COMBINATORIAL USE OF MARKERS TO ISOLATE SYNAPTIC GLIA TO GENERATE SYNAPSES IN A DISH FOR HIGH-THROUGHPUT AND HIGH-CONTENT DRUG DISCOVERY AND TESTING

20240353396 ยท 2024-10-24

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention provides molecular tools to visualize, isolate, and manipulate the glial cells that are necessary for the formation, stability, and function of the synapse. The inventors identified a unique gene expression signature that distinguishes perisynaptic Schwann cells from all other Schwann cells. Using a combinatorial approach and coxpressing two different fluorescence proteins, each using a different promoter, only those glial cells associated with the neuromuscular synapse are labeled.

    Claims

    1. A method for identifying one or more therapeutic agents that can induce and/or cause Schwann cells to stop proliferating and to differentiate into perisynaptic Schwann cells; the method comprising the steps of: (1) obtaining isolated Schwann cells, wherein the Schwann cells coexpress two different fluorescence proteins, wherein the message for each of the two different fluorescence proteins is expressed using a different promoter; and wherein the promoters are an NG2 promoter and an S100 promoter; and (2) testing the one or more therapeutic agents for an ability to cause Schwann cells to stop proliferating and differentiate into perisynaptic Schwann cells.

    2. The method of claim 1, wherein at least one of an identified one or more therapeutic agents that can induce and/or cause Schwann cells to stop proliferating and to differentiate into perisynaptic Schwann cells is useful to treat Schwannomas, glioblastoma, other glial cancers, injuries to muscles and peripheral motor axons, Amyotrophic Lateral Sclerosis, Myasthenia Gravis, muscle aging, muscular dystrophies, cachexia-induced muscle wasting, and muscle repair following exercise.

    3. The method of claim 1, further comprising the step of: (0) producing isolated Schwann cells, wherein the isolated Schwann cells are produced by a transgenic cell line crossing of two or more transgenic lines in which either the NG2 promoter, which drives expression of dsRed; or the S100 promoter, which drives the expression of GFP, is in an actively promoting state; whereby in the resulting S100B-GFP; NG2-dsRed double transgenic cell line, dsRed is capable to label all NG2-positive cells (NG2-dsRed+), and green fluorescent protein (S100B GFP+) is capable to label all Schwann cells in one or more skeletal muscles.

    4. The method of claim 1, wherein there is a select subset of one or more glia specifically at a neuromuscular junction that is operative to indicate a positive for both S100B GFP+ and NG2-dsRed; and wherein said subset is identified by one or more executions of the method.

    5. The method of claim 3, wherein one or more method steps of the method are executed in an assay.

    6. The method of claim 1 whereby based on a location and a morphology of a cell body and elaborations: the perisynaptic Schwann cells are the only cells expressing both S1003 GFP+ and NG2-dsRed in one or more skeletal muscles.

    7. The method of claim 6, whereby a coexpression of S100-GFP+ and NG2-ds Redt in perisynaptic Schwann cells has no observable and/or measurable deleterious effect on either a perisynaptic Schwan cell or upon a neuromuscular junction; and wherein a deleterious effect is defined as a cell death.

    8. The method of claim 1, wherein the method enables the ability to distinguish perisynaptic Schwann cells from all other Schwann cells, and the method enables a capability to identify genes that are either preferentially-expressed or specifically-expressed in the identified perisynaptic Schwann cells.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0022] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

    [0023] These and other features, aspects, and advantages of the present invention will become better understood with reference to the following description, appended claims, and accompanying drawings where:

    [0024] FIG. 1 is a set of photographic images and bar graphs showing that the coxpression of S100 and neuro-glia antigen-2 (NG2) is unique to perisynaptic Schwann cells in muscles. To selectively label perisynaptic Schwann cells, the inventors crossed S100-GFP and NG2-dsRed transgenic mice to create S100-GFP; NG2-dsRed mice. As shown in row (A), the S100-GFP mouse line, all Schwann cells express green fluorescent protein (GFP). See column (B, B). In the NG2-dsRed mouse line, all NG2+ cells express dsRed. See column (C, C). In S100-GFP; NG2-dsRed mice, perisynaptic Schwann cells identified based on their unique morphology and location at neuromuscular junctions (NMJs), visualized using fBTX to detect nAChRs (blue), are the only cells expressing both GFP and dsRed. See column (D, D). At non-synaptic sites, GFP-positive cells do not express dsRed (hollow arrow; B, C, D) and dsRed-positive cells do not express GFP (B, C, D). The coxpression of GFP and dsRed has no discernible negative effects on neuromuscular junction fragmentation or perisynaptic Schwann cell number in the extensor digitorum longus (EDL) muscle of young adult mice. See bar graphs (E-F). The average number of perisynaptic Schwann cells per neuromuscular junction is unchanged between S100-GFP mice and S100-GFP; NG2-dsRed mice. See the bar graph (E). The average number of nAChR clusters per neuromuscular junction is unchanged between wild-type, S100-GFP, and S100-GFP; NG2-dsRed animals. See the bar graph (F). Error bar=standard error. Scale bar=50 m (D), 25 m (D), and ten m (D).

    [0025] FIG. 2 is a set of photographic images and bar graphs showing an analysis of perisynaptic Schwann cells at different developmental stages. Neuromuscular junctions are associated exclusively with S100-GFP.sup.+ cells between E15 and E18. (A-C) Perisynaptic Schwann cells expressing both S100-GFP.sup.+ and NG2-dsRed.sup.+ appear at the neuromuscular junction around P0 and become the only cell-type present at neuromuscular junctions by P21. (D) The average number of perisynaptic Schwann cells per neuromuscular junction increases during development. (E) When standardizing for the change in neuromuscular junction size during development, there is no difference in the density of perisynaptic Schwann cells at neuromuscular junctions, represented as the number of perisynaptic Schwann cells per 500 m.sup.2 of neuromuscular junction area. Error bar=standard error. Scale bar=ten m. **=P<0.01; ***=P<0.001.

    [0026] FIG. 3 is a set of photographic images and bar graphs showing Molecular analysis of S100-GFP+; NG2-dsRed+ PSCs, S100-GFP+ Schwan cells, and NG2-dsRed+ cells following isolation with FACS. FIG. 3(A) Skeletal muscle from juvenile S100-GFP; NG2-dsRed mice was dissociated and S100-GFP+; NG2-dsRed+ PSCs, S100-GFP+ Schwan cells, and NG2-dsRed+ cells were sorted by FACS for RNA seq and qPCR. Representative fluorescence intensity gates for sorting of S100-GFP+, NG2-dsRed+ and S100-GFP+; NG2-dsRed+ cells are indicated in the scatter plot. GFP (y-axis) and dsRed (x-axis) fluorescence intensities were used to select gates for S100-GFP+ cells (outlined in orange), NG2-dsRed+ cells (outlined in teal), and double labeled S100-GFP+; NG2-dsRed+ cells (outlined in purple). Representative images of cells from sorted populations are shown. FIG. 3(B) GFP and dsRed qPCR was performed on FACS isolated cells to confirm specificity of sorting gates. FIG. 3(C) A heat map of RNA-seq results depicting genes with at least 5 counts and expression differences with a p-value of less than 0.01 between any 2 cell types reveals a distinct transcriptome in S100-GFP+; NG2-dsRed+ PSCs versus S100-GFP+ Schwann cells and NG2-dsRed+ cells. FIG. 3(D) Synaptogenesis and axon guidance signaling are among the most influential signaling pathways in PSCs according to Ingenuity Pathway Analysis of genes enriched in PSCs versus S100-GFP+, and NG2-dsRed+ cells. FIG. 3(E) qPCR was performed on FACS isolated S100-GFP+; NG2-dsRed+ PSCs, S100-GFP+ Schwan cells, and NG2-dsRed+ cells to verify mRNA levels of RNA seq identified PSC enriched genes. In each analysis, transcripts were not detected or detected at low levels in S100-GFP+ Schwann cells and NG2-dsRed+ cells. Error bar=standard error of the mean. Scale bar=10 m.

    [0027] FIG. 4 is a set of bar graphs, based upon data taken from images of the extensor digitorum longus (EDL), soleus, and diaphragm muscles of adult animals, showing the number of perisynaptic Schwann cells at neuromuscular junctions varies. In each muscle, the number of perisynaptic Schwann cells per neuromuscular junction ranges from zero to five perisynaptic Schwann cells per neuromuscular junction. When standardizing for neuromuscular junction size, the density of perisynaptic Schwann cells at neuromuscular junctions is unchanged between muscles.

    [0028] FIG. 5 is a bar graph, based upon data taken from images of fluorescence intensity gates and cells following fluorescence-activated cell sorting (FACS) isolation of perisynaptic Schwann cells, S100-GFP.sup.+, and NG2-dsRed.sup.+ cells from dissociated skeletal muscle tissue taken from S100-GFP; NG2-dsRed mice. The bar graph confirms the cell-specific dsRed and GFP expression with qPCR in perisynaptic Schwann cells, S100-GFP.sup.+, and NG2-dsRed.sup.+ cells following FACS.

    DETAILED DESCRIPTION OF THE INVENTION

    Industrial Applicability

    [0029] This invention enables the specific isolation of synaptic glia needed to reform the neuromuscular synapse in a dish. Because of this invention, a person having ordinary skill in the biomedical art can make in vitro cell culture assays to discover and test molecules for treating a variety of conditions. Several companies attempted to create neuromuscular synapses in a dish to speed the discovery of treatments for Amyotrophic Lateral Sclerosis (ALS), spinal muscular atrophy, muscular dystrophy, injuries to peripheral nerves and muscles, muscle wasting with aging and cachexia (cancer-related wasting), muscle-grafting for reconstructive surgery, Schwannomas, Charcot-Marie-Tooth disease, Guillain-Barre syndrome, the spectrum of Myasthenia Gravis, and for other insults that affect peripheral nerves and skeletal muscles.

    [0030] The invention generally applies for discerning the functions of synaptic glia in the development, maintenance, and function of select synapses.

    Method of Visualizing.

    [0031] The invention provides a method of visualizing the glial cells necessary for the formation, stability, and function of the synapse. Using a combinatorial approach and coxpressing two different fluorescence proteins, each using a different promoter, a person having ordinary skill in the biomedical art can label only those glial cells associated with the neuromuscular synapse.

    [0032] The fluorescent proteins can be selected from the group of green fluorescent proteins (and its variants) and red fluorescent proteins (and its variants). See, Rodriguez et al. (2017).

    [0033] The promoters can be an NG2 promoter or an S100B promoter. For the NG2 promoter to drive gene expression, see, e.g., Zhu, Bergles, & Nishiyama (2008) and Ampofo et al. (2017). For using S100 promoter to drive gene expression, see, e.g., Zuo et al. (2004).

    Method of Isolating.

    [0034] The invention provides a method of isolating the glial cells necessary for the formation, stability, and function of the synapse. The inventors used a combinatorial gene expression approach to uncover markers specific for perisynaptic Schwann cells. The inventors found that perisynaptic Schwann cells can be identified by a combination of two different glial marker proteins, calcium-binding protein (S100) and neuro-glia antigen-2 (NG2). The method of isolating the glial cells. Other methods of cell sorting can be used instead for isolating the glial cells necessary for the formation, stability, and function of the synapse. There are three main methods used for cell sorting: single-cell sorting, fluorescent activated cell sorting, and magnetic-activated cell sorting.

    Method of Manipulating.

    [0035] The invention provides a method of manipulating the glial cells necessary for the formation, stability, and function of the synapse. Vectors active in the perisynaptic Schwann cells can introduce recombinant genes encoding secreted factors for gene therapy. A person having ordinary skill in the biomedical art can use any of several viral vector systems active in the perisynaptic Schwann cells, including those based on herpes simplex virus, adenovirus, adeno-associated virus, lentivirus, and Moloney leukemia virus can be used. See, Ruitenberg et al., From Bench to Bedside (Academic Press, 2006), pages 273-288. The vectors can be used instead to introduce recombinant vectors that encode a gene for a therapeutic ribonucleic acid polynucleotide (RNA). Treatments that target RNA or deliver it to cells fall into three broad categories, with hybrid approaches also emerging. Deweerdt (2019). To introduce RNAs to treat various conditions that affect the neuromuscular system, vectors that contain genes for detectable markers, e.g., fluorescent proteins, can be used for neuronal tracing in vivo or in vitro.

    Assay.

    [0036] The assay comprises perisynaptic Schwann cells isolated as described in this specification and cultured in a dish or other in vitro cell culture container. The assay can further comprise muscle cells, neurons, or both types of cells co-cultured in the dish or another in vitro cell culture container. Alternatively, the cultured cells are cells that coxpress NG2 and S100, as described in this specification.

    Method for the Discovery of Agents that Cause Schwann Cells to Stop Proliferating and Differentiate into Perisynaptic Schwann Cells

    [0037] The assay is useful for high-throughput and high-content drug discovery and testing. The assay can be used for a method for the discovery of agents that cause Schwann cells to stop proliferating and differentiate into perisynaptic Schwann cells. This ability has implications for discovering and testing molecules to treat Schwannomas and other glial cancers, such as glioblastoma.

    Definitions

    [0038] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are listed below. Unless stated otherwise or implicit from context, these terms and phrases have the meanings below. These definitions are to aid in describing particular embodiments and are not intended to limit the claimed invention. Unless otherwise defined, all technical and scientific terms have the same meaning as commonly understood by a person having ordinary skill in the art to which this invention belongs. For any apparent discrepancy between the meaning of a term in the art and a definition provided in this specification, the meaning provided in this specification shall prevail.

    [0039] Agent means a composition of matter not usually present or not present at the levels administered to a cell, tissue, or subject. An agent can be selected from the group consisting of polynucleotides, polypeptides, and small molecules. A library of agents is a starting part for high throughput screening.

    [0040] Comprises and Comprising shall be interpreted as referring to elements, components, or steps in a non-exclusive manner, indicating that the referenced elements, components, or steps can be present, used, or combined with other elements, components, or steps. The singular terms A, An, and The include plural referents unless context indicates otherwise. Similarly, the word Or should cover And unless the context indicates otherwise. The abbreviation E.g. is used to indicate a non-limiting example and is synonymous with the term: for example.

    [0041] dsRed is a variant of red fluorescent protein (RFP), a fluorophore originally isolated from Discosoma (hence the name DsRed). Other variants are now available that fluoresce orange, red, and far-red. Different variants of red fluorescent protein can be used in this invention, including mFruits (mCherry, mOrange, mRaspberry), mKO, TagRFP, mKate, mRuby, FusionRed, mScarlet, and DsRed-Express.

    [0042] Flow Cytometry is a biomedical laboratory technique used to detect and measure the physical and chemical characteristics of a population of cells or particles. There are three major methods used for cell sorting: single-cell sorting, fluorescent activated cell sorting, and magnetic-activated cell sorting. The flow cytometry technology has applications in many fields, including molecular biology, pathology, immunology, virology, plant biology, and marine biology. Flow cytometry is routinely used in basic research, clinical practice, and clinical trials.

    [0043] Fluorescence-Activated Cell Sorting (FACS) is a form of flow cytometry that sorts cells according to fluorescent markers in the cell. FACS is useful as a biomedical laboratory technique for establishing cell lines carrying a transgene, enriching for cells in a specific cell cycle phase, or studying the transcriptome, or genome, or proteome, of a whole population on a single-cell level. Fluorescence-activated cell sorting (FACS) can be performed with a Sony SH800 Cell Sorter (Sony Biotechnology, San Jose, CA, USA). Sorting gates can be set at the lowest fluorescence threshold at which the sorted cell population was 100% pure and confirmed with dsRed and GFP qPCR. See FIG. 5.

    [0044] GFP (Green Fluorescent Protein) is a protein from the jellyfish Aequorea victoria that naturally exhibits bright green fluorescence when exposed to light in the blue to ultraviolet range. GFP is an excellent tool in the biomedical art because of its ability to form an internal chromophore requiring no accessory cofactors, gene products, enzymes, or substrates other than molecular oxygen. GFP gene expression is a reporter of expression, which demonstrates a proof of concept that a gene can be expressed throughout an organism, in selected organs, or cells of interest. GFP can be introduced into animals or other species through transgenic techniques and maintained in their genome and that of their offspring. The term GFP also includes similar fluorescent proteins from other cnidarians, such as the sea pansy (Renilla reniformis). Many variants of GFP known in the biomedical art fluoresce in many other colors, including blue fluorescent protein (EBFP, EBFP2, Azurite, mKalama1), cyan fluorescent protein (ECFP, Cerulean, CyPet, mTurquoise2), and yellow fluorescent protein derivatives (YFP, Citrine, Venus, YPet). BFP derivatives (except mKalama1) contain the Y66H substitution. Variants such as yellow fluorescent protein (YFP) and cyan fluorescent protein (CFP) were discovered in cnidarian species.

    [0045] High-Throughput Screening (HTS) is a method for scientific experimentation especially used in drug discovery and relevant to the fields of biology and chemistry. Using robotics, data processing/control software, liquid handling devices, and sensitive detectors, high-throughput screening allows a researcher to quickly conduct millions of chemical, genetic, or pharmacological tests. Through this process, a person having ordinary skill in the biomedical art can rapidly identify active compounds, antibodies, or genes that modulate a particular biomolecular pathway. The results provide starting points for drug design and for understanding the noninteraction or function of a particular location.

    [0046] NG2 is neuron-glial antigen 2 (NG2), also known as chondroitin sulfate proteoglycan 4 or melanoma-associated chondroitin sulfate proteoglycan (MCSP) has the biomedical art-recognized meaning of a chondroitin sulfate proteoglycan that, in humans, is encoded by the CSPG4 gene. NG2 is a marker protein of oligodendrocyte progenitor cells (OPCs). Nishiyama et al., The Journal of Cell Biology, 114 (2), 359-71 (July 1991). NG2 is present in subsets of Schwann cells besides astrocytes, oligodendrocytes, pericytes, and endothelial cells. Dimou & Gallo, GLIA, vol. 63 1429-1451 (2015).

