Hydrogenase isolated from Thermococcus spp

Abstract

The present invention relates to novel hydrogenases isolated from novel hyperthermophilic strains belonging to Thermococcus spp., genes encoding the hydrogenases, and methods of producing hydrogen using strains having the genes. According to the hydrogen production methods of the invention, a large amount of hydrogen can be produced merely by culturing the strains in specific culture conditions. Thus, the methods of the invention have advantages in that they are more economic and efficient than existing hydrogen production methods and can produce hydrogen even at high temperature.

Claims

1. A recombinant vector comprising genes that are organized in a CODH-MCH-MNH3 hydrogenase cluster in T. onnurineus NA1, and a vector from a source other than T. onnurineus NA1, and the vector is a plasmid, a cosmid or a phage, wherein the genes include the genes of SEQ ID NO: 21 (CODH dehydrogenase) and SEQ ID NO: 16 (MCH hydrogenase).

2. A host cell transformed with the recombinant vector of claim 1.

3. A recombinant vector comprising genes that are organized in a FDH1-MFH1-MNH1 hydrogenase cluster in T. onnurineus NA1, and a vector from a source other than T. onnurineus NA1, and the vector is a plasmid, a cosmid or a phage, wherein the genes include the genes of SEQ ID NO: 20 (FDH1 dehydrogenase) and SEQ ID NO: 13 (MFH1 hydrogenase).

4. A host cell transformed with the recombinant vector of claim 3.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A and 1B present a Venn diagram showing the shared and unique portions of the proteome of four Thermococcales strains, T. onnurineus NA1 (NA1), T. kodakaraensis, P. furiosus, and P. abyssi. The protein sets for the strains were obtained from the RefSeq collection in NCBI.

(2) FIG. 2A is a representative map of eight hydrogenase gene clusters in T. onnurineus NA1. A, B, C, and D: membrane-bound hydrogenases and cytoplasmic NiFe-hydrogenases. S1, S2, and S3: T. onnurineus NA1. Genes were colored according to COG functional categories. TON_0051-0055 represents SEQ ID NOs: 1 to 5; TON_0486-0498 represents SEQ ID NOs: 35 to 47; TON_0533-0544 represents SEQ ID NOs: 48 to 59; TON_1583-1595 represents SEQ ID NOs: 100 to 112; TON_0261-0289 represents SEQ ID NOs: 6 to 34; TON_1016-1031 represents SEQ ID NOs: 60 to 75; and TON_1559-1582 represents SEQ ID NOs: 76 to 99.

(3) FIG. 2B shows the gene organization of three hydrogenase gene clusters (fdh1-mfh1-mnh1, fdh2-mfh2-mnh2 and codh-mch-mnh) having a 3-module gene cluster on the genome of T. onnurineus NA1. Genes belonging to the same subclusters were indicated by the same color.

(4) FIG. 3 shows the distribution and conservation patterns of hydrogenase gene clusters in 31 archaeal genomes. The first bracket, the third bracket, the fifth bracket from the bottom encompass CDSs showing low similarities (<25%) to any CDSs from 31 archaeal genomes. The brackets other than the first bracket, the third bracket, the fifth bracket from the bottom indicate CDSs similar to hydrogenase 4 from P. abyssi. The 31 archaeal genes are as follows:

(5) TABLE-US-00001 No. Gene 1 Aeropyrum_pernix 2 Pyrobaculum_aerophilum 3 Sulfolobus_acidocaldarius_DSM_639 4 Sulfolobus_solfataricus 5 Sulfolobus_tokodaii 6 Haloarcula_marismortui_ATCC_43049 7 Natronomonas_pharaonis 8 Halobacterium_sp 9 Haloquadratum_walsbyi 10 Methanococcoides_burtonii_DSM_6242 11 Picrophilus_torridus_DSM_9790 12 Thermoplasma_acidophilum 13 Thermoplasma_volcanium 14 Methanosaeta_thermophila_PT 15 Pyrobaculum_islandicum_DSM_4184 16 Thermofilum_pendens_Hrk_5 17 Pyrococcus_abyssi 18 Pyrococcus_furiosus 19 Pyrococcus_horikoshii 20 Thermococcus_kodakaraensis_KOD1 21 Archaeogiobus_fulgidus 22 Methanosarcina_barkeri_fusaro 23 Methanosarcina_mazei 24 Methanosarcina_acetivorans 25 Methanospirillum_hungatei_JF-1 26 Methanobacterium_thermoautotrophicum 27 Methanococcus_jannaschii 28 Methanococcus_maripaludis_S2 29 Methanosphaera_stadtmanae 30 Methanopyrus_kandleri 31 Nanoarchaeum_equitans

(6) FIGS. 4 and 5 show a comparison of the subunits of CODH and F420 hydrogenase proteins. FIG. 4 is the phylogenetic tree of CODH, and FIG. 5 is the phylogenetic tree of the subunit of F420 hydrogenase. Homologues of the proteins on the phylogenetic trees were obtained from the NCBI nr database.

(7) FIGS. 6A through 6C show the growth profile of T. onnurineus NA1 depending on CO. T. onnurineus NA1 was grown in medium 1 supplemented with CO (lane 2; triangles), sulfur (lane 3; squares) or both (lane 4; triangles down). Controls without supplement (lane 1; circles) and culture in YPS medium (C) were included. DAPI-stained cells were directly counted on filters by fluorescence microscopy. FIG. 6A: Effect of medium composition at various concentrations of yeast extract (YE). FIG. 6B: Growth curves of T. onnurineus NA1 in medium 1 with other supplements. FIG. 6C: Analysis of the transcription of the CODH gene.

(8) FIG. 7A shows the growth and hydrogen production of T. onnurineus NA1 in YPS and FIG. 7B shows the growth and hydrogen production of T. onnurineus NA1 in CO-containing medium. Open circles: growth; and closed circles: hydrogen production.

(9) FIG. 8A shows the microarray analysis of the expression of hydrogenase gene clusters in T. onnurineus NA1 in YPS and FIG. 8B shows RT-PCR analysis of the expression of hydrogenase gene clusters in T. onnurineus NA1 in CO-containing medium. More particularly, FIG. 8A shows the microarray analysis of eight hydrogenase gene clusters in T. onnurineus NA1. Hierarchical clustering of the mRNA changes in CO was compared with one in an YPS growth condition as a control. Up-regulation and down-regulation were indicated by red and green, respectively. Growth conditions were indicated on top of the clustering picture. At the right side of the clustering picture, ORFs of each of codh-mch-mnh3, fdh1-mfh1-mnh1 or fdh2-mfh2-mnh2 were indicated as bars. YE: yeast extract. FIG. 8B shows the results of quantitative RT-PCR analysis in CO or YPS conditions, carried out for each of the large subunits of mbh (TON_1593), mbx (TON 0489), frh (TON_1560), sulf I (TON_0534), mch (TON_1023), mfh2 (TON_1569) and mfh1 (TON_0276) hydrogenases. The chaperonin-encoding gene (cha) was used as a control to normalize expression levels.

(10) FIGS. 9A and 9B show the targeted gene disruption of the large subunit of each of mch (TON_1023) and mfh2 (TON_1569) hydrogenases. FIG. 9A shows the gene organization of each of codh-mch-mnh3 and fdh2-mfh2-mnh2 clusters in T. onnurineus NA1. P.sub.gdh: the 5-upstream promoter region of the glutamate dehydrogenase gene of T. kodakaraensis KOD1; and hmg.sub.Pfu: the 3-hydroxy-methylglutaryl coenzyme A reductase gene of Pyrococcus furiosus. FIG. 9B shows the identification of gene disruption by PCR. The left panel shows PCR amplification with primers for the overexpression cassette (P.sub.gdh-hmg.sub.Pfu) region. The right panel shows PCR amplification with primers for the large subunit of each of mch.sub.TNA1 and mfh2.sub.TNA1 hydrogenases. M: size marker (1 kb ladder); W: wild type; lanes 1 and 2: mutant strains.

(11) FIG. 10A shows the growth and hydrogen production of a mchTNA1 mutant strain in YPS. Open circles: growth; closed circles: hydrogen production. FIG. 10B shows the growth and hydrogen production of a mfh2TNA1 mutant strain in YPS. FIG. 10C shows the growth and hydrogen production of a mchTNA1 mutant strain in CO-containing medium. FIG. 10D shows the growth and hydrogen production of a mfh2TNA1 mutant strain in CO-containing medium.

