METHOD FOR PRODUCING GAMMA-GLUTAMYL-VALYL-GLYCINE

20180195103 ยท 2018-07-12

Assignee

Inventors

Cpc classification

International classification

Abstract

A microorganism useful as an expression host for -Glu-Val synthetase and a method for producing -Glu-Val-Gly using -Glu-Val synthetase expressed in the microorganism are provided. By using -Glu-Val synthetase expressed in a bacterium, such as Escherichia bacteria, modified so that the activity of a protein encoded by a ybdK gene (YBDK) is reduced as an expression host, -Glu-Val-Gly is produced from Glu, Val, and Gly as raw materials.

Claims

1. A bacterium, wherein the bacterium has been modified so that the activity of a protein encoded by a ybdK gene is reduced as compared with a non-modified strain, wherein the bacterium has a gene encoding -glutamylvaline synthetase, and wherein the -glutamylvaline synthetase shows a ratio of -glutamylvaline synthetase activity to -glutamylglycine synthetase activity of 3.0 or higher.

2. The bacterium according to claim 1, wherein the protein is a protein defined in (a), (b), or (c) mentioned below: (a) a protein comprising the amino acid sequence of SEQ ID NO: 16; (b) a protein comprising the amino acid sequence of SEQ ID NO: 16 but including substitution, deletion, insertion, or addition of 1 to 10 amino acid residues, and having -glutamylglycine synthetase activity; (c) a protein comprising an amino acid sequence showing an identity of 90% or higher to the amino acid sequence of SEQ ID NO: 16, and having -glutamylglycine synthetase activity.

3. The bacterium according to claim 1, wherein the activity of the protein is reduced by attenuating the expression of the ybdK gene, or by disrupting the ybdK gene.

4. The bacterium according to claim 1, wherein the -glutamylvaline synthetase is a protein defined in (a), (b), or (c) mentioned below: (a) a protein comprising the amino acid sequence of SEQ ID NO: 18, 20, or 22; (b) a protein comprising the amino acid sequence of SEQ ID NO: 18, 20, or 22 but including substitution, deletion, insertion, or addition of 1 to 10 amino acid residues, and having -glutamylvaline synthetase activity; (c) a protein comprising an amino acid sequence showing an identity of 90% or higher to the amino acid sequence of SEQ ID NO: 18, 20, or 22, and having -glutamylvaline synthetase activity.

5. The bacterium according to claim 1, wherein the -glutamylvaline synthetase is a mutant glutamate-cysteine ligase having a mutation for an amino acid residue or amino acid residues corresponding to one or more amino acid residues selected from those mentioned below in a wild-type glutamate-cysteine ligase, and having the -glutamylvaline synthetase activity; L135, Q144, Y241, N243, Y300.

6. The bacterium according to claim 5, wherein the mutation includes a mutation corresponding to one or more mutations selected from those mentioned below: L135(I, F, M, V, G, A, W, K, H, R, C, N, S, T), Q144(F, A, N, S, D, T, R, H, G, K, Y, W, C, M, P, V, L, I), Y241(A), N243(I, W, K, R, H), Y300(A, H, R, K).

7. The bacterium according to claim 5, wherein the mutation includes a mutation corresponding to any one of the following mutations: L135I/Q144R, L135I/Q144D, L135I/Q144A, L135I/Q144L, L135I/N243W, L135I/N243F, L135F/Q144A, L135F/N243W, L135M/Q144R, L135M/Q144A, L135M/Q144L, L135M/N243W, L135M/N243F, L135M/Q144H, L135M/Q144N, L135M/N243Y, L135M/N243R, L135M/N243C, L135V/Q144R, L135V/Q144D, L135V/Q144A, L135V/Q144L, L135V/Q144V, L135V/Q144K, L135V/Q144C, L135V/Q144T, L135H/Q144R, L135G/Q144L, L135A/Q144L, L135V/N243W, L135V/N243F, L135V/N243P, Q144R/N243W, Q144R/N243F, Q144D/N243W, Q144D/N243F, Q144A/N243W, Q144A/N243F, Q144L/N243W, Q144L/N243F, L135M/Q144F, L135M/N243A, L135V/N243G, L135V/N243A, L135V/N243L, L135V/N243Y, L135V/N243K, L135V/N243R, L135V/N243H, L135V/N243D, L135V/N243E, L135V/N243C, L135V/N243Q, L135V/N243S, L135V/N243T, L135V/Q144I, L135V/Q144P, L135V/Q144W, L135V/Q144H, L135V/Q144E, L135V/Q144N, L135V/Q144S, L135K/Q144L, L135H/Q144L, L135D/Q144L, L135C/Q144L, L135Q/Q144L, L135N/Q144L, L135S/Q144L, L135T/Q144L.

