The white dots correspond to the particles (positive and negative) that bear a FAM-modified rT and the positive droplets appear in gray, corresponding to the fluorescence of Atto633-modified probe in solution. The microRNA was detected in the gray droplets and not in the dark gray ones. b. Histograms from the flow cytometry readout. The microRNA was detected in 79% of bead-containing droplets. c. Comparative analysis of microscopy (statistics computed from 250 bead-containing droplets) and flow cytometry readout.

[0246] FIG. 4. Detected concentrations depending on the particles' concentration in the encapsulated mix.

[0247] FIG. 5. Enzyme trapping by on-particles oligonucleotides. An enzyme mixture (polymerase, nickases, exonuclease) is incubated with or without particles grafted or not with oligonucleotides. After 30 minutes of incubation at 30° C., the particles are pelleted and the supernatant is mixed with an in-solution molecular program (amplification and pseudo template oligonucleotides) and spiked with 1 pM of Let7a. The samples are incubated at 50° C. and the fluorescence of the rT monitored in real-time. a. Real-time fluorescence curves showing the amplification reaction. b. Extraction starting times from the fluorescence curves.

[0248] FIG. 6. Effect of the neutral particles on the false positive and true positive rate. a. Cytometry fluorescence histograms of the negative controls (without target, top row) and of the positive controls (with 1 pM Let7a, bottom row) depending on particles' concentration. b. Percentages of positive particles as function on the overall particles' concentration; c. target biomolecules concentration in positive particles.

[0249] FIG. 7. Let7a range detection using neutral particles. 10.sup.5 B.sub.Let7a supplemented with 2.Math.10.sup.5 B.sub.N were used for the quantification of 0, 0.2 and 1 pM of Let7a a. Cytometry fluorescence histograms. b. Comparison of measured Let7a concentrations depending on theoretical spiked-in concentration.

[0250] FIG. 8. Detected Let7a and miR92a concentrations in a 2-target assay. a. Cytometry fluorescence histograms of the 3 particles populations (B.sub.Let7a, B.sub.92a, B.sub.N) according to their fluorescent barcode (Atto633). b. Cytometry fluorescence results (rT fluorescence) of B92a and B.sub.Let7a. c. Measured concentration of the 2 targets.

[0251] FIG. 9. Triplex assay for the simultaneous quantification of Let7a, mir92a and mir203a. a. Fluorescence intensity of the barcode (Atto633) for each population of particles (flow cytometry measurement). Particles populations are, from left to right: b. Neutral particles, miR92a particles, miR203a particles and Let7a particles and cytometry fluorescence signals of miR92a, miR203a and Let7a particles depending on the sample c. Measured concentrations of each microRNA target.

[0252] FIG. 10. Flow cytometry discrimination of ten particles populations using two-dimensional fluorescent barcoding. 1 μm streptavidin-coated particles are functionalized with various ratio of biot-TTTT-FAM (5 levels) and biot-DyXL510 (2 levels)

[0253] FIG. 11. Let7a detection from human colon total RNA extract. a. Cytometry fluorescence signals of Let7a particles. b. Measured concentrations of Let7a in the negative control and the sample containing 10 ng/μL of colon total RNA.

[0254] FIG. 12. Dynamic range adjustment as a function of the number of particles. This graph shows the evolution of the dynamic range for sample of 20 μL of various target concentration. The dynamic range is comprised between the limit of detection (LoD) and the higher limit of quantification (hLoQ). For the sake of simplicity, it is assumed that a LoD is equal to the limit of blank (LoB=average percentage of false positive events) arbitrarily set a 5%. The hLoQ is arbitrarily set at 95% of positive events (meaning that above this value, the quantification is considered not reliable). The bars at the bottom represent the appropriate number of particles to be used for each target concentration to fall within the dynamic range. As a result, it is possible to tune the dynamic range.

[0255] FIG. 13. Detected concentration of Let7a depending on the presence/absence of Klenow DNA polymerase (3′45′ exo-) during the capture on the particles.

[0256] FIG. 14. Background amplification reduction effect of strengthening “hard” washing procedure.

[0257] FIG. 15. Designing of poly(T) conversion template. The expected concentrations are 0 M (Negative controls) and 1.00 E-12 M (1 pM sample).

[0258] FIG. 16. Comparison of expected and measured patterns on a 6-plex miRNA detection.

[0259] FIG. 17. Tunable dynamic range.

[0260] FIG. 18. Detection of 3 microRNAs from human total RNA.

EXAMPLES

[0261] Methods and Materials

[0262] Oligonucleotides

[0263] All oligonucleotides (templates and synthetic micro RNA) used in the present invention were purchased from Biomers (Germany). The oligonucleotides sequences were purified by HPLC.

[0264] Template sequences are protected from degradation by the exonuclease, by 5′ phosphorothioate modification. cT (conversion template) and rT (reporting template) are modified by a polythymidylate linker followed by a biotin moiety in 3′ and 5′ respectively.