DETAILED DESCRIPTION

(12) In a first aspect, the present invention provides hydrogenases which are produced by the novel hyperthermophilic strain Thermococcus onnurineus NA1 (accession number: KCTC 10859BP) that produces hydrogen in anaerobic conditions. The strain was isolated from a deep-sea hydrothermal vent area at the PACMANUS field in the East Manus Basin. The isolated strain was deposited in the Korean Collection for Type Cultures (KCTC) at the Korean Research Institute of Bioscience and Biotechnology (KRIBB) on Oct. 7, 2005 and assigned accession number KCTC 10859BP on Oct. 20, 2005. The characteristics and culture methods of the strain are described in Korean Patent Application No. 10-2007-0127255 on which the present invention is based.

(13) T. onnurineus NA1 has eight novel hydrogenase gene clusters. The hydrogenases are key enzymes related to the metabolism of molecular hydrogen (H.sub.2) and act as catalysts in the following reversible reaction: 2H.sup.++2e.sup.H.sub.2. Preferably, the hydrogenases belonging to the above-described clusters provide proteins and functional equivalents thereof comprising one or more amino acid sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 8. As used herein, the term functional equivalent is intended to include amino acid sequence variants having amino acid substitutions in some or all of the proteins, or amino acid additions or deletions in some of the proteins. The amino acid substitutions are preferably conservative substitutions. Examples of the conservative substitutions of naturally occurring amino acids are as follow: aliphatic amino acids (Gly, Ala, and Pro), hydrophobic amino acids (Ile, Leu, and Val), aromatic amino acids (Phe, Tyr, and Tip), acidic amino acids (Asp, and Glu), basic amino acids (His, Lys, Arg, Gln, and Asn), and sulfur-containing amino acids (Cys, and Met). The deletions of amino acids are preferably located in a region which is not directly involved in the activity of the hydrogenases.

(14) In a second aspect, the present invention provides genes encoding the above-described amino acid sequences. The genes are preferably, but not limited to, genes of SEQ ID NOs: 12 to 19 (the amino acid sequences of SEQ ID NOs: 1 to 8 correspond to the genes of SEQ ID NOs: 12 to 19, respectively).

(15) In a third aspect, the present invention provides a method of producing hydrogen by culturing Thermococcus spp. The method comprises the steps of 1) preparing a medium in a culture vessel; 2) culturing Thermococcus spp. in the culture vessel; and 3) extracting hydrogen from the culture vessel. The Thermococcus spp. is preferably Thermococcus onnurineus NA1 (accession number: KCTC 10859BP).

(16) In addition, the medium may be a medium supplemented with one or more selected from the group consisting of carbon monoxide, formate and starch. Also, the culturing may be carried out at a high temperature of 80 C. in anaerobic conditions.

(17) In a fourth aspect, the present invention provides a dehydrogenase comprising at least one amino acid sequence selected from the group consisting of SEQ ID NO: 9 to SEQ ID NO: 11. The dehydrogenase, Fdh1(SEQ ID NO: 20), Fdh2(SEQ ID NO: 22) and CODH(SEQ ID NO: 21), respectively may be carried out by cluster with hydrogenase MFH1, MFH2 and MCH hydrogenase.

(18) In a fifth aspect, the present invention provides a gene encoding said dehydrogenase. Preferably, the gene is selected from genes of SEQ ID NO: 20 to SEQ ID NO: 22 (the amino acid sequences of SEQ ID NOs: 9 to 11 correspond to the genes of SEQ ID NOs: 20 to 22, respectively).

(19) In a sixth aspect, the present invention provides a recombinant vector comprising genes that are organized in a CODH-MCH-MNH3 hydrogenase cluster in T. onnurineus NA1, wherein the genes are all operably linked. Preferably, the genes include, but are not limited to, genes of SEQ ID NO: 21 (CODH dehydrogenase) and SEQ ID NO: 16 (MCH hydrogenase). As used herein, the term vector means a nucleic acid molecule that can carry another nucleic acid bound thereto.

(20) As an expression vector which can synthesize a protein encoded by a recombinant gene carried by said vector, a plasmid, cosmid or phage may be used. A preferred vector is a vector that can self-replicate and express a nucleic acid bound thereto.

(21) In addition, the present invention provides a host cell transformed with the recombinant vector. The recombinant vector can be used to transform cells such as prokaryotic, fungal, plant and animal cells so as to prepare transformed cells which can produce hydrogen at high efficiency. As used herein, the term transformation means that foreign DNA or RNA is absorbed into cells to change the genotype of the cells. A public announded transformation method along each cell can be used to make the host cell.

(22) Also, the present invention provides a method of producing hydrogen using said transformant, the method comprising the step of: preparing a medium in a culture vessel; feeding carbon monoxide into a gas phase of the culture medium; culturing said transformant in the culture vessel; and extracting hydrogen from the culture vessel.

(23) In a seventh aspect, the present invention provides a recombinant vector comprising genes that are organized in a FDH2-MFH2-MNH2 hydrogenase cluster in T. onnurineus NA1, wherein the genes are all operably linked. Preferably, the genes include, but are not limited to, genes of SEQ ID NO: 22 (FDH2 dehydrogenase) and SEQ ID NO: 18 (MFH2 hydrogenase). In addition, the present invention provides a host cell transformed with the recombinant vector.

(24) Particulars regarding the vector, transformation and host cell are as described in the above sixth aspect.

(25) Also, the present invention provides a method of producing hydrogen using said transformant, the method comprising the steps of: preparing a formate-containing medium in a culture vessel; culturing said transformant in the culture vessel; and extracting hydrogen from the culture vessel.

(26) In an eighth aspect, the present invention provides a recombinant vector comprising genes that are organized in a FDH1-MFH1-MNH1 hydrogenase cluster in T. onnurineus NA1, wherein the genes are all operably linked. Preferably, the genes include, but are not limited to, genes of SEQ ID NO: 20 (FDH1 dehydrogenase) and SEQ ID NO: 13 (MFH1 hydrogenase). In addition, the present invention provides a host cell transformed with the recombinant vector.

(27) Particulars regarding the vector, transformation and host cell are as described in the above sixth aspect.

(28) Also, the present invention provides a method of producing hydrogen using said transformant, the method comprising the steps of: preparing a starch-containing medium in a culture vessel; culturing said transformant in the culture vessel; and extracting hydrogen from the culture vessel.

(29) Hereinafter, the present invention will be described in further detail with reference to examples. It is to be understood, however, that these examples are for illustrative purposes only and are not to be construed to limit the scope of the present invention.

EXAMPLE 1

Analysis of Hydrogenase Genes of Thermococcus onnurineus NA1 Strain

(30) (1) Test Methods

(31) 1) Culture Conditions

(32) For routine cultivation, cells were grown anaerobically at 80 C. in a yeast extract-peptone-sulfur (YPS) medium (Holden et al. 2001). Physiological tests were performed using modified medium 1 (Sokolova, T. G., C. Jeanthon, N. A Kostrikina, N. A. Chemyh, A. V. Lebedinsky, E. Stackebrandt, and E. A. Bonch-Osmolovskaya. 2004. The first evidence of anaerobic CO oxidation coupled with H.sub.2 production by a hyperthermophilic archaeon isolated from a deep-sea hydrothermal vent. Extremophiles 8:317-323) supplemented with 1 ml of a trace element mixture, 1 ml of vitamin solution (Balch, W. E., G. E. Fox, L. J. Magrum, C. R. Woese, and R. S. Wolfe. 1979. Methanogens: reevaluation of a unique biological group. Microbiol. Rev. 43:260-296), NaCl (30 g g/l), and yeast extract (0.5 g/l). The pH was adjusted to 8.0 using NaOH. The anaerobically prepared medium was dispensed into 25-ml serum bottles, and the gas phase (15 ml) was charged with N.sub.2/CO.sub.2 (80:20; 1 bar) or 100% CO. When the cells were cultured with formate or starch, 10 g/L of sodium formate (Sigma) or 5 g/L of soluble starch (Sigma) was added to the medium before autoclaving. All the cultures for physiological tests were all carried out at 80 C. for 2 days.

(33) 2) Gene Sequencing

(34) The genome sequence of T. onnurineus NA1 was determined by whole-genome shotgun sequencing and pyrosequencing. For capillary sequencing, a 2-kb to 3-kb insert library (11,028 clones), 40-kb insert library (1,870 clones), and 35-kb insert library (288 clones) were constructed and sequenced using an ABI 3730XL sequencer (Applied Biosystems, CA). For pyrosequencing, 581,990 fragments of DNA were sequenced using a GS-20 sequencer (454 Life Sciences). The contigs generated by both sequencers were combined, and closure of the sequencing gap was performed by clone walking and PCR sequencing. ORFs and RNA genes were predicted through a combination of Glimmer 3.0 (University of Maryland), GSFinder and RBSFinder, followed by a manual ORF fitting process. After all the ORFs had been determined, further analysis of the protein sequence was performed by BLASTP searches against the nonredundant protein sequences of the National Center for Biotechnology Information (NCBI), Kyoto Encyclopedia of Genes and Genomes (KEGG), and COG (clusters of orthologous groups of proteins) databases (Tatusova, R. L., D. A. Natale, I. V. Garkavtsev, T. A. Tatusova, U. T. Shankavaram, B. S. Rao, B. Kiryutin, M. Y. Galperin, N. D. Fedorova, and E. V. Koonin. 2001. The COG database: new developments in phylogenetic classification of proteins from complete genomes. Nucleic Acids Res. 29:22-28). tRNAScan-SE was used for the tRNA predictions (Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25:955-964).