8. The bacterium according to claim 5, wherein the mutation includes a mutation corresponding to any one of the following mutations: L135(I, M, V, G, A, K, H, C, N, S, T), Q144(F, A, S, D, T, R, H, K, Y, W, C, M, P, V, L, I), N243(R, H). Y300(R, K), L135I/Q144R, L135I/Q144D, L135I/Q144A, L135I/Q144L, L135I/N243W, L135I/N243F, L135F/Q144A, L135M/Q144R, L135M/Q144A, L135M/Q144L, L135M/N243W, L135M/Q144H, L135M/Q144N, L135M/N243C, L135V/Q144R, L135V/Q144D, L135V/Q144A, L135V/Q144L, L135V/Q144V, L135V/Q144K, L135V/Q144C, L135V/Q144T, L135H/Q144R, L135G/Q144L, L135A/Q144L, L135V/N243W, L135V/N243F, L135V/N243P, Q144R/N243W, Q144D/N243W, Q144A/N243W, Q144A/N243F, Q144L/N243W, Q144L/N243F, L135M/Q144F, L135M/N243A, L135V/N243G, L135V/N243A, L135V/N243L, L135V/N243Y, L1I35V/N243K, L135V/N243R, L135V/N243H, L135V/N243D, L135V/N243E, L135V/N243C, L135V/N243Q, L135V/N243S, L135V/N243T, L135V/Q144P, L135V/Q144W, L135V/Q144H, L135V/Q144E, L135V/Q144N, L135V/Q144S, L135D/Q144L, L135C/Q144L, L135N/Q144L, L135S/Q144L, L135T/Q144L.

9. The bacterium according to claim 5, wherein the wild-type glutamate-cysteine ligase is protein defined in (a), (b), or (c) mentioned below: (a) a protein comprising the amino acid sequence of SEQ ID NO: 24; (b) a protein comprising the amino acid sequence of SEQ ID NO: 24 but including substitution, deletion, insertion, or addition of 1 to 10 amino acid residues. (c) a protein comprising an amino acid sequence showing an identity of 90% or higher to the amino acid sequence of SEQ ID NO: 24.

10. The bacterium according to claim 1, wherein the bacterium has been further modified so that the activity of a protein encoded by a gshA gene is reduced as compared with a non-modified strain.

11. The bacterium according to claim 1, wherein the bacterium has been further modified so that the activity of -glutamyltransferase is reduced as compared with a non-modified strain.

12. The bacterium according to claim 1, wherein the bacterium has a gene encoding glutathione synthetase.

13. The bacterium according to claim 1, wherein the bacterium is an Escherichia bacterium.

14. The bacterium according to claim 1, wherein the bacterium is Escherichia coli.

15. A method for producing -Glu-Val-Gly and or a salt thereof, the method comprising: a step of allowing -glutamylvaline synthetase and glutathione synthetase to act on Glu, Val, and Gly to generate -Glu-Val-Gly. wherein the -glutamylvaline synthetase is an enzyme obtained by using the bacterium according to claim 1 as an expression host.

16. The method according to claim 15, wherein the glutathione synthetase is an enzyme obtained by using the bacterium as an expression host.

17. The method according to claim 15, wherein the -glutamylvaline synthetase is a purified enzyme.

18. The method according to claim 15, wherein the -glutamylvaline synthetase is an immobilized enzyme.

19. The method according to claim 15, wherein the -glutamylvaline synthetase is an enzyme contained in a culture broth of the bacterium, cultured cells of the bacterium, or a processed product of the cells.

20. The method according to claim 15, wherein the glutathione synthetase is an enzyme contained in a culture broth of a microorganism having the enzyme, cultured cells of the microorganism, or a processed product of the cells.

21. The method according to claim 15, wherein the -glutamylvaline synthetase and glutathione synthetase are enzymes contained in a culture broth of the bacterium, cultured cells of the bacterium, or a processed product of the cells.

22. The method according to claim 15, wherein the step is carried out in the presence of ATP.

23. The method according to claim 15, wherein the step is carried out in the presence of a divalent metal ion.

Description

EXAMPLES

[0302] Hereafter, the present invention will be more specifically explained with reference to examples.

Example 1: Construction of Expression Plasmid for ybdK Gene

[0303] An expression plasmid pSF12-EcybdK for the ybdK gene of Escherichia coli MG1655 (ATCC 47076) was constructed by the following procedure. The nucleotide sequence of the ybdK gene and the amino acid sequence of YBDK encoded by this gene are shown as SEQ ID NOS: 15 and 16, respectively. With pSF12-EcybdK, YBDK is expressed with a His tag added to the C-terminus.

[0304] First, a pUC18-derived plasmid pSF12_ggt (WO2013/051685A1) containing the ggt gene encoding -glutamyl transpeptidase derived from the Escherichia coli W3110 strain (ATCC 27325) and a rpoH promoter was digested with NdeI/PstI, and purified with QIAquick Gel Extraction Kit (Qiagen), to obtain a fragment of about 3.0 kb.