[0265] Said oligonucleotides are shown in Table 2 below:

TABLE-US-00005 TABLE 2 Oligonucleotide sequences used in the invention. “*” denotes phosphorothioate backbone modification. “p” denotes a 3′ phosphate modification. “biotin” and “bioteg” refer to biotinylated synthons, respectively using aminoethoxy-ethoxyethanol linker and the longer triethylene glycol linker. Upper and lower cases represent deoxyribonucleotide and ribonucleotide, respectively. “aT” corresponds to autocatalytic template; “pT” corresponds to pseudo template, “rT” corresponds to reporting template and “cT” corresponds to conversion template. Atto633, FAM, DyXL510 are fluorophores. dTFAM is a deoxythymidine nucleoside derivitized with 6-FAM (6-carboxyfluorescein) through a spacer arm. SEQ ID NO: Name: Sequence Function 60 bc CATTCTGGACTG signal 61 aTc C*A*G*T*CCAGAATGCAGTCCAGAA p aT 62 pTbc T*T*T*T*TCAGTCCAGAATG p pT 63 rTbc Atto633 *A*T*TCTGAATGCAGTCCAGAAT BHQ2 rT 64 rTbc-biot Biotin *T*T*TTTTTTT dTFAM rT GTGAGAATGCAGTCCAGAATGTCTCAC BHQ2 65 cTbc-Let7a-biot TGCAGTCCAGAAGTTTGACTCAAACTATACAACCTACTACCT cT CATTTTTTT biotin 66 cTbc-92a-biot TGCAGTCCAGAAGTTTGACTCAAGCATTGCAACCGATCCCAA cT CCTTTTTTT biotin 67 cTbc-203a-biot TGCAGTCCAGAAGTTTGACTCAACTAGTGGTCCTAAACATTT cT CACTTTTTTT biotin 68 cTbc-Let7a TGCAGTCCAGAAGTTTGACTCAAACTATACAACCTACTACCT cT CA p 69 Let7a ugagguaguagguuguauaguu microRNA 70 mir92a agguugggaucgguugcaaugcu microRNA 71 mir203a-3p gugaaauguuuaggaccacuag microRNA 72 Let7a-D TGAGGTAGTAGGTTGTATAGTT DNA analogue of microRNA 73 mir92a-D AGGTTGGGATCGGTTGCAATGCT DNA analogue of microRNA 74 mir203a-D GTGAAATGTTTAGGACCACTAG DNA analogue of microRNA mir10a uacccuguagauccgaauuugug microRNA mir16 uagcagcacguaaauauuggcg microRNA mir21 uagcuuaucagacugauguuga microRNA lin4 ucccugagaccucaaguguga microRNA T5-biot-Atto633 Atto633 TTTTT bioteg barcode T5-biotFAM FAM TTTTT bioteg barcode T5-biot-DyXL510 DyXL510 TTTTT bioteg barcode

[0266] Particle Functionalization

[0267] Streptavidin-coated 1 μm particles (Dynabeads C1) were obtained from Invitrogen. Prior to functionalization, particles were washed three times in a washing buffer (20 mM Tris-HCl pH 7.5, 1 M NaCl, 1 mM EDTA, 0.2% Tween20 (Sigma-Aldrich)) and then resuspended in the same buffer. The biotinylated oligonucleotides are added to the particle suspension, mixed thoroughly with a vortex and incubated for 15 minutes at room temperature. After functionalization, the particles were washed once in the washing buffer, once in the storage buffer (5 mM Tris-HCl pH 7.5, 50 mM NaCl, 500 μM EDTA, 5 mM MgSO.sub.4) and finally resuspended in the storage buffer. Until use, grafted particles are stored at 4° C.

[0268] microRNA Capture

[0269] All capture mixes were assembled at 4° C. in 200 μL PCR tubes. The particles are mixed in the reaction buffer (10.sup.9 beads/mL for each bead population, 20 mM Tris HCl pH 8.9, 10 mM (NH.sub.4).sub.2SO.sub.4, 40 mM KCl, 10 mM NaCl, 10 mM MgSO.sub.4, 25 μM each dNTP, 0.1% (w/v) Synperonic F 104, 2 μM Netropsin). The samples were spiked with synthetic microRNA targets (serially diluted in 1× Tris-EDTA buffer using Low DNA retention tips) or target-containing fluids (plasma, urine, cell extracts, tissue extract . . . ). The samples were incubated for 1 hour at 30° C. under 2000 rpm stirring in a ThermoMixer (Eppendorf). The particles were then pelleted and resuspended in the storage buffer at a concentration of 10.sup.9 particles/mL. Alternatively, the capture step can be skipped by injecting the particles and the targets directly in the detection mix (see below).

[0270] Reaction Mixture Assembly

[0271] All reaction mixtures were assembled at 4° C. in 200 μL PCR tubes. The templates (aT and pT) and the particles (3.Math.10.sup.8 part/mL including the neutral and detection particles) were mixed with the reaction buffer (20 mM Tris HCl pH 8.9; 10 mM (NH.sub.4)2SO.sub.4, 40 mM KCl, 10 mM NaCl, 10 mM MgSO.sub.4, 25 μM each dNTP, 0.1% (w/v) Synperonic F 104, 2 μM Netropsin) and the BSA (200 μg/mL) together with the enzymes (200 u/mL Nb.Bsml, 10 u/mL Nt.BstNBI, 80 u/mL Vent(exo-) and 23 nM ttRecJ).