    [0047] Perisynaptic Schwann cells (PSCs, also known as terminal Schwann cells or teloglia) are specialized, non-myelinating, synaptic glial cells of the peripheral nervous system (PNS) found at neuromuscular junctions (NMJ). Perisynaptic Schwann cells function in synaptic transmission, synaptogenesis, and nerve regeneration. See Armati, The Biology of Schwann Cells (Cambridge University Press, 2007). They participate in synapse development, function, maintenance, and repair. Perisynaptic Schwann cells of the neuromuscular junction can be readily identified by their unique morphology and presence at the synapse. Ko & Robitaille, Cold Spring Harb. Perspect. Biol., 7 (2015). The study of perisynaptic Schwann cells has relied on an anatomy-based approach, because the identities of cell-specific perisynaptic Schwann cell molecular markers remain elusive. This limited approach has precluded the ability to isolate and genetically manipulate perisynaptic Schwann cells in a cell specific manner.

    [0048] S100 (S100 calcium-binding protein ) has the biomedical art-recognized meaning of a member of the S-100 protein family. S100 is glial-specific and is expressed primarily by astrocytes, but not all astrocytes express S100. S100 is present in all Schwann cells. For using S100 promoter to drive gene expression, see, e.g., Zuo et al., The Journal of Neuroscience, 24 (49), 10999-11009 (Dec. 8, 2004).

    [0049] The Glial Cells Necessary for the Formation, Stability, and Function of the Neuromuscular Junction, are known in the biomedical art as perisynaptic Schwann cells (PSCs) at a peripheral synapse.

    [0050] Neuronal Tracing or Neuron Reconstruction is a biomedical technique used to determine the pathway of the neurites or neuronal processes, the axons and dendrites, of a neuron. From a sample preparation viewpoint, neuronal tracing can be some of the following: anterograde tracing for labeling from the cell body to synapse; retrograde tracing for labeling from the synapse to cell body; viral neuronal tracing for a technique which can label in either direction; manual tracing of neuronal imagery; and other genetic neuron labeling techniques.

    [0051] Neuromuscular Junction (NMJ) has the biomedical art-recognized meaning of a tripartite synapse comprised of an -motor neuron (the presynapse), extrafusal muscle fiber (the postsynapse), and specialized synaptic glia called perisynaptic Schwann cells (PSCs) or terminal Schwann cells. Due to its large size and accessibility, extensive research of the neuromuscular junction has been essential to the discovery of the fundamental mechanisms that govern synaptic function, including the concepts of neurotransmitter release, quantal transmission, and active zones, among others.

    Guidance from Materials and Methods

    [0052] A person having ordinary skill in the biomedical art can use these materials and methods as guidance to predictable results when making and using the invention:

    [0053] Mice. SOD1.sup.G93A98 (see Gurney et al. (1994)), S100-GFP (B6; D2-Tg (S100-EGFP) 1Wjt/J) (see Zuo et al. (2004)) and NG2-dsRed mice (Tg (Cspg4-DsRed.T1) 1 Akik/J) (see Zhu, Bergles, & Nishiyama (2008)) were obtained from Jackson Labs (Bar Harbor, ME, USA) and crossed to generate S100-GFP; NG2-dsRed mice. Offspring were genotyped using Zeiss LSM900 to check for fluorescent labels. SOD1.sup.G93A mice were crossed with S100-GFP; NG2-dsRed mice to generate S100-GFP; NG2-dsRed; SOD1.sup.G93A mice. Postnatal mice older than nine days of age were anesthetized and immediately perfused with 4% paraformaldehyde (PFA) overnight. Pups were anesthetized by isoflurane and euthanized by cervical dislocation before muscle dissociation. Adult mice were anesthetized using CO.sub.2 and then perfused transcardially with ten ml of 0.1 M phosphate-buffered saline (PBS), followed by twenty-five ml of ice-cold 4% PFA in 0.1 M phosphate-buffered saline (pH 7.4). All experiments were carried out under NIH guidelines and animal protocols approved by the Brown University and Virginia Tech Institutional Animal Care and Use Committee.

    [0054] Fibular nerve crush. Adult S100-GFP; NG2-dsRed mice were anesthetized with a mixture of ketamine (100 mg/kg) and xylazine (10 mg/kg) delivered intraperitoneally. The fibular nerve was crushed at its intersection with the lateral tendon of the gastrocnemius muscle using fine forceps, as described by Dalkin et al. (2016). Mice were monitored for two hours after surgery and administered buprenorphine (0.05-0.010 mg/kg) at twelve-hour intervals during recovery.

    [0055] Immunohistochemistry and neuromuscular junction visualization. For neuro-glia antigen-2 (NG2) immunohistochemistry (IHC), muscles were incubated in blocking buffer (5% lamb serum, 3% BSA, 0.5% Triton X-100 in phosphate-buffered saline) at room temperature for two hours, incubated with anti-NG2 antibody (commercially available Millipore Sigma, St. Louis, MO, USA) diluted at 1:250 in blocking buffer overnight at 4 C., washed three times with 0.1M phosphate-buffered saline for five minutes. Muscles were then incubated with 1:1000 Alexa Fluor-488 conjugated anti-guinea pig antibody (A-11008, Invitrogen, Carlsbad, CA, USA) and 1:1000 Alexa Fluor-555 conjugated -bungarotoxin (fBTX; Invitrogen, Carlsbad, CA, USA, B35451) in blocking buffer for two hours at room temperature and washed there times with 0.1M phosphate-buffered saline for five minutes. For all other neuromuscular junction visualization, muscles were incubated in Alexa Fluor-647 conjugated -bungarotoxin (fBTX; Invitrogen, Carlsbad, CA, USA, B35450) at 1:1000 and 4,6-Diamidino-2-Phenylindole, Dihydrochloride (DAPI; D1306, ThermoFisher, Waltham, MA, USA) at 1:1000 in 0.1M phosphate-buffered saline at 4 C. overnight. Muscles were then washed with 0.1M phosphate-buffered saline three times for five minutes each. Muscles were whole mounted using Vectashield (H-1000, Vector Labs, Burlingame, CA, USA) and 2450-1.5 cover glass (ThermoFisher, Waltham, MA, USA).

    [0056] Confocal microscopy of perisynaptic Schwann cells and neuromuscular junctions. A person having ordinary skill in the biomedical art can take images with a Zeiss LSM700, Zeiss LSM 710, or Zeiss LSM 900 confocal light microscope (Carl Zeiss, Jena, Germany) with a 20 air objective (0.8 numerical aperture), 40 oil immersion objective (1.3 numerical aperture), or 63 oil immersion objective (1.4 numerical aperture) using the Zeiss Zen Black software. Optical slices within the z-stack were taken at 1.00 m or 2.00 m intervals. High-resolution images were acquired using the Zeiss LSM 900 with Airyscan under the 63 oil immersion objective in super-resolution mode. Optical slices within the z-stack were 0.13 m with a frame size of 22102210 pixels. Images were collapsed into a two-dimensional maximum intensity projection for analysis.

    [0057] Image analysis. Neuromuscular junction size: To quantify the area of neuromuscular junctions, the area of the region occupied by nAChRs, labeled by fBTX, can be measured using ImageJ software. At least 100 nAChRs were analyzed for several fragments, individual nicotinic acetylcholine receptor (nAChR) clusters, from each muscle to represent a single mouse. At least three animals per age group were analyzed to generate the described data.

    [0058] Cells associated with neuromuscular junctions: Cell bodies were visualized via GFP or dsRed signal or both. The cell bodies were confirmed as being cell bodies by a DAPI.sup.+ nucleus. The area of each cell body was measured by tracing the outline of the entire cell body using the freehand tool in ImageJ. To quantify the number of cells associated with neuromuscular junctions, the number of cell bodies directly adjacent to each neuromuscular junction was counted. Every cell that overlapped with or directly abutted the fBTX signal was considered adjacent to the neuromuscular junction. At least three animals per age group were analyzed to generate the represented data. Cells were examined in at least 100 neuromuscular junctions from each muscle to represent an individual mouse.

    [0059] The spacing of perisynaptic Schwann cells at neuromuscular junctions: A person having ordinary skill in the biomedical art can identify neuromuscular junctions via fBTX signal. Perisynaptic Schwann cells were identified by the colocalization of GFP, dsRed, and DAPI signal besides their location at neuromuscular junctions. The area of each perisynaptic Schwann cell and the neuromuscular junction was measured. The linear distance from the center of each perisynaptic Schwann cell soma to the center of the nearest perisynaptic Schwann cell soma at a single neuromuscular junction was measured. The distances were then separated into five m bins and plotted in a histogram. All linear measurements were made using the line tool in the ImageJ software. At least 100 neuromuscular junctions were analyzed from each muscle to represent an individual mouse.

    [0060] Muscle dissociation and fluorescence-activated cell sorting. Diaphragm, pectoralis, forelimb and hindlimb muscles were collected from p15-p21 S100-GFP; NG2-dsRed mice. After removal of connective tissue and fat, muscles were cut into five mm.sup.2 pieces with forceps and digested in two mg/mL collagenase II (Worthington Chemicals, Lakewood, NJ, USA) for one hour at 37 C. Muscles were further dissociated by mechanical trituration in Dulbecco's modified eagle medium (Life Technologies, Carlsbad, CA, USA) containing 10% horse serum (Life Technologies, Carlsbad, CA, USA) and passed through a 40 m filter to generate a single-cell suspension. Excess debris was removed from the suspension by centrifugation in 4% BSA followed by second centrifugation in 40% Optiprep solution (Sigma-Aldrich, St. Louis, MO, USA) from which the interphase was collected. Cells were diluted in FACS buffer containing 1 mM EDTA, 25 mM Hepes, 1% heat-inactivated fetal bovine serum (Life Technologies, Carlsbad, CA, USA), in Ca.sup.2+/Mg.sup.2+ free 1 Dulbecco's phosphate-buffered saline (Life Technologies, Carlsbad, CA, USA).

    [0061] FACS can be performed with a Sony SH800 Cell Sorter (Sony Biotechnology, San Jose, CA, USA). Representative fluorescence intensity gates for sorting of S100-GFP.sup.+, NG2-dsRed.sup.+ and S100-GFP.sup.+; NG2-dsRed.sup.+ cells are provided in FIG. 3. Purity of the sorted cell population was confirmed by visual inspection of sorted cells using an epifluorescence microscope and with dsRed and GFP qPCR. A single mouse can be used for each replicate and an average of 7500 cells per replicate were collected for each cell group.

    [0062] RNA-seq and qPCR. RNA was isolated from S100-GFP.sup.+, NG2-dsRed.sup.+, or S100-GFP.sup.+/NG2-dsRed.sup.+ cells following fluorescence-activated cell sorting (FACS) with the PicoPure RNA Isolation Kit (ThermoFisher, Waltham, MA, USA). The maximum number of cells that could be collected by FACS following dissociation of muscles collected from one mouse was a single replicate. On average, a single replicate consisted of 7,500 cells. Genewiz performed RNA seq on twelve replicates per cell type. Following sequencing, data were trimmed for both adaptor and quality using a combination of ea-utils and Btrim. Shapiro et al. (2007); Peng et al. (2010). Sequencing reads were aligned to the genome using Tophat2/HiSat223 Sequencing reads were counted via HTSeq. QC summary statistics were examined to identify any problematic samples (e.g., total read counts, quality and base composition profiles (+/ trimming), raw fastq formatted data files, aligned files (bam and text file containing sample alignment statistics), and count files (HTSeq text files). Following successful alignment, mRNA differential expression was determined using contrasts of and tested for significance using the Benjamini-Hochberg corrected Wald Test in the R-package DESeq225. Failed samples were identified by visual inspection of pairs plots and removed from further analysis resulting in the following number of replicates for each cell type: NG2-dsRed.sup.+, 10; S100-GFP.sup.+, 7; NG2-dsRed.sup.+/S100-GFP.sup.+, 9. Functional and pathway analysis was performed using Ingenuity Pathway Analysis (QIAGEN Inc.). Confirmation of expression of genes identified by RNA-seq was performed on six additional replicates of each cell type using quantitative reverse transcriptase PCR (qPCR). Reverse transcription was performed with iScript (Bio-Rad, Hercules, CA). The reverse transcription step was followed by a preamplification PCR step with SsoAdvanced PreAmp Supermix (Bio-Rad) pSrior to qPCR using iTAQ SYBR Green and a CFX Connect Real-Time PCR System (Bio-Rad). Relative expression was normalized to 18S using the 2-CT method.

    [0063] Statistics. A person having ordinary skill in the biomedical art can use unpaired t-test or one-way ANOVA with Bonferroni post hoc analysis for statistical evaluation. The data are expressed as the meanstandard error (SE), and p<0.05 was considered statistically significant. The number of replicates is RNA seq, 7-10 replicates; qPCR, six replicates; all other analyses, three replicates. Statistical analyses were performed using GraphPad Prism8 and R. The data values and p-values are reported within this specification.

    [0064] RNA-seq and qPCR methods: RNA was isolated from S100-GFP.sup.+, NG2-dsRed.sup.+, or S100-GFP.sup.+/NG2-dsRed.sup.+ cells following FACS with the PicoPure RNA Isolation Kit (ThermoFisher). The maximum number of cells that could be collected by FACS following dissociation of muscles collected from one mouse was a single replicate. On average, a single replicate consisted of 7,500 cells. RNA seq was performed by Genewiz on 12 replicates per cell type.

    [0065] After sequencing, data can be trimmed for both adaptor and quality using a combination of ea-utils and Btrim (see Aronesty (2013); Kong (2011)). Sequencing reads were aligned to the genome using HiSat2 (see Kim et al, (2019)) and counted via HTSeq (see Anders et al. (2015)). QC summary statistics can be examined to identify any problematic samples (e.g. total read counts, quality and base composition profiles (+/ trimming), raw fastq formatted data files, aligned files (bam and text file containing sample alignment statistics), and count files (HTSeq text files).

    [0066] After successful alignment, mRNA differential expression can be determined using contrasts of and tested for significance using the Benjamini-Hochberg corrected Wald Test in the R-package DESeq2 (see Love et al. (2014)). Failed samples were identified by visual inspection of pairs plots and removed from further analysis resulting in the following number of replicates for each cell type: NG2-dsRed.sup.+, 10; S100-GFP.sup.+, 7; NG2-dsRed.sup.+; S100-GFP.sup.+, 9. Functional and pathway analysis was performed using Ingenuity Pathway Analysis (QIAGEN Inc. Confirmation of expression of genes identified by RNA-seq was performed on 6 additional replicates of each cell type using quantitative reverse transcriptase PCR (qPCR). Reverse transcription was performed with iScript (Bio-Rad, Hercules, CA) and was followed by a preamplification PCR step with SsoAdvanced PreAmp Supermix (Bio-Rad) before qPCR using iTAQ

    [0067] SYBR Green and a CFX Connect Real Time PCR System (Bio-Rad). Relative expression was normalized to 18S using the 2.sup.CT method.

    TABLE-US-00001 TABLE1 liststheprimersusedforcDNA preamplificationandqPCR. TABLE1 Primers Forward Gene Primer(5-3) ReversePrimer(5-3) 18S GGACCAGAGCGAAAGCA GCCAGTCGGCATCGTTTATG TTTG (SEQIDNO:2) (SEQIDNO:1) Ajap1 ACAGCTTTTAGGACTCA GATGGGAAGTCGACCGCAA GCTCCA (SEQIDNO:4) (SEQIDNO:3) Bche CTGCAGTAATTCCGAAA GACCCTTCCGGTCTTGGTTG TCAACA (SEQIDNO:6) (SEQIDNO:5) Col20a1 AGTCAGCCATACGGACA CTCCAGGAAGTAGAGCCTCG CAT (SEQIDNO:8) (SEQIDNO:7) dsRed TCCCAGCCCATAGTCTT GTGACCGTGACCCAGGACTC CTTCT (SEQIDNO:10) (SEQIDNO:9) Foxd3 TCCATCCCCTCACTCAC CCCAGCGGACGGGTTGA CTAA (SEQIDNO:12) (SEQIDNO:11) Gfp AGAACGGCATCAAGGTG GGGGTGTTCTGCTGGTAGTG AACT (SEQIDNO:14) (SEQIDNO:13) Ncam1 AAGAAAAGACTCTGGAT CAAGGAGGACACACGAGCAT GGGC (SEQIDNO:16) (SEQIDNO:15) Nrxn1 GGGCGACCAAGGTAAAA GCTGCTTTGAATGGGGTTTTGA GTA (SEQIDNO:18) (SEQIDNO:17) Pdgfa GGTGGCCAAAGTGGAGT CTCACCTCACATCTGTCTCCTC ATGT (SEQIDNO:20) (SEQIDNO:19) Pdlim4 CTCACCATCTCGCGGGT AGATGATCGTGGCAGCCTTT TCA (SEQIDNO:22) (SEQIDNO:21)

    TABLE-US-00002 TABLE 2 Key reagents Reagent type (species) or resource Designation Source or reference Identifiers Genetic reagent S100-GFP PMID: 15590915 MGI: 3588512 (M. musculus) Genetic reagent NG2-dsRed PMID: 18045844 MGI: 3796063 (M. musculus) Genetic reagent SOD1.sup.G93A PMID: 8209258 MGI: 2183719 (M. musculus) Antibody Guinea pig polyclonal PMID: 19058188 Antibody Registry: anti-NG2 AB_2572299 Antibody Alexa Fluor-488 goat Invitrogen RRID: AB_2534117 polyclonal anti guinea pig Antibody Alexa Fluor-488 goat Invitrogen Catalog# A-11008 polyclonal anti rabbit Software, Ingenuity Pathway Qiagen RRID: SCR_008117 algorithm Analysis Software, GraphPad Prism GraphPad RRID: SCR_002798 algorithm Software, R The R Project for RRID: SCR_001905 algorithm Statistical Computing Software, ImageJ ImageJ RRID: SCR_003070 algorithm Software, Bio-Rad CFX Manager Bio-Rad RRID: SCR_017251 algorithm Commercial PicoPure RNA Isolation ThermoFisher Catalog#KIT0204 assay or kit Kit Commercial iScript cDNA synthesis Bio-Rad Catalog#1708891 assay or kit kit Commercial SsoAdvanced PreAmp Bio-Rad Cataolog#1725160 assay or kit Supermix Commercial iTAQ Univeral SYBR Bio-Rad Catalog#1725121 assay or kit Green Supermix Chemical Alexa Fluor-555 alpha- Invitrogen Catalog#B35451 compound, drug bungarotoxin Chemical DAPI ThermoFisher Catalog#D1306 compound, drug

    [0068] The following EXAMPLES are provided to illustrate the invention and should not be considered to limit its scope.

