Beta-galactosidase
10036000 ยท 2018-07-31
Assignee
Inventors
- Jae Youl Choi (Daejeon, KR)
- Jae Gu Pan (Sejong-si, KR)
- Seung Hwan PARK (Daejeon, KR)
- Eui Joong Kim (Daejeon, KR)
Cpc classification
C12N9/2471
CHEMISTRY; METALLURGY
C12P19/04
CHEMISTRY; METALLURGY
C12Y302/01023
CHEMISTRY; METALLURGY
International classification
C12P21/06
CHEMISTRY; METALLURGY
C12P19/18
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
C07K1/00
CHEMISTRY; METALLURGY
C12P19/04
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a novel beta-galactosidase, and more particularly to a novel beta-galactosidase derived from Bacillus circulans, a gene encoding the beta-galactosidase, a recombinant vector and a recombinant microorganism, which contain the gene, a method for producing a beta-galactosidase using the recombinant microorganism, and a method for producing galactooligosaccharide using the beta-galactosidase. The use of the novel beta-galactosidase according to the present invention makes it possible to efficiently produce a large amount of galactooligosaccharide.
Claims
1. A recombinant vector comprising a gene encoding a beta-galactosidase having the amino acid sequence of SEQ ID NO:1.
2. The recombinant vector of claim 1, wherein the gene encoding the beta-galactosidase has the nucleotide sequence of SEQ ID NO:2.
3. A recombinant microorganism wherein a gene having the nucleotide sequence of SEQ ID NO:2 or the recombinant vector of claim 1 or claim 2 is introduced into a host cell selected from the group consisting of bacteria, fungi, and yeasts.
4. A method for producing a beta-galactosidase, comprising the steps of: culturing the recombinant microorganism of claim 3 to produce a beta-galactosidase; and recovering the produced beta-galactosidase.
5. A method for producing a galactooligosaccharide, comprising: reacting the beta-galactosidase having the amino acid sequence of SEQ ID NO:1 with a lactose-containing substrate to produce galactooligosaccharide; and recovering the produced galactooligosaccharide.
6. The method of claim 5, wherein the galactooligosaccharide is one ingredient selected from the group consisting of liquid milk, dried milk powder, baby milk, baby formula, ice cream, yoghurt, cheese, fermented dairy products, beverages, infant foods, cereals, bread, biscuits, confectionary, cakes, food supplements, dietary supplements, probiotic comestible foods, prebiotic comestible foods, animal feeds, poultry feeds, and drugs.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2)
(3)
(4)
BEST MODE FOR CARRYING OUT THE INVENTION
(5) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Generally, the nomenclature used herein and the experiment methods, which will be described below, are those well known and commonly employed in the art.
(6) In one aspect, the present invention is directed to a beta-galactosidase having an amino acid sequence of SEQ ID NO: 1 and to a gene encoding the beta-galactosidase.
(7) In the present invention, it was expected that a beta-glycosidase gene having the characteristics of another additional beta-galactosidase different from the three beta-galactosidases identified to date can be present Bacillus circulans. Based on this expectation, a novel beta-galactosidase gene was isolated from the genome of Bacillus circulans.
(8) In an example of the present invention, the genomic DNA of Bacillus circulans ATCC 31382 was digested with each of 23 restriction enzymes to construct a genomic library for beta-galactosidase cloning, and a strain having beta-galactosidase activity was selected from the library.
(9) A Bacillus circulans genomic fragment contained in the selected strain having beta-galactosidase activity was sequenced. As a result, it was found that the fragment contains a beta-galactosidase gene having a novel sequence, in addition to the known beta-galactosidase genes derived from Bacillus circulans.
(10) The nucleotide sequence of the fragment containing the novel beta-galactosidase gene is represented by SEQ ID NO: 3. The total size of the DNA fragment containing the beta-galactosidase gene was 6731 bp, and three open reading frames (ORFs) were found in the fragment (
(11) In another aspect, the present invention is directed to a recombinant vector that contains a gene encoding the beta-galactosidase, and to a recombinant microorganism wherein the gene encoding the beta-galactosidase or the recombinant vector is introduced into a host cell selected from the group consisting of bacteria, fungi, and yeasts.
