Microorganisms genetically engineered to have modified N-glycosylation activity

10023854 ยท 2018-07-17

Assignee

Inventors

Cpc classification

International classification

Abstract

Described herein are methods and genetically engineered cells useful for producing an altered N-glycosylation form of a target molecule. Also described are methods and molecules with altered N-glycosylation useful for treating a variety of disorders such as metabolic disorders.

Claims

1. A method of producing an altered N-glycosylation form of a target protein, the method comprising: providing a Yarrowia lipolytica or an Arxula adeninivorans cell genetically engineered to express a protein capable of promoting mannosyl phosphorylation of N-glycans; and introducing into the cell a nucleic acid encoding a target protein, wherein the cell produces the target protein in an altered N-glycosylation form, and wherein the protein capable of promoting mannosyl phosphorylation of N-glycans is selected from the group consisting of: a wild-type MNN4 polypeptide or a biologically active variant of a wild-type MNN4 polypeptide; a wild-type PNO1 polypeptide or a biologically active variant of a wild-type PNO1 polypeptide; and a wild-type MNN6 polypeptide.

2. The method of claim 1, further comprising isolating the altered N-glycosylation form of the target protein.

3. The method of claim 1, wherein the target protein is an exogenous protein.

4. The method of claim 1, wherein the target protein is an endogenous protein.

5. The method of claim 1, wherein the target protein is a mammalian protein.

6. The method of claim 1, wherein the target protein is a pathogen protein, a lysosomal protein, a growth factor, a cytokine, a chemokine, or a fusion protein.

7. The method of claim 1, wherein the target protein is a protein associated with a lysosomal storage disorder (LSD).

8. The method of claim 7, wherein the lysosomal storage disorder is Gaucher disease, Tay-Sachs disease, Pompe disease, Niemann-Pick disease, or Fabry disease.

9. The method of claim 7, wherein the target protein is glucocerebrosidase, alpha galactosidase, or galactocerebrosidase.

10. The method of claim 7, wherein the target protein is selected from the group consisting of alpha-L-iduronidase, beta-D-galactosidase, beta-glucosidase, beta-hexosaminidase, beta-D-mannosidase, alpha-L-fucosidase, arylsulfatase B, arylsulfatase A, alpha-N-acteylgalactosaminidase, aspartylglucosaminidase, iduronate-2-sulfatase, alpha-glucosaminide-N-acetyltransferase, beta-D-glucoronidase, hyaluronidase, alpha-L-mannosidase, alpha-neuraminidase, phosphotransferase, acid lipase, acid ceramidase, sphinogmyelinase, thioesterase, cathepsin K, and lipoprotein lipase.

11. The method of claim 7, wherein the target protein is human alpha-galactosidase A.

12. The method of claim 1, further comprising additional processing of the glycoprotein.

13. The method of claim 12, wherein the additional processing comprises enzymatic or chemical treatment of the altered N-glycosylation form of the target protein.

14. The method of claim 1, wherein the target protein is a human protein.

15. The method of claim 1, wherein the cell is further genetically engineered to comprise at least one additional modification of an N-glycosylation activity.

16. The method of claim 15, wherein the at least one additional modification of an N-glycosylation activity comprises a deficiency in an N-glycosylation activity.

17. The method of claim 16, wherein the deficiency in an N-glycosylation activity is a deficiency in Outer CHain elongation (OCH1) activity.

18. The method of claim 15, wherein the at least one additional modification of an N-glycosylation activity comprises expression of a protein having N-glycosylation activity.

19. The method of claim 18, wherein the expressed protein having N-glycosylation activity is an alpha-mannosidase, or a biologically active variant thereof.

20. The method of claim 18, wherein the alpha-mannosidase is an alpha 1,2 mannosidase.

21. The method of claim 18, wherein the alpha-mannosidase is MNS1.

22. The method of claim 18, wherein the alpha-mannosidase is targeted to the endoplasmic reticulum.

23. An isolated Yarrowia lipolytica or Arxula adeninivorans cell genetically engineered to express a protein capable of promoting mannosyl phosphorylation of N-glycans, wherein the cell is capable of producing a target polypeptide in an altered glycosylation form when a nucleic acid encoding the target polypeptide is introduced into the cell, and wherein the protein capable of promoting mannosyl phosphorylation of N-glycans is selected from the group consisting of: a wild-type MNN4 polypeptide or a biologically active variant of a wild-type MNN4 polypeptide; a wild-type PNO1 polypeptide or a biologically active variant of a wild-type PNO1 polypeptide; and a wild-type MNN6 polypeptide.

24. The cell of claim 23, wherein said cell further comprises a nucleic acid encoding a target polypeptide, wherein the cell produces the target polypeptide in an altered N-glycosylation form.

25. The cell of claim 24, wherein the target polypeptide is a human polypeptide.

26. The cell of claim 24, wherein the target polypeptide is a polypeptide associated with a lysosomal storage disorder (LSD).

27. The cell of claim 26, wherein the LSD is selected from the group consisting of Gaucher disease, Tay-Sachs disease, Pompe disease, Niemann-Pick disease, and Fabry disease.

28. The cell of claim 26, wherein the target polypeptide is selected from the group consisting of glucocerebrosidase, alpha galactosidase, galactocerebrosidase, alpha-L-iduronidase, beta-D-galactosidase, beta-glucosidase, beta-hexosaminidase, beta-D-mannosidase, alpha-L-fucosidase, arylsulfatase B, arylsulfatase A, alpha-N-acteylgalactosaminidase, aspartylglucosaminidase, iduronate-2-sulfatase, alpha-glucosaminide-N-acetyltransferase, beta-D-glucoronidase, hyaluronidase, alpha-L-mannosidase, alpha- neuraminidase, phosphotransferase, acid lipase, acid ceramidase, sphinogmyelinase, thioesterase, cathepsin K, lipoprotein lipase, and human alpha- galactosidase A.

29. The cell of claim 22, wherein the cell is further genetically engineered to comprise at least one additional modification of an N-glycosylation activity.

30. The cell of claim 24, wherein the at least one additional modification of an N-glycosylation activity comprises a deficiency in an N-glycosylation activity.

31. The cell of claim 30, wherein the deficiency in an N-glycosylation activity is a deficiency in Outer CHain elongation (OCH1) activity.

32. The cell of claim 24, wherein the at least one additional modification of an N-glycosylation activity comprises expression of a protein having N-glycosylation activity.

33. The cell of claim 32, wherein the expressed protein having N-glycosylation activity is an alpha-mannosidase, or a biologically active variant thereof.

34. The substantially pure culture of claim 33, wherein said cell further comprises a nucleic acid encoding a target protein, wherein the cell produces the target protein in an altered N-glycosylation form. a wild-type MNN6 polypeptide.

35. The method of claim 28, wherein the cell is further genetically engineered to comprise at least one additional modification of an N-glycosylation activity.

36. The method of claim 29, wherein the at least one additional modification of an N-glycosylation activity comprises a deficiency in an N-glycosylation activity.

37. The method of claim 36, wherein the deficiency in an N-glycosylation activity is a deficiency in Outer CHain elongation (OCH1) activity.

38. The method of claim 29, wherein the at least one additional modification of an N-glycosylation activity comprises expression of a protein having N-glycosylation activity.

39. The method of claim 38, wherein the expressed protein having N-glycosylation activity is an alpha-mannosidase, or a biologically active variant thereof.

40. The method of claim 34, wherein the target protein is a human protein.

41. The method of claim 34, wherein the target protein is a protein associated with a lysosomal storage disorder (LSD).

42. The method of claim 41, wherein the LSD is selected from the group consisting of Gaucher disease, Tay-Sachs disease, Pompe disease, Niemann-Pick disease, and Fabry disease.

43. The method of claim 41, wherein the target protein is selected from the group consisting of glucocerebrosidase, alpha galactosidase, galactocerebrosidase, alpha-L-iduronidase, beta-D-galactosidase, beta-glucosidase, beta-hexosaminidase, beta-D-mannosidase, alpha-L-fucosidase, arylsulfatase B, arylsulfatase A, alpha-N-acteylgalactosaminidase, aspartylglucosaminidase, iduronate-2-sulfatase, alpha-glucosaminide-N-acetyltransferase, beta-D-glucoronidase, hyaluronidase, alpha-L-mannosidase, alpha-neuraminidase, phosphotransferase, acid lipase, acid ceramidase, sphinogmyelinase, thioesterase, cathepsin K, lipoprotein lipase, and human alpha-galactosidase A.

44. A substantially pure culture of Yarrowia lipolytica or Arxula adeninivorans cells, wherein the culture comprises a cell genetically engineered to express a protein capable of promoting mannosyl phosphorylation of N-glycans, wherein the cell is capable of producing a target polypeptide in an altered glycosylation form when a nucleic acid encoding the target polypeptide is introduced into the cell, and wherein the protein capable of promoting mannosyl phosphorylation of N-glycans is selected from the group consisting of: a wild-type MNN4 polypeptide or a biologically active variant of a wild-type MNN4 polypeptide; a wild-type PNO1polypeptide or a biologically active variant of a wild-type PNO1polypeptide; and a wild-type MNN6 polypeptide.

45. The substantially pure culture of claim 44, wherein said cell further comprises a nucleic acid encoding a target polypeptide, wherein the cell procedures the target polypeptide in an altered N-glycosylation form.

46. The culture of claim 45, wherein the target polypeptide is a human polypeptide.

47. The culture of claim 45, wherein the target polypeptide is a protein associated with a lysosomal storage disorder (LSD).

48. The culture of claim 44, wherein the LSD is selected from the group consisting of Gaucher disease, Tay-Sachs disease, Pompe disease, Niemann-Pick disease, and Fabry disease.

49. The culture of claim 47, wherein the target polypeptide is selected from the group consisting of glucocerebrosidase, alpha galactosidase, galactocerebrosidase, alpha-L-iduronidase, beta-D-galactosidase, beta-glucosidase, beta-hexosaminidase, beta-D-mannosidase, alpha-L-fucosidase, arylsulfatase B, arylsulfatase A, alpha-N-acteylgalactosaminidase, aspartylglucosaminidase, iduronate-2-sulfatase, alpha-glucosaminide-N-acetyltransferase, beta-D-glucoronidase, hyaluronidase, alpha-L-mannosidase, alpha- neuraminidase, phosphotransferase, acid lipase, acid ceramidase, sphinogmyelinase, thioesterase, cathepsin K, lipoprotein lipase, and human alpha-galactosidase A.

50. The culture of claim 33, wherein the cell is further genetically engineered to comprise at least one additional modification of an N-glycosylation activity.

51. The culture of claim 35, wherein the at least one additional modification of an N-glycosylation activity comprises a deficiency in an N-glycosylation activity.

52. The culture of claim 51, wherein the deficiency in an N-glycosylation activity is a deficiency in Outer CHain elongation (OCH1) activity.

53. The culture of claim 35, wherein the at least one additional modification of an N-glycosylation activity comprises expression of a protein having N-glycosylation activity.

54. The substantially pure culture of claim 53, wherein the expressed protein having N-glycosylation activity is an alpha-mannosidase, or a biologically active variant thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram depicting N-glycan precursor synthesis at the yeast endoplasmic reticulum. Genes whose encoded protein has an activity mediating the indicated enzymatic conversions are in shaded boxes (e.g., ALG7; upper left). UDP and UMP refer to uridine diphosphate and uridine monophosphate, respectively. GDP and GMP refer to guanosine diphosphate and guanosine monophosphate respectively. Gn refers to N-acetylglucosamine. M refers to monomeric mannose, G refers to glucose, Pi refers to phosphate

(2) FIG. 2 is a schematic diagram depicting N-glycan processing in the yeast endoplasmic reticulum.

(3) FIG. 3 is a schematic diagram depicting N-glycan processing in the S. cerevisiae Golgi apparatus. Genes whose encoded protein has an activity mediating the indicated enzymatic conversions are in shaded boxes (e.g., OCH1; middle left).

(4) FIGS. 4A and 4B are a schematic diagrams depicting the structure of the various N-glycan structures described herein.

(5) FIGS. 5A-5E are schematic diagrams depicting the cloning strategy for OCH1 gene disruption in Yarrowia lipolytica. PCR refers to polymerase chain reaction.

(6) FIGS. 6A and 6B are schematic diagrams depicting the cloning strategy for MNN9 gene disruption fragment. PCR refers to polymerase chain reaction.

(7) FIG. 7 is a series of electroferograms depicting N-glycan analysis of mannoproteins obtained from wild-type Yarrowia lipolytica cells or glycosylation mutant (e.g., och1 cI9, mnn91 and och1 mnn9) cells and MTLY60 strain cells. In some cases, the N-glycans were further treated with -1,2 mannosidase. Analysis was performed using DNA sequencer-assisted, fluorophore-assisted carbohydrate electrophoresis (DSA-FACE). M5, M6, M7, M8, and M9, refer to the number of mannose residues conjugated to the base N-acetylglucosamine structure. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard.

(8) FIGS. 8A-8E are schematic diagrams depicting the cloning strategy for S. cerevisiae MNS1 expression vector. PCR refers to polymerase chain reaction.

(9) FIG. 9 is a series of electroferograms depicting N-glycan analysis of secreted glycoproteins obtained from MTLY60 cells expressing wild-type (WT) Mns1p or various mutant forms (i.e., R273G, R273L, or R269S/S272G/R273L) of Mns1p as indicated. Analysis was performed using DSA-FACE. M5, M6, M7, M8, M9, refers to the number of mannose residues conjugated to the base N-acetylglucosamine structure. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard.

(10) FIG. 10 is a schematic diagram depicting the cloning strategy for an MNN4 expression vector.

(11) FIG. 11 is a series of electroferograms depicting N-glycan analysis of secreted glycoproteins obtained from wild-type MTLY60 cells or glycosylation mutant cells as indicated. Analysis was performed using DSA-FACE. M5, M6, M7, M8, M9, refers to the number of mannose residues conjugated to the chitobiose core structure. P refers to mannoproteins containing one phosphate residue and PP refers to mannoproteins containing two phosphate residues. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard.

(12) FIGS. 12A-12H are schematic diagrams depicting the cloning strategy for an -galactosidase expression vector. The nucleotide sequences set forth in SEQ ID NOs:76-81 are the oligonucleotides used in the cloning strategy in FIGS. 12A, 12C, and 12E.

(13) FIG. 13 is a series of electroferograms depicting N-glycan analysis of mannoproteins and phosphomannoproteins obtained from wild-type MTLY60 cells or various clones of glycosylation mutant cells as indicated. alg3 indicates that the cell is an ALG3 knockout. ALG6 overexpression indicates that the protein product of ALG6 is overexpressed in the cell. Analysis was performed using DSA-FACE. M5, M6, M7, M8, and M9, refer to the number of mannose residues conjugated to the base N-acetylglucosamine structure. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a polyacrylamide gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard.

(14) FIG. 14 is a series of electroferograms depicting N-glycan analysis of mannoproteins and phosphomannoproteins obtained from wild-type MTLY60 cells or various clones of glycosylation mutant cells as indicated. alg3 indicates that the cell is an ALG3 knockout. ALG6 overexpression indicates that the protein product of ALG6 is overexpressed in the cell. One peak runs at the same position as Man.sub.5GlcNAc.sub.2 of the RNaseB marker and shifts with two glucose-units after -1,2-mannosidase treatment and with 4 glucose-units after alpha-mannosidase (JB) digest. This fits with a Man.sub.5GlcNAc.sub.2 structure as expected. The additional two peaks run at a distance of about one and two glyco-units and are not affected by -1,2-mannosidase digestion. Both peaks shift one glucose-unit upon -mannosidase (JB) digestion. Minor shifts are due to the higher salt concentrations of the added enzymes, e.g. JB mannosidase. Analysis was performed using DSA-FACE. M5, M6, M7, M8, and M9, refer to the number of mannose residues conjugated to the chitobiose core structure. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard.

(15) FIG. 15 is a sequence alignment of an isolated DNA fragment (SEQ ID NO:1) sequence obtained from the unfolded protein response (UPR)-induced strain Yarrowia lipolytica with a genomic HAC1 DNA sequence (SEQ ID NO:5). The boxed sequence corresponds to the non-conventionally spliced intron.

(16) FIG. 16 is a series of sequence alignments of the predicted 5 (top) and 3 (bottom) splice sites of Pichia pastoris (SEQ ID NO:70 and SEQ ID NO:72) and Saccharomyces cerevisiae (SEQ ID NO: 71 and SEQ ID NO:73). Nucleotides in bold underlined are present in the loop structure.

(17) FIGS. 17A and 17B are two partial views of a sequence alignment of the HAC1 cDNA obtained from DTT-induced (I) (SEQ ID NO:2) and non-induced (NI) (SEQ ID NO:6) Pichia pastoris cultures.

(18) FIG. 18 is a sequence alignment of the 18 amino acid C-terminal regions of Pichia pastoris (SEQ ID NO:74) and Saccharomyces cerevisiae (SEQ ID NO:75). Conserved amino acids are in bold and underlined.

(19) FIG. 19 is a bar graph depicting the comparison of the relative expression levels of KAR2 mRNA. Clones 3, 4, and 5 (Pichia pastoris GSM5 cells) were grown on methanol as carbon source. 3+, 4+, and 5+ refer to the respective clones grown on methanol as carbon source, whereas 3, 4, and 5 refer to the respective clones grown on glucose as carbon source. The Y-axis represents the relative expression of the KAR2 gene using real-time PCR.

(20) FIG. 20 is a bar graph depicting the relative expression level of Kar2 and HAC1 mRNA in two Pichia pastoris clones (clone 6 and 8). 6+ and 8+ refer to the respective clones grown on methanol as carbon source, whereas 6- and 8- refer to the respective clones grown on glucose as carbon source. The Y-axis represents the relative expression of the KAR2 gene using real-time PCR.

(21) FIG. 21 is a schematic diagram depicting the cloning strategy for a YlMNN6 expression vector.

(22) FIG. 22 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from och1 Y. lipolytica cells, alone, or various clones (Z3, Z4, Z5, U5, U6, and U8) of och1 Y. lipolytica expressing YlMNN6 as indicated. Analysis was performed using DSA-FACE. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard.

(23) FIG. 23 is a schematic diagram depicting the cloning strategy for an MFManHDEL expression vector.

(24) FIG. 24 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from och1 Y. lipolytica cells, alone, or various clones (9, 11, 10, 3, 5, and 6) of och1 Y. lipolytica expressing MFManHDEL as indicated. Analysis was performed using DSA-FACE. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard.

(25) FIGS. 25A and 25B are schematic diagrams depicting the cloning strategy for an LIP2preManHDEL expression vector.

(26) FIG. 26 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from och1 Y. lipolytica cells, alone, or various clones (1, 5, 10, and 11) of och1 Y. lipolytica expressing LIP2ManHDEL as indicated. Analysis was performed using DSA-FACE. M5, M6, M7, M8, and M9, refer to the number of mannose residues conjugated to the chitobiose core structure. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard.

(27) FIGS. 27A and 27B are amino acid sequences of HAC1 proteins of Yarrowia lipolytica (FIG. 27A; SEQ ID NO:3) and Pichia pastoris (FIG. 27B; SEQ ID NO:4).

(28) FIG. 28 is a photograph of a Coomassie blue stained polyacrylamide gel depicting the results of Lip2p overexpression in various Yarrowia lipolytica cell (MTLY60, MTLY60alg3 and MTLY60alg3ALG6) cultures. The following samples were resolved in the gel: Lane 1 (ladder), a combination of proteins of known molecular weight; Lane 2 (WT), Lip2p protein obtained from WT Yarrowia lipolytica cells (MTLY60) overexpressing Lip2p; Lane 3 (WT+PGase F), Lip2p protein obtained from WT Yarrowia lipolytica cells overexpressing Lip2p and treated with PNGase F enzyme; Lane 4 (alg3-ALG6), Lip2p protein obtained from Yarrowia cells deficient in alg3 and overexpressing both Lip2p and ALG6 (MTLY60alg3ALG6); Lane 5 (alg3-ALG6+PNGase F), Lip2p protein obtained from Yarrowia cells deficient in alg3 and overexpressing both Lip2p and ALG6 (MTLY60alg3ALG6) and treated with PNGase F enzyme; Lane 6 (alg3), Lip2p protein obtained from Yarrowia lipolytica cells deficient in alg3 and overexpressing Lip2p (MTLY60alg3); Lane 7 (alg3+PNGase F), Lip2p protein obtained from Yarrowia lipolytica cells deficient in alg3 and overexpressing Lip2p (MTLY60alg3) treated with PNGase F enzyme; Lane 8 (WT without Lip2p overexpression), protein obtained from MTLY60 cells; and Lane 9 (WT without Lip2p overexpression+PNGase F), protein obtained from MTLY60 cells and treated with PNGase F enzyme.

(29) FIG. 29 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from various Yarrowia lipolytica cells (WT (MTLY60); alg3; alg3 ALG6 overexpressing; and clones of alg3 overexpressing ALG6 along with the alpha subunit of glucosidase II from Y. lipolytica (Yl) or Typanosoma brucei (Tb)) as indicated. Analysis was performed using DSA-FACE. M5, M6, M7, M8, and M9, refer to the number of mannose residues conjugated to the chitobiose core structure. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard. The bottom electroferogram is an analysis of RNAse B.

(30) FIG. 30 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from various Yarrowia lipolytica cells (alg3; alg3 ALG6 overexpressing; and clones of alg3 overexpressing ALG6 along with the alpha subunit of glucosidase II from Y. lipolytica (Yl) containing an HDEL sequence as indicated. Analysis was performed using DSA-FACE. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel.

(31) FIG. 31 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from various Yarrowia lipolytica cells (alg3; alg3 ALG6 overexpressing; and clones of alg3 overexpressing ALG6 along with the alpha subunit of glucosidase II from Trypanosoma brucei (Tb) containing an HDEL sequence) as indicated. Analysis was performed using DSA-FACE. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel.

(32) FIG. 32 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from alg3ALG6 Yarrowia lipolytica cells treated in vitro with different concentrations of mutanase as indicated. Analysis was performed using DSA-FACE. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard. The bottom electroferogram is an analysis of RNAse B.

