Filamentous Fungus Mutant Strain and Use Thereof
20180216121 ยท 2018-08-02
Assignee
Inventors
Cpc classification
C13K1/02
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
C12P19/14
CHEMISTRY; METALLURGY
International classification
C13K1/02
CHEMISTRY; METALLURGY
Abstract
A filamentous fungus mutant strain in which enzyme production inhibition caused by glucose is suppressed is constructed, and a method of producing a polysaccharide-degrading enzyme, a method of producing a saccharide from biomass, and a method of saccharifying biomass, each using the filamentous fungus, are provided. The filamentous fungus mutant strain in which Sre1 expression is reduced compared to a parent strain or is lost.
Claims
1. A filamentous fungus mutant strain wherein Sre1 expression is reduced compared to a parent strain or is lost, wherein Sre1 is a protein selected from the group consisting of the following (a) to (c): (a) a protein having the amino acid sequence represented by SEQ ID NO: 2; (b) a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes; and (c) a protein having the amino acid sequence represented by SEQ ID NO: 2 in which one to several amino acids are deleted, substituted, added or inserted and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes.
2. The filamentous fungus mutant strain according to claim 1, wherein the Sre1 expression is lost.
3. (canceled)
4. The filamentous fungus mutant strain according to claim 1, wherein the sre1 gene is deleted or inactivated.
5. The filamentous fungus mutant strain according to claim 4, wherein the sre1 gene is represented by any of the following (d) to (i): (d) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1; (e) a polynucleotide having a nucleotide sequence with an identity of 80% or more with the nucleotide sequence represented by SEQ ID NO: 1 and encoding a protein having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes; (f) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 under stringent conditions and encoding a protein having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes; (g) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2; (h) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 in which one to several amino acids are deleted, substituted, added or inserted and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes; and (i) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes.
6. The filamentous fungus mutant strain according to claim 1, wherein the filamentous fungus belongs to Trichoderma.
7. The filamentous fungus mutant strain according to claim 6, wherein the filamentous fungus is Trichoderma reesei.
8. A method of producing a cellulase and/or a xylanase, the method comprising a step of culturing the filamentous fungus mutant strain according to claim 1 in the presence of a cellulase inducer to generate and accumulate a cellulase and/or a xylanase in a culture product and a step of collecting the cellulase and/or the xylanase from the culture product.
9. A method of producing a cellulase and/or a xylanase, the method comprising a step of culturing the filamentous fungus mutant strain according to claim 1 in the presence of a cellulase inducer and glucose to generate and accumulate a cellulase and/or a xylanase in a culture product and a step of collecting the cellulase and/or the xylanase from the culture product.
10. The method of producing a cellulase and/or a xylanase according to claim 9, wherein the culture medium comprises the cellulase inducer in an amount of from 0.1 to 40 mass % in total and glucose in an amount of from 0.5 to 10 mass %.
11. The method of producing a cellulase and/or a xylanase according to claim 10, wherein the mass ratio of the cellulase inducer and glucose is 10:1 to 1:1.
12. A method of producing a saccharide from biomass, the method comprising using a culture product, obtained by culturing the filamentous fungus mutant strain according to claim 1 in the presence of a cellulase inducer, as a biomass saccharifying agent.
13. A method of saccharifying biomass, the method comprising using a culture product, obtained by culturing the filamentous fungus mutant strain according to claim 1 in the presence of a cellulase inducer, as a biomass saccharifying agent.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0027]
[0028]
DETAILED DESCRIPTION OF THE INVENTION
[0029] The present invention constructs a filamentous fungus mutant strain in which enzyme production inhibition caused by glucose is suppressed and provides a method of producing a polysaccharide-degrading enzyme, a method of producing a saccharide from biomass, and a method of saccharifying biomass, each using the filamentous fungus.
[0030] The present inventors diligently studied to solve the above-described problems and, as a result, found that glucose inhibition in the production of a cellulase or a xylanase is dramatically suppressed in a filamentous fungus mutant strain that has lost the expression of Serf involved in transcription regulation of genes encoding cholesterol synthesis enzymes and the strain is useful as filamentous fungi for producing the enzyme, and the present invention was accomplished.
[0031] The present invention provides filamentous fungi in which enzyme production inhibition caused by glucose is suppressed in the production of a cellulase or a xylanase, and enables production of a cellulase and/or a xylanase by using the filamentous fungi even under culture conditions including a high concentration of glucose. Furthermore, a saccharide can be produced by saccharifying biomass by using the filamentous fungi.