(35) 3) Protein Analysis

(36) T. onnurineus NA1 cells were suspended in 100 mM Tris-HCl buffer (pH 6.8) containing 4% sodium dodecyl sulfate (SDS) and 4 mM EDTA and boiled for 10 min, followed by centrifugation at 22,000 g for 20 min. The cell lysate was separated using 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and 30 fractions were obtained based on molecular size. They were then in-gel digested using trypsin (Promega, USA) (Kim, Y. H., K. Cho, S. H. Yun, J. Y. Kim, K. H. Kwon, J. S. Yoo, and S. I. Kim. 2006. Analysis of aromatic catabolic pathways in Pseudomonas putida KT 2440 by combined proteomic approach: 2-DE/MS and cleavable ICAT analysis. Proteomics 6:1301-1318), and the tryptic digests were dissolved in 0.5% trifluoroacetic acid solution to be analyzed by mass spectrometry (Thermo Finnigan LTQ IT). The identities of peptides were determined using the Sequest program (Thermo Finnigan, San Jose, Calif.).

(37) 4) Total RNA Isolation and RT-PCR Analysis

(38) A 50-ml culture of T. onnurineus NA1 was grown to mid-exponential growth phase in modified medium 1 supplemented with various concentrations of yeast extract under the gas phase of N.sub.2/CO.sub.2 (80:20, 1 bar) or 100% CO. Cells were harvested by centrifugation at 6,000g for 30 min. The pellet was resuspended in 50 l of 50 mM Tris-HCl buffer (pH 7.5) supplemented with 500 l of Trizol reagent (Invitrogen, Carlsbad, Calif.). The cells were lysed by freezing and thawing, and then the samples were extracted with 200 l of chloroform. The aqueous phase containing total RNA was further processed by ethanol precipitation and then resuspended in distilled water. RNA concentration and integrity were determined by measuring the absorbance at 260 and 280 nm, as well as by 0.8% agarose gel analysis. Reverse transcription and PCR amplification were carried out using SuperScript II reverse transcriptase (Invitrogen) according to the manufacturer's instructions. The following two sets of primers were used for amplification of CODH (carbon monoxide dehydrogenase) and Hsp60 (chaperonin) as controls:

(39) TABLE-US-00002 CODHgene (forward,5-GGACCATGTAGAATCGAYCCGTTY-3 (SEQIDNO:23) and reverse,5-TTCRTTTCCGGTACAGCA-3 (SEQIDNO:24)); and Hsp60gene (forward,5-ATGGCACAGCTTAGTGGACAG-3 (SEQIDNO:25) and reverse,5-CAAGGATTTCCTGGGCTTTCTC-3 (SEQIDNO:26)).

(40) 5) Computer Analysis

(41) The homology search of amino acid sequences was performed using the BLAST program against the non-redundant protein database of the NCBI. A motif search for proteins having the L1 signal (C[GS][ILV]C[AGNS]xxH, wherein x indicates any amino acid) of the group 4 hydrogenase was performed using the ProteinFinder program (Ensoltek, Korea) against the non-redundant protein database of the NCBI. Multiple sequence alignment for proteins was performed using the ClustalW program (Thompson, J. D., Higgins, D. G. and Gibson, T. J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-4680), and a phylogenetic tree was constructed using Molecular Evolutionary Genetics Analysis (Mega 4.1) software (Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596-1599). The phylogenetic tree of 16S rRNA sequences was made using pre-aligned sequences derived from the Ribosomal database site.

(42) 6) Generation of Signature Logos

(43) Logo representations are used to visualize the information content associated with each position of a given motif shared by related sequences. In the graphical representation, the overall height of each position is correlated to the conservation at that position (expressed in bits), whereas the relative sizes of the symbols within a position indicate their relative frequencies. Logo analyses were performed at the Berkeley Structural Genomics Center.

(44) (2) Analysis Result

(45) 1) General Features of T. onnurineus NA1 Gene

(46) To provide some insight into factors that contributed to the apparent successful competition of Thermococcus spp. in hydrothermal vent fields, the genome sequence of T. onnurineus NA1 was determined by combining random whole-genome shotgun sequencing with pyrosequencing. As a result, it was revealed that T. onnurineus NA1 has a single circular chromosome (1,847,607 bp) without any exochromosomal elements, and a total of 1,976 coding DNA sequences (CDSs) were identified (Table 1 and FIGS. 1A and 1B). Of these, 1,104 CDSs (55.8%) were annotatable by homology and domain searches, but the function of the residual 872 CDSs could not be predicted from the primary structure. When protein similarity was searched on a genome-wide scale, 82.7% of the T. onnurineus NA1 proteins showed similarity to those of other members of the Thermococcales.

(47) TABLE-US-00003 TABLE 1 General features of the T. onnurineus NA1 genome and T. kodakaraensis KOD1 and Pyrococcus strains NA1 KOD1 P. abyssi P. horikoshii P. furiosus Genome size (bp) 1,847,607 2,088,737 1,765,118 1,738,505 1,908,256 Protein-coding 90.1% 92.1% 91.1% 91.2% 92.5% regions GC content 51.0% 52.0% 44.7% 41.9% 40.8% CDSs.sup.a 1976 2306 1784 2064 2065 tRNAs 46 46 46 46 46 rRNAs 5S(2), 5S(2), 5S(2), 5S(2), 5S(2), 7S,16S,32S 7S,16S,32S 7S,16S,32S 7S,16S,32S 7S,16S,32S .sup.aThe protein sets for the strains were obtained from the RefSeq collection in NCBI.

(48) 2) Hydrogenase Clusters

(49) An extraordinary proportion of hydrogenases and related proteins was detected in the T. onnurineus NA1 genome (5.5%), reflecting enhanced conservation or recycling of reducing potentials in association with oxidoreductases, including CO dehydrogenase and formate dehydrogenases.

(50) Hydrogenases can be divided into the following three major groups based on their catalytic metal center: [NiFe]-hydrogenases, [FeFe]-hydsrogenases, and [Fe]-hydrogenases. Based on the unique functional center conserved in each of the hydrogenase groups, it is considered that all hydrogenases in T. onnurineus NA1, except for one hydrogenase, belong to [NiFe]-hydrogenases. According to the hydrogenase classification system of Vignais et al., the [NiFe]-hydrogenases in T. onnurineus NA1 belong to group 3 (one F420-reducing hydrogenase and two NADP-reducing hydrogenases) or group 4 (four membrane-associated hydrogenases) (Silva, P. J., van den Ban, E. C., Wassink, H., Haaker, H., de Castro, B., Robb, F. T. and Hagen, W. R. (2000) Enzymes of hydrogen metabolism in Pyrococcus furiosus. Eur. J. Biochem. 267, 6541-6551). The hydrogenases belonging to group 4 were termed energy-converting hydrogenases (Ech) and are widespread among bacteria and archaea.

(51) To understand the molecular basis of hydrogenase metabolism, hydrogenase gene clusters were comparatively analyzed. The hydrogenases were phylogenetically analyzed and, as a result, the group 4 hydrogenases could be divided into two subgroups, 4a and 4b, and a pair of motif patterns common to all the sequences of subgroup 4b could be found.