(33) FIG. 33 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from various Yarrowia lipolytica cells (alg3; alg3 ALG6 overexpressing; and clones of alg3 overexpressing ALG6 along with the alpha subunit of glucosidase II from Y. lipolytica (Y.l.) and the beta subunit of glucosidase II from Y.l. expressed under the control of Hp4d or TEF promoters) as indicated. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard. The bottom electroferogram is an analysis of RNAse B.

(34) FIG. 34 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from various Yarrowia lipolytica cells (alg3 ALG6 overexpressing; and clones of alg3 overexpressing ALG6 along with the HDEL-containing alpha subunit of glucosidase II from Y. lipolytica (Y.l.) and the beta subunit of glucosidase II from Y.l. expressed under the control of Hp4d or TEF promoters) as indicated. Analysis was performed using DSA-FACE. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard. The bottom electroferogram is an analysis of RNAse B.

(35) FIG. 35 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from various Yarrowia lipolytica cells (alg3 and clones of alg3 overexpressing the alpha subunit of glucosidase II from Y. lipolytica (Y.l.) and the beta subunit of glucosidase II from Y.l. expressed under the control of a TEF promoter) as indicated. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard. The bottom electroferogram is an analysis of RNAse B.

(36) FIGS. 36A and 36B is the depiction of a nucleotide sequence of a cDNA encoding a mature form of Aspergillus niger (lacking signal peptide) glucosidase II , which is codon-optimized cDNA for expression in Yarrowia lipolytica. (SEQ ID NO:7).

(37) FIG. 37 is the depiction of a nucleotide sequence of a cDNA encoding a mature form of Aspergillus niger (lacking signal peptide) glucosidase II , which is codon-optimized cDNA for expression in Yarrowia lipolytica. (SEQ ID NO:8).

(38) FIG. 38 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from various Yarrowia lipolytica cells (alg3 and ALG6 overexpressing along with the alpha subunit of glucosidase II from Aspergillus niger (An) expressed under the control of a TEF or hp4d promoter) as indicated. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of oligomaltose for use as a mobility standard. The bottom electroferogram is an analysis of RNAse B.

(39) FIGS. 39A and 39B are a pair of bar graphs depicting the relative expression level (Y-axis) of the HAC1 (39A) or KAR (39B) gene in WT (MTLY60) Yarrowia lipolytica cells or in two clones (clone 7 and clone 2) of Yarrowia lipolytica cells containing a spliced form of HAC1 cDNA under the expression control of the hp4d promoter.

(40) FIG. 40 is line graph depicting the growth of wild type Pichia pastoris GS115 cells transformed with an empty vector as compared to the growth of Pichia pastoris GS115 cells expressing the Hac1p protein.

(41) FIG. 41 is a photograph of a Coomassie blue stained polyacrylamide gel comparing the expression level of the murine IL-10 (mIL-10) protein from a culture of Pichia pastoris GS115 cell cells expressing mIL-10 protein with the expression of the mIL-10 protein obtained from a culture of GS115 cells expressing mIL-10 and the spliced HAC1 protein from Pichia pastoris under the control of an inducible promoter, AOX1. The following samples were resolved in the gel: Lane 1 (ladder), a combination of proteins of known molecular weight; Lane 2 (Reference), protein obtained from the reference mIL-10 expressing Pichia pastoris strain (GS115); Lane 3 (Reference), protein obtained from the reference mIL-10 expressing Pichia pastoris strain after PNGase F enzyme treatment of the proteins; Lane 4 (Clone 1), protein obtained from a mIL-10 expressing Pichia pastoris cells inducibly expressing HAC1 protein; Lane 5 (Clone 1), protein obtained from a mIL-10 expressing Pichia pastoris cells inducibly expressing HAC1 protein after treatment of the protein with PNGase F enzyme; Lane 6 (Clone 2), protein obtained from a mIL-10 expressing Pichia pastoris cells inducibly expressing HAC1 protein 1; Lane 7 (Clone 2), protein obtained from a mIL-10 expressing Pichia pastoris cells inducibly expressing HAC1 protein after treatment of the proteins with PNGase F enzyme.

(42) FIG. 42 is the depiction of a nucleotide sequence of an exemplary cDNA sequence encoding a Trichoderma reesei -1,2 mannosidase, codon optimized for expression in Yarrowia lipolytica (SEQ ID NO:9) containing the LIP2 pre signal sequence.

(43) FIG. 43 is the depiction of a nucleotide sequence of an exemplary nucleotide sequence for the GAP promoter of Yarrowia lipolytica. (SEQ ID NO:10).

(44) FIGS. 44A-44C are the depiction of a nucleotide sequence of an exemplary nucleic acid sequence (SEQ ID NO:11) for the expression vector pYLHUXdL2preManHDEL, which contains a cDNA sequence encoding a Trichoderma reesei -1,2 mannosidase, codon optimized for expression in Yarrowia lipolytica and containing the LIP2 pre signal sequence.

(45) FIGS. 45A-45C are the depiction of a nucleotide sequence of an exemplary nucleic acid sequence (SEQ ID NO:12) for the expression vector pYLGUXdL2preManHDEL, which contains a cDNA sequence encoding a Trichoderma reesei -1,2 mannosidase, codon optimized for expression in Yarrowia lipolytica and containing the LIP2 pre signal sequence.

(46) FIGS. 46A-46C are the depiction of a nucleotide sequence of an exemplary nucleic acid sequence (SEQ ID NO:13) for the expression vector pYLPUXdL2preManHDEL, which contains a cDNA sequence encoding a Trichoderma reesei -1,2 mannosidase, codon optimized for expression in Yarrowia lipolytica and containing the LIP2 pre signal sequence.

(47) FIGS. 47A-47C are the depiction of a nucleotide sequence of an exemplary nucleic acid sequence (SEQ ID NO:14) for the expression vector pYLTUXdL2preManHDEL, which contains a cDNA sequence encoding a Trichoderma reesei -1,2 mannosidase, codon optimized for expression in Yarrowia lipolytica and containing the LIP2 pre signal sequence.

(48) FIG. 48 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from Yarrowia lipolytica cells transformed with different expression vectors as indicated: hp4dL2ManHDEL (pYLHUXdL2preManHDEL, FIGS. 44A-44C); GAPL2ManHDEL (pYLGUXdL2preManHDEL, FIGS. 45A-45C); TEF1L2ManHDEL (pYLTUXdL2preManHDEL, FIGS. 47A-47C). The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of dextran for use as a mobility standard. The second electroferogram in the series is an analysis of RNAse B.

(49) FIG. 49 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from Yarrowia lipolytica MTLY60 och1 cells containing a stably integrated expression vector pYLTUXdL2preManHDEL (FIGS. 47A-47C). Glycoprotein samples were obtained from cell cultures at 24, 48, 72, and 96 hours. The top electroferogram is an analysis of dextran for use as a mobility standard. The second electroferogram in the series is an analysis of RNAse B.

(50) FIG. 50 is an exemplary nucleic acid sequence for human glucocerebrosidase (GLCM, Swiss Prot entry nr: P04062; SEQ ID NO:15), which was chemically synthesized as a codon-optimized cDNA for expression in Yarrowia lipolytica.

(51) FIG. 51 is a photograph of an immunoblot depicting the mobility pattern of human glucocerebrosidase expressed in Yarrowia lipolytica strains MTLY60 (WT; lanes 4 and 6) and MTLY60och1 (och1; first three lanes). The molecular weight (kDa) of the proteins is depicted, by way of molecular weight markers, at the far right of the immunoblot.

(52) FIG. 52 is an exemplary nucleic acid sequence for human erythropoietin (Epo, Swiss Prot entry nr: P01588; SEQ ID NO:16), which was chemically synthesized as a codon-optimized cDNA for expression in Yarrowia lipolytica.

(53) FIG. 53 is an exemplary nucleic acid sequence for human -galactosidase A (AGAL, Swiss Prot entry nr: P06280; SEQ ID NO:17), which was chemically synthesized as a codon-optimized cDNA for expression in Yarrowia lipolytica.

(54) FIG. 54 is a series of electron micrographs of wild type Pichia pastoris cells or Pichia pastoris cells overexpressing the spliced form of Hac1p protein. Discrete regions of stacked lipid membranes in the cells are boxed.

(55) FIG. 55 is a series of electroferograms depicting N-glycan analysis of glycoproteins obtained from WT Yarrowia lipolytica cells (pol1d) and Yarrowia lipolytica cells expressing a fusion protein of alpha-1,2-mannosidase and a HDEL sequence as indicated. Analysis was performed using DSA-FACE. M5, M6, M7, M8, and M9, refer to the number of mannose residues conjugated to the chitobiose core structure. The Y-axis represents the relative fluorescence units as an indication of the amount of each of the mannose structures. The X-axis represents the relative mobility of each complex mannose structure through a gel. The top electroferogram is an analysis of RNAse B. The bottom electroferogram is an analysis of oligomaltose for use as a mobility standard.

DETAILED DESCRIPTION

(56) The methods and genetically engineered cells described herein can be used to produce target molecules (e.g., target protein or target dolichol) having an altered N-glycosylation form as compared to the N-glycosylation form of the target molecules produced in non-genetically engineered cells. Administration of glycosylated target molecules (e.g., glycosylated proteins) to patients having metabolic disorders (e.g., lysosomal storage disorders) has been shown to ameliorate the symptoms of the disorders. Thus, the methods and cells described are useful for the preparation of altered N-glycosylated target molecules for, inter alia, the treatment of metabolic disorders such as lysosomal storage disorders. Such altered N-glycosylation molecules are also useful in a wide-variety of other fields, e.g., the food and beverage industries; the pharmaceutical industry (e.g., as vaccines); the agriculture industry; and the chemical industry, to name a few.

(57) Altered N-Glycosylation Molecule

(58) Target molecules, as used herein, refer to any molecules that undergo altered N-glycosylation by one or more N-glycosylation activities from a genetically engineered cell (e.g., a fungal cell such as Yarrowia lipolytica or Arxula adeninivorans (or other related species dimorphic yeast) cell; a plant cell, or an animal cell). In some embodiments, the target molecules are capable of being trafficked through one or more steps of the Yarrowia lipolytica or Arxula adeninivorans (or other related species dimorphic yeast) secretory pathway, resulting in their altered N-glycosylation by the host cell machinery. The target molecules can be endogenous or exogenous.

(59) Target proteins, their biologically active fragments, or biologically active variants thereof, can include proteins containing additions, deletions, or substitutions as described above. Suitable target proteins include pathogen proteins (e.g., tetanus toxoid; diptheria toxoid; viral surface proteins (e.g., cytomegalovirus (CMV) glycoproteins B, H and gCIII; human immunodeficiency virus 1 (HIV-1) envelope glycoproteins; Rous sarcoma virus (RSV) envelope glycoproteins; herpes simplex virus (HSV) envelope glycoproteins; Epstein Barr virus (EBV) envelope glycoproteins; varicella-zoster virus (VZV) envelope glycoproteins; human papilloma virus (HPV) envelope glycoproteins; Influenza virus glycoproteins; and Hepatitis family surface antigens), lysosomal proteins (e.g., glucocerebrosidase, cerebrosidase, or galactocerebrosidase), insulin, glucagon, growth factors, cytokines, chemokines, antibodies or fragments thereof, or fusions of any of the proteins to antibodies or fragments of antibodies (e.g., protein-Fc). Growth factors include, e.g., vascular endothelial growth factor (VEGF), Insulin-like growth factor (IGF), bone morphogenic protein (BMP), Granulocyte-colony stimulating factor (G-CSF), Granulocyte-macrophage colony stimulating factor (GM-CSF), Nerve growth factor (NGF); a Neurotrophin, Platelet-derived growth factor (PDGF), Erythropoietin (EPO), Thrombopoietin (TPO), Myostatin (GDF-8), Growth Differentiation factor-9 (GDF9), basic fibroblast growth factor (bFGF or FGF2), Epidermal growth factor (EGF), Hepatocyte growth factor (HGF). Cytokines include, e.g., interleukins (e.g., IL-1 to IL-33 (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, or IL-15)). Chemokines include, e.g., 1-309, TCA-3, MCP-1, MIP-1, MIP-1, RANTES, C10, MRP-2, MARC, MCP-3, MCP-2, MRP-2, CCF18, MIP-1, Eotaxin, MCP-5, MCP-4, NCC-1, Ck10, HCC-1, Leukotactin-1, LEC, NCC-4, TARC, PARC, or Eotaxin-2. Also included are tumor glycoproteins (e.g., tumor-associated antigens), for example, carcinoembryonic antigen (CEA), human mucins, HER-2/neu, and prostate-specific antigen (PSA) [R. A. Henderson and O. J. Finn, Advances in Immunology, 62, pp. 217-56 (1996)]. In some embodiments, the target protein can be one associated with a lysosomal storage disorder, which target proteins include, e.g., alpha-L-iduronidase, beta-D-galactosidase, beta-glucosidase, beta-hexosaminidase, beta-D-mannosidase, alpha-L-fucosidase, arylsulfatase B, arylsulfatase A, alpha-N-acetylgalactosaminidase, aspartylglucosaminidase, iduronate-2-sulfatase, alpha-glucosaminide-N-acetyltransferase, beta-D-glucoronidase, hyaluronidase, alpha-L-mannosidase, alpha-neuraminidase, phosphotransferase, acid lipase, acid ceramidase, sphingomyelinase, thioesterase, cathepsin K, and lipoprotein lipase.

(60) Target proteins can also be fusion proteins. Fusions proteins include, e.g., a fusion of (i) any protein described herein or fragment thereof with (ii) an antibody or fragment thereof. As used herein, the term antibody fragment refers to an antigen-binding fragment, e.g., Fab, F(ab).sub.2, Fv, and single chain Fv (scFv) fragments. An scFv fragment is a single polypeptide chain that includes both the heavy and light chain variable regions of the antibody from which the scFv is derived. In addition, diabodies [Poljak (1994) Structure 2(12):1121-1123; Hudson et al. (1999) J. Immunol. Methods 23(1-2):177-189, the disclosures of both of which are incorporated herein by reference in their entirety] and intrabodies [Huston et al. (2001) Hum. Antibodies 10(3-4):127-142; Wheeler et al. (2003) Mol. Ther. 8(3):355-366; Stocks (2004) Drug Discov. Today 9(22): 960-966, the disclosures of all of which are incorporated herein by reference in their entirety] can be used in the methods of the invention.

(61) Target proteins can also be joined to one or more of a polymer, a carrier, an adjuvant, an immunotoxin, or a detectable (e.g., fluorescent, luminescent, or radioactive) moiety. For example, a target protein can be joined to polyethyleneglycol, which polymer moiety can be used, e.g., to increase the molecular weight of small proteins and/or increase circulation residence time.

(62) In some embodiments, the target molecule can be, or contain, dolichol.

(63) Genetically Engineered Cells

(64) Described herein are genetically engineered cells having at least one modified N-glycosylation activity, which cells are useful for the production of one or more target molecules having an altered N-glycosylation form. Cells suitable for genetic engineering include, e.g., fungal cells (e.g., Yarrowia lipolytica or any other related dimorphic yeast cells described herein), plant cells, or animal cells (e.g., (nematode, insect, plant, bird, reptile, or mammal (e.g., a mouse, rat, rabbit, hamster, gerbil, dog, cat, goat, pig, cow, horse, whale, monkey, or human)). The cells can be primary cells, immortalized cells, or transformed cells. The cells can be those in an animal, e.g., a non-human mammal. Such cells, prior to the genetic engineering as specified herein, can be obtained from a variety of commercial sources and research resource facilities, such as, for example, the American Type Culture Collection (Rockville, Md.). Target molecules include proteins such as any of the target proteins described herein (see above). Target molecules also include dolichol.

(65) Genetic engineering of a cell includes genetic modifications such as: (i) deletion of an endogenous gene encoding a protein having N-glycosylation activity; (ii) introduction of a recombinant nucleic acid encoding a mutant form of a protein (e.g., endogenous or exogenous protein) having N-glycosylation activity (i.e., expressing a mutant protein having an N-glycosylation activity); (iii) introduction or expression of an RNA molecule that interferes with the functional expression of a protein having the N-glycosylation activity; (iv) introduction of a recombinant nucleic acid encoding a wild-type (e.g., endogenous or exogenous) protein having N-glycosylation activity (i.e., expressing a protein having an N-glycosylation activity); or (v) altering the promoter or enhancer elements of one or more endogenous genes encoding proteins having N-glycosylation activity to thus alter the expression of their encoded proteins. RNA molecules include, e.g., small-interfering RNA (siRNA), short hairpin RNA (shRNA), anti-sense RNA, or micro RNA (miRNA). It is understood that item (ii) includes, e.g., replacement of an endogenous gene (e.g., by homologous recombination) with a gene encoding a protein having greater N-glycosylation activity relative to the endogenous gene so replaced. Genetic engineering also includes altering an endogenous gene encoding a protein having an N-glycosylation activity to produce a protein having additions (e.g., a heterologous sequence), deletions, or substitutions (e.g., mutations such as point mutations; conservative or non-conservative mutations). Mutations can be introduced specifically (e.g., site-directed mutagenesis or homologous recombination; see accompanying Examples) or can be introduced randomly (for example, cells can be chemically mutagenized as described in, e.g., Newman and Ferro-Novick (1987) J. Cell Biol. 105(4):1587, the disclosure of which is incorporated herein by reference in its entirety.

(66) The genetic modifications described herein can result in one or more of (i) an increase in one or more N-glycosylation activities in the genetically modified cell, (ii) a decrease in one or more N-glycosylation activities in the genetically modified cell, (iii) a change in the localization or intracellular distribution of one or more N-glycosylation activities in the genetically modified cell, or (iv) a change in the ratio of one or more N-glycosylation activities in the genetically modified cell. It is understood that an increase in the amount of an N-glycosylation activity can be due to overexpression of one or more proteins having N-glycosylation activity, an increase in copy number of an endogenous gene (e.g., gene duplication), or an alteration in the promoter or enhancer of an endogenous gene that stimulates an increase in expression of the protein encoded by the gene. A decrease in one or more N-glycosylation activities can be due to overexpression of a mutant form (e.g., a dominant negative form) of one or more proteins having N-glycosylation altering activities, introduction or expression of one or more interfering RNA molecules that reduce the expression of one or more proteins having an N-glycosylation activity, or deletion of one or more endogenous genes that encode a protein having N-glycosylation activity.

(67) Methods of deleting or disrupting one or more endogenous genes are described in the accompanying Examples. For example, to disrupt a gene by homologous recombination, a gene replacement vector can be constructed in such a way to include a selectable marker gene. The selectable marker gene can be operably linked, at both 5 and 3 end, to portions of the gene of sufficient length to mediate homologous recombination. The selectable marker can be one of any number of genes which either complement host cell auxotrophy or provide antibiotic resistance, including URA3, LEU2 and HIS3 genes. Other suitable selectable markers include the CAT gene, which confers chloramphenicol resistance to yeast cells, or the lacZ gene, which results in blue colonies due to the expression of -galactosidase. Linearized DNA fragments of the gene replacement vector are then introduced into the cells using methods well known in the art (see below). Integration of the linear fragments into the genome and the disruption of the gene can be determined based on the selection marker and can be verified by, for example, Southern blot analysis.

(68) As detailed in the accompanying examples, subsequent to its use in selection, a selectable marker can be removed from the genome of the host cell by, e.g., Cre-loxP systems (see below).

(69) Alternatively, a gene replacement vector can be constructed in such a way as to include a portion of the gene to be disrupted, which portion is devoid of any endogenous gene promoter sequence and encodes none or an inactive fragment of the coding sequence of the gene. An inactive fragment is a fragment of the gene that encodes a protein having, e.g., less than about 10% (e.g., less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, or 0%) of the activity of the protein produced from the full-length coding sequence of the gene. Such a portion of the gene is inserted in a vector in such a way that no known promoter sequence is operably linked to the gene sequence, but that a stop codon and a transcription termination sequence are operably linked to the portion of the gene sequence. This vector can be subsequently linearized in the portion of the gene sequence and transformed into a cell. By way of single homologous recombination, this linearized vector is then integrated in the endogenous counterpart of the gene.

(70) Expression vectors can be autonomous or integrative.

(71) A recombinant nucleic acid (e.g., one encoding a wild-type or mutant form of a protein having N-glycosylation activity) can be in introduced into the cell in the form of an expression vector such as a plasmid, phage, transposon, cosmid or virus particle. The recombinant nucleic acid can be maintained extrachromosomally or it can be integrated into the yeast cell chromosomal DNA. Expression vectors can contain selection marker genes encoding proteins required for cell viability under selected conditions (e.g., URA3, which encodes an enzyme necessary for uracil biosynthesis or TRP1, which encodes an enzyme required for tryptophan biosynthesis) to permit detection and/or selection of those cells transformed with the desired nucleic acids (see, e.g., U.S. Pat. No. 4,704,362). Expression vectors can also include an autonomous replication sequence (ARS). For example, U.S. Pat. No. 4,837,148 describes autonomous replication sequences which provide a suitable means for maintaining plasmids in Pichia pastoris. The disclosure of U.S. Pat. No. 4,837,148 is incorporated herein by reference in its entirety.

(72) Integrative vectors are disclosed, e.g., in U.S. Pat. No. 4,882,279 (the disclosure of which is incorporated herein by reference in its entirety). Integrative vectors generally include a serially arranged sequence of at least a first insertable DNA fragment, a selectable marker gene, and a second insertable DNA fragment. The first and second insertable DNA fragments are each about 200 (e.g., about 250, about 300, about 350, about 400, about 450, about 500, or about 1000 or more) nucleotides in length and have nucleotide sequences which are homologous to portions of the genomic DNA of the species to be transformed. A nucleotide sequence containing a gene of interest (e.g., a gene encoding a protein having N-glycosylation activity) for expression is inserted in this vector between the first and second insertable DNA fragments whether before or after the marker gene. Integrative vectors can be linearized prior to yeast transformation to facilitate the integration of the nucleotide sequence of interest into the host cell genome.