    Example 1

    Identification of a Molecular Fingerprint for Synaptic Glia

    [0069] The inventors explored the possibility that synaptic glia can be distinguished by unique combinations of glial cell markers, determined by a cell-specific pattern of gene expression. Synaptic glia of both the central (CNS) and peripheral (PNS) nervous systems are generally thought in the biomedical art to provide structural, functional, and trophic support to the synapse. The inability to selectively visualize and target perisynaptic Schwann cells remains an obstacle to understanding the cellular and molecular rules that govern their differentiation and function at neuromuscular junctions during development, following injury, in old age, and diseases, such as ALS.

    [0070] To facilitate visualization of perisynaptic Schwann cells, the inventors created a transgenic mouse line (called S100-GFP; NG2-dsRed; see FIG. 1(A)) by crossing transgenic lines in which either the NG2 promoter, which drives expression of dsRed; see Zhu, Bergles, & Nishiyama (2008) or the S100 promoter, which drives the expression of GFP; see Zuo et al. (2004). In the resulting S100-GFP; NG2-dsRed double transgenic mouse line, dsRed labeled all NG2-positive cells (NG2-dsRed.sup.+), and green fluorescent protein labeled all Schwann cells (referred herein as S100-GFP.sup.+) in skeletal muscles. See FIG. 1(B-C).

    [0071] The inventors found a select subset of glia specifically at the neuromuscular junction-positive for both S100-GFP.sup.+ and NG2-dsRed.sup.+ (yellow cells in FIG. 1(D)). Based on the location and morphology of the cell body and its elaborations, the inventors determined that perisynaptic Schwann cells are the only cells expressing both S100-GFP.sup.+ and NG2-dsRed.sup.+ in skeletal muscles. The coxpression of S100-GFP.sup.+ and NG2-dsRed.sup.+ in perisynaptic Schwann cells had no apparent deleterious effect on either perisynaptic Schwann cells or the neuromuscular junction. See FIG. 1(E)-(F).

    [0072] Thus, the inventors discovered a unique combination of markers with which to readily identify and study the synaptic glia of the neuromuscular junction in a manner previously impossible.

    [0073] To determine the time when perisynaptic Schwann cells acquire specific characteristics during development, the inventors determined the earliest time point at which both S100-GFP and NG2-dsRed were coxpressed in perisynaptic Schwann cells. The inventors examined neuromuscular junctions in the extensor digitorum longus muscle of S100-GFP; NG2-dsRed mice at several embryonic (E) and postnatal (P) stages. See Zhu, Bergles, & Nishiyama (2008). This analysis revealed that neuromuscular junctions associate exclusively with S100-GFP.sup.+ cells at least until E18. See FIG. 2(A-C). Perisynaptic Schwann cells expressing both S100-GFP.sup.+ and NG2-dsRed.sup.+ appear at the neuromuscular junction around P0 and become the only cell-type present at neuromuscular junctions by P21. See FIG. 2(A, C). The inventors saw no cells expressing only NG2-dsRed.sup.+ at embryonic and postnatal neuromuscular junctions. Thus, perisynaptic Schwann cells are defined by at least one perisynaptic Schwann cell-specific characteristic, neuro-glia antigen-2 (NG2).

    [0074] To confirm that dsRed expression from the NG2 promoter denotes the temporal and spatial transcriptional control of the NG2 gene, the inventors found NG2 protein present at postnatal but not embryonic neuromuscular junctions. See FIG. 3. The observed induced expression of neuro-glia antigen-2 (NG2) in neuromuscular junction Schwann cells supports an earlier hypothesis that perisynaptic Schwann cells originate from Schwann cells. See Lee et al. (2017). The delayed expression of NG2 further indicates that fully-differentiated perisynaptic Schwann cells only become associated with neuromuscular junctions after their initial formation. See FIG. 2 and FIG. 3.

    [0075] Previous studies relied solely on a combination of anatomical location and Schwann cell markers to make inferences about the number and spatial arrangement of perisynaptic Schwann cells at neuromuscular junctions. See Love & Thompson (1998); and Brill et al. (2013). These studies could miss important relationships between perisynaptic Schwann cells and the neuromuscular junction, particularly early in development, when perisynaptic Schwann cell appearance could not be easily discerned. Monk et al. (2015).

    [0076] The inventors generated color and grayscale photographic images of perisynaptic Schwann cells at (A) E15, (B) E18, (C) P0, (D) P6, (E) P9, (F) P21, and (G) adult. The inventors also generated photographic images of cells at neuromuscular junctions express neuro-glia antigen-2 (NG2) in adults. The immunohistochemical labeling of neuro-glia antigen-2 (NG2) revealed that GFP.sup.+ cells at neuromuscular junctions do not express neuro-glia antigen-2 (NG2) in E18 mice. GFP.sup.+ cells at neuromuscular junctions do express neuro-glia antigen-2 (NG2) in adult mice.

    [0077] The inventors reexamined the number of perisynaptic Schwann cells at developing and adult neuromuscular junctions in the extensor digitorum longus muscle of S100-GFP; NG2-dsRed mice. The inventors found that the number of perisynaptic Schwann cells rapidly increased from P0 to P9. See FIG. 2(A, D). This time span is when the neuromuscular junction undergoes rapid cellular, molecular, and functional changes. Sanes & Lichtman (1999). Highlighting the importance of specifically visualizing perisynaptic Schwann cells, the inventors found neuromuscular junctions populated by a combination of perisynaptic Schwann cells and S100-GFP.sup.+ cells between P0 and P9. See FIG. 2(C). The number of perisynaptic Schwann cells reached an average of 2.3 per neuromuscular junction by P21 that remained unchanged in healthy young adult mice. See FIG. 2(A, D).

    [0078] A closer examination by the inventors revealed that the number of perisynaptic Schwann cells varies across neuromuscular junctions of different sizes and in different muscle types. Their density remains unchanged. See FIG. 2 and FIG. 4. These data demonstrate that the number of perisynaptic Schwann cells directly correlates with the size and not functional characteristics of individual neuromuscular junctions.

    [0079] This method for distinguishing perisynaptic Schwann cells from all other Schwann cells enables the identification of genes either preferentially or specifically expressed in perisynaptic Schwann cells. The inventors used fluorescence-activated cell sorting (FACS) to separately isolate perisynaptic Schwann cells, single-labeled S100-GFP.sup.+ Schwann cells, and single-labeled NG2-dsRed.sup.+ cells from juvenile S100-GFP; NG2-dsRed transgenic mice. See FIG. 3(A) and FIG. 5(A). Light microscopy and expression analysis of GFP and dsRed using quantitative PCR (qPCR) showed that only cells of interest were sorted. See FIG. 5(B). The inventors used RNA-sequencing (RNA-seq) to compare the transcriptional profile of perisynaptic Schwann cells to the other two cell types. See FIG. 3(A). This analysis revealed a unique transcriptional profile for perisynaptic Schwann cells. See, FIG. 3(B).

    [0080] The inventors found 567 genes enriched in perisynaptic Schwann cells not previously recognized to be associated with perisynaptic Schwann cells, glial cells, or synapses using Ingenuity Pathway Analysis (IPA). See TABLE 3. Many of these genes encoded secreted and transmembrane proteins. See FIG. 3(C). Thus, perisynaptic Schwann cells might use these gene products to promote the pruning, stability, repair, and functions of the neuromuscular junctions, such as the axon growth inhibitor, NG2. Filous et al. (2014). The inventors also found genes preferentially expressed by perisynaptic Schwann cells with known functions at synapses. See TABLE 3. See also Mozer & Sandstrom (2012); Fox & Umemori (2006); Rafuse et al. (2000); Ranaivoson et al. (2019); Shapiro et al. (2007); and Peng, et al. (2010). Ingenuity Pathway Analysis (IPA) identified synaptogenesis, glutamate receptor, and axon guidance signaling as top canonical pathways under transcriptional regulation. See FIG. 3(D).

    [0081] TABLE 3 lists perisynaptic Schwann cell-enriched genes. The inventors identified these listed genes in RNA seq analyses with a minimum copy count of five in perisynaptic Schwann cells. The listed genes also display at least a four-fold increase in expression and a p-value of less than 0.05 in perisynaptic Schwann cells versus both S100-GFP.sup.+ cells and NG2-dsRed.sup.+ cells.