(52) As shown in FIG. 2, three additional hydrogenase clusters (FDH1-MFH1-MNH1 (Hyg4-I, S1: TON_0279-0274, MFH1: SEQ ID NO: 2), CODH-MCH-MNH3 (Hyg4-II, S2: TON_1021-1024, MCH: SEQ ID NO: 5) and FDH2-MFH2-MNH2 (Hyg4-III, S3: TON_1565-1571, MFH2: SEQ ID NO: 7)) and Frh (TON_1559-1562, SEQ ID NO: 6) were found in the T. onnurineus NA1 genome along with the two membrane-bound hydrogenases (Mbh (TON_1590-1595, SEQ ID NO: 8) and Mbx (TON_0489-0486, SEQ ID NO: 3)) and two cytoplasmic NiFe-hydrogenases (Sulf-I (TON_0533-0544, SEQ ID NO: 4) and Sulf-II (TON_0051-0055, SEQ ID NO: 1) reported in Pyrococcus spp. and T. kodakaraensis KOD1. Gene cluster analysis of hydrogenases with CDSs from 31 archaeal genomes clearly showed that FDH1-MFH1-MNH1 (Hyg4-I), CODH-MCH-MNH3 (Hyg4-II) and FDH2-MFH2-MNH2 (Hyg4-III) were unique in primary sequence, showing low similarities to hydrogenase 4 components from P. abyssi and R. rubrum (FIG. 3). Similarly to the additional hydrogenases, the FDH2-MFH2-MNH2 (Hyg4-111) cluster (TON_1559-1582, SEQ ID NOs: 76 to 99) included the // subunits of F420 hydrogenase (TON_1559-1561, SEQ ID NOs: 76 to 78) in the genome. The subunits of F420 hydrogenase had unique primary sequences, showing similarities to the coenzyme F420-reducing hydrogenase (YP_001097176) from Methanococcus maripaludis (33%) and coenzyme F420-reducing hydrogenase (NP_987940) from M. maripaludis S2 (33%) (FIG. 3 and FIG. 5). No F420-hydrogenase homologues from the Thermococcales have been reported.

(53) 3) Construction of 3-module Gene Clusters

(54) It was found that each of the three Ech hydrogenases (MFH1, MFH2, and MCH) belonging the group 4 of [NiFe]-hydrogenases was a portion of large 17- or 18-gene clusters (fdh1-ndh1-mnh1, fdh2-mfh2-mnh2 and codh-mch-mnh3) consisting of TON_266-TON_282, TON_1563-TON_1580 and TON_1016-TON_1031 ORFs (open reading frames) (FIG. 2B). The ORFs in the clusters can be divided into three subclusters. The first part encodes oxidoreductase such as formate dehydrogenases (Fdh1 (SEQ ID NO: 9) or Fdh2 (SEQ ID NO: 11)) or carbon monoxide dehydrogenase (Codh (SEQ ID NO: 10)). The second part encodes multimeric membrane-bound hydrogenases (MFH1, MFH2 or MCH) having 5-7 subunits. The last part encodes cation/proton antiporters such as Na.sup.+/H.sup.+ antiporter. Such 3-module gene clusters have not yet been reported.

EXAMPLE 2

Analysis of Gas Composition

(55) (1) Analysis Method

(56) Hydrogen gas was measured using a gas chromatograph HP 5890 series II (Hewlett Packard) equipped with an HP-PLOT Molesieve column (Agilent) and a TCD detector. Argon was used as a carrier gas. To quantify hydrogen gas, a gas calibration standard (Supleco) containing 1% (w/w) of each of components (CO, CO.sub.2, H.sub.2, CH.sub.4 and O.sub.2) in nitrogen was used

(57) (2) Production of Hydrogen Using Various Substances

(58) In order to examine whether a number of hydrogenases cause T. onnurineus NA1 to efficiently produce hydrogen in various environments, hydrogen production rate was analyzed using various energy sources (Table 2). As a result, the NA1 strain could produce hydrogen using starch, CO and formate even under sulfur-free conditions. Particularly, CO and formate were very good energy sources for efficiently producing hydrogen.

(59) TABLE-US-00004 TABLE 2 Comparison of hydrogen production of T. onnurineus NA1 under various conditions Medium Hydrogen production (mmol/L) M + CO 30.7 M + Formate 49.7 M + Starch 15.6 M: modified medium 1

(60) The hydrogen productivity of the NA1 strain in batch culture is similar to those obtained in the continuous culture of T. kodakaraensis KOD1 and Pyrococcus furiosus. Hyperthermophilic archaea have various advantages in that they show a specific production rate higher than the hydrogen production by mesophilic bacterial fermentation or photobacteria in spite of their low volumetric productivity and produce high-purity hydrogen. The high hydrogen production rates described herein can be much improved through the optimization of culture conditions and treatment processes and metabolic engineering.

EXAMPLE 3

CO-dependent H2 Production by Thermococcus onnurineus NA1: Identification of CO-responsive Hydrogenases

(61) (1) CODH Gene Cluster and Carboxydotrophic Growth

(62) As described above, it was found that T. onnurineus NA1 possessed a unique gene cluster (CODH-MCH-MNH3) that was comprised of a putative transcriptional regulator (TON_1016), a CODH accessory protein (CooC, TON_1019), a CODH catalytic subunit (CooS, TON_1018), and an electron transfer protein (CooF, TON_1017), along with a hydrogenase (mch, TON_1021-1024, SEQ ID NO: 5) (FIG. 2B). CooS (TON_1018), a central enzyme in microbial carbon monoxide (CO) metabolism, showed significant similarities with CODHs from CO-oxidizing methanogenic archaea such as CODH (AAM06652) from Methanosarcina acetivorans C2A (60%) and CODH (AAM29817) from Methanosarcina mazei Go1 (59%) (FIGS. 3 and 4). It seemed a monofunctional CODH (Bonam, D., L. Lehman, G P Roberts, and P. W. Ludden., 1989, Regulation of carbon monoxide dehydrogenase and hydrogenase in Rhodospirillum rubrum: effects of CO and oxygen on synthesis and activity. J. Bacteriol. 171:3102-3107; and Wu, M. Q. Ren, A. S. Durkin, S. C. Daugherty, L. M Brinkac, R. J. Dodson, R. Madupu, S. A. Sullivan, J. F. Kolonay, W. C. Nelson, L. J. Tallon, K. M. Jones, L. E. Ulrich, J. M. Gonzalez, I. B. Zhulin, F. T. Robb, and J. A. Eisen. 2005, Life in hot carbon monoxide: the complete genome sequence of Carboxydothermus hydrogenoformans Z-2901. PLoS Genet. 1:e65), lacking the acetyl coenzyme A synthesis/cleavage activity of the bifunctional CODH/acetyl coenzyme A synthetase enzyme. According to Fox et al. (Fox, J. D., R. L. Kerby, G. P. Roberts, and P. W. Ludden, 1996, Characterization of the CO-induced, CO-tolerant hydrogenase from Rhodospirillum rubrum and the gene encoding the large subunit of the enzyme. J. Bacteriol. 178:1515-1524), the monofunctional CODH/hydrogenase complex from Rhodospirillum rubrum participated in CO-driven proton respiration, whereby energy is conserved in the form of a proton gradient generated across the cell membrane. In this sense, to address the issue that the CODH cluster could play a similar role in energy conservation by oxidizing CO, the present inventors tested whether T. onnurineus NA1 could utilize CO. As a result, it was found that the strain, indeed, was able to grow better in medium 1 under a CO atmosphere, in both the absence and the presence of sulfur, than in the basal medium (FIGS. 6A and 6B), even though the growth yield was still lower than that in the YPS medium (FIG. 6A). The growth under CO atmosphere was associated with the transcription of the CooS gene, indicating that the gene could be induced by the presence of CO (FIG. 6C). It is noteworthy that the addition of sulfur decreased the transcriptional level of the CooS gene. These results support the hypothesis that T. onnurineus NA1 generates energy from CO. Hereinafter, specific test methods and results for verifying the hypothesis will be described.

(63) (2) Test Methods

(64) 1) Culture Conditions

(65) T. onnurineus NA1 was anaerobically cultured in a yeast extract-peptone-sulfur (YPS) medium at 80 C. To examine the growth characteristics of a mutant strain, modified medium 1 supplemented with 30.0 g/L of NaCl was used as a basal medium (Uffen, R. L., 1976, Anaerobic growth of a Rhodopseudomonas species in the dark with carbon monoxide as sole carbon and energy substrate. Proc. Natl. Acad. Sci. USA 73:3298-3302). The medium was autoclaved, and then 1.0 ml/L of vitamin solution (Balch, W. E., G. E. Fox, L. J. Magrum, C. R. Woese, and R. S. Wolfe. 1979. Methanogens: reevaluation of a unique biological group. Microbiol. Rev. 43:260-296) and 0.5 g/L of yeast extract were added to modified medium 1 in an aerobic chamber. The pH was adjusted to 8.0 by adding 1N NaOH to the basal medium. 30 ml of the prepared medium was dispensed into 150-ml serum bottles, and the gas phase (120 ml) was changed to 100% CO (10.sup.5 Pa). All the cultures for physiological tests were carried out at 80 C. in anaerobic conditions for 24 hours, and the tests were carried out in duplicate.