(73) An expression vector can feature a recombinant nucleic acid under the control of a yeast (e.g., Yarrowia lipolytica, Arxula adeninivorans, or other related dimorphic yeast species) promoter, which enables them to be expressed in yeast. Suitable yeast promoters include, e.g., ADC1, TPI1, ADH2, hp4d, POX, and Gal10 (see, e.g., Guarente et al. (1982) Proc. Natl. Acad. Sci. USA 79(23):7410) promoters. Additional suitable promoters are described in, e.g., Zhu and Zhang (1999) Bioinformatics 15(7-8):608-611 and U.S. Pat. No. 6,265,185, the disclosures of each of which are incorporated herein by reference in their entirety. Where the expression vector is to be introduced into an animal cell, such as a mammalian cell, the expression vector can feature a recombinant nucleic acid under the control of an animal cell promoter suitable for expression in the host cell of interest. Examples of mammalian promoters include, e.g., SV40 or cytomegalovirus (CMV) promoters.

(74) A promoter can be constitutive or inducible (conditional). A constitutive promoter is understood to be a promoter whose expression is constant under the standard culturing conditions. Inducible promoters are promoters that are responsive to one or more induction cues. For example, an inducible promoter can be chemically regulated (e.g., a promoter whose transcriptional activity is regulated by the presence or absence of a chemical inducing agent such as an alcohol, tetracycline, a steroid, a metal, or other small molecule) or physically regulated (e.g., a promoter whose transcriptional activity is regulated by the presence or absence of a physical inducer such as light or high or low temperatures). An inducible promoter can also be indirectly regulated by one or more transcription factors that are themselves directly regulated by chemical or physical cues.

(75) Genetic engineering of a cell also includes activating an endogenous gene (e.g., a gene encoding a protein having N-glycosylation activity) that is present in the host cell, but is normally not expressed in the cells or is not expressed at significant levels in the cells. For example, a regulatory sequence (e.g., a gene promoter or an enhancer) of a endogenous gene can be modified such that the operably-linked coding sequence exhibits increased expression. Homologous recombination or targeting can be used to replace or disable the regulatory region normally associated with the gene with a regulatory sequence which causes the gene to be expressed at levels higher than evident in the corresponding non-genetically engineered cell, or causes the gene to display a pattern of regulation or induction that is different than evident in the corresponding non-genetically engineered cell. Suitable methods for introducing alterations of a regulatory sequence (e.g., a promoter or enhancer) of a gene are described in, e.g., U.S. Application Publication No. 20030147868, the disclosure of which is incorporated herein by reference in its entirety.

(76) It is understood that other genetically engineered modifications can also be conditional. For example, a gene can be conditionally deleted using, e.g., a site-specific DNA recombinase such as the Cre-loxP system (see, e.g., Gossen et al. (2002) Ann. Rev. Genetics 36:153-173 and U.S. Application Publication No. 20060014264, the disclosures of each of which are incorporated by reference in their entirety).

(77) A recombinant nucleic acid can be introduced into a cell described herein using a variety of methods such as the spheroplast technique or the whole-cell lithium chloride yeast transformation method. Other methods useful for transformation of plasmids or linear nucleic acid vectors into cells are described in, for example, U.S. Pat. No. 4,929,555; Hinnen et al. (1978) Proc. Nat. Acad. Sci. USA 75:1929; Ito et al. (1983) J. Bacteriol. 153:163; U.S. Pat. No. 4,879,231; and Sreekrishna et al. (1987) Gene 59:115, the disclosures of each of which are incorporated herein by reference in their entirety. Electroporation and PEG1000 whole cell transformation procedures may also be used, as described by Cregg and Russel, Methods in Molecular Biology: Pichia Protocols, Chapter 3, Humana Press, Totowa, N.J., pp. 27-39 (1998), the disclosure of which is incorporated herein by reference in its entirety. Transfection of animal cells can feature, for example, the introduction of a vector to the cells using calcium phosphate, electroporation, heat shock, liposomes, or transfection reagents such as FUGENE or LIPOFECTAMINE, or by contacting naked nucleic acid vectors with the cells in solution (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual Second Edition vol. 1, 2 and 3. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y., USA, November 1989; the disclosure of which is incorporated herein by reference in its entirety).

(78) Transformed yeast cells can be selected for by using appropriate techniques including, but not limited to, culturing auxotrophic cells after transformation in the absence of the biochemical product required (due to the cell's auxotrophy), selection for and detection of a new phenotype, or culturing in the presence of an antibiotic which is toxic to the yeast in the absence of a resistance gene contained in the transformants. Transformants can also be selected and/or verified by integration of the expression cassette into the genome, which can be assessed by, e.g., Southern blot or PCR analysis.

(79) Prior to introducing the vectors into a target cell of interest, the vectors can be grown (e.g., amplified) in bacterial cells such as Escherichia coli (E. coli). The vector DNA can be isolated from bacterial cells by any of the methods known in the art which result in the purification of vector DNA from the bacterial milieu. The purified vector DNA can be extracted extensively with phenol, chloroform, and ether, to ensure that no E. coli proteins are present in the plasmid DNA preparation, since these proteins can be toxic to mammalian cells.

(80) Genetic engineering, as described herein, can be used to express (e.g., overexpress), introduce modifications into, or delete any number of genes, e.g., genes encoding proteins having N-glycosylation activity. Such genes include, e.g., ALG7, ALG13, ALG14, ALG1, ALG2, ALG11, RFT1, ALG3, ALG9, ALG12, ALG6, ALG8, ANLL, ALG10, ALG5, OST3, OST4, OST6, STT3, OST1, OST5, WBP1, SWP1, OST2, DPMI, SEC59, OCH1, MNN9, VAN1, MNN8, MNN10, MNN11, HOC1, MNN2, MNN5, MNN6, KTR1, YURI, MNN4, KRE2, KTR2, KTR3, MNN1, MNS1, PNO1, MNN9, glucosidase I, glucosidase II, or endomannosidase. The genes encoding proteins having N-glycosylation activity can be from any species (e.g., lower eukaryotes (e.g., fungus (including yeasts) or trypanosomes), plant, or animal (e.g., insect, bird, reptile, or mammal (e.g., a rodent such as mouse or rat, dog, cat, horse, goat, cow, pig, non-human primate, or human)) containing such genes. Exemplary fungal species from which genes encoding proteins having N-glycosylation activity can be obtained include, without limitation, Pichia anomala, Pichia bovis, Pichia canadensis, Pichia carsonii, Pichia farinose, Pichia fermentans, Pichia fluxuum, Pichia membranaefaciens, Pichia membranaefaciens, Candida valida, Candida albicans, Candida ascalaphidarum, Candida amphixiae, Candida Antarctica, Candida atlantica, Candida atmosphaerica, Candida blattae, Candida carpophila, Candida cerambycidarum, Candida chauliodes, Candida corydalis, Candida dosseyi, Candida dubliniensis, Candida ergatensis, Candida fructus, Candida glabrata, Candida fermentati, Candida guilliermondii, Candida haemulonii, Candida insectamens, Candida insectorum, Candida intermedia, Candida jeffresii, Candida kefyr, Candida krusei, Candida lusitaniae, Candida lyxosophila, Candida maltosa, Candida membranifaciens, Candida milleri, Candida oleophila, Candida oregonensis, Candida parapsilosis, Candida quercitrusa, Candida shehatea, Candida temnochilae, Candida tenuis, Candida tropicalis, Candida tsuchiyae, Candida sinolaborantium, Candida sojae, Candida viswanathii, Candida utilis, Pichia membranaefaciens, Pichia silvestris, Pichia membranaefaciens, Pichia chodati, Pichia membranaefaciens, Pichia menbranaefaciens, Pichia minuscule, Pichia pastoris, Pichia pseudopolymorpha, Pichia quercuum, Pichia robertsii, Pichia saitoi, Pichia silvestrisi, Pichia strasburgensis, Pichia terricola, Pichia vanriji, Pseudozyma Antarctica, Rhodosporidium toruloides, Rhodotorula glutinis, Saccharomyces bayanus, Saccharomyces bayanus, Saccharomyces momdshuricus, Saccharomyces uvarum, Saccharomyces bayanus, Saccharomyces cerevisiae, Saccharomyces bisporus, Saccharomyces chevalieri, Saccharomyces delbrueckii, Saccharomyces exiguous, Saccharomyces fermentati, Saccharomyces fragilis, Saccharomyces marxianus, Saccharomyces mellis, Saccharomyces rosei, Saccharomyces rouxii, Saccharomyces uvarum, Saccharomyces willianus, Saccharomycodes ludwigii, Saccharomycopsis capsularis, Saccharomycopsis fibuligera, Saccharomycopsis fibuligera, Endomyces hordei, Endomycopsis fobuligera. Saturnispora saitoi, Schizosaccharomyces octosporus, Schizosaccharomyces pombe, Schwanniomyces occidentalis, Torulaspora delbrueckii, Torulaspora delbrueckii, Saccharomyces dairensis, Torulaspora delbrueckii, Torulaspora fermentati, Saccharomyces fermentati, Torulaspora delbrueckii, Torulaspora rosei, Saccharomyces rosei, Torulaspora delbrueckii, Saccharomyces rosei, Torulaspora delbrueckii, Saccharomyces delbrueckii, Torulaspora delbrueckii, Saccharomyces delbrueckii, Zygosaccharomyces mongolicus, Dorulaspora globosa, Debaryomyces globosus, Torulopsis globosa, Trichosporon cutaneum, Trigonopsis variabilis, Williopsis californica, Williopsis saturnus, Zygosaccharomyces bisporus, Zygosaccharomyces bisporus, Debaryomyces disporua. Saccharomyces bisporas, Zygosaccharomyces bisporus, Saccharomyces bisporus, Zygosaccharomyces mellis, Zygosaccharomyces priorianus, Zygosaccharomyces rouxiim, Zygosaccharomyces rouxii, Zygosaccharomyces barkeri, Saccharomyces rouxii, Zygosaccharomyces rouxii, Zygosaccharomyces major, Saccharomyces rousii, Pichia anomala, Pichia bovis, Pichia Canadensis, Pichia carsonii, Pichia farinose, Pichia fermentans, Pichia fluxuum, Pichia membranaefaciens, Pichia pseudopolymorpha, Pichia quercuum, Pichia robertsii, Pseudozyma Antarctica, Rhodosporidium toruloides, Rhodosporidium toruloides, Rhodotorula glutinis, Saccharomyces bayanus, Saccharomyces bayanus, Saccharomyces bisporus, Saccharomyces cerevisiae, Saccharomyces chevalieri, Saccharomyces delbrueckii, Saccharomyces fermentati, Saccharomyces fragilis, Saccharomycodes ludwigii, Schizosaccharomyces pombe, Schwanniomyces occidentalis, Torulaspora delbrueckii, Torulaspora globosa, Trigonopsis variabilis, Williopsis californica, Williopsis saturnus, Zygosaccharomyces bisporus, Zygosaccharomyces mellis, Zygosaccharomyces rouxii, or any other fungi (e.g., yeast) known in the art or described herein. Exemplary lower eukaryotes also include various species of Aspergillus including, but not limited to, Aspergillus caesiellus, Aspergillus candidus, Aspergillus carneus, Aspergillus clavatus, Aspergillus deflectus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus glaucus, Aspergillus nidulans, Aspergillus niger, Aspergillus ochraceus, Aspergillus oryzae, Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus restrictus, Aspergillus sojae, Aspergillus sydowii, Aspergillus tamari, Aspergillus terreus, Aspergillus ustus, or Aspergillus versicolor. Exemplary protozoal genera from which genes encoding proteins having N-glycosylation activity can be obtained include, without limitation, Blastocrithidia, Crithidia, Endotrypanum, Herpetomonas, Leishmania, Leptomonas, Phytomonas, Trypanosoma (e.g., T. bruceii, T. gambiense, T. rhodesiense, and T. cruzi), and Wallaceina.

(81) It is understood that genetic engineering, as described herein, can be used to express (e.g., overexpress), introduce modifications into, or delete any number of genes (e.g., genes encoding proteins having N-glycosylation activity) and/or any combination of one or more (e.g., two, three, four, five, six, seven, eight, nine, 10, 11, 12, 15, or 20 or more) of any of the genes recited herein.

(82) In some embodiments, the genetically engineered cell lacks the ALG3 (Genbank Accession Nos: XM_503488, Genolevures Ref: YALI0E03190g) gene or gene product (e.g., mRNA or protein) thereof. In some embodiments, the genetically engineered cell expresses (e.g., overexpresses) the ALG6 (Genbank Accession Nos: XM_502922, Genolevures Ref: YALI0D17028g) protein. In some embodiments, the genetically engineered cell expresses the MNN4 gene (Genbank Accession Nos: XM_503217, Genolevures Ref: YALI0D24101g). In some embodiments, the genetically engineered cell lacks the OCH1 and/or MNN9 gene or gene products (e.g., mRNA or protein) thereof. In some embodiments, the genetically engineered cell does not lack the OCH1 gene or a gene product (e.g., mRNA or protein) thereof. In some embodiments, the genetically engineered cell expresses an alpha or beta subunit (or both the alpha and the beta subunit) of a glucosidase II such as the glucosidase II of Yarrowia lipolytica or Trypanosoma brucei. In some embodiments, the genetically engineered cell expresses a mutantase such as the mutanase of T. harzianum. In some embodiments, the genetically engineered cell can have any combination of these modifications.

(83) For example, in some embodiments, the genetically engineered cell can lack the ALG3 (e.g., the ALG3 gene exemplified by Genbank Accession Nos: XM_503488, Genolevures Ref: YALI0E03190g) gene or gene product (e.g., mRNA or protein) thereof; can overexpress the ALG6 (e.g., the ALG6 as exemplified by Genbank Accession Nos: XM_502922, Genolevures Ref: YALI0D17028g) protein; can overexpress one or both of the alpha and the beta subunit of a glucosidase II (such as the glucosidase II of Yarrowia lipolytica, Trypanosoma brucei, or any other species described herein); can overexpress an alpha-1,2-mannosidase; and overexpress one or more (and any combination) of the following: a glycosidase, a glycosyltransferase, a sugar-nucleotide transporter, a sugar-nucleotide modifying enzyme. In some embodiments, the genetically engineered cell does not lack the OCH1 gene or a gene product (e.g., mRNA or protein) thereof.

(84) In some embodiments, the genetically modified cell can contain a mannosidase activity (e.g., an -mannosidase activity). The mannosidase activity can be targeted to the endoplasmic reticulum. The mannosidase can have a pH optimum at least below 7.5 (e.g., at least below 7.4, at least below 7.3, at least below 7.2, at least below 7.1, at least below 7.0, at least below 6.9, at least below 6.8, at least 6.7, at least below 6.6, at least below 6.5, at least 6.4, at least below 6.3, at least below 6.2, at least below 6.1, at least below 6.0, at least below 5.9, at least below 5.8, at least below 5.7, at least below 5.6, at least below 5.5, at least below 5.4, at least below 5.3, at least below 5.2, at least below 5.1, at least below 5.0, at least below 4.9, at least below 4.8, or at least below 4.7).

(85) The mannosidase can be MNS1.

(86) For example, the genetically engineered cell can overexpress a mannosidase (e.g., an alpha-1,2-mannosidase or any other mannosidase described herein), but not lack the OCH1 gene or a gene product (e.g., mRNA or protein) thereof. The mannosidase can be a wild-type form of the protein or can be a mutant form such as a fusion protein containing a mannosidase and an HDEL ER-retention amino acid sequence (see Examples). (It is understood that any protein having N-glycosylation activity can be engineered into a fusion protein comprising an HDEL sequence).

(87) In some embodiments, the genetically modified cell can contain an activity capable of promoting mannosyl phosphorylation of the altered N-glycosylation form of the target molecule. For example, a nucleic acid encoding an activity that promotes phosphorylation of N-glycans (e.g. MNN4, MNN6, PNO1) can be introduced in the genetically engineered cell, which cell is capable of increasing phosphorylating the N-glycosylation of the target molecule.

(88) In some embodiments, the genetically modified cell can contain an activity capable of removing mannose residues that cap phosphorylation (e.g., a mannosidase such as the one from Jack Bean) from the altered N-glycosylation molecules.

(89) In some embodiments, the genetically modified cell is capable of removing glucose residues from Man.sub.5GlcNAc.sub.2. For example, the genetically modified cell can overexpress a protein having -1,3-glucosidase activity such as, but not limited to, a mutanase or one or both of the alpha and beta subunit of a glucosidase II (such as the glucosidase II of Yarrowia lipolytica, Trypanosoma brucei, or any other fungal species described herein).

(90) In embodiments where a protein having N-glycosylation activity is derived from a cell that is of a different type (e.g., of a different species) than the cell into which the protein is to be expressed, a nucleic acid encoding the protein can be codon-optimized for expression in the particular cell of interest. For example, a nucleic acid encoding a protein having N-glycosylation from Trypanosoma brucei can be codon-optimized for expression in a yeast cell such as Yarrowia lipolytica. Such codon-optimization can be useful for increasing expression of the protein in the cell of interest. Methods for codon-optimizing a nucleic acid encoding a protein are known in the art and described in, e.g., Gao et al. (Biotechnol. Prog. (2004) 20(2): 443-448), Kotula et al. (Nat. Biotechn. (1991) 9, 1386-1389), and Bennetzen et al. (J. Biol. Chem. (1982) 257(6):2036-3031).

(91) A cell can also be genetically engineered to produce predominantly N-glycans that are intermediates of a mammalian (e.g., human) glycosylation pathway. For example, one or more nucleic acids encoding human proteins having N-glycosylation activity can be introduced into the cell. In some embodiments, human proteins can be introduced into the cell and one or more endogenous yeast proteins having N-glycosylation activity can be suppressed (e.g., deleted or mutated). Techniques for humanizing a fungal glycosylation pathway are described in, e.g., Choi et al. (2003) Proc. Natl. Acad. Sci. USA 100(9):5022-5027; Verveken et al. (2004) Appl. Environ. Microb. 70(5):2639-2646; and Gerngross (2004) Nature Biotech. 22(11):1410-1414, the disclosures of each of which are incorporated herein by reference in their entirety.

(92) Where the genetic engineering involves, e.g., changes in the expression of a protein or expression of an exogenous protein (including a mutant form of an endogenous protein), a variety of techniques can be used to determine if the genetically engineered cells express the protein. For example, the presence of mRNA encoding the protein or the protein itself can be detected using, e.g., Northern Blot or RT-PCR analysis or Western Blot analysis, respectively. The intracellular localization of a protein having N-glycosylation activity can be analyzed by using a variety of techniques, including subcellular fractionation and immunofluorescence.

(93) Additional genetic modifications and methods for introducing them into any of the cells described herein can be adapted from the disclosures of, e.g., U.S. Pat. Nos. 7,029,872; 5,272,070; and 6,803,225; and U.S. Application Publication Nos. 20050265988, 20050064539, 20050170452, and 20040018588, the disclosures of each of which are incorporated herein by reference in their entirety.

(94) While the engineering steps performed in dimorphic yeast species to achieve in vivo production of the Man.sub.5GlcNAc.sub.2 and Man.sub.3GlcNAc.sub.2 can be different from the engineering steps performed in other yeast species, it will be clear to those skilled in the art that the engineering techniques to produce modified glycoproteins (with the Man.sub.5GlcNAc.sub.2 and Man.sub.3GlcNAc.sub.2 core N-glycan structures) in dimorphic yeasts in vivo can be adapted by routine experimentation from the methods disclosed in, inter alia, U.S. Pat. No. 7,326,681 and U.S. Publication Nos. 20040018590, 20060040353, and 20060286637 (the disclosure of each of which is incorporated by reference in its entirety). The adapted methods can thus be used to achieve production of glycoproteins modified with human-type hybrid and complex N-glycans. These complex N-glycans can have 2 to 5 branches initiated with a GlcNAc residue onto the above-named core glycans, which can be further extended, e.g., with galactose, fucose and sialic acid residues.

(95) In some embodiments, the mutant or wild-type proteins having N-glycosylation activity can be isolated from the genetically engineered cells using standard techniques. For example, following the expression of a mutant or wild-type protein in the genetically engineered cell, the protein can be isolated from the cell itself or from the media in which the cell was cultured. Methods of isolating proteins are known in the art and include, e.g., liquid chromatography (e.g., HPLC), affinity chromatography (e.g., metal chelation or immunoaffinity chromatography), ion-exchange chromatography, hydrophobic-interaction chromatography, precipitation, or differential solubilization.

(96) In some embodiments, the isolated proteins having N-glycosylation activity can be frozen, lyophilized, or immobilized and stored under appropriate conditions, which allow the proteins to retain activity.

(97) The disclosure also provides a substantially pure culture of any of the genetically engineered cells described herein. As used herein, a substantially pure culture of a genetically engineered cell is a culture of that cell in which less than about 40% (i.e., less than about: 35%; 30%; 25%; 20%; 15%; 10%; 5%; 2%; 1%; 0.5%; 0.25%; 0.1%; 0.01%; 0.001%; 0.0001%; or even less) of the total number of viable cells in the culture are viable cells other than the genetically engineered cell, e.g., bacterial, fungal (including yeast), mycoplasmal, or protozoan cells. The term about in this context means that the relevant percentage can be 15% percent of the specified percentage above or below the specified percentage. Thus, for example, about 20% can be 17% to 23%. Such a culture of genetically engineered cells includes the cells and a growth, storage, or transport medium. Media can be liquid, semi-solid (e.g., gelatinous media), or frozen. The culture includes the cells growing in the liquid or in/on the semi-solid medium or being stored or transported in a storage or transport medium, including a frozen storage or transport medium. The cultures are in a culture vessel or storage vessel or substrate (e.g., a culture dish, flask, or tube or a storage vial or tube).

(98) The genetically engineered cells described herein can be stored, for example, as frozen cell suspensions, e.g., in buffer containing a cryoprotectant such as glycerol or sucrose, as lyophilized cells. Alternatively, they can be stored, for example, as dried cell preparations obtained, e.g., by fluidized bed drying or spray drying, or any other suitable drying method.

(99) Methods of Producing Altered N-Glycosylation Molecules

(100) Described herein are methods of producing an altered N-glycosylation form of a target molecule. The methods generally involve the step of contacting a target molecule with one or more N-glycosylation activities from a genetically engineered cell (e.g., a fungal cell (e.g., Yarrowia lipolytica, Arxula adeninivorans, or any other related dimorphic yeast cells described herein), a plant cell, or an animal cell (e.g., nematode, insect, plant, bird, reptile, or mammal (e.g., a mouse, rat, rabbit, hamster, gerbil, dog, cat, goat, pig, cow, horse, whale, monkey, or human)). The methods can be cell-based or non-cell based.