[0305] Then, PCR was carried out by using the genomic DNA of the Escherichia coli MG1655 strain as the template, and PrimeSTAR Max Polymerase (Takara Bio) according to the protocol of the manufacturer, to obtain a fragment of about 1.2 kb containing the ybdK gene. As the primers, the combination of the primers of SEQ ID NOS. 1 and 2 (Table 1) was used.

[0306] Then, a fragment of about 3.0 kb obtained by digesting pSF12_ggt with NdeI/PstI and the fragment, of about 1.2 kb obtained by PCR and containing the ybdK gene were fused by using In-Fusion HD Cloning Kit (Clontech) according to the protocol of the manufacturer. The Escherichia coli JM109 strain was transformed with the reaction mixture, applied to LB agar medium (1.0% (w/v) peptone, 0.5% (w/v) yeast extract, 1.0% (w/v) NaCl, and 1.5% (w/v) agar) containing 100 g/mL of ampicillin sodium salt (Amp), and cultured at 30 C. for 20 hours. Plasmids were extracted from the colonies of the grown transformants by a known method, the nucleotide sequences thereof were confirmed by using 3130 Genetic Analyzer (Life Technologies), and a plasmid having the objective structure was designated as pSF12-EcybdK.

TABLE-US-00001 TABLE1 SEQ ID NO Nucleotidesequence(5->3) 1 taaggaggaatccatATGCCATTACCCGATTTTCA 2 cttgcatgcctgcagTTAatgatgatgatgatgatgGTCACCGGC CCAGATCTCACAATG

Example 2: Purification of YBDK Derived from Escherichia coli MG1655 Strain and Having His tag Added to C-Terminus

[0307] The JM109 strain harboring the plasmid pSF12-EcybdK, which was obtained in Example 1, was inoculated into 3 mL of LB medium containing 100 g/mL of Amp, and cultured at 30 C. for 20 hours with shaking by 120 times/minute of reciprocal movement, to obtain a preculture broth. The obtained preculture broth in a volume of 150 L was inoculated into 15 mL of TB medium (1.2% (w/v) tryptone, 2.4% (w/v) yeast extract, 0.4% (w/v) glycerol, 0.23% (w/v) KH.sub.2PO.sub.4, and 1.25% (w/v) K.sub.2HPO.sub.4) containing 100 g/mL of Amp contained in a 70 mL-volume test tube ( 25 mm), and cultivation was carried out at 30 C. for 20 hours with shaking by 120 times/minute of reciprocal movement. Cells were collected by centrifugation (4 C., 12,000 rpm, 5 minutes). The obtained cells were suspended in 0.2 mL of a buffer (20 mM Tris-HCl (pH 8.0), 300 mM NaCl, 10 mM imidazole, and 15% glycerol), and disrupted by ultrasonication with cooling. The obtained disrupted cell suspension was centrifuged (4 C., 29,100g, 10 minutes), and the obtained supernatant was used as a cell-free extract.

[0308] The obtained cell-free extract was applied to Nickel Sepharose 6 Fast Flow Beads (GE Healthcare) equilibrated beforehand with a buffer (20 mM Tris-HCl (pH 8.0), 300 mM NaCl, 10 mM imidazole, and 15% glycerol), and the enzyme was eluted with an elution buffer (20 mM Tris-HCl (pH 8.0), 300 mM NaCl, 250 mM imidazole, and 15% glycerol) to obtain an active fraction. This active fraction was used as a purified YBDK for the following experiments.

Example 3: Production of -Glutamyl Dipeptide with Purified YBDK

[0309] The -Glu-Val synthetic activity and -Glu-Gly synthetic activity of the purified YBDK obtained in Example 2 were measured.

[0310] The measurement conditions of the -Glu-Val synthetic activity were as follows. Composition of the reaction mixture consisted of 10 mM glutamic acid, 10 mM valine, 10 mM ATP, and 10 mM MnSO4 in 100 mM Tris-HCl (pH 7.0). The volume of the reaction mixture was 0.2 mL, and the enzymatic reaction was started by adding the purified enzyme. At this time, the purified YBDK was added to the reaction mixture at a concentration of 0.1 g/L. The reaction temperature was 30 C., and the reaction time was 30 minutes. For terminating the reaction, 0.2 mL of 200 mM sulfuric acid was added per 0.2 mL of the reaction mixture. After completion of the reaction, the generated -Glu-Val was quantified by HPLC. The enzymatic activity for generating 1 mol of -Glu-Val in 1 minute under the aforementioned conditions was defined as 1 U of the -Glu-Val synthetic activity.

[0311] The quantification conditions for -Glu-Val were as follows. Synergi 4 Hydro-RP 80A produced by Phenomenex (particle size 4 microns, inner diameter 4.6 mm, length 2.50 mm) was used as the column. As the eluent, a mixture consisting an eluent A (50 mM sodium dihydrogenphosphate (pH 2.5, adjusted with phosphoric acid)) and eluent B (1:1 (v/v) mixture of eluent A and acetonitrile) in a ratio of 93:7 (v/v) was used. The flow rate was 10 mL/minute, column temperature was 40 C., and UV detection wavelength was 210 nm.