(66) 2) RNA Extraction and Microarray Design

(67) Cultures were centrifuged at 4 C. at 3,500g for 10 min, and the total RNA was extracted from the cultures with TRIZOL reagent according to the manufacturer's protocol (Invitrogen, Carlsbad, Calif.). The total RNA samples were quantitatively and qualitatively analyzed by a NanoDrop spectrophotometer (ND-1000, Thermo Scientific) and electrophoresis. The micrtoarray used in this experiment was a Roche NimbleGen microarray. Briefly, a total of 31,994 unique 60-mer oligonucleotides were designed and synthesized in situ using photo-deprotection chemistry. Each unique oligonucleotide was repeated twice on the array (a total of 72,000 features).

(68) 3) cDNA Synthesis and Hybridization Conditions

(69) A microarray test was carried out according to the manufacturer's protocol. Each total RNA sample (5 g) was labeled with Cy5-dCTP (Amersharm, Piscataway, N.J.) by a reverse transcription reaction using reverse transcriptase, SuperScript II (Invitrogen, Carlsbad, Calif.). Then, the labeled cDNA mixture was concentrated using ethanol precipitation. 30 l of the concentrated Cy5-labeled cDNAs were suspended in a hybridization solution (GenoCheck, Korea). The labeled cDNAs were located on the microarray, and then covered by a MAUI Mixer X4 hybridization chamber (BioMicro Systems, Salt Lake City, Utah). The slides were hybridized using MAUI 12-bay systems (BioMicro Systems, Salt Lake City, Utah) at 42 C. for 12 hours. The hybridized slides were washed at room temperature in 2SSC, 0.1% SDS for 2 min, 1SSC for 3 min, and then 0.2SSC for 2 min. The slides were centrifuged at 1,000g for 20 sec, followed by drying.

(70) 4) Slide Scanning, Normalization, and Data Analysis

(71) Arrays were scanned using a GenePix 4000B scanner (Molecular Devices Corporation, Union City, Calif.), and the data were extracted using NimbleScan 2.4 software. Array normalization was performed using a median polish and quantile normalization method (Amaratunga, D., and J. Cabrera. 2001. Statistical analysis of viral microchip data. J. Am. Stat. Assoc. 96:1161-1170). Normalized expression values for the individual probes were used to obtain expression values for a given ORF using the RMA (robust multi-array average) method previously described by Irizarry et al. (Karl, D. M. 1995. The microbiology of deep-sea hydrothermal vents. CRC Press, Boca Raton, Fla.). Finally, n-fold change ratios (R) were calculated using the RMA-processed expression values (RMA calls) obtained for a particular gene in a sample. Data analysis was performed using GeneSpring GX 7.3.1 (Agilent Technologies, CA). Fold change filters included the requirement that the genes be present in at least 200% of controls for up-regulated genes and lower than 50% of controls for down-regulated genes. The data were clustered into groups of genes that behave similarly in experiments using GeneSpring GX 7.3.1 (Agilent technologies, CA). An algorithm based on the Euclidean distance and average linkage was used to separate the gene of similar patterns.

(72) 5) Quantitative RT-PCR

(73) Gene specific primers were designed from the genome sequence of T. onnurineus NA1 (Genbank accession number CP000855). The primer sequences are shown in Table 3 below.

(74) cDNAs were synthesized from 350 ng of total RNA using reverse transcriptase, SuperScript II (Invitrogen, Carlsbad, Calif.), according to the manufacturer's protocol. PCR reactions were performed with rTaq (Takara) DNA polymerase using a T1 thermocycler (Biometra). The reactions were performed in 50 l of a mixture containing first-strand reaction cDNA, 10 pmol primers, 250 M dNTPs and manufacturer's buffer. Also, the PCR amplification reactions were performed in the following conditions: denaturation of 2 min for 94 C.; and then 25 cycles of denaturation (30 sec at 94 C.), annealing (30 sec at 56 C.) and extension (1 min at 72 C.). The PCR products were analyzed by 0.8% agarose gel electrophoresis. The expression level was measured using Gel Pro32.EXE v4.6 (Media Cybernetics, Inc.). A Chaperonin-encoding gene, named cha, was used as a control to normalize expression levels.

(75) TABLE-US-00005 TABLE3 OligonucleotidesusedinthisExample Gene name Sense(5.fwdarw.3) Anti-sense(5.fwdarw.3) PrimersusedinRT-PCR mbh Cacgacataggctacgacacgg Ctggcttaactcctaggtcagg (SEQIDNO:27) (SEQIDNO:28) mbx Gcgattcggtatgataccggac Ccatccttcgccgaagagctcg (SEQIDNO:29) (SEQIDNO:30) frh Gtaagctcgacgagtacgacgtg Gcaccacaacctatgcagaggcc (SEQIDNO:31) (SEQIDNO:32) sulfI Gcagtacgaggaagtcgagggg Gagggcctcgtcgataaggtcg (SEQIDNO:33) (SEQIDNO:34) mch Ctaccggacgattggccagaagg Ccttatatactgtgctctctccg (SEQIDNO:35) (SEQIDNO:36) mfh1 Gcgaccggtacggcaaccttcg Cttgtcagtcatgacgtagtgg (SEQIDNO:37) (SEQIDNO:38) mfh2 Gacccgaggttcacctcgatagc Gcagacctggtcgtaggttagcc (SEQIDNO:39) (SEQIDNO:40) Primersusedingenedisruption Flk-mch cgttgtctttgcccttggggcagggatatatc ggcaattgcttggactgccgaaaagccaatggc (SEQIDNO:41) (SEQIDNO:42) Flk-mfh1 gaagaaatcgcagagggcgcctatgactatcag gctcctcgcttactcaagcgttggacaaatgg (SEQIDNO:43) (SEQIDNO:44) Flk-mfh2 ggactgctcttcctgtcgacgggctcaatattc ggacgcacttaaagtcggcgtagccctttgcc (SEQIDNO:45) (SEQIDNO:46) Ivs-mch aatttaccaccccaccactcccaaaatccaac aatggggaggctgaaactactgggcaaggc (SEQIDNO:47) (SEQIDNO:48) Ivs-mfh1 tggcccaggcgatttccttcaccgacagg aattcaccaccccaccagcgctattatcagg (SEQIDNO:49) (SEQIDNO:50) Ivs_mfh2 gagcaccacctcaccatcccagggaagctatc gatggccgtgacgctgaagtaccccttcgtga (SEQIDNO:51) (SEQIDNO:52) Primersusedinidentificationofgenedisruption P.sub.gdh-hmg.sub.Pfu gaacggtagttttcgacaaaagacg gctcaccagccaaaaccgcaccagc (SEQIDNO:53) (SEQIDNO:54) mch.sub.TNA1 gcaatgtaccacatattcaactgcgatac ccgataccgagtttgaatggaggaatctc (SEQIDNO:55) (SEQIDNO:56) mfh1.sub.TNA1 tcaggccacccccttgcccttctgt atggagtgcagcgtgtgtgcgggtg (SEQIDNO:57) (SEQIDNO:58) mfh2.sub.TNA1 atgtctgaagttatcaagtttaacg tgaggcctttatggagagcttgttg (SEQIDNO:59) (SEQIDNO:60)

(76) 6) Targeted Gene Disruption

(77) To analyze the function of hydrogenases in vivo of T. onnurineus, insertional inactivation mutants of the large subunit of mch or mfh2 hydrogenase were constructed using a gene disruption system used for the hyperthermophilic archaeon T. kodakaraensis KOD1 (Sapra, R., K. Bagramyan, and M. W. W. Adams, 2003, A simple energy-conserving system: Proton reduction coupled to proton translocation. Proc. Natl. Acad. Sci. USA 100:7545-7550). Specifically, DNA fragments comprising the flanking region of the large subunits ((TON_023 and TON_1569) of each of mch and mfh2 hydrogenases were amplified from the genomic DNA of T. onnurineus NA1 using primer sets (Table 3) for Flk-mch or Flk-mfh2. Each of the amplified fragments was ligated into pUC118 digested with HincII. Next, a template (Flk-mch_pUC118 or Flk-mfh2_pUC118 recombinant plasmid) was subjected to inverse PCR using a set of primers (Ivs-mch or Ivs-mfh2) (Table 3), and then ligated into a P.sub.gdh-hmg.sub.Pfu cassette (Sapra, R., K. Bagramyan, and M. W. W. Adams. 2003. A simple energy-conserving system: Proton reduction coupled to proton translocation. Proc. Natl. Acad. Sci. USA 100:7545-7550). The ligated product was transformed into Escherichia coli DH5 cells. Recombinant plasmids (mch::P.sub.gdh-hmg.sub.Pfu and mfh2 P.sub.gdh-hmg.sub.Pfu) were prepared with the plasmid mini kit (Qiagen, Hilden, Germany). Finally, the plasmids were transformed into T. onnurineus NA1 using a slight modification of the method of Sato et al. (Sato, T., T. Fukui, H. Atomi, and T. Imanaka. 2003. Targeted gene disruption by homologous recombination in the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1. J. Bacteriol. 185:210-220., Sato, T., T. Fukui, H. Atomi, and T. Imanaka. 2005. Improved and versatile transformation system allowing multiple genetic manipulations of the hyperthermophilic archaeon Thermococcus kodakaraensis. Appl. Environ. Microbiol. 71:3889-3899). The transformants were screened in ASW-YT-S medium in the presence of 10 M simvastatin (Matsumi, R., K. Manabe, T. Fukui, H. Atomi, and T. Imanaka. 2007. Disruption of a sugar transporter gene cluster in a hyperthermophilic archaeon using a host-marker system based on antibiotic resistance. J. Bacteriol. 189:2683-2691), and the candidate groups thought that the target gene was deleted therefrom could be confirmed by examining whether the P.sub.gdh-hmg.sub.Pfu cassette was present in the target region.