(101) Cell based methods can include the steps of introducing into a cell (e.g., a fungal cell (e.g., Yarrowia lipolytica, Arxula adeninivorans, or any other related dimorphic yeast cells described herein), a plant cell, or an animal cell) genetically engineered to have at least one modified N-glycosylation activity a nucleic acid encoding a target molecule subject to N-glycosylation in the cell, wherein the cell produces the target molecule in an altered N-glycosylation form. The target molecule can be, e.g., a protein such as any of the target proteins described herein. In embodiments where the target protein is a lipid, the nucleic acid can be one encoding one or more enzymes which promote the synthesis of the lipid.

(102) The types of modifications produced by the genetic engineering of the cells are described herein (see the accompanying Examples and Genetically Engineered Cells above).

(103) Methods for introducing a nucleic acid are known in the art and are described in the accompanying Examples and above.

(104) Introduction or expression of a target molecule (e.g., a target protein) into a genetically engineered cell can result in the trafficking of the target molecule through the endoplasmic reticulum and/or Golgi apparatus of the cell, thereby producing an altered N-glycosylation form of the target molecule.

(105) Following the processing of the target molecule (e.g., in the genetically modified cell), the altered N-glycosylation form of the target molecule (e.g., the target protein) can contain one or more N-glycan structures. For example, the altered form of the target molecule can contain one or more specific N-glycan structures such as Man.sub.5GlcNAc.sub.2 (structural formula I or VII; FIG. 4A), Man.sub.8GlcNAc.sub.2 (structural formula I; FIG. 4A), Man.sub.9GlcNAc.sub.2 (structural formula II; FIG. 4A), Man.sub.3GlcNAc.sub.2 (structural formula XIV; FIG. 4B), Glc.sub.1Man.sub.5GlcNAc.sub.2 (structural formula VIII; FIG. 4B), or Glc.sub.2Man.sub.5GlcNAc.sub.2 (structural formula IX; FIG. 4B) (Man is mannose; Glc is glucose; and GlcNAc is N-acetylglucosamine).

(106) The target molecules having altered N-glycosylation produced from the genetically engineered cells can be homogeneous (i.e., all altered N-glycosylation molecules containing the same specific N-glycan structure) or can be substantially homogeneous. By substantially homogeneous is meant that the altered target molecules are at least about 25% (e.g., at least about 27%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, or at least about 99%) of the target molecules having altered N-glycosylation produced by the genetically engineered cell.

(107) Where the genetically engineered cell includes one or more N-glycosylation activities that effect the phosphorylation of an N-glycan, an altered N-glycosylation form of a target molecule can have at least about 25% (e.g., at least about 27%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80%) of its mannosyl residues phosphorylated.

(108) Where any of the genetic modifications of the genetically engineered cell are inducible or conditional on the presence of an inducing cue (e.g., a chemical or physical cue), the genetically engineered cell can, optionally, be cultured in the presence of an inducing agent before, during, or subsequent to the introduction of the nucleic acid. For example, following introduction of the nucleic acid encoding a target protein, the cell can be exposed to a chemical inducing agent that is capable of promoting the expression of one or more proteins having N-glycosylation activity. Where multiple inducing cues induce conditional expression of one or more proteins having N-glycosylation activity, a cell can be contacted with multiple inducing agents.

(109) Following processing by one or more N-glycosylation activities, the altered target molecule can be isolated. The altered target molecule can be maintained within the yeast cell and released upon cell lysis or the altered target molecule can be secreted into the culture medium via a mechanism provided by a coding sequence (either native to the exogenous nucleic acid or engineered into the expression vector), which directs secretion of the molecule from the cell. The presence of the altered target molecule in the cell lysate or culture medium can be verified by a variety of standard protocols for detecting the presence of the molecule. For example, where the altered target molecule is a protein, such protocols can include, but are not limited to, immunoblotting or radioimmunoprecipitation with an antibody specific for the altered target protein (or the target protein itself), binding of a ligand specific for the altered target protein (or the target protein itself), or testing for a specific enzyme activity of the altered target protein (or the target protein itself).

(110) In some embodiments, the isolated altered target molecules can be frozen, lyophilized, or immobilized and stored under appropriate conditions, e.g., which allow the altered target molecules to retain biological activity.

(111) The altered N-glycosylation form of the target molecule can be further processed in vivo (e.g., in the genetically engineered cell) or can be processed in vitro following isolation from the genetically engineered cell or cell medium. The further processing can include modifications of one or more N-glycan residues of the altered target molecule or modifications to the altered target molecule other than to its N-glycan residues. The additional processing of the altered target molecule can include the addition (covalent or non-covalent joining) of a heterologous moiety such as a polymer or a carrier. The further processing can also involve enzymatic or chemical treatment of the altered target molecule. Enzymatic treatment can involve contacting the altered target molecule with one or more of a glycosidase (e.g., mannosidase or mannanase), a phosphodiesterase, a phospholipase, a glycosyltransferase, or a protease for a time sufficient to induce modification of the altered target molecule. Enzymatic treatment can also involve contacting the altered target molecule with an enzyme capable of removing one or more glucose residues from Man.sub.5GlcNAc.sub.2 such as, but not limited to, a mannosidase or one or both of the alpha and beta subunit of a glucosidase II. Chemical treatment can, for example, involve contacting the altered target molecule with an acid such as hydrofluoric acid for a time sufficient to induce modification of the altered target molecule. Hydrofluoric acid treatment under certain conditions specifically removes the mannose residues that are phosphodiester-linked to glycans, while leaving the phosphate on the glycan. An altered target molecule can be further processed by addition or removal of a phosphate group from one or more N-glycans. For example, a altered target molecule can be contacted with a mannosyl kinase or a mannosyl phosphatase.

(112) In some embodiments, any of the altered target molecules described herein, following isolation, can be attached to a heterologous moiety, e.g., using enzymatic or chemical means. A heterologous moiety refers to any constituent that is joined (e.g., covalently or non-covalently) to the altered target molecule, which constituent is different from a constituent originally present on the altered target molecule. Heterologous moieties include, e.g., polymers, carriers, adjuvants, immunotoxins, or detectable (e.g., fluorescent, luminescent, or radioactive) moieties. In some embodiments, an additional N-glycan can be added to the altered target molecule.

(113) It is understood that a target molecule can be, but need not be, processed in a genetically engineered cell. For example, the disclosure also features cell-free methods of producing a target molecule having an altered N-glycosylation form, which methods include the step of contacting a target molecule under N-glycosylation conditions with a cell lysate prepared from a cell (e.g., a fungal cell (e.g., Yarrowia lipolytica, Arxula adeninivorans, or any other related dimorphic yeast cells described herein), a plant cell, or an animal cell (e.g., nematode, insect, plant, bird, reptile, or mammal (e.g., a mouse, rat, rabbit, hamster, gerbil, dog, cat, goat, pig, cow, horse, whale, monkey, or human)) genetically engineered to have at least one modified N-glycosylation activity, wherein the contacting of the target molecule to the cell lysate produces an altered N-glycosylation form of the target molecule.

(114) By N-glycosylation conditions is meant that a mixture (e.g., of target molecule and cell lysate) is incubated under conditions that allow for altered N-glycosylation (as described above).

(115) Suitable methods for obtaining cell lysates that preserve the activity or integrity of one or more N-glycosylation activities in the lysate can include the use of appropriate buffers and/or inhibitors, including nuclease, protease and phosphatase inhibitors that preserve or minimize changes in N-glycosylation activities in the cell lysate. Such inhibitors include, for example, chelators such as ethylenediamine tetraacetic acid (EDTA), ethylene glycol bis(P-aminoethyl ether) N,N,N1,N1-tetraacetic acid (EGTA), protease inhibitors such as phenylmethylsulfonyl fluoride (PMSF), aprotinin, leupeptin, antipain and the like, and phosphatase inhibitors such as phosphate, sodium fluoride, vanadate and the like Inhibitors can be chosen such that they do not interfere with or only minimally adversely affect the N-glycosylation activity, or activities, of interest. Appropriate buffers and conditions for obtaining lysates containing enzymatic activities are described in, e.g., Ausubel et al. Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999); Harlow and Lane, Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press (1988); Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press (1999); Tietz Textbook of Clinical Chemistry, 3rd ed. Burtis and Ashwood, eds. W.B. Saunders, Philadelphia, (1999).

(116) A cell lysate can be further processed to eliminate or minimize the presence of interfering substances, as appropriate. If desired, a cell lysate can be fractionated by a variety of methods well known to those skilled in the art, including subcellular fractionation, and chromatographic techniques such as ion exchange, hydrophobic and reverse phase, size exclusion, affinity, hydrophobic charge-induction chromatography, and the like (see, e.g., Scopes, Protein Purification: Principles and Practice, third edition, Springer-Verlag, New York (1993); Burton and Harding, J. Chromatogr. A 814:71-81 (1998)).

(117) In some embodiments, a cell lysate can be prepared in which whole cellular organelles remain intact and/or functional. For example, a lysate can contain one or more of intact rough endoplasmic reticulum, intact smooth endoplasmic reticulum, or intact Golgi apparatus. Suitable methods for preparing lysates containing intact cellular organelles and testing for the functionality of the organelles are described in, e.g., Moreau et al. (1991) J. Biol. Chem. 266(7):4329-4333; Moreau et al. (1991) J. Biol. Chem. 266(7):4322-4328; Rexach et al. (1991) J. Cell Biol. 114(2):219-229; and Paulik et al. (1999) Arch. Biochem. Biophys. 367(2):265-273; the disclosures of each of which are incorporated herein by reference in their entirety.

(118) The disclosure also provides methods of producing a target molecule having an altered N-glycosylation form that includes the step of contacting a target molecule under N-glycosylation conditions with one or more isolated proteins having N-glycosylation activity, wherein contacting the target molecule with the one or more proteins having N-glycosylation activity produces an altered N-glycosylation form of the target molecule and wherein the one or more proteins having N-glycosylation activity are prepared from a cell (e.g., a fungal cell (e.g., Yarrowia lipolytica, Arxula adeninivorans, or any other related dimorphic yeast cells described herein), a plant cell, or an animal cell (e.g., nematode, insect, plant, bird, reptile, or mammal (e.g., a mouse, rat, rabbit, hamster, gerbil, dog, cat, goat, pig, cow, horse, whale, monkey, or human)) genetically engineered to have at least one modified N-glycosylation activity.

(119) One of more proteins having N-glycosylation activity can be purified using standard techniques as described above. A target molecule can be contacted with one or more proteins in a suitable buffer for a time sufficient to induce modification of the target molecule as described in, e.g., Lee and Park (2002) 30(6):716-720 and Fujita and Takegawa (2001) Biochem. Biophys. Res. Commun. 282(3):678-682, the disclosures of which are incorporated herein by reference in their entirety.

(120) In some embodiments, the target molecule can be contacted with just one protein having N-glycosylation activity. In some embodiments, the target molecule can be contacted with more than one protein having N-glycosylation activity. The target molecule can be contacted with more than one protein at the same time or sequentially. Where the target molecule is contacted sequentially to more than one protein having N-glycosylation activity, the target molecule can, but need not, be purified after one or more steps. That is, a target molecule can be contacted with protein activity A, then purified before contacting the molecule to protein activity B, and so on.

(121) It some embodiments of the cell free methods, it can be advantageous to link the target molecule to a solid-phase support prior to contacting the target molecule with one or more N-glycosylation activities. Such linkage can allow for easier purification following the N-glycosylation modifications. Suitable solid-phase supports include, but are not limited to, multi-well assay plates, particles (e.g., magnetic or encoded particles), a column, or a membrane.

(122) Methods for detecting N-glycosylation (e.g., altered N-glycosylation) of a target molecule include DNA sequencer-assisted (DSA), fluorophore-assisted carbohydrate electrophoresis (FACE) (as described in the accompanying Examples) or surface-enhanced laser desorption/ionization time-of-flight mass spectrometry (SELDI-TOF MS) and. For example, an analysis can utilize DSA-FACE in which, for example, glycoproteins are denatured followed by immobilization on, e.g., a membrane. The glycoproteins can then be reduced with a suitable reducing agent such as dithiothreitol (DTT) or -mercaptoethanol. The sulfhydryl groups of the proteins can be carboxylated using an acid such as iodoacetic acid. Next, the N-glycans can be released from the protein using an enzyme such as N-glycosidase F. N-glycans, optionally, can be reconstituted and derivatized by reductive amination. The derivatized N-glycans can then be concentrated. Instrumentation suitable for N-glycan analysis includes, e.g., the ABI PRISM 377 DNA sequencer (Applied Biosystems). Data analysis can be performed using, e.g., GENESCAN 3.1 software (Applied Biosystems). Optionally, isolated mannoproteins can be further treated with one or more enzymes to confirm their N-glycan status. Exemplary enzymes include, e.g., -mannosidase or -1,2 mannosidase, as described in the accompanying Examples. Additional methods of N-glycan analysis include, e.g., mass spectrometry (e.g., MALDI-TOF-MS), high-pressure liquid chromatography (HPLC) on normal phase, reversed phase and ion exchange chromatography (e.g., with pulsed amperometric detection when glycans are not labeled and with UV absorbance or fluorescence if glycans are appropriately labeled). See also Callewaert et al. (2001) Glycobiology 11(4):275-281 and Freire et al. (2006) Bioconjug. Chem. 17(2):559-564, the disclosures of each of which are incorporated herein by reference in their entirety.

(123) Disorders Treatable by Altered N-Glycosylation Molecules

(124) The isolated, altered N-glycosylation molecules (e.g., the altered N-glycosylation proteins or dolichol) described herein can be used to treat a variety of disorders, which disorders are treatable by administration of one or more altered N-glycosylation molecules (e.g., a protein having altered N-glycosylation). Examples of some specific medical conditions that can be treated or prevented by administration of an altered N-glycosylation molecule (e.g., an altered N-glycoprotein or an altered N-glycosylated dolichol) are reviewed in the following sections.

(125) (i) Metabolic Disorders

(126) A metabolic disorder is one that affects the production of energy within individual human (or animal) cells. Most metabolic disorders are genetic, though some can be acquired as a result of diet, toxins, infections, etc. Genetic metabolic disorders are also known as inborn errors of metabolism. In general, the genetic metabolic disorders are caused by genetic defects that result in missing or improperly constructed enzymes necessary for some step in the metabolic process of the cell. The largest classes of metabolic disorders are disorders of carbohydrate metabolism, disorders of amino acid metabolism, disorders of organic acid metabolism (organic acidurias), disorders of fatty acid oxidation and mitochondrial metabolism, disorders of porphyrin metabolism, disorders of purine or pyrimidine metabolism, disorders of steroid metabolism disorders of mitochondrial function, disorders of peroxisomal function, and lysosomal storage disorders (LSDs).

(127) Examples of metabolic disorders that can be treated through the administration of one or more altered N-glycosylation molecules (or pharmaceutical compositions of the same) described herein can include, e.g., hereditary hemochromatosis, oculocutaneous albinism, protein C deficiency, type I hereditary angioedema, congenital sucrase-isomaltase deficiency, Crigler-Najjar type II, Laron syndrome, hereditary Myeloperoxidase, primary hypothyroidism, congenital long QT syndrome, tyroxine binding globulin deficiency, familial hypercholesterolemia, familial chylomicronemia, abeta-lipoproteinema, low plasma lipoprotein A levels, hereditary emphysema with liver injury, congenital hypothyroidism, osteogenesis imperfecta, hereditary hypofibrinogenemia, alpha-1 antichymotrypsin deficiency, nephrogenic diabetes insipidus, neurohypophyseal diabetes insipidus, adenosine deaminase deficiency, Pelizaeus Merzbacher disease, von Willebrand disease type IIA, combined factors V and VIII deficiency, spondylo-epiphyseal dysplasia tarda, choroideremia, I cell disease, Batten disease, ataxia telangiectasias, ADPKD-autosomal dominant polycystic kidney disease, microvillus inclusion disease, tuberous sclerosis, oculocerebro-renal syndrome of Lowe, amyotrophic lateral sclerosis, myelodysplastic syndrome, Bare lymphocyte syndrome, Tangier disease, familial intrahepatic cholestasis, X-linked adreno-leukodystrophy, Scott syndrome, Hermansky-Pudlak syndrome types 1 and 2, Zellweger syndrome, rhizomelic chondrodysplasia puncta, autosomal recessive primary hyperoxaluria, Mohr Tranebjaerg syndrome, spinal and bullar muscular atrophy, primary ciliary diskenesia (Kartagener's syndrome), giantism and acromegaly, galactorrhea, Addison's disease, adrenal virilism, Cushing's syndrome, ketoacidosis, primary or secondary aldosteronism, Miller Dieker syndrome, lissencephaly, motor neuron disease, Usher's syndrome, Wiskott-Aldrich syndrome, Optiz syndrome, Huntington's disease, hereditary pancreatitis, anti-phospholipid syndrome, overlap connective tissue disease, Sjgren's syndrome, stiff-man syndrome, Brugada syndrome, congenital nephritic syndrome of the Finnish type, Dubin-Johnson syndrome, X-linked hypophosphosphatemia, Pendred syndrome, persistent hyperinsulinemic hypoglycemia of infancy, hereditary spherocytosis, aceruloplasminemia, infantile neuronal ceroid lipofuscinosis, pseudoachondroplasia and multiple epiphyseal, Stargardt-like macular dystrophy, X-linked Charcot-Marie-Tooth disease, autosomal dominant retinitis pigmentosa, Wolcott-Rallison syndrome, Cushing's disease, limb-girdle muscular dystrophy, mucoploy-saccharidosis type IV, hereditary familial amyloidosis of Finish, Anderson disease, sarcoma, chronic myelomonocytic leukemia, cardiomyopathy, faciogenital dysplasia, Torsion disease, Huntington and spinocerebellar ataxias, hereditary hyperhomosyteinemia, polyneuropathy, lower motor neuron disease, pigmented retinitis, seronegative polyarthritis, interstitial pulmonary fibrosis, Raynaud's phenomenon, Wegner's granulomatosis, preoteinuria, CDG-Ia, CDG-Ib, CDG-Ic, CDG-Id, CDG-Ie, CDG-If, CDG-IIa, CDG-IIb, CDG-IIc, CDG-IId, Ehlers-Danlos syndrome, multiple exostoses, Griscelli syndrome (type 1 or type 2), or X-linked non-specific mental retardation. In addition, metabolic disorders can also include lysosomal storage disorders such as, but not limited to, Fabry disease, Farber disease, Gaucher disease, GM.sub.1-gangliosidosis, Tay-Sachs disease, Sandhoff disease, GM.sub.2 activator disease, Krabbe disease, metachromatic leukodystrophy, Niemann-Pick disease (types A, B, and C), Hurler disease, Scheie disease, Hunter disease, Sanfilippo disease, Morquio disease, Maroteaux-Lamy disease, hyaluronidase deficiency, aspartylglucosaminuria, fucosidosis, mannosidosis, Schindler disease, sialidosis type 1, Pompe disease, Pycnodysostosis, ceroid lipofuscinosis, cholesterol ester storage disease, Wolman disease, Multiple sulfatase deficiency, galactosialidosis, mucolipidosis (types II, III, and IV), cystinosis, sialic acid storage disorder, chylomicron retention disease with Marinesco-Sjgren syndrome, Hermansky-Pudlak syndrome, Chediak-Higashi syndrome, Danon disease, or Geleophysic dysplasia.

(128) Symptoms of a metabolic disorder are numerous and diverse and can include one or more of, e.g., anemia, fatigue, bruising easily, low blood platelets, liver enlargement, spleen enlargement, skeletal weakening, lung impairment, infections (e.g., chest infections or pneumonias), kidney impairment, progressive brain damage, seizures, extra thick meconium, coughing, wheezing, excess saliva or mucous production, shortness of breath, abdominal pain, occluded bowel or gut, fertility problems, polyps in the nose, clubbing of the finger/toe nails and skin, pain in the hands or feet, angiokeratoma, decreased perspiration, corneal and lenticular opacities, cataracts, mitral valve prolapse and/or regurgitation, cardiomegaly, temperature intolerance, difficulty walking, difficulty swallowing, progressive vision loss, progressive hearing loss, hypotonia, macroglossia, areflexia, lower back pain, sleep apnea, orthopnea, somnolence, lordosis, or scoliosis. It is understood that due to the diverse nature of the defective or absent proteins and the resulting disease phenotypes (e.g., symptomatic presentation of a metabolic disorder), a given disorder will generally present only symptoms characteristic to that particular disorder. For example, a patient with Fabry disease can present a particular subset of the above-mentioned symptoms such as, but not limited to, temperature intolerance, corneal whirling, pain, skin rashes, nausea, or diarrhea. A patient with Gaucher syndrome can present with splenomegaly, cirrhosis, convulsions, hypertonia, apnea, osteoporosis, or skin discoloration.

(129) In addition to the administration of one or more altered N-glycosylation molecules described herein, a metabolic disorder can also be treated by proper nutrition and vitamins (e.g., cofactor therapy), physical therapy, and pain medications.

(130) Depending on the specific nature of a given metabolic disorder, a patient can present these symptoms at any age. In many cases, symptoms can present in childhood or in early adulthood. For example, symptoms of Fabry disease can present at an early age, e.g., at 10 or 11 years of age.

(131) As used herein, a subject at risk of developing a metabolic disorder (such as one described herein) is a subject that has a predisposition to develop a disorder, i.e., a genetic predisposition to develop metabolic disorder as a result of a mutation in a enzyme such as alpha-L-iduronidase, beta-D-galactosidase, beta-glucosidase, beta-hexosaminidase, beta-D-mannosidase, alpha-L-fucosidase, arylsulfatase B, arylsulfatase A, alpha-N-acteylgalactosaminidase, aspartylglucosaminidase, iduronate-2-sulfatase, alpha-glucosaminide-N-acetyltransferase, beta-D-glucoronidase, hyaluronidase, alpha-L-mannosidase, alpha-neuromimidase, phosphotransferase, acid lipase, acid ceramidase, sphinogmyelinase, thioesterase, cathepsin K, or lipoprotein lipase. Clearly, subjects at risk of developing a metabolic disorder are not all the subjects within a species of interest.