[0272] Droplets Generation and Incubation

[0273] A 2-inlet (one for the oil, one for the aqueous sample) flow-focusing microfluidic mold was prepared with standard soft lithographic techniques using SU8 photoresist (MicroChem Corp., MA, USA) patterned on a 4-inch silicon wafer. A 10:1 mixture of Sylgard 184 PDMS resin (40 g)/crosslinker (4 g) (Dow Corning, MI, USA) was poured on the mold, degassed under vacuum and baked for 2 hours at 70° C. After curing, the PDMS was peeled off from the wafer and the inlets and outlet holes of 1.5 mm diameter were punched with a biopsy punch (Integra Miltex, PA, USA). The PDMS layer was bound onto a 1 mm thick glass slide (Paul Marienfelf GmbH Et Co. K.G., Germany) immediately after oxygen plasma treatment. Finally, the chip underwent a second baking at 200° C. for 5 hours to make the channels hydrophobic. The aqueous sample phase (amplification mix+particles) and the continuous phase (fluorinated oil Novec-7500, 3 M containing 1% (w/w) fluorosurfactant (Emulseo, France)) were mixed on chip using a pressure controller MFCS-EZ (Fluigent, France) and 200 μm diameter tubing (C.I.L., France) to generate 0.5 μL droplets by hydrodynamic flow focusing. The droplets were transferred to PCR tubes and incubated at 50° C. to let the amplification reaction happen.

[0274] Particle Analysis

[0275] After incubation, the droplets were mixed with surfactant-free fluorinated oil (Novec 7500) (1:5 v/v). The emulsion was broken using an electrostatic-pulses gun (Zerostat 3, Milty, UK). Once all water droplets merged in one water drop, the oil phase was discarded and the water drop was resuspended in the sheath fluid (Attune N×T Focusing Fluid, Thermo Fisher Scientific, MA, USA). The sample was analyzed by flow cytometry in an Attune N×T (Thermo Fisher Scientific, MA, USA).

Example 1: DNA-Grafted Particle for the Digital Detection of Micro RNA

[0276] The digital multiplex strategy of the present invention relies on the use of DNA-grafted particles able to capture single nucleic acid targets, trigger an exponential amplification reaction and report a positive signal. The ratio of positive versus negative particles gives access to the absolute concentration of the target in the initial sample, computed from the Poisson law. The inventors firstly investigated the possibility to detect one microRNA target using this digital approach.

[0277] For that, 1 μm streptavidin-coated magnetic particles were functionalized with the conversion template (cT, SEQ ID 65) targeting the microRNA Let7a and the reporting template (rT, SEQ ID 64). The particles are mixed with a sample containing 0 or 1 pM of the synthetic Let7a RNA sequence (SEQ ID 69), together with the amplification machinery (aT, SEQ ID 61 pT, SEQ ID 62, enzymes, buffer and dNTP). The suspension is then encapsulated using a microfluidic flow focusing junction, allowing for the compartmentalization of individual particles in water-in-oil droplets. Upon incubation at 50° C., the particle having captured at least one microRNA start producing multiple copies of a short DNA sequence (called the signal) via polymerization/nicking cycle, which eventually trigger the amplification reaction. In turn, the output strand of this reaction hybridizes to supported probe, which leads to the fluorescence increase of the particle. The particles are finally recovered by breaking the emulsion and analyzed by flow cytometry, whose results are presented in FIG. 2. It may be noted that without incubation (and thus, without amplification FIG. 2a), a single population of weakly fluorescent particles is observed, corresponding to the background amplification of the supported probes. After incubation in presence of 1 pM of Let7a, a population of highly fluorescent particle (31%) is distinguished from the negative population (69%). This positive population corresponds to particles having captured at least one target. Assuming a Poissonian random capture of the targets by the particle, it is possible to compute the concentration of Let7a measured with the assay, by first calculating the parameter λ of the Poissonian distribution:

[00002]$\underset{k=1}{\overset{\infty }{.Math.}}\frac{{\lambda }^k}{k!}{e}^{-\lambda }=F_{\mathrm{pos}}$

[0278] where λ is the average number of targets per particle, k is the number of targets captured by one particle and F.sub.pos is the fraction of positive particles (particles that captured at least one target). Then, the measured concentration of Let7a ([Let7a]) is given by the following equation:

[Let7a]=[part].Math.λ[Let7a]=[part].Math.ln (1−F)

[0279] where [part] is the initial concentration of particle. From this equation the inventors deduced:

λ=−Ln (1−F.sub.pos)

[0280] Hence, the measured concentration in the initial sample is 620 fM, which is in accordance with the theoretical concentration (1 pM) given the incertitude on the target dilution (diluted from 100 μM stock solution). The negative control reports 2.6% of false positive particles.

[0281] Furthermore, the inventors analyzed by flow cytometry a sample containing 1 pM of Let7a target and compare the results obtained by flow cytometry (using the on-bead rT modified with a FAM fluorophore, SEQ ID 64) and by fluorescence microscopy (using an in-solution rT modified with a Atto633 dye, SEQ ID 63). Microscopy image analysis (FIG. 3a) demonstrates that 79% of particles-containing droplets (white dots) detected the target (indicated by the gray-fluorescent droplets). These results is in good agreement with the flow cytometry readout for which 85% of positive events were detected (FIG. 3b).