(78) 7) Kinetics on Growth and Hydrogen Production

(79) Growth was observed directly by the eye. Samples were diluted in sterile water containing sea salt (30.0 g/L), formalin (2.5%) and 4-6-diamidino-2-phenylindole (0.01%) (Sato, T., T. Fukui, H. Atomi, and T. Imanaka. 2005 Improved and versatile transformation system allowing multiple genetic manipulations of the hyperthermophilic archaeon Thermococcus kodakaraensis. Appl. Environ. Microbiol. 71:3889-3899). The diluted samples were filtered through a black polycarbonate filter (pore size: 0.2 m; Whatman), and then analyzed by an optical phase contrast microscope (Zeiss Axioplan). Hydrogen gas was measured using a gas chromatograph HP 5890 series II (Hewlett Packard) equipped with a HP-PLOT Molesieve column (Agilent) and a TCD detector. Argon was used as a gas carrier. The oven temperature was 40 C. 10 l of a gas sample for analysis was taken with a gas-tight syringe through a butyl rubber plug. The measurement of the detected hydrogen gas was calculated by comparing the peak area with a calibration curve obtained by regression analysis using a standard gas containing 40% hydrogen in nitrogen.

(80) (3) Test Results

(81) 1) In Silico Analysis of T. onnurineus NA1 Hydrogenase

(82) The previous genomic analysis of T. onnurineus NA1 showed the presence of eight hydrogenase gene clusters (Porter, K. G. and Y. S. Feig. 1980. The use of DAPI for identifying and counting microflora. Limnol. Oceanogr. 25:943-948), which include five membrane-bound [NiFe]-hydrogenases (Mbh, TON_1583-1595; Mbx, TON_0486-0498; Mfh1, TON_0273-0278; Mfh2, TON_1566-1573; and Mch, TON_1021-1024), and three cytoplasmic [NiFe]-hydrogenases (Fm, TON_1559-1562; Sulf I, TON_0533-0544; and Sulf II, TON_0051-0055). Through the comparative analysis of hydrogenase gene clusters and the Thermococcales strains whose genome sequencing has been completed, it could be seen that clusters homology to Mfh1, Mfh2 and Mch clusters were very rare and were found in Thermococcales strains whose genome sequences have recently been determined, such as T. barophilus MP (Mfh1 and Mch homologues), Thermococcus sp. AM4 (Mfh1 and Mch homologues) (Unfinished sequence, GenBank accession number ABXN00000000), and T. gammatolerans (Mfh1 and Mfh2 homologues) (GenBank accession number CP001398). The sequencing of fdh1-mfh1-mnh1 (termed Hyg4-I in the paper of Lee, H. S., S. G. Kang, S. S. Bae, J. K. Lim, Y. Cho, Y. J. Kim, J. H. Jeon, S.-S. Cha, K. K. Kwon, H.-T. Kim, C.-J. Park, H.-W. Lee, S. I. Kim, J. Chun, R. R. Colwell, S.-J. Kim, and J.-H. Lee. 2008. The complete genome sequence of Thermococcus onnurineus NA1 reveals a mixed heterotrophic and carboxydotrophic metabolism. J. Bacteriol. 190:7491-7499), fdh2-mfh2-mnh2 (termed Hyg4-111) and codh-mch-mnh3 (termed Hyg4-II) clusters in T. onnurineus NA1 showed that each of the clusters included oxidoreductases such as formate dehydrogenase (FDH) and CO dehydrogenase (Codh). Particularly, carboxydotrophic metabolism resulting from growth in a CO-containing atmosphere suggests the functional role of Codh-Mch-Mnh3 that provides energy in hydrogen production pathways by oxidizing CO.

(83) 2) Expression of Hydrogenase Genes under CO-driven Growth Conditions

(84) A test for determining whether T. onnurineus NA1 can produce hydrogen while growing in a CO-containing atmosphere was carried out. As shown in FIGS. 7A and 7B, in the YPS medium, hydrogen production could not be detected, but in medium 1 supplemented with CO, the total hydrogen gas and the cell number increased with an increase in culture time.

(85) In order to examine which of hydrogenases are involved in hydrogen production during carboxydotrophic growth, the expression levels of hydrogenase genes in a CO-containing growth condition or a complex medium (YPS) were analyzed. As shown in Tables 4 and 5 and FIG. 8A, the expression levels of some ORFs (10 of 16 ORFs) in the codh-mch-mnh3 cluster were up-regulated at least two-fold in the CO-containing growth condition compared to the YPS. In addition, the expression levels of several ORFs (TON_1563, and TON_1569-1571) in the fdh2-mfh2-mnh2 cluster were also up-regulated in a CO-containing growth condition containing 1 g of yeast extract. The expression levels of ORFs in the codh-mch-mnh3 cluster varied depending on the amount of yeast extract, suggesting that the yeast extract has a correlation with the inhibition or activation of catabolism in CO-driven metabolism (Tables 4 and 5). On the other hand, the expression of other hydrogenase gene clusters did not greatly change, whereas the expression of the genes (20 genes of 29 ORFs) in the fdh1-mfh1-mnh1 cluster was down-regulated. Quantitative RT-PCR data for the large subunit of each of hydrogenases were also consistent with the microarray data. The expression of the large subunits (TON_1023 and TON_1569) of mch and mfh2 hydrogenases was increased at least two-fold (FIG. 8B), whereas the expression of the large subunit (TON_0276) of mfh1 hydrogenase was inhibited and the expression of other large subunits (mbh, mbx, frh, and sulf1) was maintained constant in both conditions. Such results suggest that the codh-mch-mnh3 or fdh2-mfh2-mnh2 clusters can be derived by CO and involved in hydrogen production processes associated with carboxydotrophic metabolism.