(132) A subject suspected of having a disorder is one having one or more symptoms of a disorder (e.g., a metabolic disorder or any other disorder described herein) such as any of those described herein.

(133) (ii) Cancer

(134) Cancer is a class of diseases or disorders characterized by uncontrolled division of cells and the ability of these to spread, either by direct growth into adjacent tissue through invasion, or by implantation into distant sites by metastasis (where cancer cells are transported through the bloodstream or lymphatic system). Cancer can affect people at all ages, but risk tends to increase with age. Types of cancers can include, e.g., lung cancer, breast cancer, colon cancer, pancreatic cancer, renal cancer, stomach cancer, liver cancer, bone cancer, hematological cancer, neural tissue cancer, melanoma, thyroid cancer, ovarian cancer, testicular cancer, prostate cancer, cervical cancer, vaginal cancer, or bladder cancer.

(135) As used herein, a subject at risk of developing a cancer is a subject that has a predisposition to develop a cancer, i.e., a genetic predisposition to develop cancer such as a mutation in a tumor suppressor gene (e.g., mutation in BRCA1, p53, RB, or APC) or has been exposed to conditions that can result in cancer. Thus, a subject can also be one at risk of developing a cancer when the subject has been exposed to mutagenic or carcinogenic levels of certain compounds (e.g., carcinogenic compounds in cigarette smoke such as Acrolein, Arsenic, Benzene, Benz {a}anthracene, Benzo{a}pyrene, Polonium-210 (Radon), Urethane, or Vinyl Chloride). Moreover, the subject can be at risk of developing a cancer when the subject has been exposed to, e.g., large doses of ultraviolet light or X-irradiation, or exposed (e.g., infected) to a tumor-causing/associated virus such as papillomavirus, Epstein-Barr virus, hepatitis B virus, or human T-cell leukemia-lymphoma virus. From the above it will be clear that subjects at risk of developing a cancer are not all the subjects within a species of interest.

(136) A subject suspected of having a cancer is one having one or more symptoms of a cancer. Symptoms of cancer are well-known to those of skill in the art and include, without limitation, breast lumps, nipple changes, breast cysts, breast pain, weight loss, weakness, excessive fatigue, difficulty eating, loss of appetite, chronic cough, worsening breathlessness, coughing up blood, blood in the urine, blood in stool, nausea, vomiting, liver metastases, lung metastases, bone metastases, abdominal fullness, bloating, fluid in peritoneal cavity, vaginal bleeding, constipation, abdominal distension, perforation of colon, acute peritonitis (infection, fever, pain), pain, vomiting blood, heavy sweating, fever, high blood pressure, anemia, diarrhea, jaundice, dizziness, chills, muscle spasms, colon metastases, lung metastases, bladder metastases, liver metastases, bone metastases, kidney metastases, and pancreas metastases, difficulty swallowing, and the like.

(137) In addition to the administration of one or more altered N-glycosylation molecules described herein, a cancer can also be treated by chemotherapeutic agents, ionizing radiation, immunotherapy agents, or hyperthermotherapy agents. Chemotherapeutic agents include, e.g., cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-fluorouracil, vincristin, vinblastin, and methotrexate.

(138) (iii) Inflammatory Disorders

(139) An inflammatory disorder, as used herein, refers to a process in which one or more substances (e.g., substances not naturally occurring in the subject), via the action of white blood cells (e.g., B cells, T cells, macrophages, monocytes, or dendritic cells) inappropriately trigger a pathological response, e.g., a pathological immune response. Accordingly, such cells involved in the inflammatory response are referred to as inflammatory cells. The inappropriately triggered inflammatory response can be one where no foreign substance (e.g., an antigen, a virus, a bacterium, a fungus) is present in or on the subject. The inappropriately triggered response can be one where a self-component (e.g., a self-antigen) is targeted (e.g., an autoimmune disorder such as multiple sclerosis) by the inflammatory cells. The inappropriately triggered response can also be a response that is inappropriate in magnitude or duration, e.g., anaphylaxis. Thus, the inappropriately targeted response can be due to the presence of a microbial infection (e.g., viral, bacterial, or fungal). Types of inflammatory disorders (e.g., autoimmune disease) can include, but are not limited to, osteoarthritis, rheumatoid arthritis (RA), spondyloarthropathies, POEMS syndrome, Crohn's disease, multicentric Castleman's disease, systemic lupus erythematosus (SLE), multiple sclerosis (MS), muscular dystrophy (MD), insulin-dependent diabetes mellitus (IDDM), dermatomyositis, polymyositis, inflammatory neuropathies such as Guillain Barre syndrome, vasculitis such as Wegener's granulomatosus, polyarteritis nodosa, polymyalgia rheumatica, temporal arteritis, Sjogren's syndrome, Bechet's disease, Churg-Strauss syndrome, or Takayasu's arteritis. Also included in inflammatory disorders are certain types of allergies such as rhinitis, sinusitis, urticaria, hives, angioedema, atopic dermatitis, food allergies (e.g., a nut allergy), drug allergies (e.g., penicillin), insect allergies (e.g., allergy to a bee sting), or mastocytosis. Inflammatory disorders can also include ulcerative colitis and asthma.

(140) A subject at risk of developing an inflammatory disorder refers to a subject with a family history of one or more inflammatory disorders (e.g., a genetic predisposition to one or more inflammatory disorders) or one exposed to one or more inflammation-inducing conditions. For example, a subject can have been exposed to a viral or bacterial superantigen such as, but not limited to, staphylococcal enterotoxins (SEs), a streptococcus pyogenes exotoxin (SPE), a staphylococcus aureus toxic shock-syndrome toxin (TSST-1), a streptococcal mitogenic exotoxin (SME) and a streptococcal superantigen (SSA). From the above it will be clear that subjects at risk of developing an inflammatory disorder are not all the subjects within a species of interest.

(141) A subject suspected of having an inflammatory disorder is one who presents with one or more symptoms of an inflammatory disorder. Symptoms of inflammatory disorders are well known in the art and include, but are not limited to, redness, swelling (e.g., swollen joints), joints that are warm to the touch, joint pain, stiffness, loss of joint function, fever, chills, fatigue, loss of energy, headaches, loss of appetite, muscle stiffness, insomnia, itchiness, stuffy nose, sneezing, coughing, one or more neurologic symptoms such as dizziness, seizures, or pain.

(142) In addition to the administration of one or more altered N-glycosylation molecules described herein, an inflammatory disorder can also be treated by non-steroidal anti-inflammatory drug (NSAID), a disease-modifying anti-rheumatic drug (DMARD), a biological response modifier, or a corticosteroid. Biological response modifiers include, e.g., an anti-TNF agent (e.g., a soluble TNF receptor or an antibody specific for TNF such as adulimumab, infliximab, or etanercept).

(143) Methods suitable for treating (e.g., preventing or ameliorating one or more symptoms of) any of the disorders described herein using any of the altered N-glycosylation molecules (or pharmaceutical compositions thereof) are set forth in the following section.

(144) Pharmaceutical Compositions and Methods of Treatment

(145) An altered N-glycosylation molecule (e.g., an altered N-glycosylation form of a target molecule such as a target protein) can be incorporated into a pharmaceutical composition containing a therapeutically effective amount of the molecule and one or more adjuvants, excipients, carriers, and/or diluents. Acceptable diluents, carriers and excipients typically do not adversely affect a recipient's homeostasis (e.g., electrolyte balance). Acceptable carriers include biocompatible, inert or bioabsorbable salts, buffering agents, oligo- or polysaccharides, polymers, viscosity-improving agents, preservatives and the like. One exemplary carrier is physiologic saline (0.15 M NaCl, pH 7.0 to 7.4). Another exemplary carrier is 50 mM sodium phosphate, 100 mM sodium chloride. Further details on techniques for formulation and administration of pharmaceutical compositions can be found in, e.g., Remington's Pharmaceutical Sciences (Mack Publishing Co., Easton, Pa.). Supplementary active compounds can also be incorporated into the compositions.

(146) Administration of a pharmaceutical composition containing an altered N-glycosylation molecule can be systemic or local. Pharmaceutical compositions can be formulated such that they are suitable for parenteral and/or non-parenteral administration. Specific administration modalities include subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, intrathecal, oral, rectal, buccal, topical, nasal, ophthalmic, intra-articular, intra-arterial, sub-arachnoid, bronchial, lymphatic, vaginal, and intra-uterine administration.

(147) Administration can be by periodic injections of a bolus of the pharmaceutical composition or can be uninterrupted or continuous by intravenous or intraperitoneal administration from a reservoir which is external (e.g., an IV bag) or internal (e.g., a bioerodable implant, a bioartificial organ, or a colony of implanted altered N-glycosylation molecule production cells). See, e.g., U.S. Pat. Nos. 4,407,957, 5,798,113, and 5,800,828, each incorporated herein by reference in their entirety. Administration of a pharmaceutical composition can be achieved using suitable delivery means such as: a pump (see, e.g., Annals of Pharmacotherapy, 27:912 (1993); Cancer, 41:1270 (1993); Cancer Research, 44:1698 (1984), incorporated herein by reference in its entirety); microencapsulation (see, e.g., U.S. Pat. Nos. 4,352,883; 4,353,888; and 5,084,350, herein incorporated by reference in its entirety); continuous release polymer implants (see, e.g., Sabel, U.S. Pat. No. 4,883,666, incorporated herein by reference in its entirety); macroencapsulation (see, e.g., U.S. Pat. Nos. 5,284,761, 5,158,881, 4,976,859 and 4,968,733 and published PCT patent applications WO92/19195, WO 95/05452, the disclosures of each of which are incorporated herein by reference in their entirety); injection, either subcutaneously, intravenously, intra-arterially, intramuscularly, or to other suitable site; or oral administration, in capsule, liquid, tablet, pill, or prolonged release formulation.

(148) Examples of parenteral delivery systems include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, pump delivery, encapsulated cell delivery, liposomal delivery, needle-delivered injection, needle-less injection, nebulizer, aerosolizer, electroporation, and transdermal patch.

(149) Formulations suitable for parenteral administration conveniently contain a sterile aqueous preparation of the altered N-glycosylation molecule, which preferably is isotonic with the blood of the recipient (e.g., physiological saline solution). Formulations can be presented in unit-dose or multi-dose form.

(150) Formulations suitable for oral administration can be presented as discrete units such as capsules, cachets, tablets, or lozenges, each containing a predetermined amount of the altered N-glycosylation molecule; or a suspension in an aqueous liquor or a non-aqueous liquid, such as a syrup, an elixir, an emulsion, or a draught.

(151) An altered N-glycosylation molecule (e.g., an altered N-glycosylation form of a target molecule such as a target protein) suitable for topical administration can be administered to a mammal (e.g., a human patient) as, e.g., a cream, a spray, a foam, a gel, an ointment, a salve, or a dry rub. A dry rub can be rehydrated at the site of administration. An altered N-glycosylation molecule can also be infused directly into (e.g., soaked into and dried) a bandage, gauze, or patch, which can then be applied topically. Altered N-glycosylation molecules can also be maintained in a semi-liquid, gelled, or fully-liquid state in a bandage, gauze, or patch for topical administration (see, e.g., U.S. Pat. No. 4,307,717, the content of which is incorporated herein by reference in its entirety).

(152) Therapeutically effective amounts of a pharmaceutical composition can be administered to a subject in need thereof in a dosage regimen ascertainable by one of skill in the art. For example, a composition can be administered to the subject, e.g., systemically at a dosage from 0.01 g/kg to 10,000 g/kg body weight of the subject, per dose. In another example, the dosage is from 1 g/kg to 100 g/kg body weight of the subject, per dose. In another example, the dosage is from 1 g/kg to 30 g/kg body weight of the subject, per dose, e.g., from 3 g/kg to 10 g/kg body weight of the subject, per dose.

(153) In order to optimize therapeutic efficacy, an altered N-glycosylation molecule can be first administered at different dosing regimens. The unit dose and regimen depend on factors that include, e.g., the species of mammal, its immune status, the body weight of the mammal. Typically, levels of an altered N-glycosylation molecule in a tissue can be monitored using appropriate screening assays as part of a clinical testing procedure, e.g., to determine the efficacy of a given treatment regimen.

(154) The frequency of dosing for an altered N-glycosylation molecule is within the skills and clinical judgement of medical practitioners (e.g., doctors or nurses). Typically, the administration regime is established by clinical trials which may establish optimal administration parameters. However, the practitioner may vary such administration regimes according to the subject's age, health, weight, sex and medical status. The frequency of dosing can be varied depending on whether the treatment is prophylactic or therapeutic.

(155) Toxicity and therapeutic efficacy of such altered N-glycosylation molecules (e.g., an altered N-glycosylation form of target molecules such as target proteins) or pharmaceutical compositions thereof can be determined by known pharmaceutical procedures in, for example, cell cultures or experimental animals. These procedures can be used, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Pharmaceutical compositions that exhibit high therapeutic indices are preferred. While pharmaceutical compositions that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to normal cells (e.g., non-target cells) and, thereby, reduce side effects.

(156) The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in appropriate subjects (e.g., human patients). The dosage of such pharmaceutical compositions lies generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For a pharmaceutical composition used as described herein (e.g., for treating a metabolic disorder in a subject), the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the pharmaceutical composition which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

(157) As defined herein, a therapeutically effective amount of an altered N-glycosylation molecule is an amount of the molecule that is capable of producing a medically desirable result (e.g., amelioration of one or more symptoms of a metabolic disorder or decreased proliferation of cancer cells) in a treated subject. A therapeutically effective amount of an altered N-glycosylation molecule (i.e., an effective dosage) includes milligram or microgram amounts of the compound per kilogram of subject or sample weight (e.g., about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram to about 5 milligrams per kilogram, or about 1 microgram per kilogram to about 50 micrograms per kilogram).

(158) The subject can be any mammal, e.g., a human (e.g., a human patient) or a non-human primate (e.g., chimpanzee, baboon, or monkey), a mouse, a rat, a rabbit, a guinea pig, a gerbil, a hamster, a horse, a type of livestock (e.g., cow, pig, sheep, or goat), a dog, a cat, or a whale.

(159) An altered N-glycosylation molecule or pharmaceutical composition thereof described herein can be administered to a subject as a combination therapy with another treatment, e.g., a treatment for a metabolic disorder (e.g., a lysosomal storage disorder). For example, the combination therapy can include administering to the subject (e.g., a human patient) one or more additional agents that provide a therapeutic benefit to the subject who has, or is at risk of developing, (or suspected of having) a metabolic disorder (e.g., a lysosomal storage disorder). Thus, the compound or pharmaceutical composition and the one or more additional agents are administered at the same time. Alternatively, the altered N-glycosylation molecule (e.g., protein or dolichol) can be administered first in time and the one or more additional agents administered second in time. The one or more additional agents can be administered first in time and the altered N-glycosylation molecule (e.g., protein or dolichol) administered second in time. The altered N-glycosylation molecule can replace or augment a previously or currently administered therapy. For example, upon treating with an altered N-glycosylation molecule of the invention, administration of the one or more additional agents can cease or diminish, e.g., be administered at lower levels. Administration of the previous therapy can also be maintained. In some instances, a previous therapy can be maintained until the level of the altered N-glycosylation molecule (e.g., the dosage or schedule) reaches a level sufficient to provide a therapeutic effect. The two therapies can be administered in combination.

(160) It will be appreciated that in instances where a previous therapy is particularly toxic (e.g., a treatment for a metabolic disorder with significant side-effect profiles), administration of the altered N-glycosylation molecule (e.g., protein or dolichol) can be used to offset and/or lessen the amount of the previously therapy to a level sufficient to give the same or improved therapeutic benefit, but without the toxicity.

(161) In some instances, when the subject is administered an altered N-glycosylation molecule (e.g., protein, dolichol, or a dolichol-linked lipid) or pharmaceutical composition of the invention the first therapy is halted. The subject can be monitored for a first pre-selected result, e.g., an improvement in one or more symptoms of a metabolic disorder such as any of those described herein (e.g., see above). In some cases, where the first pre-selected result is observed, treatment with the altered N-glycosylation molecule (e.g., an altered N-glycosylation protein or an altered N-glycosylation dolichol) is decreased or halted. The subject can then be monitored for a second pre-selected result after treatment with the altered N-glycosylation molecule (e.g., protein or dolichol) is halted, e.g., a worsening of a symptom of a metabolic disorder. When the second pre-selected result is observed, administration of the altered N-glycosylation molecule (e.g., protein or dolichol) to the subject can be reinstated or increased, or administration of the first therapy is reinstated, or the subject is administered both an altered N-glycosylation molecule (e.g., protein, dolichol, or a dolichol-linked lipid) and first therapy, or an increased amount of the altered N-glycosylation molecule (e.g., protein or dolichol) and the first therapeutic regimen.

(162) The altered N-glycosylation molecule (e.g., protein or dolichol) can also be administered with a treatment for one or more symptoms of a disease (e.g., a metabolic disorder). For example, the altered N-glycosylation molecule (e.g., protein, dolichol, or a dolichol-linked lipid) can be co-administered (e.g., at the same time or by any combination regimen described above) with, e.g., a pain medication.

(163) It is understood that in some embodiments, an altered N-glycosylation molecule is one in which the altered glycosylation increases the ability of the molecule to produce a medically relevant product. For example, an altered N-glycosylation molecule can be an enzyme capable of producing a therapeutic product (e.g., a small molecule or therapeutic peptide), which enzyme's activity is increased or optimized by glycosylation. Such products and methods of using the products are within the scope of the present disclosure.

(164) Any of the pharmaceutical compositions described herein can be included in a container, pack, or dispenser together with instructions for administration.

(165) The following are examples of the practice of the invention. They are not to be construed as limiting the scope of the invention in any way.

EXAMPLES

Example 1

Plasmids, Primers and Strains

(166) Table 1 contains a list of all of the plasmids used in the construction of vectors (e.g., expression vectors) and deletion cassettes used in the experiments described herein. The MTLY60 strain of Yarrowia lipolytica was used in the experiments.

(167) Table 2 contains a list of primers (the names of the primers) and the utility of the primers used in the following examples.

(168) TABLE-US-00001 TABLE 1 Plasmids: JMP62 pYLTsA pYLHmL pYLHmA JMP113 JMP114 pRRQ2 JME 507 JME 509 JME 461 KS-LPR- URA3 KS-LPR-LEU2 Cre ARS68 LEU2

(169) TABLE-US-00002 TABLE2 Primers: Name: Use: TCGCTATCACGTCTCTAGC Yloch1promfw AmplificationYlOCH1 (SEQIDNO:18) AmplificationYlOCH1Pfragment TCTCTGTATACTTGTATGT Yloch1terrev AmplificationYlOCH1 ACTG(SEQIDNO:19) AmplificationYlOCH1Tfragment CTAGGGATAACAGGGTAA YlOCH1Pfragrev AmplificationPfragmentinclI-Sce TGGTGTGACGAAGTATCG Isite AG(SEQIDNO:20) CATTACCCTGTTATCCCTA YlOCH1Tfragfw AmplificationTfragmentinclI-Sce GCGAGATCATGGACTGG Isite (SEQIDNO:21) GACGCGGCCGCATGAGCT YlMNS1ORF+ Ter AmplificationofYlMNS1Pfrag. TCAACATTCCCAAAAC (Pfrag)S (ORF+ terminator) (SEQIDNO:22) CTAGGGATAACAGGGTAA YlMNS1ORF+ Ter AmplificationofYlMNS1Pfrag. TACAAAATTCAGAAATAA (Pfrag)AS (ORF+ termin.)+ I-SceI AAATACTTTACAG(SEQID NO:23) CATTACCCTGTTATCCCTA YlMNS1TfragS AmplificationofYlMNS1Tfrag. AGTAACATGAGTGCTATG (downstreamterminator.)+ I-SceI AG(SEQIDNO:24) CGCTTAATTAAATGCATGG YlMNS1TfragAS AmplificationofYlMNS1Tfrag. AGGTATTGCTG(SEQID (downstreamterminator.) NO:25) GGTGCTTCGACTATCAGTT ScMNS1mut269-273S ScMNS1mutationprimertoshiftto TCGGAGGATTGGGTGATTC mam.Golgitypemannase=> proof TTTTTATG(SEQIDNO:26) ofconceptinSc CATAAAAAGAATCACCCA ScMNS1mut269-273 YlMNS1mutationprimertoshiftto ATCCTCCGAAACTGATAGT AS mam.Golgitypemannase=> proof CGAAGCACC(SEQID ofconceptinSc NO:27) TGAGCGGCCGCTTTTCTAC YlMNN9Pfw YlMNN9KOprimer TTCAGAGCTGGAG(SEQID NO:28) GGCTTAATTAATTGGTAGT YlMNN9Trv YlMNN9KOprimer GATATAATGTAACGC(SEQ IDNO:29) TAGGGATAACAGGGTAAT YlMNN9Prv YlMNN9KOprimer CACGACACATACTCATTCA AG(SEQIDNO:30) ATTACCCTGTTATCCCTAG YlMNN9Tfw YlMNN9KOprimer AAGGAGATGTAGCGTAAG (SEQIDNO:31) TGATAAATAGCTTAGATAC LIP2rv Reverseprimerusedforsequencing CACAG(SEQIDNO:32) ACATACAACCACACACAT 5 hp4d Forwardprimerusedforsequencing C(SEQIDNO:33) GGCGGATCCATGGTGCTGC YlMNN4BamHIfw Forwardprimerforamplificationof ACCCGTTTC(SEQIDNO:34) YlMNN4 GGCCCTAGGCTACTCAAAC YlMNN4AvrIIrv Reverseprimerforamplificationof TCCTCGCGAATC(SEQID YlMNN4 NO:35) GGTCTCGCCAGCGCGCCCA HAC1FW06-003 Forwardprimerregionaround CCCTCTTC(SEQIDNO:36) HAC1splicesite CTAGATCAGCAATAAAGT HAC1Rv06-001 ReverseprimerregionaroundHAC1 CGTGCTGGGC(SEQID splicesite NO:37) GGATCCATGTCTATCAAGC HAC1Fw06-002 AmplificationofHAC1gene GAGAAGAGTCC(SEQID includesstartcodonandBamHI NO:38) restrictionsite CCTAGGCTAGATCAGCAAT HAC1RV06-006 AmplificationofHAC1gene AAAGTCGTGCTGGGC(SEQ includesstopcodonandAvrII IDNO:39) restrictionsite

Example 2

Yarrowia lipolytica OCH1 and MNN9 Disruption

(170) A strategy to knock out both OCH1 (GenBank Accession No: AJ563920) and MNN9 (GenBank Accession No: AF441127) genes in Yarrowia lipolytica was set up as described in Fickers et al. ((2003) J Microbiol Methods. 55(3):727-37) for the LIP2 gene. The gene construction strategy that was followed for the OCH1 gene is depicted in FIGS. 5A-5E.