    TABLE-US-00003 TABLE 3 Genes identified in RNA seq analysis with a minimum copy count of 5 in PSCs that also display at least a four-fold increase in expression and a p-value of less than 0.05 in PSCs versus both S100-GFP+ cells and NG2-dsRed+ cells. ND = not detected in cell type under comparison. Known Function in Synapse (s), Log.sub.2 Fold Log.sub.2 Fold PSC (p), or Read Change vs Change vs Gene Description other Glia (g)? Count S100-GFP+ NG2-dsRed+ Adam11 a disintegrin and 505 4.43 4.22 metallopeptidase domain 11 Adam12 a disintegrin and 1209 3.63 4.49 metallopeptidase domain 12 (meltrin alpha) Adam23 a disintegrin and 2761 4.55 6.63 metallopeptidase domain 23 Adamts20 a disintegrin-like and 382 2.72 4.87 metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20 Asic4 acid-sensing (proton- 8 4.74 4.69 gated) ion channel family member 4 Acsbg1 acyl-CoA synthetase 2619 6.59 8.48 bubblegum family member 1 Acot1 acyl-CoA thioesterase 1 173 2.49 2.82 Adarb2 adenosine deaminase, 48 2.94 4.40 RNA-specific, B2 Ajap1 adherens junction 3172 7.97 5.77 associated protein 1 Adgrb1 adhesion G protein- s 86 3.99 6.12 coupled receptor B1 Adgrb3 adhesion G protein- s 69 2.37 4.90 coupled receptor B3 Adgrl3 adhesion G protein- s 1051 4.17 5.40 coupled receptor L3 Apba2 amyloid beta (A4) s 98 4.28 7.12 precursor protein-binding, family A, member 2 Anapc13 anaphase promoting 1519 2.50 2.45 complex subunit 13 Adgb androglobin 31 2.31 4.82 Angptl3 angiopoietin-like 3 66 2.57 3.30 Anks1b ankyrin repeat and sterile s 291 4.77 6.23 alpha motif domain containing 1B Aatk apoptosis-associated 1086 2.01 2.40 tyrosine kinase Armh4 armadillo-like helical 945 2.71 4.80 domain containing 4 Asrgl1 asparaginase like 1 555 3.13 3.19 Aspa aspartoacylase g 1252 4.47 5.27 Atp8a1 ATPase, aminophospholipid 1305 2.66 2.33 transporter (APLT), class I, type 8A, member 1 Abca8b ATP-binding cassette, 2557 3.49 2.95 sub-family A (ABC1), member 8b Bhlhe22 basic helix-loop-helix 37 3.04 2.54 family, member e22 Bmp6 bone morphogenetic g 1319 2.70 2.48 protein 6 Bex1 brain expressed X-linked 1 20 2.67 3.17 Bex4 brain expressed X-linked 4 52 5.13 4.64 Bche butyrylcholinesterase p, s 7191 7.21 7.89 C2cd4d C2 calcium-dependent 18 3.65 4.42 domain containing 4D Cdh10 cadherin 10 s 194 5.09 6.88 Cdh19 cadherin 19, type 2 1931 4.98 5.12 Cdh20 cadherin 20 49 4.08 5.38 Celsr1 cadherin, EGF LAG 126 3.20 4.11 seven-pass G-type receptor 1 Celsr2 cadherin, EGF LAG 223 2.70 3.94 seven-pass G-type receptor 2 Cacng5 calcium channel, voltage- 95 4.60 3.86 dependent, gamma subunit 5 Camk2b calcium/calmodulin- g, s 649 4.53 5.09 dependent protein kinase II, beta Car12 carbonic anhydrase 12 1762 6.10 7.37 Cpa2 carboxypeptidase A2, 15 2.59 3.30 pancreatic Cpm carboxypeptidase M 12914 7.20 3.91 Ctnnal1 catenin (cadherin 1795 3.05 4.77 associated protein), alpha-like 1 Cd59a CD59a antigen g 1172 3.31 2.32 Cd59b CD59b antigen 74 3.42 2.86 Arhgef9 CDC42 guanine s 369 3.40 2.55 nucleotide exchange factor (GEF) 9 BC064078 cDNA sequence BC064078 161 2.55 4.86 BC106179 cDNA sequence BC106179 54 3.03 3.35 Cadm1 cell adhesion molecule 1 g, s 3177 4.40 6.32 Cadm2 cell adhesion molecule 2 115 2.69 4.54 Cadm4 cell adhesion molecule 4 g 1388 4.08 6.20 Chl1 cell adhesion molecule 3637 5.61 7.60 L1-like Cenpw centromere protein W 109 2.53 2.91 Chadl chondroadherin-like 360 3.07 4.46 Cspg5 chondroitin sulfate s 240 3.83 3.98 proteoglycan 5 Cbx3-ps7 chromobox 3, 44 3.43 2.36 pseudogene 7 Cela1 chymotrypsin-like 42 4.00 4.67 elastase family, member 1 Cmtm5 CKLF-like MARVEL 1267 4.34 6.78 transmembrane domain containing 5 Cldn11 claudin 11 g 50 2.42 3.05 Clvs1 clavesin 1 132 4.71 6.12 Cdrt4os1 CMT1A duplicated region 27 4.49 5.11 transcript 4, opposite strand 1 Ccdc13 coiled-coil domain 89 2.66 4.87 containing 13 Ccdc30 coiled-coil domain g 97 2.41 4.17 containing 30 Col4a4 collagen, type IV, alpha 4 553 2.30 2.52 Col9a2 collagen, type IX, alpha 2 258 4.16 3.71 Col9a3 collagen, type IX, alpha 3 573 5.06 7.15 Col11a1 collagen, type XI, alpha 1 1883 2.93 3.27 Col20a1 collagen, type XX, alpha 1 11021 7.50 7.92 Col27a1 collagen, type XXVII, alpha 1 1765 4.01 3.90 C1ql1 complement component 214 7.13 7.40 1, q subcomponent-like 1 Cnksr2 connector enhancer of 174 3.87 2.52 kinase suppressor of Ras 2 Cntn6 contactin 6 74 3.49 6.82 Ctxn1 cortexin 1 134 2.35 2.06 Cryab crystallin, alpha B 3407 2.33 2.34 Cryl1 crystallin, lambda 1 1138 3.53 4.23 Crym crystallin, mu 304 4.43 5.12 Clec14a C-type lectin domain 1502 3.93 2.42 family 14, member a Csmd1 CUB and Sushi multiple 619 3.99 7.16 domains 1 Csmd3 CUB and Sushi multiple 201 4.09 7.58 domains 3 Ccnd1 cyclin D1 648 2.70 2.23 Cntd1 cyclin N-terminal domain 14 2.22 2.69 containing 1 Cyp2j6 cytochrome P450, family 1389 3.40 3.62 2, subfamily j, polypeptide 6 Cyp2j9 cytochrome P450, family 1347 4.51 5.12 2, subfamily j, polypeptide 9 Ckap2 cytoskeleton associated 480 2.27 2.78 protein 2 Ddx43 DEAD (Asp-Glu-Ala-Asp) 39 4.62 4.33 box polypeptide 43 Defb25 defensin beta 25 25 2.28 2.19 Dhrs2 dehydrogenase/reductase 345 6.63 8.10 member 2 Depdc7 DEP domain containing 7 412 3.37 5.81 Dagla diacylglycerol lipase, alpha 249 2.20 3.70 Dbi diazepam binding inhibitor g 13823 3.44 4.33 Dpyd dihydropyrimidine 371 3.33 4.56 dehydrogenase Dab1 disabled 1 g 68 3.90 4.67 Dlgap1 DLG associated protein 1 s 412 3.67 5.55 Dct dopachrome tautomerase 427 7.46 9.81 Dbh dopamine beta s 75 4.21 7.66 hydroxylase Dnm3 dynamin 3 s 724 3.44 2.18 Dynlrb2 dynein light chain 5 3.21 ND roadblock-type 2 Dnaic2 dynein, axonemal, 121 3.19 4.15 intermediate chain 2 Dtna dystrobrevin alpha g, s 247 2.13 2.14 Dag1 dystroglycan 1 g, s 20491 3.39 3.07 Egfem1 EGF-like and EMI domain 56 3.47 2.17 containing 1 Egfl8 EGF-like domain 8 749 2.44 4.55 Elovl2 elongation of very long 26 2.49 6.90 chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 Eno4 enolase 4 14 2.11 3.41 Erbb3 erb-b2 receptor tyrosine g, p 2471 4.46 7.05 kinase 3 Epb41l4b erythrocyte membrane 1606 5.12 6.60 protein band 4.1 like 4b Etv1 ets variant 1 2431 4.99 2.65 Etv5 ets variant 5 s 1068 3.52 2.68 Al197445 expressed sequence 16 2.01 3.23 Al197445 Fam102a family with sequence 538 2.32 2.02 similarity 102, member A Fam161b family with sequence 24 2.38 2.00 similarity 161, member B Fam181b family with sequence 292 4.21 2.02 similarity 181, member B Fam184a family with sequence 217 3.61 4.04 similarity 184, member A Fam184b family with sequence 316 4.81 6.41 similarity 184, member B Fabp7 fatty acid binding protein 721 4.60 6.86 7, brain Fbxw7 F-box and WD-40 domain 980 2.52 2.75 protein 7 Fbxo44 F-box protein 44 63 2.82 3.04 Fibp fibroblast growth factor 1254 2.73 2.53 (acidic) intracellular binding protein Fign fidgetin g 445 3.66 4.70 Fibin fin bud initiation factor 1639 4.73 4.61 homolog (zebrafish) Foxd3 forkhead box D3 1760 5.20 7.72 Fzd1 frizzled class receptor 1 1986 3.10 4.45 Fbp1 fructose bisphosphatase 1 25 3.73 5.43 Fxyd1 FXYD domain-containing 9201 3.71 3.16 ion transport regulator 1 Fxyd3 FXYD domain-containing 325 2.33 4.82 ion transport regulator 3 Fxyd7 FXYD domain-containing 67 4.67 4.14 ion transport regulator 7 Gpr156 G protein-coupled 18 2.43 3.98 receptor 156 Gpr17 G protein-coupled g 147 4.38 4.68 receptor 17 Gpr37l1 G protein-coupled g 2891 5.19 6.87 receptor 37-like 1 Gal3st1 galactose-3-O- g 480 3.23 6.07 sulfotransferase 1 Gabra1 gamma-aminobutyric acid s 89 4.51 6.47 (GABA) A receptor, subunit alpha 1 Ggt7 gamma- 71 2.87 2.05 glutamyltransferase 7 Gjc3 gap junction protein, g 3609 3.30 6.19 gamma 3 Glis3 GLIS family zinc finger 3 473 2.89 4.94 Gria3 glutamate receptor, s 221 2.15 2.79 ionotropic, AMPA3 (alpha 3) Gria4 glutamate receptor, s 118 2.01 4.58 ionotropic, AMPA4 (alpha 4) Grik2 glutamate receptor, s 448 4.98 7.64 ionotropic, kainate 2 (beta 2) Grik3 glutamate receptor, s 37 2.70 3.42 ionotropic, kainate 3 Grm5 glutamate receptor, p, s 38 2.84 6.64 metabotropic 5 Gpt2 glutamic pyruvate 1116 4.50 4.85 transaminase (alanine aminotransferase) 2 Gstm6 glutathione S-transferase, 41 2.34 3.09 mu 6 Gdpd2 glycerophosphodiester 10 2.28 2.45 phosphodiesterase domain containing 2 Gpm6b glycoprotein m6b g 6853 3.80 5.72 Gramd1c GRAM domain containing 1C 66 2.52 3.59 Gas2l3 growth arrest-specific 2 1132 2.02 4.94 like 3 H1fx H1 histone family, member X 97 2.37 2.06 Hspa12a heat shock protein 12A 2429 3.49 2.88 Hexim2 hexamethylene bis- 97 3.73 3.21 acetamide inducible 2 Hmgb2 high mobility group box 2 2401 2.61 2.81 Hist1h2ab histone cluster 1, H2ab 49 2.10 3.18 Hist1h2ae histone cluster 1, H2ae 210 2.72 4.11 Hist1h2an histone cluster 1, H2an 16 2.42 4.37 Hist1h2ao histone cluster 1, H2ao 511 2.62 3.50 Hist1h2ap histone cluster 1, H2ap 647 2.76 3.59 Hist1h3i histone cluster 1, H3i 67 2.22 3.09 Hist1h4d histone cluster 1, H4d 3364 3.09 2.70 Hoxb5os homeobox B5 and 24 5.05 2.48 homeobox B6, opposite strand Hunk hormonally upregulated 187 3.96 3.49 Neu-associated kinase Hsd17b11 hydroxysteroid (17-beta) 1230 2.45 2.19 dehydrogenase 11 Igsf11 immunoglobulin 667 4.55 7.09 superfamily, member 11 Igsf9b immunoglobulin s 1480 5.01 4.60 superfamily, member 9B Inka2 inka box actin regulator 2 698 3.70 2.46 Inava innate immunity activator 13 2.87 4.07 Insc INSC spindle orientation 210 2.85 2.46 adaptor protein Insl6 insulin-like 6 19 2.49 3.25 Itga2 integrin alpha 2 664 2.16 4.65 Itgb8 integrin beta 8 g 883 2.62 4.50 Il1rap interleukin 1 receptor 1317 3.03 3.37 accessory protein Il1rapl1 interleukin 1 receptor s 144 3.80 6.17 accessory protein-like 1 Josd2 Josephin domain 506 2.24 2.44 containing 2 Klk13 kallikrein related- 14 2.59 5.32 peptidase 13 Klk8 kallikrein related- g, s 283 4.89 4.01 peptidase 8 Klk9 kallikrein related- 17 4.13 3.99 peptidase 9 Klhl34 kelch-like 34 33 3.62 4.83 Krtap7-1 keratin associated protein 7-1 7 3.93 ND Kif21a kinesin family member 21A 860 2.88 3.81 Kank4 KN motif and ankyrin 4659 5.92 5.22 repeat domains 4 Kank4os KN motif and ankyrin 38 4.49 4.59 repeat domains 4, opposite strand L1cam L1 cell adhesion molecule g, s 2035 4.42 6.50 Lrat lecithin-retinol 26 2.80 4.14 acyltransferase (phosphatidylcholine- retinol-O-acyltransferase) Lrrc4b leucine rich repeat s 249 4.82 6.07 containing 4B Lrrc4c leucine rich repeat s 230 4.71 2.26 containing 4C Lrrc75b leucine rich repeat 169 3.87 4.63 containing 75B Lrrn3 leucine rich repeat protein s 133 3.72 5.00 3, neuronal Lrrtm1 leucine rich repeat s 97 2.68 5.20 transmembrane neuronal 1 Lrrtm4 leucine rich repeat s 20 2.48 4.27 transmembrane neuronal 4 Luzp2 leucine zipper protein 2 512 5.34 7.08 Lgi4 leucine-rich repeat LGI g 2270 4.46 5.37 family, member 4 Lhfpl2 lipoma HMGIC fusion 1434 2.20 2.35 partner-like 2 Lhfpl4 lipoma HMGIC fusion 44 2.34 2.61 partner-like protein 4 Lockd lncRNA downstream of 662 3.85 4.20 Cdkn1b Lsm7 LSM7 homolog, U6 small 495 2.48 2.28 nuclear RNA and mRNA degradation associated Lhcgr luteinizing hormone/ 39 4.71 3.98 choriogonadotropin receptor Lypd6 LY6/PLAUR domain 273 4.34 5.00 containing 6 Ly6g6d lymphocyte antigen 6 13 2.22 2.53 complex, locus G6D Ly6g6f lymphocyte antigen 6 85 6.05 8.60 complex, locus G6F Kdm4d lysine (K)-specific 15 2.66 3.02 demethylase 4D Lpcat2 lysophosphatidylcholine 382 2.47 5.78 acyltransferase 2 Mro maestro 20 2.67 4.64 Mkrn3 makorin, ring finger 18 3.00 2.59 protein, 3 Mamdc2 MAM domain containing 2 1050 3.02 2.18 Mdga2 MAM domain containing 128 3.70 4.11 glycosylphosphatidylinositol anchor 2 Matn2 matrilin 2 g 7801 4.20 2.70 Matn4 matrilin 4 1402 4.35 6.57 Mmp16 matrix metallopeptidase 16 448 2.85 3.61 Mmp17 matrix metallopeptidase 17 686 4.39 2.68 Mxd3 Max dimerization protein 3 99 2.12 2.61 Med9os mediator complex subunit 19 3.70 2.25 9, opposite strand Mns1 meiosis-specific nuclear 134 3.13 3.38 structural protein 1 Mpp7 membrane protein, 351 2.10 2.26 palmitoylated 7 (MAGUK p55 subfamily member 7) Metrn meteorin, glial cell g 158 4.14 4.05 differentiation regulator Mbd4 methyl-CpG binding 171 2.55 2.04 domain protein 4 Micall2 MICAL-like 2 359 3.78 2.69 Map2 microtubule-associated 656 4.42 2.25 protein 2 Map3k4 mitogen-activated protein 862 2.30 2.35 kinase kinase kinase 4 Mok MOK protein kinase 30 2.21 2.41 Morn4 MORN repeat containing 4 56 3.34 3.63 Megf10 multiple EGF-like- 792 4.79 4.59 domains 10 Megf9 multiple EGF-like- 3048 2.33 4.20 domains 9 Myh14 myosin, heavy 198 3.22 3.71 polypeptide 14 Myh6 myosin, heavy 33 2.58 3.93 polypeptide 6, cardiac muscle, alpha Nkain2 Na+/K+ transporting 262 3.91 6.86 ATPase interacting 2 Nkain4 Na+/K+ transporting 613 5.01 5.79 ATPase interacting 4 Nat8f1 N-acetyltransferase 8 156 2.64 2.50 (GCN5-related) family member 1 Nanos3 nanos C2HC-type zinc 52 4.34 3.21 finger 3 Ndst3 N-deacetylase/N- 167 4.70 2.98 sulfotransferase (heparan glucosaminyl) 3 Nell2 NEL-like 2 22 2.13 4.82 Ntng1 netrin G1 s 982 5.56 4.95 Ncam1 neural cell adhesion g, s 3976 5.00 5.55 molecule 1 Ncam2 neural cell adhesion 261 5.09 6.24 molecule 2 Nrxn1 neurexin I s 2269 6.59 7.68 Nrxn3 neurexin III s 176 3.53 5.23 Nxph1 neurexophilin 1 40 3.75 6.68 Nrn1 neuritin 1 s 305 5.09 6.51 Nlgn1 neuroligin 1 g, s 60 2.72 6.52 Nlgn3 neuroligin 3 g, s 390 5.30 5.51 Nsg2 neuron specific gene 232 5.96 7.01 family member 2 Negr1 neuronal growth regulator 1 921 3.74 5.90 Nptx1 neuronal pentraxin 1 s 36 2.03 3.18 Nnat neuronatin 103 2.15 3.98 Npb neuropeptide B 12 3.37 4.29 Neto2 neuropilin (NRP) and 189 3.09 2.85 tolloid (TLL)-like 2 Nkx2-2 NK2 homeobox 2 g 71 4.84 6.80 Nkx2-2os NK2 homeobox 2, g 30 3.31 7.19 opposite strand Nme5 NME/NM23 family 32 3.28 3.15 member 5 Nfatc2 nuclear factor of activated 1371 2.54 3.55 T cells, cytoplasmic, calcineurin dependent 2 Nudt10 nudix (nucleoside 16 2.70 2.34 diphosphate linked moiety X)-type motif 10 Olfr889 olfactory receptor 889 26 2.47 3.92 Pnlip pancreatic lipase 20 3.41 6.27 Pth2r parathyroid hormone 2 131 5.61 7.63 receptor Pacrg PARK2 co-regulated 35 2.28 4.29 Pdlim4 PDZ and LIM domain 4 4298 4.08 4.32 Pbk PDZ binding kinase 216 2.07 2.85 Pdzrn4 PDZ domain containing 82 3.76 5.94 RING finger 4 Pex11a peroxisomal biogenesis 61 2.08 4.60 factor 11 alpha Pex5l peroxisomal biogenesis 310 4.45 4.01 factor 5-like Pcyt1b phosphate 136 3.52 5.44 cytidylyltransferase 1, choline, beta isoform Prex1 phosphatidylinositol-3,4,5- s 2281 2.50 4.44 trisphosphate-dependent Rac exchange factor 1 Pde4d phosphodiesterase 4D, 348 2.64 2.50 cAMP specific Plppr1 phospholipid phosphatase 21 2.81 7.52 related 1 Phyhipl phytanoyl-CoA 122 3.91 5.26 hydroxylase interacting protein-like Pih1d2 PIH1 domain containing 2 19 2.87 2.16 Pdgfa platelet derived growth g 5205 5.25 3.91 factor, alpha Plekhb1 pleckstrin homology 2519 2.84 4.75 domain containing, family B (evectins) member 1 Ptn pleiotrophin g, s 7877 3.64 5.10 Plxnb3 plexin B3 879 3.61 6.23 Poc1a POC1 centriolar protein A 90 2.44 2.97 Paip2b poly(A) binding protein 716 2.21 2.07 interacting protein 2B Kcnk10 potassium channel, 78 3.37 7.25 subfamily K, member 10 Kcnn2 potassium s 283 5.67 6.71 intermediate/small conductance calcium- activated channel, subfamily N, member 2 Kcnj10 potassium inwardly- g 590 3.28 7.09 rectifying channel, subfamily J, member 10 Kcnj3 potassium inwardly- 14 3.12 ND rectifying channel, subfamily J, member 3 Kcnmb4 potassium large s 391 4.53 5.07 conductance calcium- activated channel, subfamily M, beta member 4 Kcnmb4os2 potassium large 31 3.07 6.02 conductance calcium- activated channel, subfamily M, beta member 4, opposite strand 2 Kcna1 potassium voltage-gated s 2621 2.92 5.66 channel, shaker-related subfamily, member 1 Kcna2 potassium voltage-gated 3927 3.94 5.91 channel, shaker-related subfamily, member 2 Kcna6 potassium voltage-gated 798 4.94 5.84 channel, shaker-related, subfamily, member 6 Kcnh8 potassium voltage-gated 321 5.64 7.11 channel, subfamily H (eag-related), member 8 Kcnq5 potassium voltage-gated 69 3.14 3.71 channel, subfamily Q, member 5 Pou3f1 POU domain, class 3, g 7220 4.76 6.92 transcription factor 1 Pou3f2 POU domain, class 3, g 113 3.39 6.01 transcription factor 2 Pou3f4 POU domain, class 3, 59 4.17 5.43 transcription factor 4 Prdm16os Prdm16 opposite strand 150 4.51 3.19 transcript Pbx4 pre B cell leukemia 19 2.08 2.22 homeobox 4 Gm10046 predicted gene 10046 49 4.44 4.92 Gm10146 predicted gene 10146 160 2.70 2.48 Gm10544 predicted gene 10544 77 4.45 4.26 Gm10558 predicted gene 10558 34 3.92 3.23 Gm10561 predicted gene 10561 22 2.44 2.15 Gm10657 predicted gene 10657 18 2.39 3.11 Gm10863 predicted gene 10863 166 3.85 5.30 Gm10941 predicted gene 10941 27 2.45 2.22 Gm11149 predicted gene 11149 64 4.24 4.54 Gm11266 predicted gene 11266 37 2.45 3.05 Gm11611 predicted gene 11611 11 5.82 4.40 Gm11697 predicted gene 11697 6 5.39 4.15 Gm11734 predicted gene 11734 16 3.55 3.51 Gm11816 predicted gene 11816 137 4.07 3.98 Gm12128 predicted gene 12128 11 3.10 ND Gm12222 predicted gene 12222 21 2.54 3.37 Gm12530 predicted gene 12530 21 3.17 5.33 Gm12688 predicted gene 12688 594 6.09 8.32 Gm12705 predicted gene 12705 11 3.88 2.15 Gm12829 predicted gene 12829 6 3.10 2.95 Gm12851 predicted gene 12851 9 ND 5.79 Gm12976 predicted gene 12976 7 3.84 3.81 Gm13133 predicted gene 13133 29 5.32 5.21 Gm13174 predicted gene 13174 75 6.42 7.95 Gm13175 predicted gene 13175 10 3.40 2.90 Gm13187 predicted gene 13187 65 4.80 4.37 Gm13237 predicted gene 13237 36 2.71 3.19 