(86) TABLE-US-00006 TABLE 4 Expression levels of ORFs of each of hydrogenase gene clusters in CO-containing growth condition compared to those in YPS medium Gene cluster M + CO + 0.5 g YE/ M + CO + 1 g YE/ M + CO + 3 g and ORFs Annotation YPS YPS YE/YPS sulfII hydrogenase cluster TON_0051 hypothetical protein 1.273306 3.1454 2.569546 TON_0052 hydrogenase subunit alpha 1.085002 0.652365 0.550585 TON_0053 Sulfhydrogenase II, delta chain 0.896129 1.898148 1.337585 TON_0054 hydrogenase subunit gamma 0.606088 0.517724 0.630549 TON_0055 sulfhydrogenase II, beta chain 0.84527 1.44889 1.452254 fdh1-mfh1-mnh1 cluster TON_0261 hypA hydrogenase expression/formation protein 0.658409 0.78969 0.746964 TON_0262 ATPase involved in chromosome partitioning, 0.640277 0.776389 0.619674 ParA/MinD family, Mrp homolo TON_0263 hydrogenase maturation protease HycI 0.775719 1.531337 1.090123 TON_0264 molybdopterin-guanine dinucleotide biosynthesis protein A 0.538102 0.957335 0.826924 TON_0265 Nucleotidyltransferase, putative 0.421398 0.554433 0.503557 TON_0266 component F or formate hydrogen lyase 0.38336 0.338185 0.333459 TON_0267 Putative integral membrane protein, DUF68 family 0.296945 1.215972 0.838087 TON_0268 Putative integral membrane protein, DUF67 family 0.648077 0.424896 0.386235 TON_0269 Multisubunit Na+/H+ antiporter, putative MnhB subunit 0.591411 0.571996 0.600235 TON_0270 hypothetical protein 0.827927 0.85379 0.581906 TON_0271 Na.sup.+/H.sup.+ antiporter subunit 0.410417 0.328062 0.51901 TON_0272 Na.sup.+/H.sup.+ antiporter MnhF subunit, putative 0.194663 0.411647 0.331549 TON_0273 hypothetical protein 0.269222 0.652722 0.482705 TON_0274 component I or formate hydrogen lyase 0.385799 0.627629 0.614487 TON_0275 formate hydrogen lyase subunit 6 0.313283 0.621333 0.511819 TON_0276 component G or formate hydrogen lyase 0.275138 0.724228 0.692331 TON_0277 component C or formate hydrogen lyase 0.460646 0.357836 0.387126 TON_0278 component B or formate hydrogen lyase 0.720779 0.623875 0.510273 TON_0279 NADH ubiquinone oxidoreductase 0.80929 0.515429 0.54289 TON_0280 oxidoreductase iron-sulfur protein 0.3913 0.690322 0.647104 TON_0281 fdhA formate dehydrogenase, alpha subunit 0.584576 0.446401 0.44946 TON_0282 putative transcriptional regulator 1.340444 1.195043 0.883294 TON_0283 hypC hydrogenase expression/formation protein 1.007318 1.853137 2.021914 TON_0284 367aa long hypothetical hydrogenase expression/ 1.036497 1.385466 1.182663 formation protein hypD TON_0285 hypD hydrogenase expression/formation protein 0.904687 1.066448 0.758981 TON_0286 hydrogenase maturation protein HypF 0.685606 0.778307 0.719973 TON_0287 hydrogenase expression/formation protein HypE 0.851301 1.399569 1.257059 TON_0288 hypothetical protein 1.004008 1.964442 2.27641 TON_0289 cysteine desulfurase 0.666768 1.534991 1.148004 mbx hydrogenase cluster TON_0486 4Fe4S cluster-binding subunit 0.821271 0.718277 0.504388 TON_0487 nuoD NADH dehydrogenase I, subunit D 0.606823 0.730138 0.517528 TON_0488 NADH dehydrogenase subunit 0.703506 0.618352 0.49939 TON_0489 nuoB NADH dehydrogenase I, subunit B 0.797159 0.618863 0.547462 TON_0490 NADH dehydrogenase subunit 0.372425 0.469467 0.278163 TON_0491 617aa long hypothetical protein 0.459201 0.532164 0.388201 TON_0492 MbxH subunit 0.862715 0.484349 0.423606 TON_0493 Multisubunit Na+/H.sup.+ antiporter, putative 0.70216 1.591408 1.138149 TON_0494 Multisubunit Na+/H.sup.+ antiporter, putative MnhB subunit 0.765286 0.716126 1.711304 TON_0495 MbxD subunit 0.658086 0.817339 0.749402 TON_0496 MbxC subunit 0.609819 1.200655 0.995067 TON_0497 MbxB subunit 0.860304 0.889029 0.810902 TON_0498 Multisubunit Na.sup.+/H.sup.+ antiporter, putative 0.675578 0.564247 0.483617 sulfI hydrogenase cluster TON_0533 hydrogenase-specific maturation endopeptidase 0.977803 0.516234 0.73084 TON_0534 cytosolic NiFe-hydrogenase, alpha subunit 1.283309 1.334781 1.071667 TON_0535 cytosolic NiFe-hydrogenase, delta subunit 0.652099 1.080516 0.800955 TON_0536 hydrogenase (gamma subunit) 1.100959 1.192121 0.759086 TON_0537 Sulfhydrogenase beta subunit 1.025726 1.458113 1.160718 TON_0538 probable formate transporter 0.989789 1.113613 0.960108 TON_0539 probable formate dehydrogenase, alpha subunit 1.158997 1.791123 1.314525 TON_0540 oxidoreductase iron-sulfur protein 0.987581 1.525167 0.82483 TON_0541 4Fe4S cluster-binding protein 1.112648 1.320761 0.855465 TON_0542 glutamate synthase beta chain-related oxidoreductase 0.842213 1.602828 0.936949 TON_0543 4Fe4S cluster-binding protein 0.9185 1.257283 1.019564 TON_0544 alcohol dehydrogenase 0.87473 0.419323 0.605934 codh-mch-mnh3 cluster TON_1016 putative transcriptional regulator, ModE family 1.187798 0.634394 0.731218 TON_1017 4Fe4S ferredoxin, iron-sulfur binding domain 1.713085 4.46107 3.621394 TON_1018 carbon-monoxide dehydrogenase, catalytic subunit 1.474238 2.204944 1.785437 TON_1019 putative ATP-binding protein 0.824732 2.016924 0.974466 TON_1020 hypothetical protein 3.375546 9.366047 5.425704 TON_1021 component B or format hydrogen lyase 1.112538 1.711122 1.250867 TON_1022 respiratory-chain NADH dehydrogenase, subunit 1 0.877363 1.428883 0.57715 TON_1023 component G or format hydrogen lyase 1.927395 6.118015 4.270288 TON_1024 NADH dehydrogenase (ubiquinone), 20 kDa subunit 1.816315 3.578841 2.009973 TON_1025 Na.sup.+/H.sup.+ antiporter MnhF subunit, putative 2.443938 3.389037 1.333503 TON_1026 Na.sup.+/H.sup.+ antiporter subunit 1.337719 0.605839 0.623499 TON_1027 hypothetical protein 0.991048 1.43866 0.778446 TON_1028 Multisubunit Na.sup.+/H.sup.+ antiporter, MnhB subunit 1.019583 1.203407 0.836452 TON_1029 Putative integral membrane protein, DUF67 family 2.648286 2.171138 1.123898 TON_1030 Putative integral membrane protein, DUF68 family 3.779798 4.956998 1.592196 TON_1031 component F or formate hydrogen lyase 1.030507 2.778588 1.982091 frh (F.sub.420 reducing hydrogenase) hydrogenase cluster TON_1559 coenzyme F420 hydrogenase alpha subunit 0.695408 0.64447 0.726535 TON_1560 Coenzyme F420 hydrogenase gamma subunit 0.56769 0.715513 0.635236 TON_1561 4Fe4S ferredoxin, iron-sulfur binding Nitrite/ 0.824149 0.834127 0.807754 sulfite reductase TON_1562 Formate dehydrogenase, subunit FdhD 0.908701 1.54082 1.468288 Fdh2-mfh2-mnh2 cluster TON_1563 Probable formate dehydrogenase, alpha subunit 1.008259 3.037865 3.330042 TON_1564 4Fe4S cluster-binding protein 1.178705 1.221574 1.445098 TON_1565 NADH ubiquinone oxidoreductase 0.811937 1.787894 2.088693 TON_1566 NADH dehydrogenase (quinone) 1.011779 0.736029 0.787627 TON_1567 component B or formate hydrogen lyase 1.091992 1.057076 1.184573 TON_1568 component C or formate hydrogen lyase 1.471267 1.365925 1.382301 TON_1569 component G or formate hydrogen lyase 1.204795 2.281342 1.780033 TON_1570 formate hydrogen lyase subunit 6 1.257649 2.427962 1.99559 TON_1571 component I or formate hydrogen lyase 1.030626 2.15871 1.806722 TON_1572 hypothetical protein 0.844948 0.504955 0.692272 TON_1573 probable formate transporter 1.451628 1.459657 1.158131 TON_1574 Na.sup.+/H.sup.+ antiporter MnhF subunit, putative 1.53015 1.602287 1.244315 TON_1575 Na.sup.+/H.sup.+ antiporter subunit 0.752784 0.646406 0.578467 TON_1576 hypothetical protein 1.168966 0.564328 0.60819 TON_1577 Multisubunit Na.sup.+/H.sup.+ antiporter, putative MnhB subunit 0.726511 0.655031 0.556386 TON_1578 Putative integral membrane protein, DUF67 family 0.989286 1.061599 0.900044 TON_1579 Putative integral membrane protein, DUF68 family 0.903028 0.812346 0.816319 TON_1580 component F or formate hydrogen lyase 1.015786 0.756283 0.529199 TON_1581 molybdopterin-guanine dinucleotide biosynthesis protein A 0.61468 1.708744 1.243367 TON_1582 hypothetical protein 0.753301 0.998059 0.952751 mbh hydrogenase cluster TON_1583 MbhB subunit 1.038442 0.519366 0.533773 TON_1584 MbhC subunit 0.947559 0.514932 0.5099 TON_1585 MbhD subunit 0.774604 1.015909 0.670497 TON_1586 MbhE subunit 1.101069 0.811262 0.659266 TON_1587 MbhF subunit 1.129566 0.811366 0.872572 TON_1588 MbhG subunit 1.027148 0.563686 0.510924 TON_1589 MbhH subunit 1.362042 0.948034 0.71984 TON_1590 MbhI subunit 1.334732 1.227655 0.904813 TON_1591 NiFe-hydrogenase small subunit 1.627315 1.158127 0.856929 TON_1592 NiFe-hydrogenase large subunit 1 0.940698 1.573248 0.956935 TON_1593 NiFe-hydrogenase large subunit 2 1.609483 2.286207 1.354849 TON_1594 MbhM subunit 0.982323 0.742211 0.458623 TON_1595 4Fe4S cluster-binding subunit 1.589684 1.280298 0.491906 M, medium 1; CO, carbon monoxide; YE, yeast extract.