(171) The OCH1 KO fragment was isolated from the plasmid Y10CH1 PUT TOPO by restriction digest and by PCR and was transformed to Yarrowia lipolytica strain MTLY60. 20 uracil prototrophic strains were obtained and screened by PCR on genomoic DNA (gDNA) using primers Yloch1 prom fw (SEQ ID NO:18) and Yloch1 ter rev (SEQ ID NO:19) to analyse the genomic integration of the plasmid. A fragment of the correct size (i.e., 2618 bp vs. 1894 bp in the wild type) was amplified in 2 of the 20 clones tested. Several clones contained a random integrated copy of the construct and therefore both fragments were amplified.

(172) To remove the URA3 gene, the two positive clones were transformed with the episomal plasmid pRRQ2 that contains an expression cassette for the Cre recombinase. Removal of the URA3 gene was screened for by PCR on gDNA using primers Yloch1 prom fw and Yloch1 ter rev (see above). The 2328 bp fragment (incl. URA3) was absent from, and a 1075 bp (excl. URA3) fragment of 1075 bp was present in, the positive clones.

(173) A Southern blot analysis was performed on the 2 positive clones to check whether aberrant DNA integration had occurred. Genomic DNA (gDNA) was double digested with EcoRV/HindIII, subjected to agarose-gel electrophoresis, and transferred to nitrocellulose membrane. The membrane was probed with a 500 bp SpeI/I-SceI fragment from plasmid YlOCH1 PT TOPO. A fragment of 1456 bp was present in och1 PUT, whereas a fragment of 2066 bp in och1 PT and a fragment of 2893 bp in the wild type strain was present.

(174) A construction strategy to inactivate MNN9 was set up and is depicted in FIGS. 6A and 6B.

(175) The disruption fragment was cut out of plasmid YlMNN9PUT TOPO by a NotI/PacI double digest and transformed to MTLY60 and och1 PT clone 9. Several URA3 positive clones were obtained for both strains and they were screened for correct integration of the construct by PCR on gDNA after single clones were isolated. A fragment of 2349 bp was amplified in the disruptant strains, whereas in the non-transformants, a fragment of 2056 bp was amplified using primers YlMNN9 P fw and YlMNN9 T rv. (Table 2).

(176) To analyze the N-glycan structures that were synthesized by the mutant strains, DSA-FACE was performed on glycans derived from mannoproteins (FIG. 7). The wild-type (MTLY60) strain has as main core type glycan structures mainly Man.sub.8GlcNAc.sub.2 (structural formula I; FIG. 4A) and a substantial amount of Man.sub.9GlcNAc.sub.2 (structural formula II; FIG. 4A) the latter most probably containing an additional mannose as a result of Och1p activity. Furthermore, some larger structures can be seen. The och1 strain has mainly Man.sub.8GlcNAc.sub.2 (structure formula I) and a small portion of Man.sub.9GlcNAc.sub.2 (structural formula II; FIG. 4A), both of which are sensitive to -1,2-mannosidase treatment (indicated och1 -1,2-man) resulting in trimming to Man.sub.5GlcNAc.sub.2 (structural formula IV; FIG. 4A). The mnn9 strain accumulates more Man.sub.9GlcNAc.sub.2 (structural formula II; FIG. 4A) than the och1 strain, which indicates that Mnn9p is involved in the elongation of the glycan structure subsequent to Och1p activity. The double mutant och1 mnn9 displays a glycosylation phenotype that resembles the one from the och1 strain.

Example 3

Mutagenesis of MNS1

(177) MNS1 (ER -1,2-mannosidase) is involved in the trimming of the Man.sub.9GlcNAc.sub.2 to Man.sub.8GlcNAc.sub.2 and has a strict substrate specificity in the sense that it is only able to trim the -1,2-mannose that is linked to the -1,3-mannose of the central arm (FIG. 2). To determine where the MNS1 gene could be mutagenized in order to shift its substrate specificity towards a Golgi type -1,2-mannosidase, the primary sequences of several ER type mannosidases were compared with Golgi type mannosidases. One region that is different between the two classes was identified. In addition, an oligosaccharide that was crystallised in the catalytic site of the Golgi type mannosidase into the yeast MNS1 was also analyzed to identify possible interactions between sugar and protein. Surprisingly, the same sites were identified using both methods.

(178) The MNS1 gene from Saccharomyces cerevisiae (GenBank Accession No: Z49631, sgd: YJR131W) was mutated in order to change its substrate specificity. Three mutated versions were made: two with one mutation (R273L and R273G) and one with 3 mutations (R269S/S272G/R273L) in the same region:

(179) A) R273L (arginine 273 to leucine)

(180) B) R273G (arginine 273 to glycine)

(181) C) R269S/S272G/R273L (arginine 269 to serine/serine 272 to glycine/arginine 273 to leucine).

(182) All mutations were made using the Quick Change (Stratagene) mutagenesis kit. Constructs were made to express the 3 different mutant genes under control of the strong constitutive TPI1 promoter. Oligonucleotides CGACTATCCGGTTCGGATCATTGGGTGATTCTTTTTATGAG (SEQ ID NO:40) and CTCATAAAAAGAATCACCCAATGATCCGAACCGGATAGTCG (SEQ ID NO:41) were used to generate mutant R273L, and oligonucleotides CGACTATCCGGTTCGGATCAGGTGGTGATTCTTTTTATGAG (SEQ ID NO:42) and CTCATAAAAAGAATCACCACCTGATCCGAACCGGATAGTCG (SEQ ID NO:43) were used to obtain mutant R273G using the wild type gene as a template. Oligonucleotides GGTGCTTCGACTATCAGTTTCGGAGGATTGGGTGATTCTTTTTATG (SEQ ID NO:44) and CATAAAAAGAATCACCCAATCCTCCGAAACTGATAGTCGAAGCACC (SEQ ID NO:45) were used to obtain mutant R269S/S272G/R273L using mutant R273L as template DNA. Via PCR reaction using oligonucleotides CCCGATATCGGATCCATGAAGAACTCTGTCGGTATTTC (SEQ ID NO:46) and GGGAAGCTTAACGCGGTTCCAGCGGGTCCGGATACGGCACCGGCGCACCCAACGAC CAACCTGTGGTCAG (SEQ ID NO:47) the coding sequence of an E-tag was added at the 3 end of the mutant and the wild type MNS1 open reading frames to allow protein detection after expression. An overview of the construction strategy is presented in FIGS. 8A-8E.

(183) The three constructs, as well as the non-mutated gene (as a negative control), were transformed to S. cerevisiae strain XW27 (MAT leu2 ura3 trp1 his3 ade2 lys2 och1::LEU2 mnn1::URA3 mnn6::ADE2) using TRP1 as a selection marker after digestion of the plasmids with XbaI to direct the construct to the TRP1 locus in the S. cerevisiae genome. The latter strain is able to synthesize uniform Man.sub.8GlcNAc.sub.2 (on its glycoproteins. If the mutated enzyme is active this Man.sub.8GlcNAc.sub.2 (structural formula I; FIG. 4A) should be trimmed to Man.sub.5GlcNAc.sub.2 (structural formula IV; FIG. 4A), Man.sub.6GlcNAc.sub.2 (structural formula V; FIG. 4A) and/or Man.sub.7GlcNAc.sub.2 (structural formula VI; FIG. 4A).

(184) Tryptophan prototrophic strains were isolated, grown in liquid SDC-trp medium and mannoproteins were prepared. N-glycans derived from mannoproteins were analysed via DSA-FACE. As can be appreciated from FIG. 9, a small amount of Man.sub.8GlcNAc.sub.2 (structural formula I; FIG. 4A) from the strains that contain the R273G and R269S/S272G/R273L mutations are converted to Man.sub.5GlcNAc.sub.2 (structural formula IV; FIG. 4A), Man.sub.6GlcNAc.sub.2 (structural formula V; FIG. 4A) and Man.sub.7GlcNAc.sub.2 (structural formula VI; FIG. 4A). The expression of the other mutant or the wild type gene cause an altered N-glycosylation phenotype. To evaluate whether all mutants are equally well expressed, a Western blot analysis was performed using an antibody specific for an E-tag (a 13 amino acid epitope added to the MNS1 proteins). All mutant proteins, as well as the wild-type MNS1 protein, were expressed equally well.

Example 4

Increasing Phosphorylation

Expression of Yarrowia lipolytica MNN4

(185) To increase the phosphorylation of Man.sub.8GlcNAc.sub.2, Yarrowia liplytica MNN4 (a homologue of the P. pastoris PN01) was overexpressed in Yarrowia lipolytica to promote the core type phosphorylation of N-glycans.

(186) The coding sequence of the Yarrowia lipolytica MNN4 (XM_503217, YALI0D24101g) gene was amplified using primers GGCGGATCCATGGTGCTGCACCCGTTTC (YlMNN4 BamHI fw; SEQ ID NO:34) and GGCCCTAGGCTACTCAAACTCCTCGCGAATC (YlMNN4 AvrII rv; SEQ ID NO:35). This open reading frame (ORF) was cloned into the plasmid using BamHI and AvrII sites, which placed the ORF under control of the hp4d promoter of plasmid pYlHURA3 that contains the URA3d1 gene as a selection marker and the zeta sequences for improving random integration (FIG. 10).

(187) Prior to transformation in the MTLY60 och1 strain, the plasmid containing the MNN4 expression cassette was digested either with Eco471II for integration in the URA3 locus, PvuI for integration in the MNN4 locus, or RsrII/BstBI for random integration. Transformants targeted to the URA3 and MNN4 locus were analysed by PCR using a primer in the hp4d promoter and one in the LIP2 terminator. Transformants with random integration of the construct were evaluated by Southern blot analysis.

(188) To evaluate whether manno-phosphorylation was increased we analysed N-glycans derived from secreted glycoproteins after 48 hours culture in YPD medium by DSA-FACE capillary electrophoresis (FIG. 11). The amount of Man.sub.8GlcNAc.sub.2 (structural formula I) was drastically reduced in favour of two structures that migrate faster (compared to Man.sub.8GlcNAc.sub.2 (structural formula I; FIG. 4A)) and that are likely to contain one (P) (structural formula X or XI; FIG. 4B) and two (PP) (structural formula XII; FIG. 4B) phosphate residues, respectively (FIG. 11). Thus, it can be concluded that the random integrated expression cassettes perform better than the cassettes integrated in the URA3 locus or the MNN4 locus, in that order. The MZ2 exhibited the highest level of phosphorylation.

(189) Assuming that both peaks derive from the Man.sub.8GlcNAc.sub.2 (structural formula I; FIG. 4A) peak, the amount of Man.sub.8GlcNAc.sub.2 converted to phosphorylated glycans was quantitated (Table 3).

(190) TABLE-US-00003 TABLE 3 Phosph- N-glycan struct. height area % signal Status Strain och1 M82P (struct. form. XII) 18 302 1.02826 18.91045* M8P (struct. form. X or XI) 261 5252 17.88219 M8 (struct. form. I) 928 23816 81.08955 81.08955* 29370 100 100 Strain MU5 M82P (struct. form. XII) 1319 19736 27.16773 81.17283* M8P (struct. form. X or XI) 2025 39232 54.00509 M8 (struct. form. I) 539 13677 18.82717 18.82717* 72645 100 100 Strain MZ2 M82P (struct. form. XII) 1182 17662 27.75299 83.11282* M8P (struct. form. X or XI) 1803 35231 55.35984 M8 (struct. form. I) 419 10747 16.88718 16.88718* 63640 100 100 Table 3 Legend: Height and area refer to the peak height and peak area as determined from electropherograms. % signal refers to the proportion of each glycan in the N-glycan mixture. The numbers identified by asterisk depict the proportion of phosphorylated Man.sub.8Gn.sub.2 (top) and the proportion of non-phosphorylated Man.sub.8Gn.sub.2 (bottom).

(191) These results indicated that more than 80% of Man.sub.8GlcNAc.sub.2 (structural formula I; FIG. 4A) that is present in the parent och1 is phosphorylated in the strain that over expresses the YlMNN4 gene.

Example 5

Modifying Glycosylation by Lipid-Linked Oligosaccharide Modification in the Endoplasmic Reticulum

Materials and Methods

(192) Strains, Culture Conditions and Reagents.

(193) Escherichia coli strains MC1061 or TOP10 or DH5 were used for the amplification of recombinant plasmid DNA and grown in a thermal shaker at 37 C. in Luria-Broth (LB) medium supplemented with 100 g/ml of carbenicillin or 50 g/ml of kanamycin depending on the plasmids used.

(194) Yarrowia lipolytica MTLY60 (ura3 leu2) strain was used as parent strain. All yeast strains were cultured in a 28 C. incubator. They were grown on YPD medium (2% dextrose, 2% bacto-peptone and 1% yeast extract) or synthetic dextrose complete (SDC) medium (0.17% YNB w/o amino acids and without ammonium sulphate, 1% glucose, 0.5% NH.sub.4C1, 50 mM K/Na phosphate buffer pH 6.8 and 0.077% Complete Supplement Mixture (Qbiogene Inc, Morgan Irvine, Calif.)). For selection of Ura+ and Leu+ transformants 0.077% CSM-ura or CSM-leu was added respectively.

(195) Standard Genetic Techniques.

(196) Transformation competent cells of Yarrowia lipolytica were prepared as described in Boisrame et al. (1996) J. Biol. Chem. 271(20):11668-75, the disclosure of which is incorporated herein by reference in its entirety. Genomic DNA from all yeast strains was isolated using a published protocol (Epicenter Kit catologue No. MPY80200; Epicenter Biotechnologies, Madison, Wis.). The protocol involves non-enzymatic cell lysis at 65 C., followed by removal of protein by precipitation and nucleic acid precipitation and resuspension. PCR amplification was performed in a final volume of 50 l containing 5 l of 10 buffer (200 mM Tris-HCl pH8.4 and 500 mM KCl), a variable quantity of MgCl.sub.2, 2.5 M dNTP, 50 ng of template, 50 pmol of the proper primers and 2.5 units of either Taq or Pfu DNA polymerase. Cycling conditions used were as follows: denaturation at 94 C. for 10 minutes followed by hot start and 30 cycles of 94 C. for 45 seconds, suitable annealing temperature for 45 seconds and extension at 72 C. for 1 minute per kb followed by 10 min of extension at 72 C. DNA fragments (PCR products or fragments) recovered from gel were purified using NucleoSpin extract II (Macherey-Nagel). DNA sequencing was performed by VIB Genetic Service Facility (Antwerp, Belgium).

(197) Vector Construction.

(198) (i) Knock-out (gene-replacement) of the ALG3 gene. The promoter fragment (P) of the ALG3 gene (GenBank Accession No: XM_503488, Genolevures: YALI0E03190g) was amplified from genomic DNA of the Yarrowia lipolytica MTLY60 strain by PCR with 5CAGTGCGGCCGCACTCCCTCTTTTCACTCACTATTG3 (SEQ ID NO:48) and 5CATTACCCTGTTATCCCTACGCTCAGATCCAATTGTTTTGGTGGTC3 (SEQ ID NO:49) as the forward and reverse primers, respectively, using Taq polymerase (Invitrogen). The overhanging A nucleotide was removed with T4 DNA polymerase (Fermentas, Ontario, Canada). The terminator fragment (T) of the ALG3 gene was amplified from genomic DNA of the Yarrowia lipolytica MTLY60 strain by PCR with 5GTAGGGATAACAGGGTAATGCTCTCAAGGACGGACCAGATGAGACTGTTATCG3 (SEQ ID NO:50) and 5GACTTTAATTAAACCCTATGTGGCACCTCAACCCACATCTCCCGTC3 (SEQ ID NO:51) as the forward and reverse primers, respectively, using the proofreading Pfu DNA polymerase (Fermentas). Because of overlapping primer sequences containing an ISceI restriction site, both fragments could be linked by PCR with the P-forward primer and the T-reverse primer. This co-amplicon was then subcloned in a pCR-2.1 TOPO TA (Invitrogen) vector and the correctness of the co-amplicon's sequence was confirmed by sequencing. The co-amplicon was then cloned using the NotI-PacI sites into an intermediate vector.

(199) (ii) Overexpression of the ALG6 gene. The ALG6 ORF (1725 bp) together with the terminator (415 bp downstream) of the ALG6 gene (GenBank Accession No: XM_502922, Genolevures: YALI0D17028g) were cloned from genomic DNA of the Yarrowia lipolytica MTLY60 strain by PCR with 5CAGTGGATCCATGAACTCTCCTATTTTCACTACCG3 (SEQ ID NO:52) and 5GACTCCTAGGAAGCTTCCAGGTTACAAGTTGTTAC3(SEQ ID NO:53) as the forward and reverse primers, respectively, using the proofreading Pfu DNA polymerase (Fermentas). The sequence was cloned in pCR-Blunt II-TOPO (Invitrogen) and the correctness of the ALG6 ORF sequence was confirmed by sequencing (as above). Next, the ALG6 ORF was cloned in a vector (pYLHmA) containing the hp4d promoter via BamHI and AvrII and subsequently cloned in the intermediate vector via the unique restriction sites ClaI and HindIII present in the terminator fragment of ALG3.

(200) (iii) Selection marker cassette. To remove the selectable marker URA3 from the host genomic DNA, the Cre-lox recombination system was used, e.g., as described by Fickers et al. ((2003) J. Microbiol. Methods 55(3):727-737, the disclosure of which is incorporated herein by reference in its entirety). Upon expression of the Cre recombinase from the plasmid pRRQ2 (hp4d-cre, LEU2) (a gift from the Institut National de Recherche Agronomique (INRA)), the marker gets excised by recombination between the two lox sites. In both constructs, with and without the ALG6 overexpression cassette, the URA3 selection marker flanked by lox sites, was inserted in the introduced I-SceI site between P and T fragments of the vector, resulting in a PUT construct.

(201) Preparation of Mannoproteins.

(202) Yeast strains were grown overnight in 10 ml standard YPD medium in 50 ml falcon tubes, rotating at 250 rpm in a 28 C. incubator. The cells were then pelleted by centrifugation at 4000 rpm at 4 C. The supernatants were removed, and the cells were first washed with 2 ml of 0.9% NaCl solution followed by two washes with 2 ml of water and subsequently resuspended in 1.5 ml of 0.02 M sodium citrate pH 7 in a microcentrifuge tube. After autoclaving the tubes for 90 minutes at 121 C., the tubes were vortexed and the cellular debris was pelleted by centrifugation. The supernatants were collected and the mannoproteins were precipitated overnight with 4 volumes of methanol at 4 C. with rotary motion. The precipitate was then obtained by centrifugation of the alcohol precipitated material. The pellets were allowed to dry and dissolved in 50 l of water.

(203) Sugar Analysis.

(204) DNA sequencer-assisted (DSA), fluorophore-assisted carbohydrate electrophoresis (FACE) was performed with an ABI 3130 DNA sequencer as described by Callewaert et al. (2001; supra). Briefly, glycoproteins were denatured for 1 hour in RCM buffer (8M urea, 360 mM Tris pH 8.6 and 3.2 mM EDTA) at 50 C. followed by immobilization on a prewetted PVDF membrane of a IP plate containing 15 l RCM. Prewetting of the membrane was done with 300 l MeOH, 3 times washed with 300 l water and 50 l RCM, followed by vacuum removal. The glycoproteins were reduced for 1 hour with 50 l 0.1M dithiothreitol and washed 3 times with 300 l water. A 30 minute incubation in the dark with 50 l 0.1M iodoacetic acid was used to carboxymethylate the SH groups, followed by 3 washes with 300 l water. The plates were subsequently incubated for 1 hour with 100 l 1% polyvinylpyrrolidone 360 to saturate the unoccupied binding sites on the membrane, again followed by 3 washes with 300 l water. Next, the N-glycans were released by 3 hours treatment with peptide: N-glycosidase F (PNGase F)U in 50 l of 10 mM Tris-acetate pH 8.3. N-glycans were recuperated and derivatized with the fluorophore 8-aminopyrene-1,3,6-trisulfonate (APTS) by reductive amination. This was accomplished with an overnight (ON) incubation at 37 C. with 1 l of 1:1 mixture of 20 mM APTS in 1.2M citric acid and 1M NaCNBH.sub.3 in DMSO and quenching by addition of 4 l water. Excess label was removed by size fractionation on Sephadex G-10 resin. The remaining labeled N-glycans were then concentrated by evaporation. The N-glycans of RNase B and an oligomaltose ladder were included as size markers. Data analysis was performed using Genemapper software (Applied Biosystems). Glycosidase digests on the labeled sugars were performed ON at 37 C. in 100 mM NH.sub.4AC pH5. Additional Jack bean (JB) mannosidase was added after ON digestion and left for another 24 hours at 37 C.