Example 2: Enzymes Trapping Effect

[0282] The inventors examined the effect of the particle concentration on the false positive rate. 2.Math.10.sup.7 particles were incubated in presence of 0 or 1 pM or Let7a target (20 μL). The particles were then resuspended in the master mix either at 10.sup.5 or 10.sup.6 part.Math./μL, before being emulsified via droplet microfluidics, incubated at 50° C. for 4 hours and analyzed by flow cytometry (FIG. 4). For 10.sup.5 or 10.sup.6 part.Math./μL, the negative control recorded respectively 16.4% and 2.6% of false positive events, demonstrating a significant effect of the particle concentration on the sensitivity of the assay. The inventors demonstrate that pre-incubation of the particle in the master mix before partitioning leads to the concentration of the enzymes (one or several) on the DNA-grafted particle. As a result, the overconcentration of enzyme (e.g. the DNA polymerase) accelerates the non-specific amplification reaction and eventually increases the false positive rate.

[0283] To demonstrate further this effect, the inventors designed the experiment shown in FIG. 5: an enzyme mixture (polymerase, nickases, exonuclease) used for microRNA detection is incubated for 30 minutes i) without particles, ii) with unfunctionalized particles and iii) with oligonucleotide functionalized particles. Then, the particles are pelleted and the supernatant is used as the enzyme mix for the detection of Let7a in solution: 10 pM of Let7a and the molecular program (a set of oligonucleotide including aT, SEQ ID 61 pT, SEQ ID 62 cT, SEQ ID 68, rT, SEQ ID 63) are added, and the mix is incubated at 50° C. while the fluorescence of the reporting template is monitored in real-time (FIG. 5a). FIG. 5b compares the start times (Cq) of the three samples. Using the enzyme mixed preincubated without particles or with unfunctionalized particles, the Cq are very similar (˜100 minutes), demonstrated that the particles themselves do not affect the reaction. The mixing of the enzymes with oligo-carrying particles may slow the reaction down and induce false negative.

[0284] To counter this effect and to accelerate the reaction speed and increase its sensitivity, the reaction is performed at constant particle concentration. Moreover, the particle dilution is compensated by adding a population of “neutral particles”, keeping the particle concentration constant. These neutral particles carry the same amount of reporter templates as the detection particles, but no conversion template. Hence, neutral particles trap as much enzymes as detection particles, but are unable to capture microRNAs and trigger the amplification.

[0285] Particularly, a constant concentration of detection particles for Let7a (B.sub.Let7a at 10.sup.5 beads/μL), supplemented with 0 to 2.Math.10.sup.5 neutral particules (BN, which are not grafted with a cT) has been used. FIG. 6 shows the proportion of positive B.sub.Let7a for the samples incubated with 0 or 1 pM of Let7a target. Comparing the negative controls, the inventors demonstrated that the addition of neutral beads reduces the percentage of false positive whereas it does not affect the microRNA quantification. At 10.sup.5 particles/μL, the reaction is complete after 4 hours. At 3.Math.10.sup.5 particles/μL, it takes around 10 hours, and at 10.sup.6 particles/μL, the reaction is not complete after 24 hours. Finally, the inventors concluded that the optimal particles concentration may be about 3.Math.10.sup.5 particles/μL.

[0286] In order to validate these experimental conditions, the inventors performed the digital detection of Let7a at different concentration. FIG. 7 shows that the false positive proportion is only 0.7%, which proves the effect of the addition of neutral particles. In the positive samples, the detected concentrations are in accordance with the expected ones. Overall, these results demonstrated that DNA-functionalized particles are suitable for the digital detection of one microRNA target.

[0287] Multiplex and Digital Detection of microRNA

[0288] With the system well characterized for the detection of one target, the inventors proceeded to the detection of several targets in a single assay. FIG. 8 shows a duplex assay performed with two populations of particles B.sub.Let7a and B.sub.92a, targeting respectively the microRNAs Let7a and mir92a. To be able to discriminate them, both populations are barcoded with different concentrations of a biotinylated fluorescent marker. The experiment was composed of four samples: one negative control (no target); two samples containing 1 pM of only one of the two targets; one sample containing 1 pM of both targets.

[0289] As in a single target assay, particles populations significantly turn on only if their specific target is present. The false positive percentages in the negative control are very low (0.14% for B.sub.Let7a, 0.64% for B92a). It is noted that false positive percentages are higher when the other target is present. For example, in the Let7a only sample, 7% of B92a turn on. This is probably due to co-encapsulated particles, which can be mathematically compensated. The detected concentrations are in accordance with the expected ones. Hence, the inventors demonstrated here that it is effectively possible to measure two miRNAs in a single assay.

[0290] The inventors then moved on to a 3-target assay (Let7a, mir203a and mir92a) to further demonstrate the generalization of the digital multiplex approach. The cognate particles, i.e., particles corresponding to each of target biomolecule (i.e. modified with corresponding conversion template (cT), SEQ ID 66-68) plus the neutral particle population) are spiked with 1 pM of one of the three targets. The results of the flow cytometry analysis are presented in FIG. 9.

[0291] This multiplexing capability is only limited by the number of different particles populations but these one may be separated by flow cytometry for example.

[0292] This multiplexing capability is only limited by the number of different particles populations but these one may be separated by flow cytometry.

[0293] FIG. 10 demonstrates the discrimination of ten bead population using a combination of two fluorescent barcodes (with respectively five and two levels of fluorescence).