[0312] When the -Glu-Gly synthetic activity was measured, valine in the aforementioned reaction mixture was replaced with glycine, and 0.025 g/L of the purified YBDK was added to the reaction mixture to perform the enzymatic reaction. The reaction was terminated in the same manner as described above, and then the generated -Glu-Gly was quantified. The enzymatic activity for generating 1 U mol of -Glu-Gly in 1 minute under the aforementioned conditions was defined as 1 U of the -Glu-Gly synthetic activity.

[0313] The quantification conditions for -Glu-Gly were as follows. Inertsil ODS-3 produced by GL Science (particle size 5 microns, inner diameter 4.6 mm, length 250 mm) was used as the column. As the eluent, an eluent C (100 mM potassium dihydrogenphosphate, 5 mM sodium octanesulfonate (pH 2.2, adjusted with phosphoric acid)) was used. The flow rate was 1.5 m /minute, column temperature was 40 C., and UV detection wavelength was 210 nm.

[0314] By the methods described above, the amounts of generated -Glu-Val and -Glu-Gly were quantified, and specific activities were calculated. The results are shown in Table 2. In the table, data in the columns of Reaction (A), Reaction (B), and (B)/(A) indicated the specific activities of the -Glu-Gly synthetic activity, specific activities of the -Glu-Val synthetic activity, and ratios of the specific activity of -Glu-Val synthetic activity to the specific activity of -Glu-Gly synthetic activity, respectively.

TABLE-US-00002 TABLE 2 Reaction (A) Reaction (B) Glu + Gly + ATP Glu + Val + ATP Enzyme (origin) (U/mg) (U/mg) (B)/(A) YBDK (E. coli) 0.11 0.29 2.6

Example 4: Construction of Triple-Gene-Disruption Strain Deficient in ggt, gshA, and ybdK Genes Derived from Escherichia coli JM109 Strain

[0315] (1) Construction of ggt-Gene Disruption Strain Derived from Escherichia coli JM109 Strain

[0316] A strain not producing GGT was constructed from the Escherichia coli JM109 strain as the parent strain. The nucleotide sequence of the ggt gene and the amino acid sequence of GGT encoded by the gene are shown in SEQ ID NOS: 25 and 26, respectively.

[0317] Gene disruption was carried out by using a combined method (WO2005/010175) of the method called Red-driven integration, which was first developed By Datsenko and Wanner (Proc. Natl. Acad. Sci. USA, 2000, vol. 97, No. 12, pp 6640-6645) and the excision system originated from phage (J. Bacteriol. 2002 September; 184(18): 5200-3. Interactions between integrase and excisionase in the phage lambda excisive nucleoprotein complex. Cho E H, Gumport R I, Gardner J F.) According to the Red-driven integration method, a target gene on a chromosome can be replaced with an antibiotic resistance gene by using a PCR product containing the antibiotic resistance gene, which product was obtained by PCR using synthetic oligonucleotides in each of which a sequence corresponding to a part of the target gene is designed on the 5 side, and thereby a gene disruption strain can be constructed. In addition, by using the excision system originated from phage in combination, the antibiotic resistance gene integrated into the gene disruption strain can be removed.

[0318] As the template for the Red-driven integration method, pMW118-attL-Cm-attR (WO2006/078039) was used. pMW118-attL-Cm-attR (WO2006/078039) is a plasmid in which attL and attR genes, which are attachment sites of phage, and a cat gene, which is an antibiotic resistance gene, have been inserted into pMW118 (Nippon Gene Co., Ltd.) in the order of attL-cat-attR. PCR was carried out by using as primers synthetic oligonucleotides having sequences corresponding to the respective ends of attL and attR genes at the 3 ends and sequences corresponding to a part of the target gene at the 5 ends, to obtain a fragment for gene disruption. A gene disruption strain was constructed by using the obtained fragment for gene disruption. Procedures are shown below.

[0319] A fragment for disrupting the ggt gene, was obtained as follows. That is, PCR was carried out by using the genomic DNA of the Escherichia coli, JM109 strain as the template, primers of SEQ ID NOS: 3 and 4, and KOD-plus-Ver 2 (TOYOBO) according to the protocol of the manufacturer, to amplify an upstream region of the gene of 0.3 kb, to thereby obtain a fragment A. Similarly, PCR was carried out by using the genomic DNA of the Escherichia coli JM109 strain as the template, and primers of SEQ ID NOS. 5 and 6, to amplify a downstream region of the ggt gene of 0.3 kb, to thereby obtain a fragment C. Similarly, PCR was carried out by using pMW118-attL-Cm-attR as the template, and primers of SEQ ID NOS: 7 and 8, to obtain a fragment B of 1.6 kb. PCR reaction of 10 cycles was carried out by using 50 ng, 10 ng, and 50 ng of the fragments A, B, and C for 50 L of PCR reaction mixture. A DNA fragment of 2 kb was amplified by using 1 L of this reaction mixture as the template, and primers of SEQ ID NOS: 3 and 6, and purified with QIAquick Gel Extraction Kit (Qiagen), to obtain the fragment for disrupting the gene. The primers used are shown in Table 3.