[0032] In the present specification, amino acid sequence and nucleotide sequence identities are calculated according to a Lipman-Pearson method (Lipman, D. J., Pearson, W. R.: Science, 1985, 227: 1435-1441). Specifically, the identity is calculated by performing analysis using a homology analysis (Search homology) program of genetic information processing software Genetyx-Win (Software Development Co.) and setting the unit size to compare (ktup) at 2.
[0033] In the present specification, one or several used in connection with deletion, substitution, addition, or insertion of amino acid(s) or nucleotide(s) in an amino acid sequence or a nucleotide sequence can be, for example, 1 to 12, preferably 1 to 8, more preferably 1 to 4, unless otherwise defined. In the present specification, the term addition of amino acid(s) or nucleotide(s) includes addition of one or several amino acids or nucleotides to one end or both ends of a sequence.
[0034] In the present specification, the term stringent conditions relating to hybridization refers to conditions allowing a gene comprising a nucleotide sequence having a sequence identity of about 80% or more or about 90% or more to be verified, unless otherwise defined. Examples of the stringent conditions include the conditions described in Molecular Cloning: A LABORATORY MANUAL THIRD EDITION (Joseph Sambrook, David W. Russell, Cold Spring Harbor Laboratory Press, 2001). A person skilled in the art of hybridization can appropriately make stringent conditions by regulating, for example, the salt concentration of a hybridization solution and the temperature, depending on, for example, the nucleotide sequence, the concentration and the length of a probe. In one example, the stringent conditions are preferably 5SSC and 70 C. or more, more preferably 5SSC and 85 C. or more for hybridization condition; and preferably 1SSC and 60 C. or more, more preferably 1SSC and 73 C. or more for washing condition. The above-mentioned combinations of SSC and temperature conditions are merely examples, and a person skilled in the art can achieve appropriate stringency by appropriately combining the above-mentioned or other factors determining the stringency of hybridization.
[0035] In the present specification, the terms upstream and downstream of a gene refer to a region extending toward the 5 end and the 3 end, respectively, of a targeted gene or region. The upstream and the downstream of a gene are not limited to the upstream region and the downstream region from the translation initiation site of the gene, unless otherwise defined.
<Construction of Filamentous Fungus Mutant Strain>
[0036] In the filamentous fungus mutant strain of the present invention, the Sre1 expression is reduced compared to a parent strain or is lost.
[0037] Sre1 is a protein having the amino acid sequence represented by SEQ ID NO: 2 and is a transcription factor for genes encoding cholesterol synthesis enzymes. The protein has HLH Superfamily and DUF2014 Superfamily domains and therefore corresponds to Sre1 registered in the NCBI database as Sterol regulatory element-binding protein 1. The protein has an amino acid sequence identity with other Sre1s, i.e., with Sre1 derived from Fusarium oxysporum f. sp. cubense race 1 of 58% and with Sre1 derived from Acremonium chrysogenum ATCC 11550 of 55%.
[0038] Examples of Sre1 in the present invention include:
[0039] (a) a protein having the amino acid sequence represented by SEQ ID NO: 2;
[0040] (b) a protein having the amino acid sequence represented by SEQ ID NO: 2 in which one to several amino acids are deleted, substituted, added or inserted and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes; and
[0041] (c) a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes.
[0042] Examples of the amino acid sequence having an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 include amino acid sequences preferably having an identity of 90% or more, more preferably 95% or more, even more preferably 97%, even more preferably 98%, even more preferably 99% or more.
[0043] In the present invention, the expression of Sre1 means that a translation product (i.e., Sre1 protein (referred to as Sre1)) is produced from the gene encoding the protein (sre1 gene) and is localized at the site of action in a functional state. A reduction in Sre1 expression means a state where the amount of Sre1 protein present in the filamentous fungus mutant strain cells is significantly reduced compared to that in the parent strain resultantly. Accordingly, the way for reducing or losing the Sre1 expression in the filamentous fungus mutant strain of the present invention encompasses modifications of genetic level, transcriptional level, posttranscriptional regulatory level, translational level, and posttranslational modification level.
[0044] A reduction in Sre1 expression compared to a parent strain means that the amount of Sre1 expressed in filamentous fungi is reduced compared to a parent strain, more specifically, the amount of Sre1 expressed in the cells is usually reduced to 50% or less, preferably 20% or less, more preferably 10% or less compared to a parent strain, and thereby the activity is similarly reduced. It is most preferred that the amount of Sre1 expressed is 0%, that is, the Sre1 expression is lost.
[0045] The comparison of amount of Sre1 expressed is performed based on the amount of the Sre1 protein expressed.