(12) As used herein, the term vector means a DNA construct containing a DNA sequence operably linked to a suitable control sequence capable of effecting the expression of the DNA in a suitable host. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once incorporated into a suitable host, the vector may replicate and function independently of the host genome, or may in some instances, integrate into the genome itself. In the present specification, plasmid and vector are sometimes used interchangeably, as the plasmid is the most commonly used form of vector. However, the present invention is intended to include other types of vectors with the same function as that would be known or known in the art. Typical expression vectors for mammalian cell culture expression are based on, for example, pRK5 (EP 307,247), pSV16B (WO91/08291), and pVL1392 (Pharmingen).
(13) As used herein, the term expression control sequence refers to the DNA sequences essential for the expression of the coding sequence operably linked to in a particular host organism. Such control sequences include a promoter for performing transcription, any operator sequence for controlling such transcription, a sequence for encoding a suitable mRNA ribosomal binding site, and a sequence for controlling the termination of transcription and translation. For example, control sequences suitable for prokaryotes include a promoter, an arbitrary operator sequence, and a ribosomal binding site. Eukaryotic cells include promoters, polyadenylation signals, and enhancers. The factor having the greatest effect on the expression level of the gene in the plasmid is a promoter. SRpromoter, cytomegalovirus promoter and the like are preferably used as a promoter for high expression.
(14) To express the DNA sequence of the present invention, any of a wide variety of expression control sequences may be used in the vector. Examples of useful expression control sequences include, for example, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, T3 and T7 promoters, the major operator and promoter regions of phage lambda, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast mating system, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof. T7 RNA polymerase promoter 010 may be effectively used to express the protein NSP in E. coli.
(15) A nucleic acid sequence is operably linked when it is arranged in a functional relationship with another nucleic acid sequence. The nucleotide sequence may be a gene and a control sequence(s) linked to be capable of expressing the gene when it binds to a control sequence(s) (e.g., transcription-activating protein). For example, DNA for a pre-sequence or a secretory leader is operably linked to DNA encoding polypeptide when expressed as pre-protein participating in secretion of polypeptide; a promoter or an enhancer is operably linked to a coding sequence when affecting the transcription of the sequence; and a RBS is operably linked to a coding sequence when affecting the transcription of the sequence, or to a coding sequence when arranged to facilitate translation. Generally, the term operably linked means that the DNA linked sequences are contiguous, and in the case of the secretory leader, are contiguous and present in a reading frame. However, an enhancer is not necessarily contiguous. The linkage between these sequences is performed by ligation at a convenient restriction enzyme site. However, when the site does not exist, a synthetic oligonucleotide adaptor or a linker is used according to a conventional method.
(16) The term expression vector used herein generally means a double-stranded DNA fragment functioning as a recombinant carrier into which a heterologous DNA fragment is inserted. Here, the heterologous DNA means a hetero-type DNA, which is not naturally found in a host cell. The expression vector may be self-replicable regardless of host chromosomal DNA once in a host cell, and may produce several copies of the vector and (heterologous) DNA inserted thereinto.
(17) As is well known in the art, in order to increase the expression level of a transfected gene in a host cell, a corresponding gene should be operably linked to transcription and translation expression control sequences which are operated in a selected expression host. Preferably, the expression control sequences and the corresponding gene are included in one expression vector together with a bacterial selection marker and a replication origin. When an expression host cell is a eukaryotic cell, an expression vector should further include an expression marker which is useful in a eukaryotic expression host.
(18) The host cell transformed or transfected by the aforementioned expression vector constitutes another aspect of the present invention. As used herein, the term transformation means that DNA can be replicated as a factor outside of chromosome or by means of completion of the entire chromosome by introducing DNA as a host. As used herein, the term transfection means that an expression vector is accepted by a host cell regardless of whether or not any coding sequence is actually expressed.