TABLE-US-00003 TABLE3 SEQ ID NO Nucleotidesequence(5->3) 3 TGCATCTGGGTTTGCATCCGCTGCT 4 ataaaaaagcaggcttcaCGTTATTCTCCAGAGATTAAGGGGC 5 tttatactaacttgagcgGGTTAGCGGCCCTCTTCGTGGGAAG 6 ACTCTACATGGACGCTTTAGCCAGG 7 GCCCCTTAATCTCTGGAGAATAACGtgaagcctgcttttttat 8 CTTCCCACGAAGAGGGCCGCTAACCcgctcaagttagtataaa

[0320] The obtained fragment for disrupting the ggt gene was introduced into the Escherichia coil JM109 strain containing a plasmid pKD46 (Proc. Natl. Acad. Sci. USA, 2000. vol. 97, No. 12, p 6640-6645) by electroporation. The plasmid pKD46 is a plasmid having a temperature-sensitive replication ability and containing a DNA fragment of total 2154 base-pairs from -phage (GenBank/EMBL Accession; JO2459, position 31088-33241), which fragment contains genes encoding the Red recombinase of the -Red homologous recombination system (, , and exo genes) under the control of an arabinose-inducible P.sub.araB promoter. The plasmid pKD46 is required for integrating the DNA fragment for gene disruption into the chromosome of the JM109 strain.

[0321] Competent cells for electroporation were prepared as follows. That is, the Escherichia coli JM109 strain containing the plasmid pKD46 was cultured in LB medium containing 100 mg/L of Amp at 30 C. for 20 hours, and diluted 50-fold with 2 mL of SOB-medium (Sambrook J., et al., Molecular Cloning: A Laboratory Manual (2.sup.nd ed.), Cold Spring Harbor Laboratory Press, 1989) containing Amp (100 mg/L). The diluted product was grown at 30 C. to OD610 of about 0.3, added with 70 L of 10% (v/v) L-arabinose, and cultured for 1 hour at 37 C. The obtained culture broth was concentrated 65-fold, and washed 3 times with 10% (v/v) glycerol, to obtain the competent cells for electroporation.

[0322] After electroporation, the cell suspension was added with 0.3 mL of SOC medium, cultured for 3 hours at 37 C., and then cultured on LB-agar medium containing 50 mg/L of chloramphenicol (Cm) at 37 C., to select a Cm-resistant recombinant.

[0323] Then, for removal of the plasmid pKD46, cultivation was carried out on LB-agar medium containing Cm (50 mg/L) at 42 C., and obtained colonies were tested for Amp resistance, to obtain an Amp-sensitive strain, from which the plasmid pKD46 was removed. Disruption of the ggt gene marked with the Cm-resistant gene was confirmed by PCR. The obtained ggt-gene disruption strain was designated as the strain JM109ggt:att-cat.

[0324] Then, for removal of the att-cat genes introduced into the gene, pMW-intxis-ts (WO2007/037460) was used as a helper plasmid. pMW-intxis-ts is a plasmid having a temperature-sensitive replication ability and containing genes encoding integrase (Int) and excisionase (Xis) of -phage. As a result of introduction of pMW-intxis-ts, attL or attR on the chromosome is recognized and recombination occurs to excise a gene between attL and attR, so that only the attL or attR sequence remains on the chromosome. The JM109ggt:att-cat strain obtained above was transformed with pMW-intxis-tx, and cultured on LB-agar medium containing 100 mg/L of Amp at 30 C., to obtain an Amp-resistant strain.

[0325] Then, for removal of the plasmid pMW-intxis-ts, cultivation was carried out on LB-agar medium at 42 C., and obtained colonies were tested for Amp resistance and Cm resistance, to obtain a Cm- and Amp-sensitive strain, from which att-cat and pMW-intxis-ts was removed and or which the ggt gene was disrupted. This strain was designated as the strain JM109ggt.

(2) Construction of Double-Gene-Disruption Strain Deficient in ggt and gshA Genes Derived from Escherichia coli JM109 Strain

[0326] A strain not producing GGT or GSHA was constructed from the Escherichia coli JM109ggt strain as the parent strain. The nucleotide sequence of the gshA gene and the amino acid sequence of GSHA encoded by the gene are shown in SEQ ID NOS: 23 and 24, respectively.