[0046] The amount of Sre1 expressed can be measured by a known immunological method, such as western blotting or immunohistochemical staining.
[0047] The filamentous fungus mutant strain in which Sre1 expression is reduced compared to a parent strain or is lost preferably can be acquired by deleting or inactivating the sre1 gene on the chromosomal DNA of the filamentous fungus parent strain. Herein, the sre1 gene refers to a DNA having the transcriptional region including an ORF and transcriptional regulatory regions such as a promoter of the gene.
[0048] In the present invention, the sre1 gene specifically includes a gene having an ORF given by any of the following polynucleotides:
[0049] (d) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1;
[0050] (e) a polynucleotide having a nucleotide sequence with an identity of 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or even more, more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, even more preferably 99% or more with the nucleotide sequence represented by SEQ ID NO: 1 and encoding a protein having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes;
[0051] (f) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 under stringent conditions and encoding a protein having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes;
[0052] (g) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2;
[0053] (h) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO:2 in which one to several amino acids are deleted, substituted, added or inserted and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes; and
[0054] (i) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, even more preferably 99% or more with the amino acid sequence represented by SEQ ID NO: 2 and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes.
[0055] Examples of deletion or inactivation of the sre1 gene include introducing a mutation into one or more nucleotides on the nucleotide sequence of the gene, that is, deleting a part or the whole of the nucleotide sequence of the gene, or substituting for or inserting to the nucleotide sequence, another nucleotide sequence, (in this case, the amino acid sequence of Sre1 may be the same as or different from that of a parent strain).
[0056] Examples of the nucleotide region into which a mutation is introduced include the transcriptional region of the sre1 gene and transcriptional regulatory regions, such as a promoter and an enhancer (transcriptional activation region), of the gene, and preferred is the transcriptional region.
[0057] Examples of the transcriptional regulatory region of the sre1 gene include a region of 30 nucleotides upstream of the 5 end of the transcriptional region of the sre1 gene on the chromosomal DNA. Examples of the transcriptional activation region of the sre1 gene include a region corresponding to the nucleotides 1000 to 500 upstream.
[0058] A nucleotide mutation may be introduced into the transcriptional region without limitation of the kinds and number of nucleotides as long as it can reduce or lose the Sre1 expression. Examples of deletion of nucleotides include deletion of a part of the transcriptional region, preferably 10 nucleotides or more, more preferably 20 nucleotides or more, even more preferably 100 nucleotides or more, even preferably 200 nucleotides or more, even more preferably the whole of the transcriptional region. Examples of substitution of nucleotides include substitution of nucleotides within a range from the 5 end of the transcriptional region to the 150th nucleotide, preferably to the 100th nucleotide, more preferably to the 50th nucleotide, even more preferably to the 30th nucleotide, even more preferably the 20th nucleotide with a nonsense codon or with a control region that can reduce the Sre1 expression. Examples of insertion of nucleotides include addition of 50 or more nucleotides, preferably 100 or more nucleotides, more preferably 200 or more nucleotides, even more preferably 500 or more nucleotides, even more preferably a DNA fragment of 1 kb or more at the position following the nucleotides within a range from the 5 end of the transcriptional region to the 150th nucleotide, preferably to the 100th nucleotide, more preferably to the 50th nucleotide, even more preferably to the 30th nucleotide, even more preferably to the 20th nucleotide. Preferred examples of the form of the addition of nucleotides include introduction of a drug resistance gene, such as a hygromycin resistance gene and an aureobasidin resistance gene, or an auxotrophic gene, such as an acetoamidase gene that is not possessed by the filamentous fungi.
[0059] The method of introducing a nucleotide mutation into the sre1 gene on the chromosomal DNA of filamentous fungi may be, for example, a method of using homologous recombination. In a method of using common homologous recombination, for example, a gene mutated by deletion, substitution, or insertion of nucleotides is inserted between the upstream region and the downstream region of the sre1 gene to produce a DNA fragment including a drug resistance gene or an auxotrophic gene, and the DNA fragment is used to cause homologous recombination in the locus of the sre1 gene of a host cell to which nucleotide deletion or the like is desired to be introduced.
[0060] In the method using homologous recombination, specifically, i) the DNA fragment for homologous recombination is introduced into a filamentous fungus parent strain by a usual manner, and subsequently a transformant into which, as a result of homologous recombination, a plasmid for homologous recombination has been introduced on the chromosomal DNA is selected using drug resistance or auxotrophy as an index; ii) PCR is performed using the chromosomal DNA of the resulting transformant as a template. The primers on this occasion are designed such that the site where the nucleotides of the gene have been deleted, substituted, or inserted is amplified. A strain in which a gene having the original length is not amplified, but a gene having a length reflecting the deletion, substitution, or insertion of the nucleotides is amplified is selected; and iii) finally, a strain in which the mutated gene is introduced into only the locus of the chromosomal DNA, but not introduced into any another site can be obtained by Southern analysis.