(19) It should be understood that all vectors and expression control sequences do not equally function in expressing the DNA sequence of the present invention. Similarly, all hosts do not equally function for an identical expression system. However, those skilled in the art may make a suitable selection from among various vectors, expression control sequences, and hosts without either departing from the scope of the present invention or bearing an excessive experimental burden. For example, a vector must be selected taking a host cell into consideration, because the vector should be replicated in the host cell. Specifically, the copy number of a vector, the ability to control the copy number, and the expression of other protein encoded by the vector (e.g., the expression of an antibiotic marker) should also be deliberated. Also, an expression control sequence may be selected taking several factors into consideration. For example, relative strength, control capacity and compatibility with the DNA sequence of the present invention of the sequence should be deliberated particularly with respect to possible secondary structures. Further, the selection of a host cell may be made under consideration of compatibility with a selected vector, toxicity of a product encoded by a DNA sequence, secretory nature of the product, ability to correctly fold a polypeptide, fermentation or cultivation requirements, ability to ensure easy purification of a product encoded by a DNA sequence, or the like. Within the scope of these parameters, one of ordinary skill in the art may select various vectors/expression control sequences/host combinations that can express the DNA sequences of the invention in either large scale animal culture or fermentation. In cloning the cDNA of an NSP protein by the expression cloning strategy, screening procedures such as a binding method, a panning method, and a film emulsion method can be used.
(20) In the definition of the present invention, the term substantially pure means that a polypeptide according to the present invention and the DNA sequences encoding the polypeptide substantially do not contain any other proteins derived from bacteria.
(21) As host cells for expressing recombinant proteins, prokaryotic cells, such as E. coli and Bacillus subtillis, which can be cultured at a high concentration within a short time, easily genetically modified and have well established genetic and physiological properties, have been widely used. However, to solve various problems, including the post-translational modification, secretion, three-dimensional active structure and activation of proteins, a wide range from microorganisms to higher organisms, including unicellular eukaryotic cells, yeasts (Pichia pastoris, Saccharomyces cerevisiae, Hansenula polymorpha, etc.), filamentous fungi, insect cells, plant cells, and mammalian cells, has recently been used as host cells for recombinant protein production. Thus, it will be obvious to one skilled in the art to use not only E. coli cells illustrated in Examples, but also other host cells.
(22) In still another aspect, the present invention is directed to a method for producing a beta-galactosidase, comprising the steps of: culturing the recombinant microorganism to produce a beta-galactosidase; and recovering the produced beta-galactosidase.
(23) In an example of the present invention, a recombinant beta-galactosidase was produced using transformed recombinant E. coli (DH5/pACE-BgaI.New). Herein, the pACE vector (GenoFocus, Korea) makes it possible to produce a recombinant protein by microbial culture without having to add a separate inducer for protein expression in a state in which cell growth and protein expression are separated from each other. The beta-galactosidase produced by the above-described method was analyzed by SDS-PAGE, and as a result, a band having a size of 120 kDa was observed (
(24) In another example of the present invention, using the obtained recombinant beta-galactosidase and 4-nitrophenyl--D-galactopyranoside (SIGMA) as a substrate, the optimum temperature of an enzymatic reaction was determined. As a result, it was found that the optimum temperature for activity of the novel beta-galactosidase of the present invention is 40 C.
(25) In yet another aspect, the present invention is directed to a method for producing a galactooligosaccharide, comprising: reacting the beta-galactosidase with a lactose-containing substrate to produce galactooligosaccharide; and recovering the produced galactooligosaccharide.
(26) In the present invention, the galactose oligosaccharide may be one ingredient selected from the group consisting of liquid milk, dried milk powder, baby milk, baby formula, ice cream, yoghurt, cheese, fermented dairy products, beverages, infant foods, cereals, bread, biscuits, confectionary, cakes, food supplements, dietary supplements, probiotic comestible foods, prebiotic comestible foods, animal feeds, poultry feeds, and drugs.
(27) In another example of the present invention, the ability of the novel beta-galactosidase of the present invention to synthesize galactooligosaccharide was analyzed using lactose as a substrate, and as a result, it was shown that the rate of conversion of lactose to galactooligosaccharide by the beta-galactosidase of the present invention was about 32%.