Gm13403 predicted gene 13403 48 3.33 4.92 Gm13479 predicted gene 13479 21 2.27 5.35 Gm13491 predicted gene 13491 22 3.65 5.66 Gm13830 predicted gene 13830 22 3.06 2.57 Gm13963 predicted gene 13963 9 2.62 ND Gm13967 predicted gene 13967 8 5.73 ND Gm14113 predicted gene 14113 74 4.39 7.65 Gm14114 predicted gene 14114 7 3.71 ND Gm14770 predicted gene 14770 7 4.53 5.21 Gm14776 predicted gene 14776 24 5.75 5.40 Gm14808 predicted gene 14808 10 4.61 4.08 Gm14817 predicted gene 14817 8 3.88 2.67 Gm15222 predicted gene 15222 18 3.89 2.72 Gm15270 predicted gene 15270 85 3.58 2.12 Gm15326 predicted gene 15326 13 2.00 4.27 Gm15327 predicted gene 15327 21 2.35 2.75 Gm15535 predicted gene 15535 15 3.94 3.64 Gm15802 predicted gene 15802 13 3.90 5.37 Gm15834 predicted gene 15834 24 2.29 2.60 Gm15941 predicted gene 15941 15 3.60 2.49 Gm15972 predicted gene 15972 36 3.70 2.04 Gm16054 predicted gene 16054 5 3.55 ND Gm16062 predicted gene 16062 32 2.32 3.12 Gm16082 predicted gene 16082 5 5.16 ND Gm16104 predicted gene 16104 26 3.63 3.28 Gm16139 predicted gene 16139 6 3.50 3.82 Gm20619 predicted gene 20619 10 2.04 5.08 Gm2115 predicted gene 2115 2372 6.65 7.76 Gm2164 predicted gene 2164 12 4.89 6.99 Gm27202 predicted gene 27202 106 7.88 3.03 Gm27217 predicted gene 27217 27 4.28 6.32 Gm28177 predicted gene 28177 14 4.63 2.99 Gm29539 predicted gene 29539 12 3.07 6.98 Gm4128 predicted gene 4128 10 2.18 ND Gm4189 predicted gene 4189 21 2.60 2.22 Gm4221 predicted gene 4221 27 2.13 2.88 Gm42463 predicted gene 42463 15 2.31 3.46 Gm42466 predicted gene 42466 42 2.38 2.96 Gm42683 predicted gene 42683 24 2.47 3.95 Gm42735 predicted gene 42735 40 2.65 2.07 Gm42788 predicted gene 42788 67 3.21 5.66 Gm42825 predicted gene 42825 52 7.45 ND Gm42909 predicted gene 42909 18 2.51 5.82 Gm42942 predicted gene 42942 11 2.14 2.52 Gm42946 predicted gene 42946 59 3.80 7.15 Gm43084 predicted gene 43084 8 3.51 6.43 Gm43526 predicted gene 43526 25 3.93 5.50 Gm43527 predicted gene 43527 43 3.23 5.89 Gm43528 predicted gene 43528 50 3.33 5.44 Gm43560 predicted gene 43560 79 2.32 2.17 Gm43594 predicted gene 43594 10 2.72 ND Gm43652 predicted gene 43652 21 3.40 3.84 Gm4419 predicted gene 4419 19 2.61 2.05 Gm44750 predicted gene 44750 16 4.10 5.27 Gm44883 predicted gene 44883 23 2.32 4.35 Gm44894 predicted gene 44894 8 3.14 4.06 Gm44895 predicted gene 44895 16 4.64 ND Gm44897 predicted gene 44897 18 3.99 ND Gm44898 predicted gene 44898 8 3.83 6.22 Gm45174 predicted gene 45174 36 5.32 ND Gm4524 predicted gene 4524 41 3.74 3.38 Gm45393 predicted gene 45393 10 4.81 3.46 Gm45394 predicted gene 45394 23 3.49 5.46 Gm45620 predicted gene 45620 11 6.16 3.16 Gm45731 predicted gene 45731 29 2.10 2.46 Gm45869 predicted gene 45869 36 2.56 5.81 Gm4739 predicted gene 4739 212 2.92 2.99 Gm5454 predicted gene 5454 124 4.85 2.15 Gm5914 predicted gene 5914 124 3.84 2.82 Gm7537 predicted gene 7537 12 2.86 6.90 Gm807 predicted gene 807 10 2.54 2.82 Gm8495 predicted gene 8495 11 3.01 2.56 Gm9085 predicted gene 9085 10 2.08 2.68 Gm9930 predicted gene 9930 13 2.29 3.09 Gm9945 predicted gene 9945 8 3.01 2.41 Gm17308 predicted gene, 17308 25 3.60 7.19 Gm19196 predicted gene, 19196 18 2.94 2.16 Gm19445 predicted gene, 19445 30 6.77 3.75 Gm19514 predicted gene, 19514 33 2.83 4.56 Gm19554 predicted gene, 19554 55 4.32 6.85 Gm19744 predicted gene, 19744 14 2.66 3.76 Gm19935 predicted gene, 19935 13 5.06 4.37 Gm20172 predicted gene, 20172 7 4.56 5.19 Gm20754 predicted gene, 20754 193 7.07 8.65 Gm24784 predicted gene, 24784 7 6.01 ND Gm25188 predicted gene, 25188 31 3.72 3.37 Gm26519 predicted gene, 26519 7 4.10 ND Gm26660 predicted gene, 26660 49 2.33 2.20 Gm26674 predicted gene, 26674 78 2.01 2.39 Gm26728 predicted gene, 26728 25 2.70 2.46 Gm26797 predicted gene, 26797 22 2.44 3.54 Gm26930 predicted gene, 26930 17 2.43 2.01 Gm27011 predicted gene, 27011 13 2.52 2.89 Gm30177 predicted gene, 30177 6 3.44 ND Gm32031 predicted gene, 32031 128 3.00 2.23 Gm32369 predicted gene, 32369 6 2.72 3.33 Gm32834 predicted gene, 32834 11 3.54 2.71 Gm32842 predicted gene, 32842 11 3.91 2.16 Gm33533 predicted gene, 33533 6 4.39 5.69 Gm33782 predicted gene, 33782 16 4.22 5.85 Gm33979 predicted gene, 33979 33 5.02 ND Gm34777 predicted gene, 34777 13 4.72 2.71 Gm36939 predicted gene, 36939 6 5.23 ND Gm36944 predicted gene, 36944 396 5.82 6.08 Gm36952 predicted gene, 36952 12 3.01 ND Gm36988 predicted gene, 36988 94 4.01 2.59 Gm37056 predicted gene, 37056 11 3.28 5.42 Gm37181 predicted gene, 37181 80 4.77 6.70 Gm37211 predicted gene, 37211 13 2.88 4.14 Gm37331 predicted gene, 37331 11 2.18 5.48 Gm37419 predicted gene, 37419 42 2.30 2.64 Gm37443 predicted gene, 37443 9 3.50 4.53 Gm37459 predicted gene, 37459 22 2.59 4.32 Gm37526 predicted gene, 37526 9 3.04 3.78 Gm37602 predicted gene, 37602 21 3.65 7.82 Gm37626 predicted gene, 37626 63 2.21 2.28 Gm37725 predicted gene, 37725 82 5.53 9.89 Gm37767 predicted gene, 37767 8 3.32 2.58 Gm37855 predicted gene, 37855 14 2.84 2.51 Gm37880 predicted gene, 37880 12 2.65 5.19 Gm37965 predicted gene, 37965 7 3.92 2.04 Gm38031 predicted gene, 38031 19 3.73 7.65 Gm38243 predicted gene, 38243 9 2.68 3.99 Gm38255 predicted gene, 38255 70 5.78 5.03 Gm38260 predicted gene, 38260 21 3.11 5.10 Gm38335 predicted gene, 38335 25 2.30 2.43 Gm38353 predicted gene, 38353 8 3.57 ND Gm39473 predicted gene, 39473 15 6.98 3.96 Gm42067 predicted gene, 42067 35 2.80 2.27 Gm43965 predicted gene, 43965 14 4.04 2.98 Gm44190 predicted gene, 44190 29 2.60 2.26 Gm44386 predicted gene, 44386 32 2.35 2.43 Gm44436 predicted gene, 44436 62 5.29 8.20 Gm44439 predicted gene, 44439 179 5.19 9.72 Gm44440 predicted gene, 44440 77 4.39 5.50 Gm44441 predicted gene, 44441 44 3.64 7.99 Gm46212 predicted gene, 46212 26 2.37 2.02 Gm46404 predicted gene, 46404 22 2.42 2.49 Gm47017 predicted gene, 47017 52 5.66 6.03 Gm47018 predicted gene, 47018 28 5.79 8.19 Gm47022 predicted gene, 47022 31 3.44 7.28 Gm47023 predicted gene, 47023 7 3.65 3.60 Gm47076 predicted gene, 47076 16 2.60 2.28 Gm47359 predicted gene, 47359 13 4.49 ND Gm47547 predicted gene, 47547 7 2.99 3.05 Gm47591 predicted gene, 47591 16 3.34 6.56 Gm47592 predicted gene, 47592 20 4.29 5.84 Gm47621 predicted gene, 47621 155 5.24 3.52 Gm47623 predicted gene, 47623 106 7.36 3.67 Gm47624 predicted gene, 47624 116 6.55 4.39 Gm47700 predicted gene, 47700 17 2.87 ND Gm47702 predicted gene, 47702 41 6.26 6.62 Gm47704 predicted gene, 47704 19 2.75 4.32 Gm47772 predicted gene, 47772 19 3.30 3.49 Gm47817 predicted gene, 47817 143 2.11 2.19 Gm47990 predicted gene, 47990 90 ND 7.87 Gm47991 predicted gene, 47991 8 ND ND Gm48259 predicted gene, 48259 12 6.36 4.84 Gm48261 predicted gene, 48261 15 2.95 6.00 Gm48427 predicted gene, 48427 25 3.27 3.38 Gm48497 predicted gene, 48497 23 7.27 ND Gm48751 predicted gene, 48751 18 3.53 2.84 Gm4798 predicted pseudogene 4798 30 2.25 2.09 Gm5473 predicted pseudogene 5473 8 2.75 3.26 Gm6525 predicted pseudogene 6525 31 3.98 2.73 Prnp prion protein g, s 5306 2.31 2.79 Prima1 proline rich membrane 852 6.63 8.21 anchor 1 Psrc1 proline/serine-rich coiled- 38 2.58 3.10 coil 1 Prrt1 proline-rich 169 4.77 3.29 transmembrane protein 1 Psapl1 prosaposin-like 1 9 3.83 4.49 Ppp1r14c protein phosphatase 1, 540 4.65 6.13 regulatory inhibitor subunit 14C Ppp1r1b protein phosphatase 1, s 104 4.43 4.81 regulatory inhibitor subunit 1B Ppp1r26 protein phosphatase 1, 74 2.34 2.75 regulatory subunit 26 Ppp2r2b protein phosphatase 2, 319 2.30 4.26 regulatory subunit B, beta Ptprz1 protein tyrosine g 5121 6.21 7.29 phosphatase, receptor type Z, polypeptide 1 Ptprd protein tyrosine s 1071 2.22 3.63 phosphatase, receptor type, D Plp1 proteolipid protein g, s 5346 3.14 5.81 (myelin) 1 Pcdh10 protocadherin 10 166 2.07 2.92 Pcdhb10 protocadherin beta 10 48 3.85 3.26 Pcdhb8 protocadherin beta 8 30 2.64 2.85 P2ry12 purinergic receptor P2Y, g, p 274 3.70 6.14 G-protein coupled 12 Qrfpr pyroglutamylated 9 3.93 6.28 RFamide peptide receptor Rab27b RAB27B, member RAS 74 2.65 3.77 oncogene family Rab31 RAB31, member RAS 1717 2.22 2.26 oncogene family Rgl3 ral guanine nucleotide 37 2.38 2.63 dissociation stimulator-like 3 Rasgef1c RasGEF domain family, 1619 6.19 7.49 member 1C Rit2 Ras-like without CAAX 2 s 19 4.35 7.67 Rbpjl recombination signal 95 2.51 4.25 binding protein for immunoglobulin kappa J region-like Rflna refilin A 155 2.66 3.20 Rfx4 regulatory factor X, 4 20 2.86 3.81 (NDluences HLA class II expression) Rlbp1 retinaldehyde binding 33 3.12 5.69 protein 1 Rxrg retinoid X receptor g 764 5.70 6.79 gamma Arhgef16 Rho guanine nucleotide 401 5.61 4.27 exchange factor (GEF) 16 Arhgef19 Rho guanine nucleotide 164 3.44 5.09 exchange factor (GEF) 19 Arhgef26 Rho guanine nucleotide 572 4.06 2.92 exchange factor (GEF) 26 Rtkn2 rhotekin 2 30 3.07 2.08 1110032F04Rik RIKEN cDNA 31 5.14 4.91 1110032F04 gene 1500026H17Rik RIKEN cDNA 36 3.62 3.63 1500026H17 gene 1700010I14Rik RIKEN cDNA 16 2.42 2.46 1700010I14 gene 1700047M11Rik RIKEN cDNA 239 4.81 5.26 1700047M11 gene 1700057H15Rik RIKEN cDNA 11 3.64 ND 1700057H15 gene 1810010H24Rik RIKEN cDNA 94 2.05 3.61 1810010H24 gene 1810024B03Rik RIKEN cDNA 135 2.30 2.25 1810024B03 gene 2010204K13Rik RIKEN cDNA 48 3.01 3.92 2010204K13 gene 2010320O07Rik RIKEN cDNA 19 3.51 5.43 2010320O07 gene 2310016G11Rik RIKEN cDNA 7 2.45 5.27 2310016G11 gene 2610020C07Rik RIKEN cDNA 66 2.44 2.57 2610020C07 gene 2900002M20Rik RIKEN cDNA 6 4.66 ND 2900002M20 gene 2900022M07Rik RIKEN cDNA 33 4.53 6.28 2900022M07 gene 2900052L18Rik RIKEN cDNA 33 2.33 2.69 2900052L18 gene 3110009E18Rik RIKEN cDNA 80 2.11 2.59 3110009E18 gene 3110021N24Rik RIKEN cDNA 17 2.23 2.40 3110021N24 gene 3110080E11Rik RIKEN cDNA 113 4.07 7.02 3110080E11 gene 4632428C04Rik RIKEN cDNA 41 3.44 2.85 4632428C04 gene 4732491K20Rik RIKEN cDNA 92 3.00 3.74 4732491K20 gene 4930469K13Rik RIKEN cDNA 120 3.99 8.56 4930469K13 gene 4930480K15Rik RIKEN cDNA 21 3.90 7.77 4930480K15 gene 4930505M18Rik RIKEN cDNA 12 2.92 5.81 4930505M18 gene 4930509J09Rik RIKEN cDNA 11 2.80 5.31 4930509J09 gene 4930570D08Rik RIKEN cDNA 26 ND 5.70 4930570D08 gene 4930570G19Rik RIKEN cDNA 44 2.25 3.98 4930570G19 gene 4930579J19Rik RIKEN cDNA 31 3.10 2.10 4930579J19 gene 4930579K19Rik RIKEN cDNA 8 2.94 3.05 4930579K19 gene 4930589L23Rik RIKEN cDNA 25 2.23 2.66 4930589L23 gene 4932435O22Rik RIKEN cDNA 17 2.83 3.02 4932435O22 gene 4933407E24Rik RIKEN cDNA 11 2.64 5.56 4933407E24 gene 4933407I08Rik RIKEN cDNA 16 5.55 6.20 4933407I08 gene 5330409N07Rik RIKEN cDNA 11 2.26 4.25 5330409N07 gene 5430427N15Rik RIKEN cDNA 6 3.16 2.95 5430427N15 gene 5430435K18Rik RIKEN cDNA 15 5.93 7.02 5430435K18 gene 5930430L01Rik RIKEN cDNA 94 3.45 2.24 5930430L01 gene 6030407O03Rik RIKEN cDNA 12 3.40 3.40 6030407O03 gene 6330403L08Rik RIKEN cDNA 409 3.77 2.84 6330403L08 gene 6430503K07Rik RIKEN cDNA 38 5.09 6.85 6430503K07 gene 8030445P17Rik RIKEN cDNA 29 3.48 6.65 8030445P17 gene 9230112E08Rik RIKEN cDNA 115 2.10 2.23 9230112E08 gene 9330159F19Rik RIKEN cDNA 144 3.93 5.20 9330159F19 gene 9430041J12Rik RIKEN cDNA 50 4.01 7.47 9430041J12 gene 9630001P10Rik RIKEN cDNA 40 4.07 5.49 9630001P10 gene A130050O07Rik RIKEN cDNA 70 2.80 3.14 A130050O07 gene A230081H15Rik Riken cDNA 39 3.43 6.20 A230081H15 gene A330058E17Rik RIKEN cDNA 15 2.04 2.86 A330058E17 gene A530095I07Rik RIKEN cDNA 10 2.66 5.15 A530095I07 gene A930018P22Rik RIKEN cDNA 13 5.27 6.22 A930018P22 gene B230312C02Rik RIKEN cDNA 25 2.13 2.70 B230312C02 gene B230317F23Rik RIKEN cDNA 53 2.15 3.56 B230317F23 gene B230359F08Rik RIKEN cDNA 7 3.29 ND B230359F08 gene B630019A10Rik RIKEN cDNA 19 3.07 2.63 B630019A10 gene C030006N10Rik RIKEN cDNA 48 3.73 7.19 C030006N10 gene C030029H02Rik RIKEN cDNA 13 3.87 5.51 C030029H02 gene C130071C03Rik RIKEN cDNA 48 2.89 7.96 C130071C03 gene C230035I16Rik RIKEN cDNA 18 2.97 2.74 C230035I16 gene C530008M17Rik RIKEN cDNA 153 2.73 4.04 C530008M17 gene D030047H15Rik RIKEN cDNA 10 2.88 2.62 D030047H15 gene D030068K23Rik RIKEN cDNA 248 6.28 7.43 D030068K23 gene D930032P07Rik RIKEN cDNA 19 2.91 4.15 D930032P07 gene I0C0044D17Rik RIKEN cDNA 28 4.83 4.79 I0C0044D17 gene Rnf219 ring finger protein 219 188 2.41 2.17 S100b S100 protein, beta g, p, s 1788 3.12 5.34 polypeptide, neural Scrg1 scrapie responsive gene 1 62 5.00 6.18 Sec14l2 SEC14-like lipid binding 2 80 3.12 2.86 Sfrp1 secreted frizzled-related 1702 2.03 4.11 protein 1 Sfrp5 secreted frizzled-related 2689 3.25 4.09 sequence protein 5 Sema3e sema domain, s 744 2.12 7.11 immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E Stk32a serine/threonine kinase 32A 372 4.85 6.61 Sh3gl3 SH3-domain GRB2-like 3 s 215 3.48 2.94 Shc4 SHC (Src homology 2 301 2.29 4.95 domain containing) family, member 4 Shisa2 shisa family member 2 67 2.81 2.14 Shisa4 shisa family member 4 449 2.87 2.67 Sgo1 shugoshin 1 96 2.17 2.95 Sppl2b signal peptide peptidase 512 2.42 2.24 like 2B Ssbp1 single-stranded DNA 666 2.49 2.49 binding protein 1 Slain1 SLAIN motif family, 27 2.04 5.33 member 1 Slitrk1 SLIT and NTRK-like s 452 6.40 6.56 family, member 1 Slitrk3 SLIT and NTRK-like s 879 7.68 7.87 family, member 3 Slitrk5 SLIT and NTRK-like s 92 4.09 5.06 family, member 5 Svip small VCP/p97-interacting 374 3.42 3.58 protein Soga3 SOGA family member 3 24 2.42 5.44 Slc13a5 solute carrier family 13 22 3.69 ND (sodium-dependent citrate transporter), member 5 Slc22a17 solute carrier family 22 671 2.63 3.38 (organic cation transporter), member 17 Slc26a7 solute carrier family 26, 14 2.09 ND member 7 Slc27a6 solute carrier family 27 51 2.81 4.27 (fatty acid transporter), member 6 Slc35d3 solute carrier family 35, 58 4.17 5.35 member D3 Slc35f1 solute carrier family 35, 1805 5.62 3.58 member F1 Slc8a3 solute carrier family 8 g, s 211 4.52 5.54 (sodium/calcium exchanger), member 3 Sstr1 somatostatin receptor 1 183 5.42 4.70 Sorcs1 sortilin-related VPS10 292 2.31 2.86 domain containing receptor 1 Sorcs2 sortilin-related VPS10 s 980 3.66 2.57 domain containing receptor 2 Sowaha sosondowah ankyrin 54 2.02 3.15 repeat domain family member A Sox2ot SOX2 overlapping 51 2.05 4.36 transcript (non-protein coding) Sall1 spalt like transcription 46 5.45 3.93 factor 1 Spon1 spondin 1, (f-spondin) 1660 2.78 2.57 extracellular matrix protein Srcin1 SRC kinase signaling s 155 4.54 4.86 inhibitor 1 Sox10 SRY (sex determining g 3494 4.63 6.87 region Y)-box 10 Sox2 SRY (sex determining 210 3.77 6.53 region Y)-box 2 Sox30 SRY (sex determining 17 2.40 3.73 region Y)-box 30 Sox6 SRY (sex determining g 763 4.38 2.62 region Y)-box 6 Ss18l2 SS18, nBAF chromatin 554 2.30 2.45 remodeling complex subunit like 2 St8sia1 ST8 alpha-N-acetyl- 130 4.05 6.84 neuraminide alpha-2,8- sialyltransferase 1 St8sia2 ST8 alpha-N-acetyl- g 770 4.94 3.09 neuraminide alpha-2,8- sialyltransferase 2 Saxo2 stabilizer of axonemal 22 2.28 2.24 microtubules 2 Stard10 START domain containing 10 405 4.10 3.47 Samd5 sterile alpha motif domain 514 3.11 2.04 containing 5 Srd5a1 steroid 5 alpha-reductase 1 256 2.99 3.26 Sapcd1 suppressor APC domain 7 2.81 2.82 containing 1 Sapcd2 suppressor APC domain 29 2.15 3.17 containing 2 Syt9 synaptotagmin IX 91 3.15 6.09 Tafa1 TAFA chemokine like 49 3.42 5.84 family member 1 Tafa5 TAFA chemokine like 842 4.77 5.92 family member 5 Tbx4 T-box 4 31 2.04 2.45 Tenm3 teneurin transmembrane 556 2.69 2.74 protein 3 Tns3 tensin 3 2573 3.18 3.12 Tox thymocyte selection- 341 4.11 4.90 associated high mobility group box Tmsb15l thymosin beta 15b like 14 3.43 4.74 Tmsb15b1 thymosin beta 15b1 29 3.64 3.59 Tnik TRAF2 and NCK 546 2.92 3.18 interacting kinase Tceal3 transcription elongation 54 3.03 2.94 factor A (SII)-like 3 Tfap2a transcription factor AP-2, 13 2.04 3.01 alpha Tagln3 transgelin 3 26 4.54 3.35 Tvp23bos trans-golgi network 22 3.41 2.62 vesicle protein 23B, opposite strand Trpm3 transient receptor 778 4.29 4.31 potential cation channel, subfamily M, member 3 Trpv3 transient receptor 39 3.26 4.10 potential cation channel, subfamily V, member 3 Tram1l1 translocation associated 36 2.39 3.41 membrane protein 1-like 1 Tmprss5 transmembrane protease, 325 4.41 7.01 serine 5 (spinesin) Tmem121 transmembrane protein 121 129 3.97 4.41 Tmem196 transmembrane protein 196 44 3.51 3.59 Tmem200a transmembrane protein 200A 183 5.44 3.79 Tmem26 transmembrane protein 26 149 2.42 3.21 Tmem88b transmembrane protein 88B 62 2.90 3.80 Ttr transthyretin 7 3.62 3.05 Trim2 tripartite motif-containing 2 1415 2.52 2.64 Tub tubby bipartite 63 2.71 2.40 transcription factor Ttyh1 tweety family member 1 812 4.47 4.69 Tyrp1 tyrosinase-related protein 1 131 2.07 7.17 Usp51 ubiquitin specific protease 51 13 2.99 3.49 Ube2ql1 ubiquitin-conjugating 77 3.64 5.00 enzyme E2Q family-like 1 Unc79 unc-79 homolog 122 2.90 5.90 Unc80 unc-80, NALCN activator 2511 7.12 8.28 Vxn vexin 93 4.86 5.55 Vmn1r181 vomeronasal 1 receptor 181 67 6.10 7.18 Vstm2a V-set and transmembrane 182 4.63 2.63 domain containing 2A Wdr31 WD repeat domain 31 17 2.79 2.10 Wnk3 WNK lysine deficient 20 2.36 3.16 protein kinase 3 Wwc1 WW, C2 and coiled-coil s 92 2.38 4.62 domain containing 1 Xylt1 xylosyltransferase 1 922 2.87 2.64 Zfp114 zinc finger protein 114 55 3.06 3.24 Zfp428 zinc finger protein 428 146 3.27 3.10 Zfp536 zinc finger protein 536 477 3.52 5.31 Zfp811 zinc finger protein 811 25 2.30 2.23 Zcwpw1 zinc finger, CW type with 145 2.26 3.39 PWWP domain 1 Zdbf2 zinc finger, DBF-type 265 2.55 3.11 containing 2