[0061] Alternatively, a nucleotide mutation may be introduced into the sre1 gene on the chromosomal DNA of a parent strain by, for example, a method using a bacteriophage or conjugation.
[0062] The filamentous fungus mutant strain of the present invention can also be obtained by subjecting a filamentous fungus parent strain to mutation processing and then selecting a strain in which Sre1 expression is reduced compared to the parent strain or is lost. Examples of the mutation processing include treatment with N-methyl-N-nitro-N-nitrosoguanidine (NTG), ethylnitrosourea, or ultraviolet light (Shinban Biseibutsu Zikken-ho (New Edition, Microorganisms Experimental Methods), 1999, pp. 126-134, Kodansha Scientific Ltd.), and irradiation with radioactive rays. In addition, a variety of alkylating agents and carcinogens can be used as mutagens.
[0063] Alternatively, the Sre1 expression can be reduced without introducing a mutation into the sre1 gene. Examples of such a method include introduction of a nucleic acid having an activity of degrading a transcriptional product of a gene encoding a protein or a nucleic acid suppressing translation of the transcriptional product into a protein. Examples of such a nucleic acid include a nucleic acid having a nucleotide sequence complementary or substantially complementary to the nucleotide sequence of mRNA encoding the protein or a part of the nucleotide sequence.
[0064] A nucleotide sequence substantially complementary to the nucleotide sequence of mRNA encoding Sre1 refers to a nucleotide sequence having complementarity such that the nucleotide sequence binds to the target sequence of the mRNA to inhibit the translation thereof under physiological conditions inside the target filamentous fungus cells, and specifically, for example, a nucleotide sequence having an identity of about 80% or more, preferably about 90% or more, more preferably about 95% or more, even more preferably about 97% or more with the nucleotide sequence completely complementary to the nucleotide sequence of the mRNA (i.e., the nucleotide sequence of a complementary strand of the mRNA) in the overlapping region.
[0065] More specifically, examples of the nucleotide sequence complementary or substantially complementary to the nucleotide sequence of mRNA encoding Sre1 include polynucleotides in the above-described (d) to (i).
[0066] Preferred examples of the mRNA encoding Sre1 include mRNA encoding Sre1 of Trichoderma reesei having the nucleotide sequence represented by SEQ ID NO: 1.
[0067] A part of the nucleotide sequence complementary or substantially complementary to the nucleotide sequence of mRNA encoding Sre1 may have no limitation of length and position as long as it can specifically binds to mRNA of Sre1 and can inhibit the translation of the mRNA into the protein. From the viewpoint of sequence specificity, the part complementary or substantially complementary to the target sequence includes at least 10 or more nucleotides, preferably about 15 or more nucleotides, more preferably about 20 or more nucleotides.
[0068] Specifically, preferred examples of the nucleic acid having a nucleotide sequence complementary or substantially complementary to the nucleotide sequence of mRNA encoding Sre1 or a part of the nucleotide sequence includes the following (j) to (l):
[0069] (j) Antisense RNA to mRNA encoding Sre1;
[0070] (k) Small interfering RNA (siRNA) to mRNA encoding Sre1; and
[0071] (l) Ribozyme to mRNA encoding Sre1.
[0072] The parent strain in the present invention is not limited as long as it is a filamentous fungus that expresses Sre1 and has cellulase activity and/or xylanase activity, and examples thereof include filamentous fungi belonging to Eumycota or Oomycota. Specifically, the filamentous fungi are, for example, those belonging to Trichoderma, Aspergillus, Penicillium, Neurospora, Fusarium, Chrysosporium, Humicola, Emericella, or Hypocrea. The filamentous fungi are preferably those belonging to Trichoderma.
[0073] Examples of the filamentous fungi belonging to Trichoderma include Trichoderma reesei, Trichoderma longibrachiatum, Trichoderma harzianum, Trichoderma koningii, and Trichoderma viride. The filamentous fungi are preferably Trichoderma reesei, more preferably Trichoderma reesei PCD-10 strain (FERM P-8172).
[0074] The filamentous fungi as the parent strain may be a wild-type strain, a strain artificially bred from the wild-type strain, or a variant strain (variant) or a mutant in which a nucleotide sequence in the genome is substituted, added, deleted, or modified.