Disruption of the ALG3 Gene in Yarrowia lipolytica

(205) To disrupt the ALG3 gene, a vector was generated that includes parts of the promoter and terminator of ALG3 and has a URA3 selection marker cassette and was designated pYLalg3PUT. A NotI and Pad site were integrated to linearize the vector and thereby remove the E. coli related DNA elements. Double homologous recombination at the promoter and terminator site was used to replace ALG3 with the URA3 selectable marker, which resulted in an alg3::URA3 mutant strain. The knockout strategy applied was described by Fickers et al. (2003; supra) and makes use of the Cre-lox recombination system, that facilitates efficient marker rescue. Upon integration in the genomic ALG3 contig the Alg3p -1,6-mannosyltransferase activity should be lost. This was monitored by analyzing the glycosylation pattern of the mannoproteins of several transformants. The N-glycans derived from mannoproteins were analysed by DSA-FACE (capillary electrophoresis) and treated with a selection of exoglycosidases to reveal the structures. Seven out of 24 transformants gave a change in glycosylation profile (three of which are depicted in FIG. 13). In all seven transformants, correct integration of the knockout cassette in the genome could be confirmed by PCR. Three main glycan structures were found by analyzing the profiles: (i) one (structural formula VII; FIG. 4A) that runs at the same size as the Man.sub.5GlcNAc.sub.2 structure of RNase B (the latter being structural formula IV; FIG. 4A); (ii) one at a distance of one glucose-unit extra; and (iii) one at the distance of two extra glucose-units. (FIG. 13). These results indicate that ALG3 was disrupted in these cells.

Overexpression of -1,6-mannosyltransferase Alg6p

(206) A strategy was developed in which a constitutively active overexpression cassette for the first glucosyltransferase, i.e., Alg6p, was incorporated into the alg3 gene replacement vector. This vector was designated pYLalg3PUT-ALG6. A NotI/PacI fragment of this vector was transformed into the Yarrowia lipolytica MTLY60 strain. In this way, disruption of ALG3 and overexpression of ALG6 under control of the hp4d promoter is achieved. Correct integration in the genome was again confirmed by PCR. DSA-FACE analysis of the N-glycans derived from mannoproteins showed that half of the transformants, i.e., 12 out of 24, exhibited a change in glycosylation pattern comparing to the WT strain. Overexpression of ALG6 led to a mild clonal variation (FIG. 13).

Identification of the N-glycan Structures

(207) To further elucidate the nature of the glycan structures from the experiments described above, in vitro digests of glycans derived from the mannoproteins (as above) were performed with a selection of exoglycosidases. The mannoprotein glycans were analyzed with the following enzymes: -1,2-mannosidase; -mannosidase (JB) and glucosidase II. Three observed glycanstructures represent Man.sub.5GlcNAc.sub.2 (structural formula VII; FIG. 4A), GlcMan.sub.5GlcNAc.sub.2 (structural formula VIII; FIG. 4B) and Glc.sub.2Man.sub.5GlcNAc.sub.2 (structural formula IX; FIG. 4B) (FIG. 14). These results indicate that there is very little to no high mannose elongation by -1,6-mannosyltranferases (e.g., Och1p).

(208) To determine if ALG6 overexpression is necessary for promoting N-glycosylation site-occupancy, Lipase 2 (LIP2) from Yarrowia lipolytica was expressed in three different strains of Yarrowia: MTLY60, MTLY60alg3 and MTLY60alg3ALG6. A construct for the Yarrowia lipolytica LIP2, under control of a TEF constitutive promoter was obtained from INRA. The expression cassette was transformed to the above-mentioned strains and the expression of the protein was verified by subjecting the supernatant prepared from the transformed cells to SDS-PAGE analysis (FIG. 28). The Lip2p protein has 2 glycosylation sites. Lip2p protein derived from the alg3-deficient (knockout) yeast strain was resolved by SDS-PAGE into three distinct bands that were visualized using Coomassie blue staining of the gel (FIG. 28). To confirm that all three forms of protein in the gel were different glycosylation forms of the Lip2p protein, Lip2p protein obtained from the alg3-deficient (knockout) yeast strain was subject to treatment with PNGase F (an enzyme that removes oligosaccharide residues from glycoproteins) and then subjected to SDS-PAGE analysis as described above. Treatment of the Lip2p protein with PNGase F resulted in a single band (which had the same molecular weight as non-glycosylated Lip2p) on the gel following Coomassie blue staining and indicated that all three forms of protein previously observed were different glycosylation forms of the same Lip2p molecule. The same is true for the Lip2p derived from the alg3ALG6 strain. However, the amount of protein in a reduced glycosylation form is decreased. Thus, it can be concluded that overexpression of ALG6 can (at least partially) restore N-glycosylation site-occupancy, which is reduced in the alg3 knockout mutant yeast strain.

Removing Capping Glucose Structures

(209) Next, to eliminate mono (structural formula VIII; FIG. 4B) and bi-glucosylated (structural formula IX; FIG. 4B) Man.sub.5GlcNAc.sub.2 (structural formula VII; FIG. 4B) structures in vivo, cells were genetically engineered to overexpress the -subunit of the enzyme glucosidase II. The subunit of glucosidase II of Yarrowia (GenBank Accession No: XM_500574) and the subunit of glucosidase II Trypanosoma brucei (GenBank Accession No: AJ865333) were independently cloned as two strategies to overexpress the protein. The subunit of glucosidase II Trypanosoma brucei was chosen since its natural substrate is GlcMan.sub.5GlcNAc.sub.2 (structural formula VIII; FIG. 4B). Both genes were cloned under control of the constitutive hp4d promoter and their plasmids contain the URA3 marker. These constructs were transformed into alg3 mutant yeast strains, both with and without ALG6 overexpression.

(210) Oligosaccharides were prepared from secreted proteins derived from cultured cells containing the constructs and the profile of the oligosaccharides was determined by DSA-FACE analysis. All transformants gave the same DSA-FACE profile, two different clones of each glucosidaseII are depicted in FIG. 29. From these results it was concluded that the overexpression of either the Yarrowia or the Trypanosoma glucosidase II subunit has only a minor effect on the amount of mono (structural formula VIII; FIG. 4B) and bi-glucosylated (structural formula IX; FIG. 4B) Man.sub.5GlcNAc.sub.2 (structural formula VII; FIG. 4A) structures.

Expression of Glucosidase II -Subunits of Yarrowia lipolytica and Trypanosoma brucei Tagged with an HDEL Sequence

(211) To improve the effect of the expression of Yarrowia or the Trypanosoma glucosidase II subunit on removing glucose residues from Man.sub.5GlcNAc.sub.2 in vivo, a nucleic acid encoding an HDEL tag was added using molecular biology techniques in frame to the 3 end of the nucleic acid encoding each of the two GlsII enzymes. The HDEL tag was meant to serve as a retrieval mechanism from the Golgi to the ER. Plasmids encoding HDEL-tagged glucosidase II sequences from both Yarrowia lipolytica (Y.l.) and Trypanosoma brucei (T.b.) under control of the hp4d promoter were transformed to the alg3 KO strain with and without overexpression of the ALG6 gene. As can be seen in FIG. 30, overexpression of the Yarrowia lipolytica glucosidase II subunit had only a minor effect on the amount of glucosylated structures. In contrast, overexpressing the -Glucosidase II of Typanosoma brucei subunit with an extra HDEL tag leads to a reduction of the mono-glucose peak (see FIG. 31).

Treatment of Glucosylated Glycans with Mutanase

(212) The above-described results demonstrate one exemplary means of reducing mono-glucosylated forms of Man.sub.5GlcNAc.sub.2. To reduce bi-glucosylated forms of Man.sub.5GlcNAc.sub.2 from glycoproteins, the mutanase of T. harzianum was investigated as one potential solution. An enzyme preparation was obtained from Novozymes (Novozyme 234; Bagsvaerd, Denmark) and was used to digest oligosaccharides in vitro. That is, mutanase was added in different concentrations to the oligosaccharides derived from a alg3ALG6 strain (glycans: Man.sub.5GlcNAc.sub.2, GlcMan.sub.5GlcNAc.sub.2 and Glc.sub.2Man.sub.5GlcNAc.sub.2). As shown in the DSA-FACE profile of FIG. 32, the bi-glucose peak observed in the oligosaccharides was effectively reduced.

(213) Next, the mutanase of T. harzianum was overexpressed in vivo. An HDEL-sequence containing mutanase was synthesized as a codon-optimized cDNA for expression in Yarrowia lipolytica. The mature protein was cloned in frame with the LIP2 pre signal sequence under control of the TEF1 promoter (FIG. 33). This construct is transformed into alg3 mutant yeast strains, both with and without ALG6 overexpression. Oligosaccharides are prepared from cultured cells containing the construct and the profile of the oligosaccharides is determined by DSA-FACE analysis. It is expected that the DSA-FACE profile will show a reduction in the bi-glucose peak observed in the oligosaccharides. From these results it will be concluded that the overexpression of mutanase in vivo is effective at reducing the bi-glucose peak observed in oligosaccharides as compared to cells not overexpressing the mutanase.

Co-Expression of Yl GlsII - and Subunits

(214) It is known that the - and -subunits of glucosidase II form a heterodimeric complex whereby the -subunit is responsible for retrieval of the complex to the ER and is also involved in substrate recognition, whereas the -subunit contains the catalytic activity. Since the overexpression of only the -subunit of glucosidase II had a small effect on bi-glucose oligosaccharide structures, the - and -subunits were co-expressed.

(215) The open reading frame of the -subunit (YALI0B03652g) was amplified from genomic DNA that was isolated from the MTLY60 strain using PCR and was cloned under control of the TEF1 and hp4d promoter. The constructs were made with LEU2 as a selection marker and with the glucosidase II -subunit under control of the TEF1 and the hp4d promoter. These were transformed to the alg3 knockout strains with and without ALG6 overexpression and overexpressing the Yarrowia lipolytica Glucosidase II subunit with and without an HDEL sequence tag. N-glycans were prepared from proteins secreted from the cells and the DSA-FACE profiles of the N-glycans are depicted in FIGS. 33 and 34 (alg3 knockout with overexpression of ALG6). It can be concluded from these profiles that overexpressing the subunit of glucosidase II from Yarrowia lipolytica did have a positive effect on the trimming of the glucosylated sugars. In general, the efficacy of the subunit of glucosidase II was improved when expressed under the TEF1 promoter. The glucosylated structures were even more reduced when the Yarrowia lipolytica glucosidase II subunit contained an HDEL tag (FIGS. 33 and 34).

(216) For alg3-deficient cells without ALG6 overexpression, similar results regarding reduction of glucosylated structures were observed for each of the different cell populations (FIG. 35).

Expression of Aspergillus GlsII a and b Subunit

(217) In order for the glucose residues to be removed from the glucose bearing structures that occur in alg3-deficient background, the Aspergillus niger mature (lacking signal peptide) glucosidase II and were synthesized as codon-optimized cDNA for expression in Yarrowia lipolytica (-subunit (SEQ ID NO:7; FIGS. 36A-36B) -subunit: (SEQ ID NO:8; FIG. 37). Aspergillus niger (An) glucosidase subunit was cloned under control of the constitutive TEF1 and hp4d promoters and had URA3 gene as a selection marker. The expression cassettes (ORFs under control of TEF1 and hp4d) were transformed to Yarrowia lipolytica alg3ALG6 strain. Transformant candidates were grown in YPD and glycans from secreted proteins were analysed by DSA-FACE. It can be deduced from FIG. 38 that the two glucosylated structures are less abundant in the transformant strains compared to the non-transformant (alg3ALG6).

(218) To further reduce the glucosylated glycan structures a construct is made with -subunit of the Aspergillus niger glucosidase II under control of TEF1 promoter or hp4d promoter with LEU2 as a selection marker. This construct is transformed to Yarrowia lipolytica alg3ALG6 strain expressing the An glucosidase II -subunit. It is expected that expression of the -subunit of the Aspergillus niger glucosidase II will result in a decrease in glucosylated structures in Yarrowia lipolytica cells.

Example 6

Identification of the HAC1 Intron and Cloning and Isolation of the HAC1 Gene

(219) Y. lipolytica HAC1 Splice Site.

(220) On the basis of sequence homology between the intronic regions of HAC1 in Yarrowia lipolytica and the fungi Trichoderma reesei and Aspergillus nidulans, a potential splice site of the Yarrowia lipolytica HAC1 (Genbank: XM_500811, Genolevures: Yali0B12716g) was identified. The 5 and 3 splice sites were predicted to be localized in a characteristic loop structure and the intron was calculated to be 29 bp long.

(221) Primers were developed around the splice site in order to identify the intron. First strand cDNA was synthesized from the isolated mRNA from an UPR (unfolded protein response) induced (by means of growth in dithiothreitol (DTT)) and non-induced culture (negative control) with gene specific primers. PCR was then performed on first strand using primers HAC1FW06-003 and HAC1Rv06-001. Amplification products were analyzed on a 1.5% agarose gel.

(222) A fragment of +/400 bp was expected to be amplified for the non-induced cells; a 29 bp smaller fragment was expected to be amplified for the induced cells. Fragments of the correct size were obtained from the non-induced cells and the UPR induced cells. Two more amplification products were obtained for the UPR induced culture. The middle fragment was the same size as the band obtained for the non-induced culture and was interpreted as being unspliced HAC1. The lower, most prominent band was purified from the gel and cloned into a sequencing vector. After sequencing the construct, a sequence alignment was performed in order to identify the splice site (FIG. 15). From the sequence alignment it can be seen that the splice site is located at the position that was predicted from the comparison of the Yarrowia lipolytica and the fungal (Trichoderma reesei and Aspergillus nidulans) HAC1 sequences. The splice site is 29 bp long.

(223) In order to isolate the active full length HAC1 sequence, primers were engineered to have restriction sites suitable for cloning into an expression vector. Primer sequences were as follows: Hac1ylRv07-018: CCTAGGTCACTCCAATCCCCCAAACAGGTTGCTGACGCTCGACTCATAGTGAGCTAG ATCAGCAATAAAGTCG (SEQ ID NO:54) and HAC1Fw06-002: GGA TCC ATG TCT ATC AAG CGA GAA GAG TCC (SEQ ID NO:55). A 10 ml culture of yeast cells was incubated for 1.5 hours in the presence of 5 mM DTT to induce the UPR response. Following the incubation, RNA was isolated from the DTT-treated cells and first strand cDNA was prepared from the isolated RNA using reverse transcriptase and PCR using the cDNA as a template and the above primers. The PCR-amplified sequence containing the spliced HAC1 was inserted into the pCR-blunt-TOPO cloning vector using standard molecular biology techniques and sequenced.

(224) Pichia pastoris HAC1 Splice Site.

(225) On the basis of sequence homology of the intronic regions of the Pichia pastoris and Saccharomyces cerevisiae HAC1 genes, a potential splice site in the Pichia pastoris HAC1 gene was identified (FIG. 16). The 5 and 3 splice sites were predicted to be localized in a characteristic loop structure and the intron was calculated to be 322 bp in length.

(226) Primers (HAC1Fw06-004 and HAC1Rv06-005) were developed around the predicted splice site in order to identify the intron (see Table 4). A fragment of 257 nucleotides was expected to be amplified when the intron is removed and a 579 bp fragment if intron is still present. First strand cDNA was synthesized from the isolated mRNA from an UPR induced and non-induced culture. The UPR was induced by adding 5 mM DTT to a 10 ml culture of exponentially growing cells. The cells were cultured in the presence of DTT for 1.5 hours. The amplification product was analyzed by 1.5% agarose gel electrophoresis. A fragment of approximately 257 bp was obtained from cDNA from both non-induced and induced cells.

(227) TABLE-US-00004 TABLE4 Primers Primercode sequence5 > 3 Information HAC1-Karl GAATTCATGCCCGTAGATTC ForwardprimerHac1gene+ startcodonand TTCTC(SEQIDNO:56) EcoRIsite HAC1Fw06-004 GAGTCTTCCGGAGGATTCA ForwardprimerHac1generegionaround5 G(SEQIDNO:57) splicesite HAC1Rv06-005 CCTGGAAGAATACAAAGTC ReverseprimerHac1genenearstopcodon (SEQIDNO:58) HAC1Rv06-009 CCTAGGCTATTCCTGGAAG reverseprimerHac1gene+ stopcodonand AATACAAAGTC(SEQID AviIIsite NO:59) ACTppFw07-007 GGTATTGCTGAGCGTATGC Act1forwardprimerforQPCR AAA(SEQIDNO:60) ACTppRv07-003 CCACCGATCCATACGGAGT Act1reverseprimerforQPCR ACT(SEQIDNO:61) HAC1ppFw07-008 CGACCTGGAATCTGCACTT Hac1forwardprimerQPCR CAA(SEQIDNO:62) HAC1ppRV07-004 CGGTACCACCTAAGGCTTC Hac1reverseprimerQPCR CAA(SEQIDNO:63) Kar2ppFw07-009 CCAGCCAACTGTGTTGATTC Kar2forwardprimerQPCR AA(SEQIDNO:64) Kar2ppRv07-005 GGAGCTGGTGGAATACCAG Kar2reverseprimerQPCR TCA(SEQIDNO:65)

(228) To verify the length of the unspliced P. pastoris HAC1 gene, PCR was performed on genomic DNA using primers HAC1-Kar1 and HAC1Rv06-005. The length of the obtained fragment was compared with the length of a PCR product obtained from the cDNA from an induced cell culture. The amplified fragment from the genomic DNA is about 300 bp longer than the amplicon derived from the cDNA using the same primers indicating that the intron is present in the genomic DNA sequence and absent from the spliced mRNA.

(229) The cDNA fragment of 257 bp was isolated from the gel and cloned in a sequencing vector. The fragment was sequenced and an alignment was performed in order to identify the splice site (FIG. 17). To isolate and clone the spliced P. pastoris HAC1 gene, PCR primers were developed with restriction enzyme sites for cloning into an expression vector (HAC1-Kar1 and HAC1Rv06-009). A 10 ml culture was UPR-induced with 5 mM DTT for 1.5 hours. First strand cDNA was prepared from the isolated RNA using reverse transcriptase and PCR was subsequently performed on the cDNA template DNA using the above primers. The spliced HAC1 was isolated and cloned in pCR-blunt-TOPO cloning vector for sequencing. The spliced gene was also cloned under the control of the methanol inducible AOX1 promoter in the expression vector pBLHIS IX to obtain the vector pBLHIS IX ppHAC1 spliced. The correct insertion of the HAC1 gene into the expression vector was confirmed using PCR and restriction enzyme analysis.

(230) In Saccharomyces cerevisiae, upon splicing, the coding sequence of the C-terminal 10 amino acids in the non-spliced mRNA is replaced with the coding sequence of 18 amino acids. In accordance, in Pichia pastoris it was revealed that the coding sequence of the C-terminal 45 amino acids in the non-spliced HAC1 are replaced upon splicing by the coding sequence of again 18 amino acids which are homologous to the ones from the S. cerevisiae sequence (FIG. 18).

Example 7

Transformation and Induction of Spliced HAC1 Gene into Yarrowia lipolytica

(231) Yarrowia lipolytica cells (MTLY60 strain) were transformed with the vector PYHMAXHAC1ylspliced containing the spliced HAC1 cDNA (above) under the expression control of the hp4d promoter and the URA3 gene as a selection marker. Integration of the vector into the yeast genome was verified using PCR. The MTLY60 strain transformed with PYHMAXHAC1ylspliced was grown in a 2 ml culture in YPG at 28 C. for 24 hours. The cultured cells were washed twice with YNB, then diluted to OD.sub.600 0.6 and grown for 24 hours in YTG buffered with 50 mM phosphate buffer pH: 6.8. The cells were then diluted to OD.sub.600 0.2 and grown for 3 more generations in order to harvest the cells in the mid-exponential phase. To the pellet, 1 ml of RNApure solution was added to the cells along with 1 g of glass beads. Cells were broken by vigorous shaking RNA was extracted from the broken cells by adding 150 l chloroform and precipitating the RNA with isopropanol. The extracted RNA was also treated with DNAse to remove any coprecipitated DNA impurities.

(232) First strand cDNA was prepared from 800 ng of the RNA using the iScriptTMcDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, Calif.) in a 20 l total volume reaction. The equivalent of 20 ng RNA was used for real time PCR analysis to determine the amount of HAC1 mRNA in the cells. Real time PCR was run using SYBR green as the detection reagent (fluorescent) (Eurogentec). In addition to designing primers for detecting the amount of HAC1 mRNA in the cells, primers were also designed to quantify the amount of ACT1 (household gene) and KAR2 (UPR responsive gene) genes as controls for the real time PCR. The relative amount of mRNA of each gene in the cells was calculated from the comparative threshold cycle values using Actin (a housekeeping gene) as the expression control. Induction of the UPR response by the cells was confirmed by measuring the expression of UPR. The expression levels of KAR2 as well as HAC1 are higher in the strains expressing HAC1 under control of a constitutive promoter compared to the wild type strain MTLY60 (FIG. 39).

Example 8

Transformation and Induction of Spliced HAC1 Gene into Pichia pastoris

(233) Media:

(234) For the following experiments, three types of media were used: BMY (Buffered Medium for Yeast: 100 mM potassium phosphate pH: 6.0/1.34% YNB without amino acids/1% Yeast extract/2% peptone); BGMY (Buffered Glycerol-complex Medium for Yeast: 100 mM potassium phosphate pH: 6.0/1.34% YNB without amino acids/1% Yeast extract/2% peptone/1% glycerol); and BMMY (Buffered Methanol-complex Medium for Yeast: 100 mM potassium phosphate pH: 6.0/1.34% YNB without amino acids/1% Yeast extract/2% peptone/0.5% glycerol).

(235) Pichia pastoris cells were transformed according to the electroporation protocol from the Pichia Expression kit (Invitrogen Cat. No. K1710-01). The vector pBLHIS IX ppHAC1spliced was linearized in the HIS4 gene to target the construct to the HIS4 locus for integration. Ten micrograms of DNA was transformed into the yeast cells. The correct integration of the construct was validated using PCR on genomic DNA after isolation of single colonies (primers HAC1-Kar1 and HAC1Rv06-005). Fragments of 915 kb and 1237 kb were amplified from DNA obtained from the transformed cells, whereas in the non-transformants (cells without integration of the construct) a fragment of 1237 kb was amplified. Clones so identified as positive for integration of the plasmid were grown in 10 ml BMGY medium for 24 hours before induction. Cells were washed once with BMY. BMGY was added to non-induced cultures while BMY was added to the induced cultures. Every 12 hours, induced cultures were fed with 0.5% methanol (final concentration). Induction was performed for 24 hours after which cells were harvested by centrifugation. To prepare RNA, cells were combined with 1 ml RNApure (Genhunter Corporation, Nashville, N.Y.) and 1 g of glass beads, and lysed by vigorous shaking RNA was extracted by the addition of 150 l chloroform and precipitated with isopropanol. The extracted and precipitated RNA was DNAse treated with RNAse-free DNAse obtained from Qiagen (Cat No. 79254). 400 ng of total RNA was subjected to reverse transcriptase reaction using an oligodT primer and the Superscript II reverse transcriptase (Invitrogen, Cat. No. 18064-014). The equivalent of 20 ng RNA was used in a real-time PCR reaction. Primer sequences were designed by Primer Express software (Applied Biosystems) (see primer table for sequence). Real time PCR utilizing SYBR green fluorescent reagent (Eurogentec) was run in the iCycler machine from BioRad. The relative amounts of mRNA were calculated from the comparative threshold cycle values using the housekeeping gene actin as a control. Quantification of UPR is performed through expression analysis of the UPR-target gene KAR2. A 3 to 7 fold higher expression of KAR2 was obtained when comparing clones that were not induced as compared to the same clones that were induced with methanol (FIG. 19).