[0294] MicroRNA Detection from Biological Samples

[0295] By this experiment, the inventors demonstrated the compatibility of the current digital detection approach for the detection of microRNA targets from biological samples (RNA extraction from human intestine cells). The proposed procedure decorrelates the target capture step from the signal amplification. After the capture, the particles can thus be washed and resuspended in an appropriate buffer compatible with the downstream biochemical reactions. Hence, this assay is compatible with biological samples made of complex media, the washing step enabling to get rid of the initial matrix that could interfere with the amplification reaction. Human colon total RNA, at a final concentration of 10 ng/μL is mixed with B.sub.Let7a before proceeding to the quantification of the Let7a target. FIG. 11 shows the detected concentration of Let7a, approximated to 6.Math.10.sup.4 copies per ng of extract. This demonstrates that the present invention allows for the detection of endogenous microRNA in biological samples.

[0296] Adjustment of the Sensitivity and Dynamic Range

[0297] The assay sensitivity is of paramount important when considering the quantification of low abundance target. The sensitivity of a digital assay is tightly correlated to the ratio of positive/negative events, which is given by the average number of targets per particle (A). In the present assay, this parameter was adjusted by modifying the amount of detection particle. Therefore, the assay dynamic range and sensitivity can be tuned independently for each target. According to the graphic presented in FIG. 12, for highly abundant targets that are expected to saturate the particle population (for λ>5, the expected percentage of positive particle is >99%), the number of detection particles can be increased to adjust parameter λ. On the opposite, the amount of detection particles targeting poorly expressed targets can be decreased. Alternatively, for low target concentration, it is possible to increase the volume of sample used during the capture step. As a result, it will increase the number of particles hybridize to their target therefore raising the λ value.

Example 3: Use of Two Polymerases for Nucleic Acid Detection

[0298] Further to use of (Vent(exo-)) polymerase allowing sensitive quantification of DNA synthetic targets, the inventors assessed the effect of adding Klenow(exo-) polymerase to the amplification reaction for the quantification of the microRNA. Firstly, this assay was performed for detecting Let7a.

[0299] Capture Step

[0300] miRNA capture was realized by incubating the detection particles, the miRNA target, 25 μM of dATP, dTTP, dCTP and dGTP, and Klenow polymerase at 40° C. for 2 hours. The concentrations are presented in Table 3 below:

TABLE-US-00006 TABLE 3 Concentrations of Klenow polymerase, particles and microRNA Sample Klenow polymerase Particles Let7a 1  0 units/mL 10.sup.9 particles/mL 0 pM 2  0 units/mL 10.sup.9 particles/mL 2 pM 3 50 units/mL 10.sup.9 particles/mL 0 pM 4 50 units/mL 10.sup.9 particles/mL 2 pM

[0301] Stirring was applied during incubation in order to avoid particle sedimentation. After incubation, particles were recovered and washed twice in storage buffer having the composition presented in Table 4 below:

TABLE-US-00007 TABLE 4 Composition of the storage buffer Storage buffer Tris HCl pH 7.5 5 mM NaCl 50 mM 0.5 mM MgSO.sub.4 5 mM

[0302] The reaction mixtures A and B used in the present assay are presented in Table 5 below:

TABLE-US-00008 TABLE 5 The composition of reaction mixtures A and B Concentrations Mix A miR Buffer 1X Nb Bsml 400 u/mL Vent (exo−) 160 u/mL Nt.Bst.NBI 20 u/mL BSA 400 μg/mL ttRecJ/140 26 nM Bsml 100 u/mL Mix B miR Buffer 1X CBc12-2PS4 100 nM pTBc12T5SP 16 nM rTBc 100 nM Particles 5.10.sup.8 particles/mL

[0303] Encapsulation

[0304] Mix A and Mix B are encapsulated in 50%/50% proportion in 9 μm water-in-oil droplets using a double water inlet flow focusing microfluidic device.

[0305] Incubation

[0306] The droplets are incubated at 50° C. for 8 hours.

[0307] Particle Analysis

[0308] The droplets are broken using an electrostatic gun (Zerostat 3, Milty, UK). The particles are resuspended in Attune N×T focusing fluid (ThermoFisher) and analysed by flow cytometry (Attune N×T flow cytometer, ThermoFisher).

[0309] FIG. 13 shows that the introduction of Klenow(exo-) during the capture step (i. the capture of miRNA (Let7a) on the particle surface) clearly increases the detected amount of Let7a: With Klenow(exo-) in the capture mixture, 450 fM of Let7a were detected, whereas only 31 fM were detected if there was no Klenow(exo-) during the capture step.

[0310] For optimizing the action of Klenow (exo-) polymerase and for eliminating the remaining background amplification (due to the unspecific amplification), if any, the inventors enhanced the experimental protocol described above by performing additional steps of post-capture washing in a stringent buffer and sonication steps in order to remove trapped polymerase molecules.

[0311] Capture Step

[0312] miRNA capture was realized by incubating the detection particles, the miRNA target and Klenow polymerase at 40° C. for 2 hours, under agitation to avoid particle sedimentation (2000 rpm). The concentrations were: [0313] Particles: 10.sup.9 particles/mL [0314] Klenow polymerase: 50 units/mL

[0315] Post-Capture Washing:

[0316] “Soft” Washing Procedure: [0317] Particles are magnetically pooled and the rest of the capture mix is discarded [0318] Resuspension in storage buffer [0319] Vortex 30 s [0320] Supernatant is discarded [0321] Resuspension in storage buffer [0322] Vortex 30 s [0323] Supernatant is discarded [0324] Resuspension in storage buffer [0325] Vortex 30 s