[0075] Preferred examples of the filamentous fungus mutant strain of the present invention include filamentous fungi obtained by deleting the sre1 gene of the Trichoderma reesei PCD-10 strain (FERM P-8172) by homologous recombination to lose the Sre1 expression. Specifically, Trichoderma reesei Sre1 disclosed in Example described below is an example.
[0076] In the thus-constructed filamentous fungus mutant strain of the present invention, the Sre1 expression in the cells is lost or reduced compared to the parent strain, and therefore the inhibition of production of cellulase or xylanase by glucose is consequently suppressed compared to the parent strain.
[0077] Accordingly, a reduction in productivity of a cellulase or a xylanase can be suppressed by using the filamentous fungus mutant strain of the present invention, even if a high concentration of glucose is present in the culture medium.
<Production of Cellulase and/or Xylanase>
[0078] A cellulase and/or a xylanase can be produced by culturing the filamentous fungus mutant strain of the present invention in the presence of a cellulase inducer to generate and accumulate a cellulase and/or a xylanase in a culture product and collecting the cellulase and/or the xylanase from the culture product.
[0079] Herein, the cellulase inducer is not limited as long as it is a substance that induces the production of cellulase by cellulase-producing filamentous fungi and is, for example, a compound selected from cellulose; sophorose; and cellooligosaccharides, such as cellobiose, cellotriose, cellotetraose, cellopentaose, and cellohexaose.
[0080] Herein, the cellulose encompasses a polymer of glucose polymerized by -1,4-glucoside bonds and derivatives thereof. The degree of polymerization of glucose is not particularly limited. Examples of the derivative include carboxymethylated, aldehyded, and esterified derivatives. Furthermore, the cellulose may be glucoside, which is a glycoside; lignocellulose, which is a complex with lignin and/or hemicellulose; or a complex with, for example, pectin. The cellulose may be crystalline cellulose or may be amorphous cellulose.
[0081] The cellulase inducer can be added by any method, such as one-shot addition (batch method), divided addition (fed-batch method), or continuous addition (feeding method). The cellulase inducer may be added to a culture medium at any amount that can induce production of a cellulase and/or a xylanase by the filamentous fungi mutant strain of the present invention. The amount differs depending on the method of addition, but the total amount is preferably 0.1 mass % or more, more preferably 0.5 mass % or more, even more preferably 1 mass % or more and preferably 40 mass % or less, more preferably 35 mass % or less, even more preferably 30 mass % or less of the amount of the culture medium. The amount is preferably from 0.1 to 40 mass %, more preferably from 0.5 to 35 mass %, even more preferably from 1 to 30 mass %.
[0082] Among the above-mentioned methods, the amount of the cellulase inducer in the one-shot addition is preferably 0.1 mass % or more, more preferably 0.5 mass % or more, even more preferably 1 mass % or more and preferably 16 mass % or less, more preferably 14 mass % or less, even more preferably 12 mass % or less. The amount is preferably from 0.1 to 16 mass %, more preferably from 0.5 to 14 mass %, even more preferably from 1 to 12 mass %.
[0083] The culture medium used in the method of the present invention may be a synthetic culture medium or a natural culture medium that contains nutrients necessary for proliferation of the filamentous fungus mutant strain of the present invention and production of a cellulase and/or a xylanase, such as a carbon source, a nitrogen source, inorganic salts, and vitamins.
[0084] The carbon source may be any carbon source that can be assimilated by the filamentous fungus mutant strain of the present invention, and examples thereof include carbohydrates, such as glucose and fructose; alcohols, such as ethanol and glycerol; and organic acids, such as acetic acid, in addition to the above-mentioned cellulase inducers. These carbon sources may be used alone or in combination of two or more thereof.
[0085] In the filamentous fungus mutant strain of the present invention, the productivity of a cellulase or a xylanase is not suppressed even when glucose is present in the culture medium at the time of starting the culture. In this case, the amount of glucose added is preferably 0.1 mass % or more, more preferably 0.5 mass % or more, even more preferably 2.5 mass % or more and 15 mass % or less, more preferably 10 mass % or less, even more preferably 5 mass % or less of the amount of the culture medium. The amount is preferably from 0.1 to 15 mass %, more preferably from 0.5 to 10 mass %, more preferably from 2.5 to 5 mass %. The mass ratio of the amounts of the cellulase inducer and glucose in the culture medium is preferably from 10:1 to 1:1, more preferably from 4:1 to 2:1.
[0086] Examples of the nitrogen source include ammonium salts, such as ammonia and ammonium sulfate; nitrogen compounds, such as amine; natural nitrogen sources, such as peptone and soybean hydrolysates.