    Example 2

    The S1003-GFP: NG2-dsRed Mouse Line is a Reliable Model to Study Perisynaptic Schwann Cells

    [0082] The inventors evaluated whether the S100-GFP; NG2-dsRed mouse line is a reliable model to study perisynaptic Schwann cells and their functions at neuromuscular junctions. In healthy young adult muscle, the inventors observed the same number of perisynaptic Schwann cells at neuromuscular junctions in the extensor digitorum longus muscle of S100-GFP and S100-GFP; NG2-dsRed mice. See FIG. 1(E). The morphology of perisynaptic Schwann cells also appeared to be indistinguishable between the two transgenic lines. The morphology of neuromuscular junctions, as assessed by fragmentation of nicotinic acetylcholine receptor (nAChR) clusters, is unchanged in S100-GFP; NG2-dsRed mice compared to S100-GFP and wild type mice. See FIG. 1(F). Thus, the coxpression of S100-GFP and NG2-dsRed does not appear to cause apparent deleterious changes on either perisynaptic Schwann cells or the postsynaptic region revealed by nAChRs. However, coxpression of these markers in perisynaptic Schwann cells could disrupt the presynapse and biophysical properties of the neuromuscular junction. Such changes would be minor given that S100-GFP; NG2-dsRed mice are outwardly indistinguishable when compared to S100-GFP and wild type mice.

    [0083] The inventors next assessed whether S100-GFP; NG2-dsRed mice can also be used to study perisynaptic Schwann cells at degenerating and regenerating neuromuscular junctions. The inventors first examined expression of NG2-dsRed and S100-GFP after crushing the fibular nerve. See Dalkin et al. (2016). In this injury model, motor axons completely retract within one day and return to reinnervate vacated postsynaptic sites by seven days post-injury in young adult mice. Similar to healthy uninjured extensor digitorum longus muscles, NG2-dsRed and S100-GFP coxpressed exclusively in perisynaptic Schwann cells at 4-day and 7-day post-injury.

    [0084] The inventors next crossed the SOD1G93A mouse line (see Gurney et al. (1994)), which is a model of ALS shown to exhibit significant degeneration of neuromuscular junctions (see Moloney et al. (2014)), with S100-GFP; NG2-dsRed mice and examined the expression pattern of NG2-dsRed and S100-GFP in the extensor digitorum longus during the symptomatic stage (P120). NG2-dsRed and S100-GFP coxpressed only in perisynaptic Schwann cells in the extensor digitorum longus of P120 SOD1G93A; S100-GFP; NG2-dsRed mice.

    [0085] Accordingly, this genetic labeling approach can confidently be used to study the synaptic glia of the neuromuscular junction in a manner previously not possible in healthy and stressed neuromuscular junctions.

    Example 3

    The Relationship Between NG2 Expression and Perisynaptic Schwann Cell Differentiation

    [0086] The inventors analyzed NG2 expression in S100-GFP.sup.+ Schwann cells during the course of neuromuscular junction development in the extensor digitorum longus muscle of S100-GFP; NG2-dsRed mice. See FIG. 2(A). The inventors observed the presence of S100-GFP+ cells at the neuromuscular junction as early as embryonic day 15 (E15) with 100% of neuromuscular junctions having at least one S100-GFP+ cell by post-natal day 9. See FIG. 2(A)-(B). During the embryonic developmental stages, neuromuscular junctions are exclusively populated by S100-GFP+ cells that do not express NG2-dsRed. See FIG. 2(C). At post-natal day 0 (P0), however, NG2-dsRed expression in a small subset of S100-GFP+ cells. See FIGS. 2(A) & (C). Surprisingly, the proportion of neuromuscular junctions with S100-GFP+; NG2-dsRed+ cells sharply increased between the ages of P0 and P9, coinciding with the period of neuromuscular junction maturation in mouse skeletal muscles. See FIG. 2(C). By P21, when neuromuscular junction maturation in mice is near completion (Sanes & Lichtman (1999), S100-GFP+; NG2-dsRed+ cells was exclusively present at neuromuscular junctions. At this age, the number of S100-GFP+; NG2-dsRed+ perisynaptic Schwann cells reached an average of 2.3 per neuromuscular junction. This condition remained unchanged in healthy young adult mice. See FIG. 2(A). To confirm that dsRed expression from the NG2 promoter denotes the temporal and spatial transcriptional control of the NG2 gene in S100-GFP; NG2-dsRed mice, the inventors immunostained for NG2 protein. The inventors found NG2 protein present at mature neuromuscular junctions but not in neuromuscular junctions of E18 mice with immunohistochemistry. Thus, the induced expression of NG2 during the course of neuromuscular junction development in Schwann cells located proximally to the neuromuscular junction provides further evidence that NG2 is a marker of mature, differentiated S100+ perisynaptic Schwann cells.

    [0087] Perisynaptic Schwann cells might upregulate NG2 during development to restrict motor axon growth at the neuromuscular junction. See Filous et al. (2014). Induced NG2 expression during neuromuscular junction development along with the constant presence of S100-GFP+ cells (S100-GFP+ or S100-GFP+; NG2-dsRed+) and absence of single labeled NG2-dsRed+ cells at neuromuscular junctions at every observed developmental time point strongly support previous studies indicating that perisynaptic Schwann cells originate from Schwann cells. See Lee et al. (2017).

    [0088] To gain insights into the rules that govern the distribution of perisynaptic Schwann cells at neuromuscular junctions, the inventors compared perisynaptic Schwann cell density in the relationship between NG2 expression and perisynaptic Schwann cell differentiation, soleus, and diaphragm muscles to determine if perisynaptic Schwann cell density is similar across muscles with varying neuromuscular junction sizes, fiber types and functional demands. The inventors observed similar perisynaptic Schwann cell densities in each muscle type, suggesting that the number of perisynaptic Schwann cells directly correlates with the size of the neuromuscular junction and not the functional characteristics or fiber type composition of the muscles with which they are associated.

    [0089] Immunostaining showed that NG2, which the inventors identified as a PSC-enriched gene by RNA-Seq, is concentrated at the neuromuscular junction. The inventors showed that NG2 is specifically expressed by S100-GFP.sup.+ perisynaptic Schwann cells but not myelinating S100-GFP.sup.+ Schwann cells. Thus, the combined expression of S100 and NG2 is a unique molecular marker of perisynaptic Schwann cells in skeletal muscle. Thus, NG2 is a marker of differentiated perisynaptic Schwann cells. The inventors showed that Schwann cells induce expression of NG2 shortly after the cells arrive at the neuromuscular junction during maturation of the synapse. However, the means by which the induced expression of NG2 is part of a program to establish or further specify perisynaptic Schwann cell identity in Schwann cells at the neuromuscular junction, through activation of the NG2 promoter, remains to be determined.

    [0090] The inventors used FACS to isolate S100-GFP.sup.+; NG2-dsRed.sup.+ perisynaptic Schwann cells from skeletal muscle to analyze perisynaptic Schwann cell transcriptome. This analysis reveals expression of several genes that were previously implicated in modulation of synaptic activity, synaptic pruning, and synaptic maintenance by perisynaptic Schwann cells. The inventors identified several genes that are highly expressed in perisynaptic Schwann cells but not Schwann cells or NG2+ cells. The inventors verified several of these with qPCR and immunohistochemistry. This analysis shows a unique gene expression signature that distinguishes perisynaptic Schwann cells from all other Schwann cells.

    [0091] While the function of the majority of genes found enriched in perisynaptic Schwann cells at the neuromuscular synapse remains to be determined, many function in neuronal circuits in the central nervous system and in cell-cell communication. This is the case for NG2, which terminates axonal growth in glial scars in the spinal cord. See Filous et al. (2014). Therefore, NG2 can be used by perisynaptic Schwann cells to tile, and thus occupy unique territories, and prevent motor axons from developing sprouts that extend beyond the postsynaptic partner. The inventors found that the NG2 promoter is active in some perisynaptic Schwann cells at P0, a time when motor axon nerve endings at neuromuscular junctions undergo rapid morphological changes. See Sanes & Lichtman (1999); Sanes & Lichtman (2001). The progressive activation of the NG2 promoter in perisynaptic Schwann cells is complete by P9, which coincides with the elimination of extranumeral axons innervating the same postsynaptic site in mice. See Sanes & Lichtman (1999); Sanes & Lichtman (2001). Perisynaptic Schwann cells might use NG2 to promote the maturation of the presynaptic region and thus the neuromuscular junction. Perisynaptic Schwann cells might use NG2 to repel each other as they tile during development to occupy unique territories at the neuromuscular junction. See Brill et al. (2011).

    Example 4

    Spatial Distribution

    [0092] The inventors next examined the spatial distribution of perisynaptic Schwann cells at the neuromuscular junction using the Nearest Neighbor (NN) analysis. This analysis measures the linear distance between neighboring cells to determine the regularity of spacing (see Wassle & Riemann (1978); Cook (1996)), quantified using the regularity index. Randomly distributed groups of cells yield a nearest neighbor regularity index (NNRI) of 1.91 while those with nonrandom, regularly ordered distributions yield higher NNRI values. See Reese & Keeley (2015).

    [0093] The spacing of perisynaptic Schwann cells yielded high NNRI values and thus maintained ordered, non-random distributions at neuromuscular junctions in adult mouse extensor digitorum longus muscle. This ordered distribution was maintained regardless of the overall number of perisynaptic Schwann cells at a given neuromuscular junction. These observations are in accord with a published study indicating that perisynaptic Schwann cells occupy distinct territories at adult neuromuscular junctions. See Brill et al. (2011). Presynaptic, postsynaptic, or PSC-PSC mechanisms of communication can dictate the spatial distribution of perisynaptic Schwann cells.

    [0094] The ability to distinguish perisynaptic Schwann cells from all other Schwann cells makes it possible to identify genes that are either preferentially-expressed or specifically-expressed in perisynaptic Schwann cells. The inventors used fluorescence-activated cell sorting (FACS) to separately isolate double labeled S100-GFP+; NG2-dsRed+ perisynaptic Schwann cells, single-labeled S100-GFP+ Schwann cells, and single-labeled NG2-dsRed+ cells (including -SMA pericytes and Tuj1+ precursor cells (see Birbrair et al. (2013b)) from juvenile (P15-P22) S100-GFP; NG2-dsRed transgenic mice. We then used RNA-Sequencing (RNA Seq) to compare the transcriptional profile of perisynaptic Schwann cells with the other two groups. See FIG. 3. Light microscopy and expression analysis of GFP and dsRed using quantitative PCR (qPCR) confirmed that only cells of interest were sorted. See FIG. 3. This analysis revealed a unique transcriptional profile for perisynaptic Schwann cells. See FIG. 3. The inventors found 567 genes enriched in perisynaptic Schwann cells that were not previously recognized to be associated with perisynaptic Schwann cells, glial cells or synapses (see TABLE 3) using Ingenuity Pathway Analysis (IPA). The perisynaptic Schwann cells preferentially expressed several genes with known functions at synapses. See Mozer & Sandstrom (2012); Fox & Umemori (2006); Rafuse et al. (2000); Ranaivoson et al. (2019); Shapiro et al. (2007); Peng et al. (2010); and TABLE 4. Ingenuity Pathway Analysis showed synaptogenesis, glutamate receptor, and axon guidance signaling as top canonical pathways under transcriptional regulation. See FIG. 3.

    [0095] Cross-referencing the transcriptomic data with a list of genes compiled from previously published studies showed enrichment or functions in perisynaptic Schwann cells. This analysis identified twenty-seven genes expressed in isolated S100-GFP.sup.+; NG2-dsRed.sup.+ perisynaptic Schwann cells that were previously shown to be associated with perisynaptic Schwann cells. See TABLE 4. These included genes involved in detection and modulation of synaptic activity such as adenosine (Robitaille (1995)); Rochon et al. (2001)), P2Y (Robitaille (1995); Heredia et al. (2018); Darabid et al. (2018), acetylcholine (Robitaille et al. (1997); Petrov et al. (2014); Wright et al. (2009) and glutamate receptors (Pinard et al. (2003), Butyrylcholinesterase (BChE) (Petrov et al. (2014), and L-type calcium channels (Robitaille et al., 1996). Additionally, genes involved in neuromuscular junction development, synaptic pruning, and maintenance including agrin, 2,3-cyclic nucleotide 3 phosphodiesterase (CNP) (Georgiou & Charlton (1999)), Erb-b2 receptor tyrosine kinase 2 (Erbb2) (Trachtenberg & Thompson (1996); Morris et al. (1999); Woldeyesus et al. (1999)), Erbb3 (Trachtenberg & Thompson (1996); Riethmacher et al. (1997)) GRB2-associated protein 1 (Gab1) (Park et al. (2017), myelin-associated glycoprotein (MAG) (Georgiou & Charlton (1999)), and myelin protein zero (Mpz) (Georgiou & Charlton (1999)) were detected in perisynaptic Schwann cells.

    TABLE-US-00004 TABLE 4 Genes with functions in PSCs identified by RNA seq analysis of isolated PSCs Log2 Log2 change vs change vs Read NG2- S100- Gene Description count dsRed+ GFP+ Reference Adora2a Adenosine A2a receptor 8.1 3.68 2.67 Robitaille (1995); Rochon et al. (2001)) Adora2b Adenosine A2b receptor 9.2 3.16 4.55 Robitaille (1995); Rochon et al. (2001) Agrn Agrin 2049.7 1.16 2.93 Georgiou & Charlton (1999) Bche Butyrylcholinesterase 7191.0 7.89 7.21 Trachtenberg Thompson (1996) Cacna1c L type Calcium channel, 14.3 4.92 2.10 Morris et al. (1999) alpha 1 c Cacna1d L type Calcium channel, 18.4 0.42 1.49 Morris et al. (1999) alpha 1d Cd44 CD44 antigen 1249.2 0.75 1.22 Woldeyesus et al. (1999) Chrm1 Muscarinic acetylcholine 14.8 n.d. 0.89 Robitaille et al. (1997); receptor M1 Riethmacher et al. (1997) Cnp 2,3-cyclicnucleotide 3 2990.2 4.23 1.66 Personius et al. (2016) phosphodiesterase Erbb2 Erb-b2 receptor tyrosine 228.9 0.84 1.37 Park et al. (2017); kinase 2 Pinard et al. (2003); Descarries et al. (1998) Erbb3 Erb-b2 receptor tyrosine 2471.3 7.05 4.46 Park et al. (2017); kinase 3 Hess et al. (2007) GAb1 GRB2-associated 693.8 0.31 1.57 Heredia et al. (2018) protein 1 Grm1 Glutamate receptor, 9.2 n.d. 0.80 Darabid et al. (2018) metabotropic 1 Grm5 Glutamate receptor, 38.0 n.d. 2.84 Darabid et al. (2018) metabotropic 5 LNX1 Ligand of numb-protein 37.5 2.29 0.70 Peper et al. (1974) X 1 MAG Myelin-associated 136.0 3.12 0.55 Personius et al. (2016) glycoprotein Mpz Myelin protein zero 4590.7 2.54 0.79 Personius et al. (2016) Nos2 Nitric oxide synthase 2, 13.4 2.91 1.28 Musarella et al. (2006) inducible Nos3 Nitric oxide synthase 3, 48.6 2.69 0.68 Musarella et al. (2006) endothelial cell P2ry1 Purinergic receptor 144.4 0.52 2.21 Robitaille (1995); P2Y1 De Winter et al. (2006); Feng & Ko (2008) P2ry2 Purinergic receptor 24.0 1.55 1.04 Robitaille (1995) P2Y2 P2ry10b P2Y receptor family 10.0 1.25 3.14 Robitaille (1995) member P2Y10b P2ry12 P2Y receptor family 273.5 n.d. 3.70 Robitaille (1995) member P2Y12 P2ry14 P2Y receptor family 13.6 3.49 2.06 Robitaille (1995) member P2Y14 S100b S100 protein beta 1788.3 5.34 3.12 Reynolds & Woolf (1992) Sema3a Semaphorin 3a 136.6 2.95 1.07 Yang et al. (2001) Tgfb1 Transforming growth 173.2 1.08 1.90 Petrov et al. (2014) factor, beta 1

    [0096] Quantitative PCR (qPCR) to validate preferential expression of select genes in perisynaptic Schwann cells. The inventors obtained RNA from S100-GFP.sup.+; NG2-dsRed.sup.+ perisynaptic Schwann cells, single-labeled S100-GFP.sup.+ Schwann cells, and single-labeled NG2-dsRed.sup.+ cells isolated using FACS from juvenile S100-GFP; NG2-dsRed transgenic mice. The inventors examined eight genes identified by RNA seq as being highly enriched in perisynaptic Schwann cells. These genes included the identified Ajap1, Col20a1, FoxD3, Nrxn1, PDGFa, and Pdlim4 genes and other genes previously shown to be enriched in perisynaptic Schwann cells. See FIG. 3. These other genes included BChE (Petrov et al. (2014)) and NCAM1 (Covault & Sanes (1986)). qPCR analysis showed that all eight genes are highly enriched in perisynaptic Schwann cells as compared to all other cell types isolated by FACS (FIG. 3), validating the RNA-Seq findings.