(236) The relative amount of HAC1 mRNA from two additional clones 6 and clone 8 was determined by quantitative PCR and compared with the relative amount of mRNA of Kar2. A strong induction of HAC1 was observed in both clones. The relative amount of KAR2 mRNA appeared to correlate with the relative amount of HAC1 mRNA, higher expression levels of HAC1 lead to higher expression level of KAR2 (FIG. 20).

(237) Cell death studies of the methanol-induced cultures were performed using fluorescence flow cytometry (FFC) and compared to cell death of non-induced cultures. Ten thousand cells were measured per analysis. Cells were analyzed on the FACScalibur (Becton Dickinson) after 12, 36 and 48 hours of induction. No cell death was observed. The GlycoSwitchM5 (GSM5) strain has as main core type glycan structures mainly Man.sub.5GlcNAc.sub.2 (structural formula IV; FIG. 4). In order to check if Hac1p induction has an influence on the N-glycan structure a DSA-FACE analysis was performed of 1 ml of the culture medium. The glycan profiles obtained after 48 hours of induction of spliced Hac1p are similar to the profile of the parental GSM5 strain. A growth curve was made in order to check if the induction of Hac1p impairs the growth of P. pastoris. No growth defect was seen of the Hac1p induced strain compared to the empty vector transformed strain (FIG. 22).

Example 9

Expression of YlMNN6

(238) In S. cerevisiae, MNN6 transfers phosphomannose residues to N-glycans. Therefore, overexpression of YlMNN6 in Y. lipolytica could lead to increased phosphorylation. Moreover, an additional effect on phosphorylation Y. lipolytica be obtained by over expressing YlMNN4 and YlMNN6. The YlMNN6 coding region (Genbank Accession No. XM_499811, Genolevures Ref: YALI0A06589g) was PCR amplified from the genome using PCR primers YlMNN6 BamHI fw (GCGGGATCCATGCACAACGTGCACGAAGC (SEQ ID NO:34)) and YlMNN6 AvrII rv (GCGCCTAGGCTACCAGTCACTATAGTTCTCC (SEQ ID NO:35)) and cloned in the pYHmAX expression vector for expression under control of the hp4d promoter (FIG. 21). The plasmid was transformed to the Y. lipolytica strain MTLY60 using zeta sequences to improve random integration. Secreted glycoproteins were collected from cell clones that grew on medium without uracil and the composition of the glycans synthesized the glycoproteins was analyzed using DSA-FACE. However, no increased phosphorylation was observed (FIG. 22).

Example 10

Effects of Hac1p Expression

(239) Evaluation of Hac1p Overexpression on the Secretion of Heterologous Proteins.

(240) Vectors containing the hygromycin resistance marker and the spliced HAC1 cDNA under control of the inducible AOX1 promoter (pPIChygppHAC1spliced) or under control of the constitutive GAP promoter (pGAPhygHAC1ppspliced) were transformed to a GS115 strain expressing a mIL-10 protein under the control of the inducible AOX1 promoter. P. pastoris cells were transformed according to the electroporation protocol from the Pichia Expression kit (Invitrogen Cat. No. K1710-01, Invitrogen, Carlsbad, Calif.). The vectors were linearized in the AOX1 or GAP promoter to target the integration of the Hac1p gene to respectively the AOX1 or GAP locus. Integration of the plasmid into the host genome was confirmed using PCR.

(241) Precultures (5 ml) from positive identified clones were grown in YPD for 24 hours. The concentration (OD) at a wavelength of 600 nm (OD.sub.600) of the cells in the cultures was measured and cultures were diluted to an OD.sub.600 of 1 in 2 ml of BMGY media in each well of a 24 well plate. Cultures were grown in BMGY for 48 hours, washed twice with BMY, and then induced for 24 hours in BMMY. Every 8 to 12 hours, cultures were re-fed with medium containing 1% methanol (final concentration). After induction, the supernatant of the cells was harvested and the protein from 1 ml of the supernatant was precipitated using trichloroacetic acid (TCA). The precipitated protein was subjected to 15% SDS-PAGE.

(242) From the SDS-PAGE, clonal variation in the expression of at least one proteinmIL-10was observed between the different clones. For example, for the clones expressing the Hac1p protein constitutively (under control of GAP promoter), no improvement in expression level was observed, whereas for the clones expressing the Hac1p inducibly (AOX1 promoter), two clones could be identified that exhibited higher expression levels of the mIL-10 protein (FIG. 40 and FIG. 41). Expression of mIL-10 by each of the clones was compared to the expression of mIL-10 produced by a reference GS115 mL-10 expressing strain.

(243) A new induction was performed for these clones. A preculture grown for 24 hours was diluted to OD 1 in 20 ml BMGY in a baffled flask. Cells were grown for 48 hours in BMGY, washed twice, and then induced in BMMY. Cultures were re-fed with medium containing 1% methanol every 8-12 hours. After induction, the supernatant of the cells was harvested and the protein from 1 ml of the supernatant was precipitated using TCA. Prior to subjecting the precipitated protein to 15% SDS-PAGE, the protein was treated with PNGase F (or not) to remove all glycosylation (FIG. 41). SDS-PAGE resolved proteins from the supernatant of Hac1p-expressing strains contained a prominent band of 75 kDa, which is not present in the reference strain. This band was identified by means of mass spectrometry as being Kar2p, which is the most prominent UPR target gene. It could be shown using the cytokine bead array (CBA) that simultaneous inducible expression of the Hac1p and the mIL-10 protein can lead to a 2 fold higher expression of the mIL-10 protein (clone 1, FIG. 41). CBA was performed on endoH treated mIL-10 protein.

(244) Evaluation of Hac1p Overexpression on the Surface Expression of Heterologous Proteins.

(245) Vectors containing the hygromycin resistance marker and the spliced HAC1 cDNA under control of the inducible AOX1 promoter (pPlChygppHAC1spliced) or under control of the constitutive GAP promoter (pGAPhygHAC1 ppspliced) were transformed to GlycoswitchMan5 strains expressing a mature human interferon-beta/alpha-agglutinin fusion protein, a mature mouse interferon gamma/alpha-agglutinin fusion protein, a mature human erythropoietin/alpha-agglutinin fusion protein, or a fusion protein of alpha-agglutinin and the lectin-like domain of mouse thrombomodulin, each of which were under the control of the inducible AOX1 promoter. P. pastoris cells were transformed according to the electroporation protocol from the Pichia Expression kit (Invitrogen Cat. No. K1710-01). The vectors were linearized in the AOX1 or GAP promoter to target the Hac1p gene to respectively the AOX1 or GAP locus for integration. Integration of the plasmid into the host genome was confirmed using PCR.

(246) Precultures (5 ml) from positive identified clones were grown in YPD for 24 hours. The OD.sub.600 was measured and cultures were diluted to OD.sub.600 of 11n 2 ml BMGY in each well of a 24 well plate. The cultures were grown in BMGY for 24 hours, washed twice with dionized water, and then induced (using culture medium containing 1% methanol) for 24 hours in BMMY. Surface expression was demonstrated by indirect immunostaining with an antibody specific for the V5-epitope, which is fused C-terminally to the V.sub.HH coding sequence. After induction, 10.sup.7 cells in 1 ml PBS (pH 7.2), supplemented with 0.1% bovine serum albumin (PBS/BSA), were incubated with 1 l/ml of the anti-V5 antibody (1 g/l; Invitrogen), washed with PBS/BSA, and incubated with 1 l/ml Alexa fluor 488-labeled goat anti-mouse IgG (1 g/ml; Molecular Probes). After washing twice with PBS/BSA, the cells were analyzed by flow cytometry (Table 5).

(247) TABLE-US-00005 TABLE 5 MFI values determined by flow cytometry Pichia + Pichia + Expressed Protein Wild-type Pichia AOX GAP GAP HAC mouse Interferon- 36.6 19.9 42.8 gamma human EPO 59.5 45.8 66.5 interferon-beta 22.6 12.4 14.4 human 95.5 184.1 67.8 thrombomodulin MFI = Mean Fluorescence Intensity obtained from the flow cytometry analysis.

(248) For the strains expressing the Hac1p protein constitutively no improvement, or very minor differences, could be observed in surface expression levels for all four proteins compared to reference strains expressing the surface protein alone. In cells expressing human interferon-beta, a significant reduction of surface expression levels was observed. For the strains overexpressing the inducible Hac1p (Table 5) the following could be observed: 1) in the human interferon-gamma surface expressing strain, a 1.8-fold lowering of the surface expression levels could be observed compared to the reference strain expressing alone the human interferon-beta a-agglutinin fusion; 2) for the strain surface-expressing human erythropoietin a-agglutinin fusion protein, a 1.3-fold lowering of the surface expression levels could be observed compared to the reference strain; 3) in the strain surface expressing human interferon-beta, no difference of the surface expression levels could be observed compared to the reference strain; and 4) in the strain surface expressing mouse thrombomodulin lectin-like domain, an 1.9-fold increase of the surface expression levels could be observed compared to the reference strain.

(249) Effect of Overexpression of Hac1p on Phosholipid Synthesis.

(250) To determine whether overexpression of the Hac1p product (produced from the spliced HAC1 cDNA) had an effect of lipid metabolism in P. pastoris, cells were transformed with the above-described spliced HAC1 cDNA and the effect of Hac1p on lipid metabolism in the cells was determined by electron microscopy analysis. Cells were grown for 48 hours on BMGY, washed once with PBS, and then grown for another 48 hours on BMMY. The cells were next cultured in medium containing 1% methanol every 8 to 12 hours. The cells were then prepared for electron microscopy according to the method of Baharaeen (Baharaeen et al. (2004) Mycopathologia). Briefly, a primary fixative containing glutaraldehyde (3%) and para-formaldehyde (1.5% buffered in 0.05 M sodium cacodylate at pH 7.2) was contacted with the cells for 2 hours on ice. The cells were then washed three times for 20 minutes with 0.05 M sodium cacodylate. After washing, the cells were contacted with a 6% potassium permanganate solution for one hour at room temperature and then washed with 0.05 M sodium cacodylate three times for 20 minutes. The results of the experiment are presented in FIG. 54. Overexpression of the Hac1p product (produced from the spliced HAC1 cDNA) in P. pastoris lead to the formation of discrete regions of stacked membranes as can be shown in the electron micrograph (EM) depicted in FIG. 54. These results demonstrate that overexpression of Hac1p, by way of its transcriptional activation of genes involved in lipid metabolism, indeed has a strong effect on lipid metabolism in P. pastoris.

Example 11

Expression of ManHDEL

(251) For Man.sub.5GlcNAc.sub.2 to be bound to glycoproteins expressed by the och1 strain, an -1,2-mannosidase can be expressed to cleave Man.sub.8GlcNAc.sub.2 to Man.sub.5GlcNAc.sub.2 (i.e., Golgi type -1,2-mannosidase activity). This mannosidase should be targeted to the secretion system. Trichoderma reesei -1,2-mannosidase (Genbank accession no. AF212153), fused to the S. cerevisiae prepro mating factor and tagged with a HDEL sequence, is able to trim Man.sub.8GlcNAc.sub.2 to Man.sub.5GlcNAc.sub.2 in vivo in Pichia pastoris as well as in Trichoderma reesei and Aspergillus niger. An expression construct was made to overexpress MFManHDEL (S. cerevisiae a-mating factor prepro fused to Trichoderma reesei -1,2-mannosidase tagged with an HDEL sequence) in Y. lypolytica under control of the constitutive hp4d promoter (FIG. 23). The expression cassette was transformed into the cells after digestion of the plasmid pYHmAXManHDEL with the restriction enzyme NotI, followed by isolation of the desired fragment using agarose-gel electrophoresis.

(252) Glycans derived from mannoproteins from the transformed cells were analysed using DSA-FACE. Only A minor fraction of Man.sub.8GlcNAc.sub.2 was converted to Man.sub.5GlcNAc.sub.2 (FIG. 24). Incomplete conversion of Man.sub.8GlcNAc.sub.2 to Man.sub.5GlcNAc.sub.2 could have been due to a non-optimal secretion signal. Therefore, the Saccharomyces cerevisiae secretion signal was replaced with the secretion signal derived from the well expressed Yarrowia lipolytica LIP2 (LIP2pre). The LIP2pre sequence was made by hybridizing the synthetic oligonucleotides LIP2pre fw GATCCATGAAGCTTTCCACCATCCTCTTCACAGCCTGCGCTACCCTGGCCGCGGTAC (SEQ ID NO:66) and Lip2prepro rv GTACCGGCCGGCCGCTTCTGGAGAACTGCGGCCTCAGAAGGAGTGATGGGGGAAGG GAGGGCGGC (SEQ ID NO:67) and cloning the DNA into pYLHmA vector (at the BamHI/AvrII sites) resulting in the following construct: pYLHUdL2pre. The ManHDEL coding sequence was PCR amplified from pGAPZMFManHDEL using oligonucleotides ManHDEL Eco471II fw (GGCAGCGCTACAAAACGTGGATCTCCCAAC (SEQ ID NO:68)) and ManHDEL AvrII rv (GGCCCTAGGTTACAACTCGTCGTGAGCAAG (SEQ ID NO:69)) and cloned in pYLHUdL2pre. The construction strategy is depicted in FIGS. 25A and 25B. The expression cassette (with L2preManHDEL under control of the constitutive promoter hp4d) was transformed to Yarrowia lipolytica och1 strain after digestion of the plasmid with NotI and isolation of the correct fragment (see above). Glycans derived from secreted proteins were analysed via DSA FACE. Some conversion of Man.sub.8GlcNAc.sub.2 to Man.sub.5GlcNAc.sub.2 occurred, but the reaction was incomplete (Man.sub.8GlcNAc.sub.2 was present as well as intermediate products Man.sub.7GlcNAc.sub.2 and Man.sub.6GlcNAc.sub.2; FIG. 26).

(253) To further improve the trimming of Man.sub.8GlcNAc.sub.2, Man.sub.7GlcNAc.sub.2, and Man.sub.6GlcNAc.sub.2 to Man.sub.5GlcNAc.sub.2, the Trichoderma reesei -1,2 mannosidase was codon optimized for expression in Yarrowia lipolytica (SEQ ID NO:9; FIG. 42) and fused to the LIP2 pre signal sequence. This fusion construct was expressed under control of 4 different promoters: (i) hp4d, (ii) GAP (SEQ ID NO:10; FIG. 43), (iii) POX2, and (iv) TEF1. Final expression plasmids were named pYLHUXdL2preManHDEL (SEQ ID NO: 11; FIGS. 44A-C) pYLGUXdL2preManHDEL (SEQ ID NO:12; FIGS. 45A-C) pYLPUXdL2preManHDEL (SEQ ID NO:13; FIGS. 46A-C) pYLTUXdL2preManHDEL (SEQ ID NO:14; FIGS. 47A-C). All 4 plasmids were transformed to Yarrowia lipolytica MTLY60 och1 strain (described in example 2) after cutting the plasmid with NotI and isolation of the fragment containing the ManHDEL expression cassette. Transformed strains with the ManHDEL under control of the hp4d, GAP and TEF promoter (plasmids pYLHUXdL2preManHDEL, pYLGUXdL2preManHDEL and pYLTUXdL2preManHDEL) were grown in YPD.

(254) Glycans derived from secreted proteins of transformed strains were analyzed by DSA FACE. Results are represented in FIG. 48. Alternatively, transformants (including a transformant that had integrated the pYLPUXdL2preManHDEL plasmid) were grown in medium containing oleic acid (protein production conditions) and glycans were analysed via DSA-FACE. Data for one of the vectors, pYLTUXdL2preManHDEL, are presented in FIG. 49. As can be concluded from the data, by 48 hours of culture, almost all glycans are converted to Man.sub.5GlcNAc.sub.2.

Example 12

Culturing Conditions for POX2 Promoter Controlled Gene Expression

(255) Cultures were started from a single colony of a fresh plate and grown overnight in 10 mL YPD at 28 C. in a 50 mL tube in an orbital shaker at 250 rpm. Next, a 250 mL shake flask containing 22 mL of production medium (including 2.5 mL oleic acid emulsion) was inoculated with the preculture at a final OD600 of 0.2. This culture was incubated at 28 C. in an orbital shaker at 250 rpm. Samples of the culture were taken at various time points over a 96 hour culture.

(256) The Oleic Acid Emulsion (20%) was Made the Method as Follows:

(257) Add to a sterile 50 ml vessel;

(258) 20 ml sterile water;

(259) 5 ml oleic acid; and

(260) 125 l Tween 40.

(261) Sonication resulting in the formation of the emulsion was performed for one minute at 75 Hz.

(262) The Production Medium Consisted of the Following:

(263) 1% yeast extract;

(264) 2% trypton;

(265) 1% glucose; and

(266) 50 mM phosphate pH 6.8.

Example 13

Expression of Human Glucocerebrosidase

(267) Human glucocerebrosidase (GLCM, Swiss Prot entry nr: P04062) was chemically synthesized as a codon-optimized cDNA for expression in Yarrowia lipolytica (SEQ ID NO:15; FIG. 50).

(268) The coding sequence for the mature protein was fused to the coding sequence of the LIP2 pre signal sequence. This fusion construct was cloned under control of the oleic acid inducible POX2 promoter. The resulting plasmid was named pYLPUXL2preGLCM (=pRAN21)). Before transformation, the plasmid was digested with NotI and the fragment containing the expression cassette was isolated and transformed to Yarrowia lipolytica strain MTLY60, MTLY60och1 (described in Example 2 above), and MTLY60och1ManHDEL (described in Example 11). Transformants obtained in these three strains were grown as described in Example 12. Proteins were precipitated from the supernatant as described above, subjected to SDS-PAGE, and immunoblotted using a rat monoclonal anti-glucocerebrosidase antibody (Alessandrini et al. (2004) J. Invest. Dermatol 23(6):1030-6). An exemplary immunoblot analysis is depicted in FIG. 51. It can be appreciated from FIG. 51 that in a och1 disrupted strain no smearing occurs (lanes 1, 2, and 3), whereas heterogeneity of the protein is seen as a smear in WT cells (lanes 4 and 6). No smearing of protein was observed in protein obtained from a strain of yeast expressing ManHDEL. These results demonstrate that a more homogeneous population of a target protein can be obtained using the genetically engineered Yarrowia lipolytica cells MTLY60och1 and MTLY60och1ManHDEL.

Example 14

Expression of Human Erythropoietin

(269) Human erythropoietin (Epo, Swiss Prot entry nr: P01588) encoding cDNA was chemically synthesized codon optimized for expression in Yarrowia lipolytica (SEQ ID NO:16; FIG. 52). The cDNA coding sequence for the mature protein was fused to the coding sequence of the LIP2 pre signal sequence. This fusion construct was cloned under control of the oleic acid inducible POX2 promoter. The resulting plasmid was named pYLPUXL2prehuEPO. Before transformation the plasmid was cut NotI and the fragment containing the expression cassette was isolated and transformed to Yarrowia lipolytica strain MTLY60och1 (described in Example 2). Transformant candidates were grown as described in Example 12 and secreted proteins were analysed by western blot after SDS PAGE using a monoclonal mouse anti human Epo antibody obtained from R&D systems (clone AE7A5). The EPO product obtained from the cells exhibited very homogenous glycosylation.

Example 15

Expression of Human -Galactosidase A

(270) Human -galactosidase A (AGAL, Swiss Prot entry nr: P06280) encoding cDNA was chemically synthesized as a codon-optimized cDNA for expression in Yarrowia lipolytica (SEQ ID NO:17; FIG. 53). FIGS. 12A-12H contain the cloning strategy of the galactosidase.

(271) The cDNA coding sequence for the mature protein was fused to the coding sequence of the LIP2 pre signal sequence. This fusion construct was cloned under control of the oleic acid inducible POX2 promoter. The resulting plasmid was named pYLPUXL2preaGalase). Before transformation the plasmid was cut NotI and the fragment containing the expression cassette was isolated and transformed to Yarrowia lipolytica strain MTLY60 and MTLY60och1MNN4 (described in Example 4). Transformants obtained in these two strains were grown as described in Example 12. Extracellular proteins obtained from transformants were analyzed by immunoblot after SDS-PAGE analysis. Two antibodies specific for -galactosidase A (a chicken polyclonal antibody obtained from Abcam (ab28962) and a rabbit polyclonal antibody obtained from Santa Cruz Biotechnology (sc-25823)) were used to detect the expressed human a-galactosidase A protein.

Example 16

Expression of Mannosidase in WT Yarrowia lipolytica

(272) To determine whether expression of MannosidaseHDEL alone (that is in cells containing a functional OCH1 gene) could lead to a more homogenous glycosylation of proteins expressed by fungal cells, an expression cassette containing a nucleic acid encoding MannosidaseHDEL (see Example 11) was transformed into wild-type Yarrowia lipolytica pold cells. Glycans derived from secreted proteins obtained from the cells were analysed by DSA-FACE (FIG. 55). The analyzed glycans consisted mainly of Man.sub.5GlcNAc.sub.2 and a minor part Man.sub.6GlcNAc.sub.2. These results demonstrate that expression of MannosidaseHDEL alone, in the absence of any disruption of the OCH1 gene, leads to a more homogenous glycosylation of proteins expressed by Yarrowia lipolytica.

Other Embodiments

(273) While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.