[0087] Examples of the inorganic salt include potassium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, and potassium carbonate.
[0088] Examples of the vitamin include biotin and thiamine. The medium can further optionally contain a substance required for growth of the filamentous fungi mutant strain of the present invention.
[0089] The culture is preferably performed under aerobic conditions such as shaking culture or aerated and agitated culture. The culture temperature is preferably 10 C. or more, more preferably 20 C. or more, even more preferably 25 C. or more and preferably 50 C. or less, more preferably 42 C. or less, even more preferably 35 C. or less. The temperature is preferably from 10 C. to 50 C., more preferably from 20 C. to 42 C., even more preferably from 25 C. to 35 C.
[0090] The pH in the culture is from 3 to 9, preferably from 4 to 5. The culture time is from 10 hours to 10 days, preferably from 2 to 7 days.
[0091] After the completion of the culture, the culture product is collected, is subjected to cell disruption by, for example, ultrasonication or pressurization, as needed, and is solid-liquid separated by, for example, filtration or centrifugation, followed by an appropriate combination of ultrafiltration, salting-out, dialysis, chromatography, and so on to obtain a cellulase and/or a xylanase. The degree of separation and purification is not particularly limited. The culture supernatant or its roughly separated and purified product itself can also be used as a cellulase or a xylanase.
[0092] In the present invention, the term cellulase is a generic name of enzymes degrading cellulose and encompasses endoglucanase (EC 3.2.1.4) cleaving cellulose from the inside of the molecule; and exoglucanase (cellobiohydrolase, EC 3.2.1.91) and -glucosidase (EC 3.2.1.21) degrading cellulose from the reducing terminal or nonreducing terminal to release cellobiose.
[0093] The xylanase is an enzyme (EC 3.2.1.8) hydrolyzing the 1-4 bond of xylan to generate xylose.
[0094] Degradation or saccharification of cellulose or xylan and production of a monosaccharide using the filamentous fungus mutant strain of the present invention can be performed by known methods.
[0095] That is, a monosaccharide can be produced by using the above-mentioned culture product, obtained by culturing the filamentous fungus mutant strain of the present invention in the presence of a cellulase inducer, as a biomass saccharifying agent and heating the culture product together with a cellulose- or xylan-containing material (biomass) in an aqueous solvent with stirring or shaking to degrade or saccharify the biomass.
[0096] As the cellulose- or xylan-containing material, those exemplified as the cellulase inducers to be contained in the above-described culture medium can be used.
[0097] In the degradation or saccharification of biomass, the reaction solution may have any pH and any temperature within ranges that do not inactivate the cellulase or xylanase. Generally, when the reaction is performed at normal pressure, the temperature is within a range of 5 C. to 95 C., and the pH is within a range of 1 to 11.
[0098] The process of degradation or saccharification of biomass may be a batch system or a continuous system.
[0099] Regarding the above-described embodiments, the present invention further discloses the following aspects:
[0100] <1> A filamentous fungus mutant strain wherein Sre1 expression is reduced compared to a parent strain or is lost;
[0101] <2> The filamentous fungus mutant strain according to aspect <1>, wherein the Sre1 expression is lost;
[0102] <3> The filamentous fungus mutant strain according to aspect <1>, wherein the Sre1 is a protein selected from the group consisting of the following (a) to (c):
[0103] (a) a protein having the amino acid sequence represented by SEQ ID NO: 2,
[0104] (b) a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes, and
[0105] (c) a protein having the amino acid sequence represented by SEQ ID NO: 2 in which one to several amino acids are deleted, substituted, added-or inserted and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes;
[0106] <4> The filamentous fungus mutant strain according to any of aspects <1> to <3>, wherein sre1 gene is deleted or inactivated;
[0107] <5> The filamentous fungus mutant strain according to aspect <4>, wherein the sre1 gene is represented by any of the following (d) to (i):
[0108] (d) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1,
[0109] (e) a polynucleotide having a nucleotide sequence with an identity of 80% or more with the nucleotide sequence represented by SEQ ID NO: 1 and encoding a protein having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes,
[0110] (f) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 under stringent conditions and encoding a protein having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes,