    Other Embodiments

    [0097] Specific compositions and methods of combinatorial use of markers to isolate synaptic glia to generate synapses in a dish for high-throughput and high-content drug discovery and testing have been described. The detailed description in this specification is illustrative and not restrictive or exhaustive. The detailed description is not intended to limit the disclosure to the precise form disclosed. Other equivalents and modifications besides those already described are possible without departing from the inventive concepts described in this specification, as a person having ordinary skill in the biomedical art can recognize. When the specification or claims recite method steps or functions in order, alternative embodiments may perform the functions in a different order or substantially concurrently. The inventive subject matter, therefore, shall not be restricted except in the spirit of the disclosure.

    [0098] When interpreting the disclosure, all terms shall be interpreted in the broadest possible manner consistent with the context. Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by a person having ordinary skill in the biomedical art. This invention is not limited to the particular methodology, protocols, reagents, and the like described in this specification and, as such, can vary in practice. The terminology used in this specification is not intended to limit the scope of the invention, which is defined solely by the claims.

    [0099] All patents and publications cited throughout this specification are expressly incorporated by reference to disclose and describe the materials and methods that might be used with the technologies described in this specification. The publications discussed are provided solely for their disclosure before the filing date. They shall not be construed as an admission that the inventors may not antedate such disclosure under prior invention or for any other reason. If there is an apparent discrepancy between a previous patent or publication and the description provided in this specification, the present specification (including any definitions) and claims shall control. All statements as to the date or representation as to the contents of these documents are based on the information available to the applicants and constitute no admission as to the correctness of the dates or contents of these documents. The dates of publication provided in this specification may differ from the actual publication dates. If there is an apparent discrepancy between a publication date provided in this specification and the actual publication date supplied by the publisher, the actual publication date shall control.

    [0100] When a range of values is provided, each intervening value, to the tenth of the unit of the lower limit, unless the context dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that range of values.

    REFERENCES

    [0101] A person having ordinary skill in the biomedical art can use these patents, patent applications, and scientific references as guidance to predictable results when making and using the invention:

    Patent References:

    [0102] U.S. Pat. No. 8,962,314B2 (Wei et al.). This patent provides a pluripotent stem cell isolated from the lateral ventricle of the brain or choroid plexus. Compositions and methods of isolating and using the cell also are provided. [0103] US20050048462A1 (Ackermann et al.). This patent application provides in vivo and in vitro methods for identifying or detecting a synapse activated or assessing the level of activation of a synapse, which method comprises: (i) determining the presence and/or amount, in a morphologically specialized postsynaptic site in the synapse (e.g., a dendritic spine), of a detectable cellular component associated with the activation (which is a tag or marker for the activation e.g., an actin-cytoskeleton interacting protein such as profilin II or gelsolin), and (ii) correlating the result of the determination with synaptic activation. Such assays can be useful in identifying processes involved in LTP, and also more generally in identifying modulators of synaptic activation or transmission, and hence cognitive function. [0104] US20080109914A1 (Popko et al.). The patent application relates to the generation of an animal model that exhibits a neural cell-specific expression of a marker gene that correlates to remyelination or myelin repair. The compositions and methods embodied in the present invention are useful for drug screening or treatment of demyelination disorders, particularly in identifying compounds that promote or inhibit remyelination. [0105] US20110262956A1 (Munoz et al.). Co-culture compositions and methods are described for identifying agents that modulate a cellular phenotype, particularly of neurons or pancreatic beta cells, are provided. The methods include co-culturing differentiated cells, wherein at least one of the cell-types are derived from human induced pluripotent stem cells from a subject having or predisposed to a neurodegenerative or metabolic disorder. Co-culture compositions of differentiated cells from two human subjects are also described. [0106] US20130022583A1 (The Board of Trustees of the Leland Stanford Junior University). Methods, compositions, and kits for producing functional neurons, astrocytes, oligodendrocytes, and progenitor cells thereof are provided. These methods, compositions, and kits find use in producing neurons, astrocytes, oligodendrocytes, and progenitor cells thereof for transplantation, for experimental evaluation, as a source of lineage- and cell-specific products for example for treating human disorders of the CNS. Also provided are methods, compositions, and kits for screening candidate agents for activity in converting cells into neuronal cells, astrocytes, oligodendrocytes, and progenitor cells thereof. [0107] US20190195863A1 (Brivanlou et al.). The compositions and methods disclosed concern an isogenic population of in vitro human embryonic stem cells comprising a disease form of the Huntingtin gene (HTT) at the endogenous HTT gene locus in the genome of the cell; wherein the disease form of the HTT gene comprises a polyQ repeat of at least 40 glutamines at the N-terminus of the Huntingtin protein (HTT). The cell lines of the disclosure include genetically-defined alterations made in the endogenous HTT gene that recapitulate Huntington's Disease in humans. The cell lines have isogenic controls that share a similar genetic background. Differentiating cell lines committed to a neuronal fate and fully differentiated cell lines are also provided. They also display phenotypic abnormalities associated with the length of the polyQ repeat of the HTT gene. These cell lines are used as screening tools in drug discovery and development to identify substances that fully or partially revert these phenotype abnormalities. [0108] EP3359648A1 (Memorial Sloan Kettering Cancer Center). The patent application relates to an in vitro human neuromuscular junction model prepared from a co-culture of human pluripotent stem cell-derived spinal motor neurons and human myoblast-derived skeletal muscle cells. The application also provided methods of screening compounds for their ability to modulate neuromuscular junction activity by determining whether a candidate compound increases or decreases the activity of the in vitro human neuromuscular junction model.

    Non-Patent References:

    [0109] Allen & Eroglu, Cell biology of astrocyte-synapse interactions. Neuron, 96, 697-708 (2017). [0110] Ampofo et al., The regulatory mechanisms of NG2/CSPG4 expression. Cell. Mol. Biol. Lett., 22, 4 (Feb. 28, 2017). [0111] Anders, Pyl, & Huber, HTSeq-a Python framework to work with high-throughput sequencing data. Bioinformatics, 31, 166-169 (2015). [0112] Aronesty, Comparison of sequencing utility programs. The Open Bioinformatics Journal, 7, 1-8 (2013). [0113] Astrow, Qiang, & Ko, Perisynaptic Schwann cells at neuromuscular junctions revealed by a novel monoclonal antibody, Journal of Neurocytology, 27, 667-681 ((1998)). [0114] Astrow, Son, & Thompson, Differential neural regulation of a neuromuscular junction-associated antigen in muscle fibers and Schwann cells, Journal of Neurobiology, 25, 937-952 (1994). [0115] Barik et al., Schwann cells in neuromuscular junction formation and maintenance Journal of Neuroscience, 36, 9770-9781 ((2016)). [0116] Batiuk et al., An immunoaffinity-based method for isolating ultrapure adult astrocytes based on ATP1B2 targeting by the ACSA-2 antibody. The American Society for Biochemistry and Molecular Biology, Inc. (Apr. 3, 2017). The understanding of the molecular mechanisms underlying astrocyte development and function is still rudimentary. This lack of knowledge is at least partly due to the lack of tools available for astrocyte biology. ACSA-2 is a commercially available antibody (Miltenyi Biotec, Bergisch Gladbach, Germany) originally developed for the isolation of astrocytes from young postnatal mouse brain, using magnetic cell-sorting methods. Still, its usefulness in isolating cells from adult tissue had not yet been published. Using a modified protocol, the authors used this tool to isolate astrocytes from the adult brain. Using a variety of techniques (including single-cell sequencing, overexpression and knockdown assays, immunoblotting, and immunohistochemistry), the authors identify the ACSA-2 epitope for the first time as ATP1B2 and characterize its distribution in the CNS. The authors show that ATP1B2 is stably expressed in multiple models of CNS injury and disease. The authors show that the ACSA-2 antibody possesses the potential to be a valuable tool for astrocyte research, allowing the purification and characterization of astrocytes (potentially including injury and disease models) with no specialized and expensive equipment. [0117] Bergles, Jabs, & Steinhuser, Neuron-glia synapses in the brain, Brain Research Reviews, 63, 130-137 (2010). [0118] Birbrair et al., Role of pericytes in skeletal muscle regeneration and fat accumulation Stem Cells and Development, 22, 2298-2314 (2013a). [0119] Birbrair et al., Skeletal muscle pericyte subtypes differ in their differentiation potential. Stem Cell Research, 10, 67-84 (2013b). [0120] Boeke, The sympathetic endformation, its synaptology, the interstitial cells, the periterminal network, and its bearing on the neurone theory discussion and critique. Cells Tissues Organs, 8, 18-61 (1949). [0121] Brill, Marinkovi, & Misgeld, Sequential photo-bleaching to delineate single Schwann cells at the neuromuscular junction. J. Vis. Exp., e4460 (2013). [0122] Brill et al., Spatial constraints dictate glial territories at murine neuromuscular junctions, Journal of Cell Biology, 195, 293-305 (2011). [0123] Brockes, Fields, & Raff, Studies on cultured rat Schwann cells. I. Establishment of purified populations from cultures of peripheral nerve, Brain Research 165, 105-118 ((1979)). [0124] Castro et al., Specific labeling reveals unique cellular and molecular features of synaptic Schwann cells, eLife, 9: e56935 (2020). [0125] Castro et al., Identification of a molecular fingerprint for synaptic glia, bioRxiv, 2020.03.13.991323. [0126] Castro et al., Synaptic Schwann cells: specific labeling reveals unique cellular and molecular features. (2020) NCBI Gene Expression Omnibus ID GSE152774. [0127] Changeux, Kasai, & Lee, Use of a snake venom toxin to characterize the cholinergic receptor protein. Proc. Natl. Acad. Sci. U.S.A., 67, 1241-1247 (1970). [0128] Clavreul et al., Cortical astrocytes develop in a plastic manner at both clonal and cellular levels. Nature Communications. Oct. 25, 2019. The authors performed multiclonal lineage tracing using combinatorial genetic markers with a large-volume color imaging approach to study astrocyte development in the mouse cortex. The authors show that cortical astrocyte clones intermix with their neighbors and display extensive variability in terms of spatial organization, number, and subtypes of cells generated. Clones develop through 3D spatial dispersion, while at the individual level, astrocytes acquire their complex morphology progressively. They find that the astroglial network is supplied both before and after birth by ventricular progenitors that scatter in the neocortex and can cause protoplasmic and pial astrocyte subtypes. [0129] Cook, Spatial properties of retinal mosaics: an empirical evaluation of some existing measures. Visual Neuroscience, 13, 15-30 (1996). [0130] Couteaux, The structure and function of muscle (Elsevier, 1960). [0131] Covault & Sanes, Distribution of N-CAM in synaptic and extrasynaptic portions of developing and adult skeletal muscle. The Journal of Cell Biology, 102, 716-730 (1986). [0132] Dalkin, Taetzsch, & Valdez, The fibular nerve injury method: a reliable assay to identify and test factors that repair neuromuscular junctions. Journal of Visualized Experiments, 11, 54186 (2016). [0133] Darabid, Arbour, & Robitaille, Glial cells decipher synaptic competition at the mammalian neuromuscular junction. Journal of Neuroscience, 33, 1297-1313 (2013). [0134] Darabid, Perez-Gonzalez, & Robitaille, Neuromuscular synaptogenesis: cordinating partners with multiple functions, Nature Reviews Neuroscience, 15, 703-718 (2014). [0135] Darabid, St-Pierre-See, & Robitaille, Purinergic-dependent glial regulation of synaptic plasticity of competing terminals and synapse elimination at the neuromuscular junction. Cell Reports, 25, 2070-2082 (2018). [0136] De Winter et al., The expression of the chemorepellent semaphorin 3A is selectively induced in terminal Schwann cells of a subset of neuromuscular synapses that display limited anatomical plasticity and enhanced vulnerability in motor neuron disease. Molecular and Cellular Neuroscience, 32, 102-117 (2006). [0137] Deloulme et al., Nuclear expression of S100 in oligodendrocyte progenitor cells correlates with differentiation toward the oligodendroglial lineage and modulates oligodendrocytes maturation. Molecular and Cellular Neuroscience, 27, 453-65 (2004). A lineage-tracing analysis. [0138] Descarries et al., Localization and characterization of nitric oxide synthase at the frog neuromuscular junction. Journal of Neurocytology, 27, 829-840 (1998). [0139] Deweerdt, RNA therapies explained. Nature (2019). [0140] Dimou & Gallo, NG2-glia and their functions in the central nervous system. GLIA, vol. 63, 1429-1451 (2015). NG2 is present in subsets of Schwann cells besides astrocytes, oligodendrocytes, pericytes, and endothelial cells. [0141] Fatt & Katz, The electric activity of the motor end-plate. Proc. R. Soc. London. Ser. B, Biol. Sci., 140, 183-186 (1952). [0142] Feng & Ko, Schwann cells promote synaptogenesis at the neuromuscular junction via transforming growth factor-beta1, Journal of Neuroscience 28, 9599-9609 (2008). [0143] Filous et al., Entrapment via synaptic-like connections between NG2 proteoglycan.sup.+ cells and dystrophic axons in the lesion plays a role in regeneration failure after spinal cord injury. The Journal of Neuroscience, 34, 16369-84 (2014). [0144] Fox & Umemori, Seeking long-term relationship: axon and target communicate to organize synaptic differentiation. Journal of Neurochemistry, 97, 1215-1231 (2006). A gene preferentially expressed by perisynaptic Schwann cells with a known function at synapses. [0145] Georgiou & Charlton, Non-myelin-forming perisynaptic Schwann cells express protein zero and myelin-associated glycoprotein. GLIA, 27, 101-109 (1999). [0146] Godfrey et al., Components of Torpedo electric organ and muscle that cause aggregation of acetylcholine receptors on cultured muscle cells. The Journal of Cell Biology, 99, 615-627 (1984). [0147] Gorlewicz et al., CD44 is expressed in non-myelinating Schwann cells of the adult rat and may play a role in neurodegeneration-induced glial plasticity at the neuromuscular junction. Neurobiology of Disease, 34, 245-258 (2009). [0148] Griffin & Thompson, Biology and pathology of nonmyelinating Schwann cells. GLIA, 56, 1518-1531 (2008). [0149] Gurney et al., Motor neuron degeneration in mice that express a human cu,zn superoxide dismutase mutation. Science, 264, 1772-1775 (1994). [0150] Hachem et al., Spatial and temporal expression of S100 in cells of oligodendrocyte lineage, GLIA, 51, 81-97 (2005). [0151] Heredia et al., Postnatal restriction of activity-induced Ca2+ responses to Schwann cells at the neuromuscular junction are caused by the proximo-distal loss of axonal synaptic vesicles during development. The Journal of Neuroscience, 38, 8650-8665 (2018). [0152] Hess et al., Localization of TrkC to Schwann cells and effects of neurotrophin-3 signaling at neuromuscular synapses. The Journal of Comparative Neurology, 501, 465-482 (2007). [0153] Heuser & Reese, Evidence for recycling of synaptic vesicle membrane during transmitter release at the frog neuromuscular junction. The Journal of Cell Biology, 57, 315-344 (1973). [0154] Jahromi, Robitaille, & Charlton, Transmitter release increases intracellular calcium in perisynaptic Schwann cells in situ. Neuron, 8, 1069-1077 (1992). [0155] Jkel & Dimou, Glial cells and their function in the adult brain: A journey through the history of their ablation. Frontiers in Cellular Neuroscience, Vol. 11 (2017). A growing number of molecular markers that recognize subsets of glial cells throughout the nervous system were identified. [0156] Jennings, Dyer, & Burden, Muscle-specific trk-related receptor with a kringle domain defines a distinct class of receptor tyrosine kinases. Proc. Natl. Acad. Sci. U.S.A., 90, 2895-2899 (1993). [0157] Kang et al., Regulation of the intermediate filament protein nestin at rodent neuromuscular junctions by innervation and activity. Journal of Neuroscience, 27, 5948-5957 (2007). [0158] Katz & Miledi, Input-output relation of a single synapse. Nature, 212, 1242-1245 (1966). [0159] Katz & Miledi, A study of synaptic transmission in the absence of nerve impulses. The Journal of Physiology, 192, 407-436 (1967). [0160] Kim et al., Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nature Biotechnology, 37, 907-915 (2019). [0161] Kim, D., Langmead, B. & Salzberg, S. L. HISAT: a fast spliced aligner with low memory requirements. Nat. Methods 12, 357-60 (2015). [0162] Ko & Robitaille, Perisynaptic Schwann cells at the neuromuscular synapse: Adaptable, multitasking glial cells. Cold Spring Harb. Perspect. Biol., 7, (2015). While great progress has been made in understanding the cellular and physiological characteristics of perisynaptic Schwann cells, very little is known about the molecular composition of these cells. [0163] Koirala et al., Reciprocal interactions between perisynaptic Schwann cells and regenerating nerve terminals at the frog neuromuscular junction. Journal of Neurobiology, 44, 343-360 (2000). [0164] Kong, Btrim: A fast, lightweight adapter and quality trimming program for next-generation sequencing technologies. Genomics, 98, 152-153 (2011). [0165] Laranjeira et al., Glial cells in the mouse enteric nervous system can undergo neurogenesis in response to injury. Journal of Clinical Investigation, Vol. 121, No. 9; pp. 3412-24 (August 2011). Multipotent progenitors of the enteric nervous system (ENS) can be identified in the adult intestine using clonal cultures and in vivo transplantation assays. Using genetic fate mapping, the inventors here demonstrate that mouse neural crest cells marked by SRY box-containing gene 10 (Sox10) generate the neuronal and glial lineages of enteric ganglia. Most neurons originated from progenitors residing in the gut during mid-gestation. Afterward, enteric neurogenesis was reduced, and it ceased between one and three months of postnatal life. Sox10-expressing cells present in the myenteric plexus of adult mice expressed glial markers. The authors found no evidence these cells participated in neurogenesis under steady-state conditions. They retained neurogenic potential, as they could generate neurons with characteristics of enteric neurons in culture. Enteric glia caused neurons in vivo in response to chemical injury to the enteric ganglia. The results indicate that despite the absence of constitutive neurogenesis in the adult gut, enteric glia maintain limited neurogenic potential, which can be activated by tissue dissociation or injury. [0166] Lee et al., Advanced fluorescence protein-based synapse-detectors. Front. Synaptic Neurosci. (Jun. 30, 2016). Recent advances in fluorescent protein engineering, along with developments in light-favoring tissue clearing and optical imaging techniques, rendered light microscopy (LM) a potent candidate for large-scale analyses of synapses, their properties, and their connectivity. Optically imaging engineered fluorescent proteins (FPs) tagged to synaptic proteins or microstructures enables the efficient, fine-resolution illumination of synaptic anatomy and function in large neural circuits. The authors reviewed the progress in fluorescent protein-based molecular tools for imaging individual synapses and synaptic connectivity. The authors identify associated technologies in gene delivery, tissue processing, and computational image analysis that bridge the gap between synapse- and system-level neuroscience. [0167] Lee et al., Schwann cells participate in synapse elimination at the developing neuromuscular junction. Current Opinion in Neurobiology, 47, 176-181 (2017). A suggestion that perisynaptic Schwann cells originate from Schwann cells. [0168] Livet et al., Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system. Nature, 450 (7166), 56-62 (December 2007). The authors present strategies to visualize synaptic circuits by genetically labeling neurons with multiple, distinct colors. In Brainbow transgenes, Cre/lox recombination is used to create a stochastic choice of expression between three or more fluorescent proteins. Integration of tandem Brainbow copies in transgenic mice yielded combinatorial fluorescent protein expression, and thus many colors, providing a way to distinguish adjacent neurons and visualize other cellular interactions. The authors reconstructed hundreds of neighboring axons and multiple synaptic contacts in one small volume of a cerebellar lobe exhibiting approximately ninety colors. The expression in some lines also allowed us to map glial territories and follow glial cells and neurons over time in vivo. The ability of the Brainbow system to label uniquely many individual cells within a population can facilitate the analysis of neuronal circuitry on a large scale. [0169] Love & Thompson, Schwann cells proliferate at rat neuromuscular junctions during development and regeneration. The Journal of Neuroscience, 18, 9376-9385 (1998). [0170] Love, Huber, & Anders, Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology, 15, 550 (2014). [0171] Lwebuga-Mukasa, Lappi, & Taylor, Molecular forms of acetylcholinesterase from Torpedo californica: their relationship to synaptic membranes. Biochemistry, 15, 1425-1434 (1976). [0172] Matthias et al., Segregated expression of AMPA-type glutamate receptors and glutamate transporters defines distinct astrocyte populations in the mouse hippocampus. The Journal of Neuroscience, 23, 1750-1758 (2003). [0173] Miledi & Slater, Electrophysiology and electron-microscopy of rat neuromuscular junctions after nerve degeneration. Proc. R. Soc. London. Ser. B. Biol. Sci., 169, 289-306 (1968). [0174] Miledi & Slater, On the degeneration of rat neuromuscular junctions after nerve section. The Journal of Physiology, 207, 507-528 (1970). [0175] Moloney, de Winter, & Verhaagen, ALS as a distal axonopathy: molecular mechanisms affecting neuromuscular junction stability in the presymptomatic stages of the disease. Frontiers in Neuroscience, 8, 252 (2014). [0176] Monk, Feltri, & Taveggia, New insights on Schwann cell development. GLIA, 63, 1376-1393 (2015). [0177] Morris et al., Rescue of the cardiac defect in ErbB2 mutant mice reveals essential roles of ErbB2 in peripheral nervous system development. Neuron, 23, 273-283 (1999). [0178] Moshrefi-Ravasdjani et al., Changes in the proliferative capacity of NG2 cell subpopulations during postnatal development of the mouse hippocampus. Brain Structure and Function, 222, 831-847 (2017). [0179] Mozer & Sandstrom, Drosophila neuroligin 1 regulates synaptic growth and function in response to activity and phosphoinositide-3-kinase. Molecular and Cellular Neuroscience, 51, 89-100 (2012). A gene preferentially expressed by perisynaptic Schwann cells with known functions at synapses. [0180] Musarella et al., Expression of Nav1.6 sodium channels by Schwann cells at neuromuscular junctions: Role in the motor endplate disease phenotype. GLIA, 53, 13-23 (2006). [0181] Nitkin et al., Identification of Agrin, a synaptic organizing protein from Torpedo electric organ. The Journal of Cell Biology, 105, 2471-2478 (1987). [0182] O'Malley et al., In vivo observations of terminal Schwann cells at normal, denervated, and reinnervated mouse neuromuscular junctions. Journal of Neurobiology, 38, 270-286 (1999). [0183] Park et al., The scaffolding protein, Grb2-associated Binder-1, in skeletal muscles and terminal Schwann cells regulates postnatal neuromuscular synapse maturation. Experimental Neurobiology, 26, 141-150 (2017). [0184] Peng et al., Platelet-derived growth factor-mediated induction of the synaptic plasticity gene arc/Arg3.1. Journal of Biological Chemistry, 285, 21615-21624 (2010). A gene preferentially expressed by perisynaptic Schwann cells with known functions at synapses. [0185] Peper et al., Structure and ultrastructure of the frog motor endplate a freeze-etching study. Cell and Tissue Research, 149, 437-455 (1974). [0186] Perez & Moore, Wallerian degeneration in rabbit tibial nerve: changes in amounts of the S-100 protein. Journal of Neurochemistry, 15, 971-977 (1968). [0187] Personius, Slusher, & Udin, Neuromuscular NMDA receptors modulate developmental synapse elimination. The Journal of Neuroscience, 36, 8783-8789 (2016). [0188] Petrov et al., Schwann cells sense and control acetylcholine spillover at the neuromuscular junction by a7 nicotinic receptors and butyrylcholinesterase. Journal of Neuroscience, 34, 11870-11883 (2014). [0189] Pinard et al., Glutamatergic modulation of synaptic plasticity at a PNS vertebrate cholinergic synapse. European Journal of Neuroscience, 18, 3241-3250 (2003). [0190] Platel et al., GFAP-GFP neural progenitors are antigenically homogeneous and anchored in their enclosed mosaic niche. GLIA, 57, 66-78 (2009). [0191] Porter & Froehner, Characterization and localization of the mr=43,000 proteins associated with acetylcholine receptor-rich membranes. The Journal of Biological Chemistry, 258, 10034-10040 (1983). [0192] Rafuse, Polo-Parada, & Landmesser, Structural and functional alterations of neuromuscular junctions in NCAM-deficient mice. The Journal of Neuroscience, 20, 6529-39 (2000). A gene preferentially expressed by perisynaptic Schwann cells with known functions at synapses. [0193] Ranaivoson et al., A proteomic screen of neuronal Cell-Surface molecules reveals IgLONs as structurally conserved interaction modules at the synapse. Structure 27, 893-906.e9 (2019). A gene preferentially expressed by perisynaptic Schwann cells with known functions at synapses. [0194] Reddy et al., Glial cells maintain synaptic structure and function and promote development of the neuromuscular junction in vivo. Neuron, 40, 563-580 (2003). [0195] Reese & Keeley, Design principles and developmental mechanisms underlying retinal mosaics. Biological Reviews 90, 854-876 (2015). [0196] Reist & Smith, Neurally evoked calcium transients in terminal Schwann cells at the neuromuscular junction. Proc. Natl. Acad. Sci. U.S.A., 89, 7625-7629 (1992). [0197] Reynolds & Woolf, Terminal Schwann cells elaborate extensive processes following denervation of the motor endplate. Journal of Neurocytology, 21, 50-66 (1992). [0198] Riethmacher et al., Severe neuropathies in mice with targeted mutations in the ErbB3 receptor. Nature, 389, 725-730 (1997). [0199] Robertson, The ultrastructure of a reptilian myoneural junction. The Journal of Biophysical and Biochemical Cytology, 2, 381-394 (1956). [0200] Robitaille, Purinergic receptors and their activation by endogenous purines at perisynaptic glial cells of the frog neuromuscular junction. The Journal of Neuroscience, 15, 7121-7131 (1995). [0201] Robitaille, Bourque, & Vandaele, Localization of L-type Ca.sup.2+ channels at perisynaptic glial cells of the frog neuromuscular junction. The Journal of Neuroscience, 16, 148-158 (1996). [0202] Robitaille, Jahromi, & Charlton, Muscarinic Ca.sup.2+ responses resistant to muscarinic antagonists at perisynaptic Schwann cells of the frog neuromuscular junction. The Journal of Physiology, 504, 337-347 (1997). [0203] Rochon, Rousse, & Robitaille, Synapse-glia interactions at the mammalian neuromuscular junction. The Journal of Neuroscience, 21, 3819-3829 (2001). [0204] Ruitenberg et al., Chapter 21-Gene Therapy for Spinal Cord Injury, in Gene Therapy of the Central Nervous System, From Bench to Bedside (Academic Press, 2006) [0205] Sanes & Lichtman, Development of the vertebrate neuromuscular junction. Annual Review of Neuroscience, 22, 389-442 (1999). [0206] Sanes & Lichtman, Induction, assembly, maturation and maintenance of a postsynaptic apparatus. Nature Reviews Neuroscience, 2, 791-805 (2001). [0207] Sealock et al., Immunochemical identification of desmin in Torpedo postsynaptic membranes and at the rat neuromuscular junction. Synapse, 3, 315-324 (1989). [0208] Shapiro, Love, & Coleman, Adhesion Molecules in the Nervous System: Structural Insights into Function and Diversity. Annual Review of Neuroscience, 30, 451-474 (2007). A gene preferentially expressed by perisynaptic Schwann cells with known functions at synapses. [0209] Shi et al., Glia co-culture with neurons in microfluidic platforms promotes the formation and stabilization of synaptic contacts. Lab on a Chip, Issue 15 (2013). Two novel microfluidic cell culture schemes, a vertically-layered set-up and a four-chamber set-up, were developed for co-culturing central nervous system (CNS) neurons and glia. The cell chambers in these devices were separated by pressure-enabled valve barriers, which permitted the authors to control communication between the two cell types. The unique design of these devices facilitated the co-culture of glia with neurons nearby (50-100 m), differential transfection of neuronal populations, and dynamic visualization of neuronal interactions, such as developing synapses. With these co-culture devices, initial synaptic contact between neurons transfected with different fluorescent markers, such as green fluorescent protein (GFP) and mCherry-synaptophysin, was imaged using high-resolution fluorescence microscopy. The presence of glial cells had a profound influence on synapses by increasing the number and stability of synaptic contacts. As determined by liquid chromatography-ion mobility-mass spectrometry, neuron-glia co-cultures produced elevated levels of soluble factors compared to that secreted by individual neuron or glia cultures, suggesting a potential mechanism by which neuron-glia interactions could modulate synaptic function. [0210] Smith et al., Terminal Schwann cells participate in the competition underlying neuromuscular synapse elimination. Journal of Neuroscience, 33, 17724-17736 (2013). [0211] Sobel et al., Structural and functional properties of the acetylcholine regulator. Advances in Cytopharmacology, 3, 191-196 (1979). [0212] Sobel, Weber, & Changeux, Large-scale purification of the acetylcholine-receptor protein in its membrane-bound and detergent-extracted forms from Torpedo marmorata electric organ. European Journal of Biochemistry, 80, 215-224 (1977). [0213] Son & Thompson, Schwann cell processes guide regeneration of peripheral axons. Neuron, 14, 125-132 (1995). [0214] Stallcup, The NG2 antigen, a putative lineage marker: immunofluorescent localization in primary cultures of rat brain. Developmental Biology, 83, 154-165 (1981). [0215] Sdhof, Towards an understanding of synapse formation. Neuron, 100, 276-293 (2018). [0216] Trachtenberg & Thompson, Schwann cell apoptosis at developing neuromuscular junctions is regulated by glial growth factor. Nature, 379, 174-177 (1996). [0217] Trachtenberg & Thompson, Nerve terminal withdrawal from rat neuromuscular junctions induced by neuregulin and Schwann cells. The Journal of Neuroscience, 17, 6243-6255 (1997). [0218] Vives et al., Visualization of S100-positive neurons and glia in the central nervous system of EGFP transgenic mice. The Journal of Comparative Neurology, 457, 404-419 (2003). [0219] Wassle & Riemann, The mosaic of nerve cells in the mammalian retina. Proc. R. Soc. London-Biol. Sci. (1978). [0220] Wiernasz et al., Ttyh1 Protein is Expressed in Glia In Vitro and Shows Elevated Expression in Activated Astrocytes Following Status Epilepticus. Neurochem. Res., Vol. 39; 2516-2526 (2014). The authors describe Ttyh1 protein expression in astrocytes, oligodendrocytes, and microglia in vitro. Using double immunofluorescence, the authors showed Ttyh1 protein expression in activated astrocytes in the hippocampus following amygdala stimulation-induced status epilepticus. In migrating astrocytes in an in vitro wound model, Ttyh1 concentrates at the edges of extending processes. Ttyh1 not only participates in shaping neuronal morphology but can also function in activated glia in brain pathology. To localize Ttyh1 expression in the cellular compartments of neurons and astrocytes, the authors performed in vitro double immunofluorescent staining using markers for the following subcellular structures: endoplasmic reticulum (GRP78), Golgi apparatus (GM130), clathrin-coated vehicles (clathrin), early endosomes (Rab5 and APPL2), recycling endosomes (Rab11), trans-Golgi network (TGN46), endoplasmic reticulum membrane (calnexin), late endosomes and lysosomes (LAMP1) and synaptic vesicles (synaptoporin and synaptotagmin 1). Ttyh1 is present in the endoplasmic reticulum, Golgi apparatus, and clathrin-coated vesicles (clathrin) in both neurons and astrocytes and also in late endosomes or lysosomes in astrocytes. [0221] Woldeyesus et al., Peripheral nervous system defects in erbB2 mutants following genetic rescue of heart development. Genes & Development, 13, 2538-2548 (1999). [0222] Wright et al., Distinct muscarinic acetylcholine receptor subtypes contribute to stability and growth, but not compensatory plasticity, of neuromuscular synapses. Journal of Neuroscience, 29, 14942-14955 (2009). [0223] Yang et al., Schwann cells express active agrin and enhance aggregation of acetylcholine receptors on muscle fibers. The Journal of Neuroscience, 21, 9572-9584 (2001). [0224] Young et al., LNX1 is a perisynaptic Schwann cell specific E3 ubiquitin ligase that interacts with ErbB2. Molecular and Cellular Neuroscience, 30, 238-248 (2005). [0225] Zhu, Bergles, & Nishiyama, NG2 cells generate both oligodendrocytes and gray matter astrocytes. Development, 135, 145-157 (2008). The NG2 promoter drives gene expression. [0226] Zuo et al., Fluorescent proteins expressed in mouse transgenic lines mark subsets of glia, neurons, macrophages, and dendritic cells for vital examination. The Journal of Neuroscience, 24 (49), 10999-11009 (Dec. 8, 2004). Transgenic mice were generated that express green fluorescent proteins under the control of transcriptional regulatory sequences of the human S100 gene. Terminal Schwann cells were imaged repetitively in living animals of one of the transgenic lines to show that, except for extension and retraction of short processes, the glial coverings of the adult neuromuscular synapse are stable. In other lines, subsets of Schwann cells were labeled. The distribution of label suggests that Schwann cells at individual synapses are clonally related, a finding with implications for how these cells might be sorted during postnatal development. Other labeling patterns included astrocytes, microglia, and subsets of cerebellar Bergmann glia, spinal motor neurons, macrophages, and dendritic cells. Labeled macrophage lines can follow the accumulation of these cells at sites of injury.

    Textbooks and Technical References

    [0227] Current Protocols in Immunology (CPI) (2003). John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc. (ISBN 0471142735, 9780471142737). [0228] Current Protocols in Molecular Biology (CPMB) (2014). Frederick M. Ausubel (ed.), John Wiley and Sons (ISBN 047150338X, 9780471503385). [0229] Current Protocols in Protein Science (CPPS), (2005). John E. Coligan (ed.), John Wiley and Sons, Inc. [0230] Immunology (2006). Werner Luttmann, published by Elsevier. [0231] Janeway's Immunobiology, (2014). Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited, (ISBN 0815345305, 9780815345305). [0232] Laboratory Methods in Enzymology: DNA, (2013). Jon Lorsch (ed.) Elsevier (ISBN 0124199542). [0233] Lewin's Genes XI, (2014). published by Jones & Bartlett Publishers (ISBN-1449659055). [0234] Molecular Biology and Biotechnology: a Comprehensive Desk Reference, (1995). Robert A. Meyers (ed.), published by VCH Publishers, Inc. (ISBN 1-56081-569-8). [0235] Molecular Cloning: A Laboratory Manual, 4th ed., Michael Richard Green and Joseph Sambrook, (2012). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (ISBN 1936113414). [0236] The Encyclopedia of Molecular Cell Biology and Molecular Medicine, Robert S. Porter et al. (eds.), published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908). [0237] The Merck Manual of Diagnosis and Therapy, 19.sup.th edition (Merck Sharp & Dohme Corp., 2018). [0238] Pharmaceutical Sciences 23.sup.rd edition (Elsevier, 2020). [0239] Rodriguez et al., The Growing and Glowing Toolbox of Fluorescent and Photoactive Proteins. Trends in Biochemical Sciences. 42 (2), 111-129 (February 2017). [0240] RNA-Seq data has been deposited in NCBI GEO. The GEO accession number for this dataset is GSE152774.