[0326] “Hard” Washing Procedure: [0327] Particles are magnetically pooled and the rest of the capture mix is discarded [0328] Resuspension in BW buffer [0329] Vortex 30 s [0330] Ultrasound bath sonication 30 s [0331] Supernatant is discarded [0332] Resuspension in BW buffer [0333] Vortex 30 s [0334] Ultrasound bath sonication 30 s [0335] Supernatant is discarded [0336] Resuspension in storage buffer [0337] Vortex 30 s [0338] Supernatant is discarded [0339] Resuspension in storage buffer [0340] Vortex 30 s [0341] Supernatant is discarded [0342] Resuspension in storage buffer [0343] Vortex 30 s

[0344] The storage buffer has the same composition as the one shown in Table 4 above. The composition of BW buffer is presented in Table 6 below:

TABLE-US-00009 TABLE 6 Composition of BW buffer BW buffer Tris-HCl pH 7.5 20 mM NaCl 1M EDTA  1 mM Tween 20 0.2%

[0345] The reaction mixtures A and B have the same composition as those presented in Table 5 above. Moreover, the encapsulation, the incubation and the particle analysis are performed at the same manner as described above.

[0346] FIG. 14 shows that the detected concentration from the negative control (sample without biomolecule target) is reduced by 80% thanks to the “hard” washing procedure. This demonstrates that Klenow polymerase molecules is trapped on the particles and that the “hard” washing procedure allows to eliminate unspecific amplification (background amplification).

Example 4: Designing the Conversion Template as Poly(T) Conversion Template

[0347] As demonstrated above, the addition of Klenow polymerase to the capture step increased the detected amount of RNA targets. In order to further improve the sensitivity of the method of the present multiplex method, the inventors designed conversion templates comprising a poly(T) spacer in between the microRNA binding sequence and the Nt.BstNBI recognition site, thus increasing the number of DNA nucleotides on the primer.

[0348] The experimental conditions (capture step, post-capture washing (hard wash protocol), encapsulation, incubation and particle analysis) are as those described above. It is however noted that only dATP (25 μM) is introduced during the capture step.

[0349] I

[0350] FIG. 15 shows that T5 and T15 (corresponding to a poly (T) spacer of 5 to 15 nucleotides of length, which corresponds to sequence 21 toBc T5 T7 biot (for T5) and 21 toBc T15 T7 biot (for T15)); converter templates allow an accurate quantification of miR21: The detected concentrations are 1.20 pM and 1.02 pM, respectively, whereas the original TO cT only detects 0.28 pM. Moreover, the T5 converter does not increase the background amplification.

Example 5: 6-Plex Detection of Synthetic miRNA

[0351] With this set of optimized conditions (Klenow polymerase in capture, “hard” washing procedure, T5 converter template) the inventors assessed the detection of synthetic miRNAs spiked in water.

[0352] Capture Step

[0353] miRNA capture was performed by incubating the detection particles, the miRNA target and Klenow polymerase at 40° C. for 2 hours. The concentrations were:

[0354] Particles: 2.5.Math.10.sup.8 particles/mL for each of the 6 subpopulations (1.5.Math.10.sup.9 particles/mL total) [0355] Klenow polymerase: 50 units/mL

[0356] The concentrations of six miRNA are presented in Table 7 below:

TABLE-US-00010 TABLE 7 Concentrations of miRNA Target Concentration Let7a 500 fM miR21 10 fM 500 fM miR203a 10 fM miR16 500 fM miR10a 10 fM

[0357] Stirring was applied during incubation in order to avoid particle sedimentation.

[0358] The other experimental conditions (capture step, post-capture washing (hard wash protocol), encapsulation, incubation and particle analysis) are as those described above. It is however noted that only dATP (25 μM) is introduced during the capture step.

[0359] FIG. 16 shows that the measured pattern is very close to the expected one (1.00 E-12). The new experimental conditions allow the multiplex quantification of RNA targets, which could be applied to the detection of disease-associated molecular signatures.

Example 6: Tunable Dynamic Range

[0360] The detected concentration of microRNA target is given by the equation:

[microRNA]=−ln (1−F.sub.pos).Math.[Particles].sub.Capture

[0361] Where F.sub.pos is the percentage of positive particles, comprised between 0% and 100%. The very high variability of the measured miRNA concentration for extreme values of F.sub.pos (close to 0% or 100%) decreases the reliability of the quantification at such F.sub.pos values. The dynamic range, in which the miRNA target can be reliably quantified, is thus limited.

[0362] It is however possible to broaden the dynamic range by adapting the concentration of particles during the capture step. Lowering the concentration of detection particles allows to detect the target at lower concentrations.

[0363] In order to assess the dynamic range of the test and to verify that it can be modified by changing the particles concentration, various amounts of Let7a are quantified using 2 different concentrations of particles.

[0364] Capture Step

[0365] miRNA capture was realized by incubating the detection particles, the miRNA target and Klenow polymerase at 40° C. for 2 hours. The concentrations were: [0366] Klenow polymerase: 50 units/mL in all samples [0367] Buffer: miR buffer 1× dATP only

TABLE-US-00011 TABLE 8 Concentration of miRNA Sample [Particles] [Let7a] 1 2.10.sup.9 particles/mL 0 fM 2 2.10.sup.9 particles/mL 10 fM 3 2.10.sup.9 particles/mL 400 fM 4 2.10.sup.9 particles/mL 1 pM 5 2.10.sup.9 particles/mL 4 pM 6 2.10.sup.9 particles/mL 10 pM 7 2.10.sup.9 particles/mL 100 pM 8 2.10.sup.8 particles/mL 0 fM 9 2.10.sup.8 particles/mL 1 fM 10 2.10.sup.8 particles/mL 40 fM 11 2.10.sup.8 particles/mL 100 fM 12 2.10.sup.8 particles/mL 400 fM 13 2.10.sup.8 particles/mL 1 pM 14 2.10.sup.8 particles/mL 10 pM

[0368] After the capturing step a hard washing was performed as described above.