EXAMPLES
(28) Hereinafter, the present invention will be described in further detail with reference to examples. It will be obvious to a person having ordinary skill in the art that these examples are illustrative purposes only and are not to be construed to limit the scope of the present invention.
Example 1
Cloning of Novel Beta-Galactosidase Derived from Bacillus circulans
(29) Bacillus circulans ATCC 31382 was cultured in LB basal medium (1% tryptone, 0.5% yeast extract, 1% NaCl), and 500 g of genomic DNA was isolated from the cultured cells by a genomic DNA extraction kit (RBC). The isolated genomic DNA was treated with each of 23 restriction enzymes, AatII, AflII, ApaI, ApaLI, BamHI, BgalII, BsiWI, ClaI, EcoRI, EcoRV, HindIII, HpaI, KpnI, MluI, NcoI, NdeI, NheI, NotI, NsiI, PciI, PsiI, PstI, PvuI, PvuII, Sad, SaII, ScaI, SpeI, SphI, StuI, XbaI, XhoI, and XmaI, and a mixture of 1-8 kb DNA fragments among the DNA fragments obtained by digestion with the restriction enzymes was treated with Klenow fragment enzyme (TaKaRa) to make both ends of the DNA fragments blunt. Then, each of the blunt-end DNA fragments was ligated into a T-blunt vector (SolGent), thereby constructing a library containing each vector, named T-gDNA.flag.
(30) The library was transformed into E. coli DH5which was then cultured in X-gal-containing LB agar (1% tryptone, 0.5% yeast extract, 1% NaCl, 1.5% agar, 50 ug/ml X-gal). After 24 hours, among the transformed E. coli colonies grown in the LB agar, colonies showing a green color after degradation of the X-gal were determined to be strains containing a gene having beta-galactosidase activity and were recovered. Each of the recovered colonies was cultured in LB liquid medium, and plasmid vectors were recovered from these colonies by plasmid mini extraction kit (Bioneer) and sequenced (SolGent).
(31) As a result, the nucleotide sequences of several beta-galactosidase genes reported in the prior art were found, and a novel beta-galactosidase gene was found in the vector library produced by treatment with HpaI restriction enzyme.
(32) The nucleotide sequence of the fragment containing the novel beta-galactosidase gene is represented by SEQ ID NO: 3. The total size of the DNA fragment containing the beta-galactosidase gene was 6731 bp, and three open reading frames (ORFs) were found in the fragment (
(33) Among these ORFs, the third ORF was found to have a 3105bp DNA size (SEQ ID NO: 2) and to be composed of 1035 amino acid residues (SEQ ID NO: 1) and also to have beta-galactosidase activity.
Example 2
Construction of Recombinant Vector and Recombinant Microorganism, Which Contain Beta-Galactosidase II Gene
(34) Using the nucleotide sequence of the novel beta-galactosidase from Bacillus circulans, obtained in Example 1, a recombinant vector and a recombinant microorganism were constructed.
(35) Based on the nucleotide sequence of the beta-galactosidase (SEQ ID NO: 2), the following primers of SEQ ID NOs: 4 and 5 were constructed.
(36) TABLE-US-00001 SEQIDNO.4:aaaaatgtcacaattaacgtatga; SEQIDNO.5:aaaactgcagttagtgtaaggtaaatgaat.
(37) Using the genomic DNA of Bacillus circulans as a template, PCR was performed using the primers of SEQ ID NOs: 4 and 5. The PCR product was purified, and then inserted into the NdeI and PstI restriction enzyme sites of a pACE vector (GenoFocus, Korea) by the NdeI and PstI restriction enzyme sequences inserted in the primers, thereby constructing a vector, named pACE-BgaI.New vector. The constructed vector was transformed into an E. coli DH5a strain.