[0111] (g) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2,
[0112] (h) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO:2 in which one to several amino acids are deleted, substituted, added or inserted and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes, and
[0113] (i) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 and having an activity as a transcription factor for genes encoding cholesterol synthesis enzymes;
[0114] <6> The filamentous fungus mutant strain according to any one of aspects <1> to <5>, wherein the filamentous fungus belongs to Trichoderma;
[0115] <7> The filamentous fungus mutant strain according to any of aspects <1> to <5>, wherein the filamentous fungus is Trichoderma reesei;
[0116] <8> A method of producing a cellulase and/or a xylanase, the method comprising a step of culturing the filamentous fungus mutant strain according to any one of aspects <1> to <7> in the presence of a cellulase inducer to generate and accumulate a cellulase and/or a xylanase in a culture product and a step of collecting the cellulase and/or the xylanase from the culture product;
[0117] <9> A method of producing a cellulase and/or a xylanase, the method comprising a step of culturing the filamentous fungus mutant strain according to any of aspects <1> to <7> in the presence of a cellulase inducer and glucose to generate and accumulate a cellulase and/or a xylanase in a culture product and a step of collecting the cellulase and/or the xylanase from the culture product;
[0118] <10> The method of producing a cellulase and/or a xylanase according to aspect <9>, wherein the culture medium comprises the cellulase inducer in an amount of from 0.1 to 40 mass %, preferably from 0.5 to 35 mass %, more preferably from 1 to 30 mass in total, and glucose in an amount of from 0.1 to 15 mass %, preferably from 0.5 to 10 mass %, more preferably 2.5 to 5 mass %;
[0119] <11> The method of producing a cellulase and/or a xylanase according to aspect <10>, wherein a mass ratio of the cellulase inducer and glucose is from 10:1 to 1:1, preferably from 4:1 to 2:1;
[0120] <12> A method of producing a saccharide from biomass, the method comprising using a culture product, obtained by culturing the filamentous fungus mutant strain according to any of aspects <1> to <7> in the presence of a cellulase inducer, as a biomass saccharifying agent; and
[0121] <13> A method of saccharifying biomass, the method comprising using a culture product, obtained by culturing the filamentous fungus mutant strain according to any of aspects <1> to <7> in the presence of a cellulase inducer, as a biomass saccharifying agent.
EXAMPLES
[0122] The present invention will now be described more specifically by Examples.
Example 1
Gene Mutation Site Analysis
[0123] Trichoderma reesei PCD-10 strain was used as a parent strain and subjected to mutation processing, and a strain in which cellulase production in the presence of glucose was increased compared to the parent strain was selected. The genomic DNA of this mutant strain was extracted with an ISOPLANT II DNA extraction kit (Nippon Gene Co., Ltd.) and was subjected to comparative genomic analysis with Trichoderma reesei PCD-10 strain. The results demonstrated that mutation was introduced into the ORF of the sre1 gene and gene disruption due to frameshift was consequently caused.
Example 2
Production of Gene Disruption Strain
(1) Construction of Plasmid DNA for Gene Disruption
[0124] Using a plasmid pUC-Sre1 carrying a part of the sre1 gene derived from Trichoderma reesei (SEQ ID NO: 3) inserted into the HincII restriction endonuclease cutting site of pUC118 (Takara Bio Inc.) as a template and using forward primer 1 (SEQ ID NO: 4) and reverse primer 1 (SEQ ID NO: 5) shown in Table 1, PCR was carried out to amplify a fragment (A) of about 5.2 kbp. Separately, using an acetamidase amdS derived from Aspergillus nidurans (SEQ ID NO: 6) as a template and using forward primer 2 (SEQ ID NO: 7) and reverse primer 2 (SEQ ID NO: 8) shown in Table 1, PCR was carried out to amplify a fragment (B) of about 3.1 kbp. The resulting DNA fragments (A) and (B) were treated in accordance with the protocol of In-Fusion HD Cloning Kit (Takara Bio Inc.) to construct a plasmid carrying amdS gene inserted into the sre1 gene. This plasmid was transformed into E. coli DH5 competent Cells (Takara Bio Inc.), and a strain retaining the plasmid carrying the target gene was selected from the transformants obtained as ampicillin resistance strains by colony PCR. The selected transformant was cultured (at 37 C. for 1 day) using an ampicillin-containing LB medium, and the plasmid was then collected from the resulting cells and purified with High Pure Plasmid Isolation kit (Roche Diagnostics K.K.). Herein, the resulting vector is referred to as pUC-Sre1-amdS.