[0369] Reaction Mixtures:

TABLE-US-00012 TABLE 9 Reaction mixtures and concentrations Concentrations Mix A miR Buffer 1X Nb Bsml 400 u/mL Vent (exo−) 160 u/mL Nt.Bst.NBI 20 u/mL BSA 400 μg/mL ttRecJ/140 26 nM Bsml 100 u/mL Bsml 1% v/v Mix B miR Buffer 1X CBc12-2PS4 100 nM pTBc12T5SP 16 nM MBBc.Bsml.Atto633.BHQ2 100 nM Particles 5.10.sup.8 particles/mL

[0370] Encapsulation

[0371] Mix A and Mix B are encapsulated in 50%/50% proportion in 9 μm water-in-oil droplets using a double water inlet flow focusing microfluidic device.

[0372] Incubation

[0373] The droplets are incubated at 50° C. for 8 hours.

[0374] Particle Analysis:

[0375] The droplets are broken using an electrostatic “gun”. The particles are resuspended in Attune N×T focusing fluid (ThermoFisher) and analysed by flow cytometry (Attune N×T flow cytometer, Thermo Fisher).

[0376] FIG. 17 shows that for a concentration of detection particles in the capture mix of 2.Math.10.sup.9 particles/mL, the dynamic range is comprised between 10 pM and 100 fM. Reducing the concentration of particles to 2.Math.10.sup.8 particles/mL shifts the dynamic range by approximately one order of magnitude (1 pM-10 fM).

Example 7: Multiplex Detection from Human Colon Total RNA

[0377] The system is working on synthetic miRNA targets spiked in water. Here the inventors demonstrate the multiplex detection of 3 microRNA targets in human colon total RNA. In this assay, the inventors detected human miRNAs Let7a, miR21 while Lin4 from Caenorhabditis elegans as a control.

[0378] Capture Step

[0379] miRNA capture was realized by incubating the detection particles, the miRNA target and Klenow polymerase at 40° C. for 2 hours. The concentrations were: [0380] Klenow polymerase: 50 units/mL in all samples [0381] Particles: 5.Math.10.sup.8 particles/mL for each of the 3 subpopulations (1.5.Math.10.sup.9 particles/mL total) [0382] Total RNA: 2.5 μg/mL [0383] Lin4: 1 pM (exogenous spike-in control) [0384] Buffer: miR buffer 1×dATP only

[0385] After the capture step a hard washing was performed as described above.

[0386] Reaction Mixtures:

[0387] The reaction mixtures A and B were the same (same composition and same concentrations) as those shown in Table 9 above.

[0388] Moreover, the encapsulation, the incubation and the particle analysis were performed as described on Example 6.

[0389] FIG. 18 shows that the system successfully detected 3 microRNAs from a sample of human colon total RNA, including two endogenous targets (let7a and mir21) and 1 exogenous target (spike-in lin4). The expected concentration of control microRNA lin4 was 1 pM and the measured concentration is 0.94 pM.