Example 3
Production of Novel Beta-Galactosidase Derived from Bacillus circulans by Use of Recombinant Microorganism
(38) Using the recombinant E. coli (DH5/pACE-BgaI.New) constructed in Example 2, a recombinant beta-galactosidase was produced. The pACE vector (GenoFocus, Korea) makes it possible to produce a recombinant protein by microbial culture without having to add a separate inducer for protein expression in a state in which cell growth and protein expression are separated from each other. Thus, 5 ml of the transformed recombinant strain, which was previously sufficiently seed-cultured, was inoculated into a 1-L Erlenmeyer flask containing 100 ml of sterile LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl) and was cultured at 30 C. and 200 rpm for 24 hours. After completion of the culture, the transformed recombinant strain was separated from the medium by centrifugation and diluted in sterile distilled water at a suitable concentration. The transformed recombinant strain was disrupted with an ultrasonic homogenizer (VibraCell), and then beta-galactosidase II was separated from the cell debris by centrifugation and analyzed by protein electrophoresis (SDS-PAGE).
(39) As a result, as shown in
Example 4
Determination of Optimum Temperature for Activity of Novel Beta-Galactosidase
(40) The optimum temperature for activity of the recombinant beta-galactosidase obtained in Example 3 was examined To determine the activity of the beta-galactosidase, 4-nitrophenyl--D-galactopyranoside (SIGMA) was dissolved in various buffers and used as a substrate. An enzymatic reaction using the beta-galactosidase and the substrate was performed at a temperature of 30 to 60 C., and then stopped using 10% (w/v) sodium carbonate (Na.sub.2CO.sub.3), followed by color development.
(41) To determine the activity of the enzyme, the concentration of O-nitrophenol released was measured by the absorbance at a wavelength of 420 nm. One unit of the beta-galactosidase was determined as the amount of enzyme that released 1 mol of O-nitrophenol per minute under the above-described conditions.
(42) As shown in
Example 5
Synthesis of Oligosaccharide Using Novel Beta-Galactosidase
(43) The galactooligosaccharide-synthesis ability of the beta-galactosidase obtained in Example 3 was analyzed. As a substrate for synthesis of galactooligosaccharide, lactose was used. Lactose was dissolved in 50 mM phosphate buffer (pH 6.0) at a concentration of 500 g/L under a high-temperature condition. 500 ml of the lactose solution (500 g/L concentration) was added to a 1 L reactor, and the reaction temperature was set at 50 C., and the stirring speed was maintained at 100 rpm. The beta-galactosidase was added to the lactose solution until it reached a final concentration of 10 units (U/g lactose). Synthesis of galactooligosaccharide was performed for 48 hours.
(44) The analysis of galactooligosaccharide was performed by HPLC (Agilent) equipped with a RI detector by use of a Polyamine II (YMC) column. As a mobile phase, acetonitrile and purified water were used as a ratio of 65%/35% (v/v). The flow rate of the mobile phase was set at 1.0 ml/min. The results of analysis of galactooligosaccharide after completion of the reaction are shown in Table 1 below.
(45) The rate of conversion to galactooligosaccharide was calculated as follows. The amount described below indicates the peak area measured by HPLC. In the product from the lactose substrate, a di- or higher-order saccharide, except for monosaccharides (glucose and galactose) and disaccharide lactose, is defined as galactooligosaccharide.
Conversion (%) to galactooligosaccharide=[total amount of saccharides][amount of glucose][amount of galactose][amount of lactose]
(46) TABLE-US-00002 TABLE 1 Saccharide composition Tetra-saccharide Tri-saccharide Di-saccharide Total galacto- galacto- galacto- Glucose + galacto- oligosaccharide oligosaccharide oligosaccharide Lactose galactose oligosaccharide Content (%) 3.45 19.72 8.87 56.30 11.65 32.04
(47) In Table 1 above, the content (%) is the percentage of each saccharide relative to the sum of total saccharides (glucose, galactose, lactose and oligosaccharide). Thus, it can be seen that the rate of conversion to galactooligosaccharide by the beta-galactosidase of the present invention was about 32%.
INDUSTRIAL APPLICABILITY
(48) The use of the novel beta-galactosidase according to the present invention makes it possible to efficiently produce a large amount of galactooligosaccharide.
(49) Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.