[0327] A DNA fragment for disrupting the gshA gene was obtained by carrying out PCR using pMW118-attL-Cm-attR as the template, primers of SEQ ID NOS. 9 and 10 (Table 4), and KOD-plus-Ver 2 (TOYOBO) according to the protocol of the manufacturer. The fragment for disrupting the gshA gene was introduced into the JM109ggt strain containing the plasmid pKD46 by electroporation. Competent cells of the JM109ggt strain for electroporation were obtained in the same manner as described in Example 4(1). After electroporation, the cell suspension was added with 0.3 mL of SOC medium, cultured for 3 hours at 37 C., and then cultured on LB-agar medium containing Cm (50 mg/L) at 37 C., to select a Cm-resistant recombinant. Then, for removal of the plasmid pKD46, cultivation was carried out on LB-agar medium containing Cm (50 mg/L) at 42 C., and obtained colonies were tested for Amp resistance, to obtain an Amp-sensitive strain, from which the plasmid pKD46 was removed. Disruption of the gshA gene marked with the Cm-resistant gene was confirmed by PCR. The obtained gshA-gene disruption strain was designated as the strain JM109ggtgshA:att-cat.

[0328] Then, for removal of the att-cat genes introduced into the gshA gene, the JM109ggtgshA:att-cat strain obtained above was transformed with pMW-intxis-ts, and cultured on LB-agar medium containing 100 mg/L of Amp at 30 C., to obtain an Amp-resistant strain.

[0329] Then, for removal of the plasmid pMW-intxis-ts, cultivation was carried out on LB-agar medium at 42 C., and obtained colonies were tested for Amp resistance and Cm resistance, to obtain a Cm- and Amp-sensitive strain, from which att-cat and pMW-intxis-ts was removed and of which the gshA gene was disrupted. This strain was designated as the strain JM109ggtgshA.

TABLE-US-00004 TABLE4 SEQ ID NO Nucleotidesequence(5->3) 9 TTATGCTAATTAAAACGATTTTGACAGGCGGGAGGTCAAT tgaagcctgcttttttat 10 TGAAATTTTGGCCACTCACGAGTGGCCTTTTTCTTTTCTG cgctcaagttagtataaa
(3) Construction of Triple-Gene-Disruption Strain Deficient in ggt, gshA, and ybdK Genes Derived from Escherichia coli JM109 Strain

[0330] A strain not producing GGT, GSHA, or YBDK was constructed from the Escherichia coli JM109ggtgshA strain as the parent strain. The nucleotide sequence of the ybdK gene and the amino acid sequence of YBDK encoded by the gene are shown in SEQ ID NOS: 15 and 16, respectively.

[0331] A DNA fragment for disrupting the ybdK gene was obtained by carrying out PCR using pMW118-attL-Cm-attR as the template, primers of SEQ ID NOS: 11 and 12 (Table 5), and PrimeSTAR Max Polymerase (Takara Bio) according to the protocol of the manufacturer. The fragment for disrupting the ybdK gene was introduced into the JM109ggtgshA strain containing the plasmid pKD46 by electroporation. Competent cells of the JM109ggtgshA strain for electroporation were obtained in the same manner as described in Example 4(1). After electroporation, the cell suspension was added with 0.3 mL of SOC medium, cultured for 3 hours at 37 C., and then cultured on LB-agar medium containing Cm (50 mg/L) at 37 C., to select a Cm-resistant recombinant.

[0332] Then, for removal, of the plasmid pKD46, cultivation was carried out on LB-agar medium containing Cm (50 mg/L) at 42 C., and obtained colonies were tested for Amp resistance, to obtain an Amp-sensitive strain, from which the plasmid pKD46 was removed. Disruption of the ybdK gene marked with the Cm-resistant gene was confirmed by PCR. The obtained ybdK-gene disruption strain was designated as the strain JM109ggtgshAybdK:att-cat.

[0333] Then, for removal of the att-cat genes introduced into the ybdK gene, the JM109ggtgshAybdK:att-cat strain obtained above was transformed with pMW-intxis-ts, and cultured on LB-agar medium containing 100 mg/L of Amp at 30 C., to obtain an Amp-resistant strain.

[0334] Then, for removal of the plasmid pMW-intxis-ts, cultivation was carried out on LB-agar medium at 42 C., and obtained colonies were tested for Amp resistance and Cm resistance, to obtain a Cm- and Amp-sensitive strain, from which att-cat and pMW-intxis-ts was removed and of which the ybdK gene was disrupted. This strain was designated as the strain JM109ggtgshAybdK.