BIBLIOGRAPHICAL REFERENCES

[0390] [1] S. Roy, J. H. Soh, and J. Y. Ying, “A microarray platform for detecting disease-specific circulating miRNA in human serum,” Biosensors and Bioelectronics, vol. 75, pp. 238-246, January 2016. [0391] [2] T. Ueno and T. Funatsu, “Label-Free Quantification of MicroRNAs Using Ligase-Assisted Sandwich Hybridization on a DNA Microarray,” PLOS ONE, vol. 9, no. 3, p. e90920, March 2014. [0392] [3] Y. Sun et al., “Development of a micro-array to detect human and mouse microRNAs and characterization of expression in human organs,” Nucl. Acids Res., vol. 32, no. 22, pp. e188-e188, January 2004. [0393] [4] P. T. Nelson, D. A. Baldwin, L. M. Scearce, J. C. Oberholtzer, J. W. Tobias, and Z. Mourelatos, “Microarray-based, high-throughput gene expression profiling of microRNAs,” Nat Meth, vol. 1, no. 2, pp. 155-161, November 2004. [0394] [5] I. Beuvink et al., “A novel microarray approach reveals new tissue-specific signatures of known and predicted mammalian microRNAs,” Nucl. Acids Res., vol. 35, no. 7, p. e52, January 2007. [0395] [6] P. Campomenosi et al., “A comparison between quantitative PCR and droplet digital PCR technologies for circulating microRNA quantification in human lung cancer,” BMC Biotechnology, vol. 16, p. 60, 2016. [0396] [7] C. Chen et al., “Real-time quantification of microRNAs by stem-loop RT-PCR,” Nucleic Acids Res, vol. 33, no. 20, p. e179, 2005. [0397] [8] V. Benes and M. Castoldi, “Expression profiling of microRNA using real-time quantitative PCR, how to use it and what is available,” Methods, vol. 50, no. 4, pp. 244-249, April 2010. [0398] [9] G. Wan, Q. 'En Lim, and H. P. Too, “High-performance quantification of mature microRNAs by real-time RT-PCR using deoxyuridine-incorporated oligonucleotides and hemi-nested primers,” RNA, vol. 16, no. 7, pp. 1436-1445, January 2010. [0399] [10] K. L. Opel, D. Chung, and B. R. McCord, “A Study of PCR Inhibition Mechanisms Using Real Time PCR*,†,” Journal of Forensic Sciences, vol. 55, no. 1, pp. 25-33. [0400] [11] J. Aslanzadeh, “Preventing PCR Amplification Carryover Contamination in a Clinical Laboratory,” Ann Clin Lab Sci, vol. 34, no. 4, pp. 389-396, January 2004. [0401] [12] C. A. Raabe, T. H. Tang, J. Brosius, and T. S. Rozhdestvensky, “Biases in small RNA deep sequencing data,” Nucleic Acids Res, vol. 42, no. 3, pp. 1414-1426, February 2014. [0402] [13] S. Bustin et al., “Variability of the Reverse Transcription Step: Practical Implications,” Clinical Chemistry, vol. 61, no. 1, pp. 202-212, January 2015. [0403] [14] P. Zhang, Y. Liu, Y. Zhang, C. Liu, Z. Wang, and Z. Li, “Multiplex ligation-dependent probe amplification (MLPA) for ultrasensitive multiplexed microRNA detection using ribonucleotide-modified DNA probes,” Chem. Commun., vol. 49, no. 85, pp. 10013-10015, October 2013. [0404] [15] P. Zhang, J. Zhang, C. Wang, C. Liu, H. Wang, and Z. Li, “Highly Sensitive and Specific Multiplexed MicroRNA Quantification Using Size-Coded Ligation Chain Reaction,” Anal. Chem., vol. 86, no. 2, pp. 1076-1082, January 2014. [0405] [16] V. Taly et al., “Multiplex Picodroplet Digital PCR to Detect KRAS Mutations in Circulating DNA from the Plasma of Colorectal Cancer Patients,” Clinical Chemistry, vol. 59, no. 12, pp. 1722-1731, January 2013. [0406] [17] E. Tan et al., “Specific versus nonspecific isothermal DNA amplification through thermophilic polymerase and nicking enzyme activities,” Biochemistry, vol. 47, no. 38, pp. 9987-9999, September 2008. [0407] [18] T. Sano, C. L. Smith, and C. R. Cantor, “Immuno-PCR: very sensitive antigen detection by means of specific antibody-DNA conjugates,” Science, vol. 258, no. 5079, pp. 120-122, October 1992. [0408] [19] V. Taly, D. Pekin, A. E. Abed, and P. Laurent-Puig, “Detecting biomarkers with microdroplet technology,” Trends in Molecular Medicine, vol. 18, no. 7, pp. 405-416, July 2012. [0409] [20] Y. Rondelez et al., “Microfabricated arrays of femtoliter chambers allow single molecule enzymology,” Nat Biotech, vol. 23, no. 3, pp. 361-365, March 2005. [0410] [21] Y. Zhao, Y. Cheng, L. Shang, J. Wang, Z. Xie, and Z. Gu, “Microfluidic Synthesis of Barcode Particles for Multiplex Assays,” Small, vol. 11, no. 2, pp. 151-174, January 2015. [0411] [22] A. Sarkar, H. W. Hou, A. E. Mahan, J. Han, and G. Alter, “Multiplexed Affinity-Based Separation of Proteins and Cells Using Inertial Microfluidics,” Scientific Reports, vol. 6, p. 23589, March 2016. [0412] [23] S. C. Chapin and P. S. Doyle, “Ultrasensitive Multiplexed MicroRNA Quantification on Encoded Gel Microparticles Using Rolling Circle Amplification,” Anal. Chem., vol. 83, no. 18, pp. 7179-7185, September 2011. [0413] [24] D. C. Pregibon, M. Toner, and P. S. Doyle, “Multifunctional Encoded Particles for High-Throughput Biomolecule Analysis,” Science, vol. 315, no. 5817, pp. 1393-1396, March 2007. [0414] [25] D. S. Zhang et al., “Dual-Encoded Microbeads through a Host-Guest Structure: Enormous, Flexible, and Accurate Barcodes for Multiplexed Assays,” Advanced Functional Materials, vol. 26, no. 34, pp. 6146-6157, September 2016. [0415] [26] Brouzes et al. “Droplet microfluidic technology for single-cell high-throughput screening”, PNAS 2009 [0416] [27] Genot et al, “High-resolution mapping of bifurcations in nonlinear biochemical circuits”, Nat. Chem. 2016. [0417] [28] A. Yamagata, R. Masui, Y. Kakuta, S. Kuramitsu and K. Fukuyama; Overexpression, purification and characterization of RecJ protein from Thermus thermophilus HB8 and its core domain; Nucleic Acids Res. Nov. 15, 2001; 29(22): 4617-4624. [0418] [29] Xu et al 2005: Generation of Monodisperse Particles by Using Microfluidics: Control over Size, Shape, and Composition, GDCH, Vol. 44, pages 724-728. [0419] [30] Huggett et al. BMC Res Notes 2008 [0420] [31] Wil A. M. Loenen and Elisabeth A. Raleigh The other face of restriction: modification-dependent enzymes; Nucleic Acids Res. Jan. 1, 2014; 42(1): 56-69.