(2) Production of Transformant
[0125] Trichoderma reesei PCD-10 strain was transformed with the vector constructed in the above (1). The introduction was performed by a protoplast PEG method (Biotechnol Bioeng. 2012, January. 109(1): 92-99). The transformant was selected with a selection medium (2% glucose, 1.1 M sorbitol, 2% agar, 0.2% KH.sub.2PO.sub.4 (pH 5.5), 0.06% CaCl.sub.2.2H.sub.2O, 0.06% CsCl.sub.2, 0.06% MgSO.sub.4.7H.sub.2O, 0.06% acetamide, 0.1% Trace element1, wherein every % means w/v %) containing acetamide as a single nitrogen source. Trace element 1 has the following composition: 0.5 g FeSO.sub.4.7H.sub.2O, 0.2 g CoCl.sub.2, 0.16 g MnSO.sub.4.H.sub.2O, and 0.14 g ZnSO.sub.4.7H.sub.2O were diluted with distilled water to 100 mL total. Among the resulting transformants, a transformant having gene disruption by insertion of amdS into the sre1 gene site by homologous recombination was selected by colony PCR using primers: forward primer 3 (SEQ ID NO: 9) and reverse primer 3 (SEQ ID NO: 10) and forward primer 4 (SEQ ID NO: 11) and reverse primer 4 (SEQ ID NO: 12), shown in Table 1. A strain showing correct DNA amplification was defined as a transformant, and the strain obtained herein was referred to as PCD-10Sre1.
TABLE-US-00001 TABLE1 SEQ Primer Sequence IDNO Forward CGTTTCCAGTGCGCATTACCGGAGGAGATTCCGA 4 primer1 G Reverse CCAATGATGTGCGCAGGCAATGTTTCTCAGTTGT 5 primer1 T Forward TGCGCACATCATTGGATAGG 7 primer2 Reverse TGCGCACTGGAAACGCAACC 8 primer2 Forward ATCCCTCCCCCATCGTCGCA 9 primer3 Reverse TCCTGACCCTCCATGCTGTTCGCCATCTTT 10 primer3 Forward CCAGTCCGAGTCGGACA 11 primer4 Reverse CATTGTATGCCTGATACCAC 12 primer4
Example 3
Culture of Transformant
[0126] The enzyme productivity of a transformant was evaluated by the following culture. For pre-culture, spores of Trichoderma reesei PCD-10 strain (WT) and PCD-10Sre1 produced in Example 1 were each inoculated at 110.sup.5 cells/mL in 50 mL of a culture medium placed in a 500-mL flask and were shaking-cultured at 28 C. and at 220 rpm (PRXYg-98R manufactured by Preci Co., Ltd.). The composition of the medium was as follows: 1% glucose, 0.14% (NH.sub.4).sub.2SO.sub.4, 0.2% KH.sub.2PO.sub.4, 0.03%, CaCl.sub.22H.sub.2O, 0.03% MgSO.sub.4.7H.sub.2O, 0.1% hipolypepton N, 0.05% Bacto Yeast extract, 0.1% Tween 80, 0.1% Trace element 2, and 50 mM tartaric acid buffer (pH 4.0). The composition of Trace element 2 was as follows: 6 mg H.sub.3BO.sub.3, 26 mg (NH.sub.4).sub.6Mo.sub.7O.sub.24.Math.4H.sub.2O, 100 mg FeCl.sub.3.6H.sub.2O, 40 mg CuSO.sub.4.5H.sub.2O, 8 mg MnCl.sub.2.4H.sub.2O, and 200 mg ZnCl.sub.2 were diluted with distilled water to 100 mL total. After the pre-culture for 2 days, main culture was performed using a jar fermentor (manufactured by Biott Corporation, BTR-25NA1S-8M). Ten percent (v/v %) of the pre-culture solution was inoculated and was cultured for 5 days. The carbon source was 10% Avicel or 10% Avicel+5% glucose, and other culture medium components were as follows: 0.42% (NH.sub.4).sub.2SO.sub.4, 0.2% KH.sub.2PO.sub.4, 0.03% CaCl.sub.2.2H.sub.2O, 0.03% MgSO.sub.4.7H.sub.2O, 0.1% hipolypepton N, 0.05% Bacto Yeast extract, 0.1% Tween 80, 0.1% Trace element 2, and 0.2% Antifoam PE-L. The jar fermentor was set as follows: a temperature of 28 C., an air flow rate of 0.5 vvm, and a pH of 4.5 (adjusted with 5% ammonia water). The agitation rate was varied to maintain a constant DO of 3.0 ppm. The main culture was performed for 5 days.
Example 4
Measurement of Protein Concentration
[0127] The concentration of a protein was measured by a Bradford method. In the Bradford method, Quick Start Protein Assay (Bio-Rad Laboratories, Inc.) was used, and the protein amount was calculated based on a standard curve drawn using bovine -globulin as a standard protein.
[0128] The results demonstrated that the reduction in enzyme productivity was suppressed in the produced transformant compared to a parent strain even if glucose was present at a high concentration.