TABLE-US-00005 TABLE5 SEQ ID NO Nucleotidesequence(5->3) 11 cttctatactgaatagaaaacgccaacataagagaaacct TGAAGCCTGCTTTTTTATACTAAGTTGGCATTATAAAAAA 12 accattgtcagggatattcttctgtaaggcaattcccggc CGCTCAAGTTAGTATAAAAAAGCTGAACGAGAAACGTAAA

Example 5: Construction of Expression Strains for Kocuria rosea -Glu-Val Synthetase

[0335] Expression strains for Kocuria rosea -Glu-Val synthetase were constructed from the double-gene-disruption strain deficient in ggt and gshA genes (JM109ggtgshA) and triple-gene-disruption strain deficient in ggt, gshA, and ybdK genes (JM109ggtgshAybdK) derived from the Escherichia coli JM109 strain as the expression hosts. The nucleotide sequence of the KrgshA gene encoding -Glu-Val synthetase derived from the Kocuria rosea AJ3I32 strain is shown in SEQ ID NO: 17. The amino acid sequence of -Glu-Val synthetase encoded by the gene is shown in SEQ ID NO: 18. Incidentally, upon constructing pSF-KrgshA, an expression plasmid for the KrgshA gene, a nucleotide sequence codon-optimized for expression in Escherichia coli was designed on the basis of the nucleotide sequence of the KrgshA gene (SEQ ID NO: 17). The nucleotide sequence of the KrgshA gene codon-optimized for expression in Escherichia coli is shown in SEQ ID NO: 29.

[0336] First, a pUC18-derived plasmid pSF12_ggt (WO2013/051685A1) containing a ggt gene encoding -glutamyl transpeptidase derived from the Escherichia coli W3110 strain (ATCC 27325) and a rpoH promoter was digested with NdeI/PstI, and purified with QIAquick Gel Extraction Kit (Qiagen), to obtain a fragment of about 3.0 kb.

[0337] Then, cDNA (SEQ ID NO: 29) designed to be codon-optimized for expression in Escherichia coli on the basis of the nucleotide sequence of the KrgshA gene (SEQ ID NO: 17) was ordered to Eurofins Genomics. PCR was carried out by using the delivered plasmid as the template, and Phusion High-fidelity DNA Polymerase (FINNZYMES) according to the protocol of the manufacturer, to obtain a fragment of about 1.2 kb containing the KrgshA gene. As the primers, the combination of SEQ ID NOS: 13 and 14 (Table 6) was used.

[0338] Then, the PCR fragment of about 1.2 kb obtained by PCR and containing the KrgshA gene and the fragment of about 3.0 kb obtained by digesting pSF12_ggt with NdeI/PstI were fused by using In-Fusion HD Cloning Kit (Clontech) according to the protocol of the manufacturer. The Escherichia coli JM109 strain was transformed with the reaction mixture, applied to LB agar medium containing 100 g/mL of ampicillin sodium salt (Amp), and cultured at 30 C. for 20 hours. Plasmids were extracted from the colonies of the grown transformants by a known method, the nucleotide sequences thereof were confirmed by using 3130 Genetic Analyzer (Life Technologies), and a plasmid having the objective structure was designated as pSF12-KrGshA.

[0339] The strains JM109ggtgshA and JM109ggtgshAybdK obtained in Example 4 were each transformed with pSF12-KrgshA, to obtain transformants containing pSF12-KrgshA. These transformants were designated as strains JM109ggtgshA/pSF12-KrgshA and JM109ggtgshAybdK/pSF12-KrgshA, respectively.

TABLE-US-00006 TABLE6 SEQ ID NO Nucleotidesequence(5->3) 13 AAGGAGGAATCCATATGGAAATCTCGTTTGCCCGC 14 CCAAGCTTGCATGCCIGCAGTTAGTCGTTTTCGCGAGTACG

Example 6: Production of -Glutamyl Dipeptide with Cell-Free Extract of Expression Strains for Kocuria rosea -Glu-Val Synthetase

[0340] Production of -glutamyl dipeptide was investigated by using a cell-free extract of expression strains for Kocuria rosea -Glu-Val synthetase constructed from the double-gene-disruption strain deficient in ggt and gshA genes (JM109ggtgshA) and triple-gene-disruption strain deficient in ggt, gshA, and ybdK genes (JM109ggtgshAybdK) derived from the Escherichia coli JM109 strain as the expression hosts.

[0341] The strains JM109ggtgshA/pSF12-KrgshA and JM109ggtgshAybdK/pSF12-KrgshA obtained in Example 5 were each inoculated into 3 mL of LB medium containing 100 g/mL of Amp, and cultured at 30 C. for 20 hours with shaking by 120 times/minute of reciprocal movement, to obtain a preculture broth. The obtained preculture broth in a volume of 150 L was inoculated into 15 mL of TB medium containing 100 g/mL of Amp contained in a 70 mL-volume test tube ( 25 mm), and cultivation was carried out at 30 C. for 20 hours with shaking by 120 times/minute of reciprocal movement. Cells were collected by centrifugation (4 C., 12,000 rpm, 5 minutes). The obtained cells were suspended in 0.2 mL of a buffer (20 mM Tris-HCl (pH 8.0), 300 mM NaCl, 10 mM imidazole, and 15% glycerol), and disrupted by ultrasonication with cooling. The obtained disrupted cell suspension was centrifuged (4 C., 29,100g, 10 minutes), and the obtained supernatant was used as a cell-free extract.

[0342] First, the -Glu-Val synthetic activity was measured by using the cell-free extract. Composition of the reaction mixture consisted of 100 mM glutamic acid, 100 mM valine, 40 mM ATP, and 20 mM MgSO.sub.4 in 100 mM Tris-HCl (pH 7.0). The volume of the reaction mixture was 0.5 mL. The enzymatic reaction was started by adding the cell-free extract containing 0.25 mg of proteins. The reaction temperature was 30 C., and the reaction time was 30 minutes. For terminating the reaction, 0.5 mL of 200 mM sulfuric acid was added per 0.5 mL of the reaction mixture. After completion of the reaction, -Glu-Val was quantified by means shown in Example 3, and the -Glu-Val synthetic activity per cell-free extract was calculated. Results are shown in Table 7.

TABLE-US-00007 TABLE 7 -Glu-Val synthetic Origin of cell-free extract activity (U/mg) JM109ggtgshA/pSF12-KrgshA 0.008 JM109ggtgshAybdK/pSF12-KrgshA 0.024

[0343] Then, the -Glu-Val synthesis amount and the -Glu-Gly synthesis amount in the presence of Glu, Val, and Gly were measured by using the obtained cell-free extract. Composition of the reaction mixture consisted of 100 mM glutamic acid, 50 mM valine, 50 mM glycine, 40 mM ATP, and 20 mM MgSO.sub.4 in 100 mM Tris-HCl (pH 7.0). The enzymatic reaction was started by adding the cell-free extract. For terminating the reaction, an equal volume of 200 mM sulfuric acid was added to the reaction mixture. After completion of the reaction, -Glu-Val and -Glu-Gly were quantified by means shown in Example 3. Results are shown in Tables 8 and 9. Table 8 shows data obtained when the cell-free extract was added to the reaction mixture in an amount of 0.004 U in terms of the -Glu-Val synthetase activity. In this case, the volume of the reaction mixture was 0.2 mL, the reaction temperature was 30 C., and the reaction time was 16 hours. Table 9 shows data obtained when the cell-free extract containing 0.25 mg of proteins was added to the reaction mixture. In this case, the volume of the reaction mixture was 0.5 mL, the reaction temperature was 30 C., and the reaction time was 2.5 hours.

TABLE-US-00008 TABLE 8 -Glu-Val -Glu-Gly Origin of cell-free extract (mM) (mM) JM109ggtgshA/pSF12-KrgshA 0.4 0.1 JM109ggtgshAybdK/pSF12-KrgshA 0.7 n.d. n.d.: below detection limit.

TABLE-US-00009 TABLE 9 -Glu-Val -Glu-Gly Origin of cell-free extract (mM) (mM) JM109ggtgshA/pSF12-KrgshA 0.5 0.1 JM109ggtgshAybdK/pSF12-KrgshA 2.1 n.d. n.d.: below detection limit.

INDUSTRIAL APPLICABILITY

[0344] According to the present invention, a microorganism useful as an expression host for -Glu-Val synthetase can be provided. By using -Glu-Val synthetase expressed in the microorganism, -Glu-Val or -Glu-Val-Gly can be efficiently produced. For example, by using -Glu-Val synthetase expressed in the microorganism in combination with glutathione synthetase, it is expected that -Glu-Val-Gly can be efficiently produced from Glu, Val, and Gly as raw materials with reduced by-production of -Glu-Gly.

EXPLANATION OF SEQUENCE LISTING

[0345] SEQ ID NOS: [0346] 1-14: Primers [0347] 15: Nucleotide sequence of ybdK gene of Escherichia coli W3110 strain [0348] 16: Amino acid sequence of YBDK of Escherichia coli K-12 W3110 strain [0349] 17: Nucleotide sequence of -Glu-Val synthetase gene of Kocuria rosea (AJ3132) [0350] 11: Amino acid sequence of -Glu-Val synthetase of Kocuria rosea (AJ3132) [0351] 19: Nucleotide sequence of -Glu-Val synthetase gene of Kocuria rhizophila DC2201 strain [0352] 20: Amino acid sequence of -Glu-Val synthetase of Kocuria rhizophila DC2201 strain [0353] 21: Nucleotide sequence of -Glu-Val synthetase gene of Micrococcus luteus NCTC2665 strain [0354] 22: Amino acid sequence of -Glu-Val synthetase of Micrococcus luteus NCTC2665 strain [0355] 23: Nucleotide sequence of gshA gene of Escherichia coli K-12 W3110 strain [0356] 24: Amino acid sequence of GSHA Escherichia coli K-12 W3110 strain [0357] 25: Nucleotide sequence of ggt gene of Escherichia coli K-12 MG1655 strain [0358] 26: Amino acid sequence of GGT of Escherichia coli K-12 MG1655 strain [0359] 27: Nucleotide sequence of gshB gene of Escherichia coli K-12 W3110 strain [0360] 28: Amino acid sequence of GSHB of Escherichia coli K-12 W3110 strain [0361] 29: Nucleotide sequence of -Glu-Val synthetase gene of Kocuria rosea (AJ3132) optimized for expression in Escherichia coli