(87) TABLE-US-00007 TABLE 5 Hierarchical clustering of 112 ORFs including hydrogenase clusters from T. onnurineus NA1 M + CO + 0.5 g M + CO + 1 g M + CO + 3 g Gene cluster ORFs Annotation YE/YPS YE/YPS YE/YPS fdh1-mfh1-mnh1 TON_0272 Na.sup.+/H.sup.+ antiporter MnhF subunit, putative 0.194663 0.411647 0.331549 fdh1-mfh1-mnh1 TON_0267 Putative integral membrane protein, DUF68 family 0.296945 1.215972 0.838087 fdh1-mfh1-mnh1 TON_0273 hypothetical protein 0.269222 0.652722 0.482705 fdh1-mfh1-mnh1 TON_0275 formate hydrogen lyase subunit 6 0.313283 0.621333 0.511819 fdh1-mfh1-mnh1 TON_0276 component G or formate hydrogen lyase 0.275138 0.724228 0.692331 fdh1-mfh1-mnh1 TON_0274 component I or formate hydrogen lyase 0.385799 0.627629 0.614487 fdh1-mfh1-mnh1 TON_0280 oxidoreductase iron-sulfur protein 0.3913 0.690322 0.647104 fdh1-mfh1-mnh1 TON_0271 Na.sup.+/H.sup.+ antiporter subunit 0.410417 0.328062 0.51901 fdh1-mfh1-mnh1 TON_0266 component F or formate hydrogen lyase 0.38336 0.338185 0.333459 fdh1-mfh1-mnh1 TON_0277 component C or formate hydrogen lyase 0.460646 0.357836 0.387126 fdh1-mfh1-mnh1 TON_0268 Putative integral membrane protein, DUF67 family 0.648077 0.424896 0.386235 fdh1-mfh1-mnh1 TON_0281 fdhA formate dehydrogenase, alpha subunit 0.584576 0.446401 0.44946 fdh1-mfh1-mnh1 TON_0265 Nucleotidyltransferase, putative 0.421398 0.554433 0.503557 mbx TON_0491 617aa long hypothetical protein 0.459201 0.532164 0.388201 mbx TON_0490 NADH dehydrogenase subunit 0.372425 0.469467 0.278163 fdh1-mfh1-mnh1 TON_0261 hypA hydrogenase expression/formation protein 0.658409 0.78969 0.746964 mbx TON_0495 MbxD subunit 0.658086 0.817339 0.749402 fdh1-mfh1-mnh1 TON_0286 hydrogenase maturation protein HypF 0.685606 0.778307 0.719973 mbx TON_0494 Multisubunit Na.sup.+/H.sup.+ antiporter, putative MnhB subunit 0.765286 0.716126 0.711304 frh TON_1559 coenzyme F420 hydrogenase alpha subunit 0.695408 0.64447 0.726535 mbx TON_0487 nuoD NADH dehydrogenase I, subunit D 0.606823 0.730138 0.517528 fdh1-mfh1-mnh1 TON_0262 ATPase involved in chromosome partitioning, Mrp homolo 0.640277 0.776389 0.619674 frh TON_1560 Coenzyme F420 hydrogenase gamma subunit 0.56769 0.715513 0.635236 sufII TON_0054 hydrogenase subunit gamma 0.606088 0.517724 0.630549 fdh1-mfh1-mnh1 TON_0269 Multisubunit Na+/H+ antiporter, putative MnhB subunit 0.591411 0.571996 0.600235 mbx TON_0486 4Fe4S cluster-binding subunit 0.821271 0.718277 0.504388 fdh1-mfh1-mnh1 TON_0278 component B or formate hydrogen lyase 0.720779 0.623875 0.510273 mbx TON_0488 NADH dehydrogenase subunit 0.703506 0.618352 0.49939 mbx TON_0498 Multisubunit Na.sup.+/H.sup.+ antiporter, putative 0.675578 0.564247 0.483617 mbx TON_0489 nuoB NADH dehydrogenase I, subunit B 0.797159 0.618863 0.547462 fdh2-mfh2-mnh2 TON_1575 Na.sup.+/H.sup.+ antiporter subunit 0.752784 0.646406 0.578467 fdh2-mfh2-mnh2 TON_1577 Multisubunit Na.sup.+/H.sup.+ antiporter, putative MnhB subunit 0.726511 0.655031 0.556386 sulfI TON_0544 alcohol dehydrogenase 0.87473 0.419323 0.605934 sulfI TON_0533 hydrogenase-specific maturation endopeptidase 0.977803 0.516234 0.73084 fdh2-mfh2-mnh2 TON_1572 hypothetical protein 0.844948 0.504955 0.692272 mbx TON_0492 MbxH subunit 0.862715 0.484349 0.423606 fdh1-mfh1-mnh1 TON_0279 NADH ubiquinone oxidoreductase 0.80929 0.515429 0.54289 mbh TON_1584 MbhC subunit 0.947559 0.514932 0.5099 mbh TON_1583 MbhB subunit 1.038442 0.519366 0.533773 mbh TON_1588 MbhG subunit 1.027148 0.563686 0.510924 sufII TON_0052 hydrogenase subunit alpha 1.085002 0.652365 0.550585 fdh2-mfh2-mnh2 TON_1580 component F or formate hydrogen lyase 1.015786 0.756283 0.529199 mbh TON_1594 MbhM subunit 0.982323 0.742211 0.458623 codh-mch-mnh3 TON_1016 putative transcriptional regulator, ModE family 1.187798 0.634394 0.731218 codh-mch-mnh3 TON_1026 Na.sup.+/H.sup.+ antiporter subunit 1.337719 0.605839 0.623499 fdh2-mfh2-mnh2 TON_1576 hypothetical protein 1.168966 0.564328 0.60819 codh-mch-mnh3 TON_1022 respiratory-chain NADH dehydrogenase, subunit 1 0.877363 1.428883 0.57715 fdh1-mfh1-mnh1 TON_0264 molybdopterin-guanine dinucleotide biosynthesis protein A 0.538102 0.957335 0.826924 sulfI TON_0535 cytosolic NiFe-hydrogenase, delta subunit 0.652099 1.080516 0.800955 mbx TON_0496 MbxC subunit 0.699819 1.200655 0.995067 fdh2-mfh2-mnh2 TON_1582 hypothetical protein 0.753301 0.998059 0.952751 fdh1-mfh1-mnh1 TON_0270 hypothetical protein 0.827927 0.85379 0.581906 fdh1-mfh1-mnh1 TON_0285 hypD hydrogenase expression/formation protein 0.904687 1.066448 0.758981 mbh TON_1585 MbhD subunit 0.774604 1.015909 0.670497 mbx TON_0497 MbxB subunit 0.860304 0.889029 0.810902 frh TON_1561 4Fe4S ferredoxin, iron-sulfur binding Nitrite/sulfite reductase 0.824149 0.834127 0.807754 fdh2-mfh2-mnh2 TON_1579 Putative integral membrane protein, DUF68 family 0.903028 0.812346 0.816319 fdh2-mfh2-mnh2 TON_1566 NADH dehydrogenase (quinone) 1.011779 0.736019 0.787627 mbh TON_1587 MbhF subunit 1.129566 0.811366 0.872572 mbh TON_1586 MbhE subunit 1.101069 0.811262 0.659266 sufII TON_0051 hypothetical protein 1.273306 3.1454 2.569546 fdh2-mfh2-mnh2 TON_1563 Probable formate dehydrogenase, alpha subunit 1.008259 3.037865 3.330042 fdh1-mfh1-mnh1 TON_0283 hypC hydrogenase expression/formation protein 1.007318 1.853137 2.021914 fdh1-mfh1-mnh1 TON_0288 hypothetical protein 1.004008 1.964442 2.27641 fdh2-mfh2-mnh2 TON_1571 component I or formate hydrogen lyase 1.030636 2.15871 1.806722 fdh2-mfh2-mnh2 TON_1565 NADH ubiquinone oxidoreductase 0.811937 1.787894 2.088693 codh-mch-mnh3 TON_1031 component F or formate hydrogen lyase 1.030507 2.788568 1.982091 codh-mch-mnh3 TON_1018 carbon-monoxide dehydrogenase, catalytic subunit 1.474238 2.204944 1.785437 fdh2-mfh2-mnh2 TON_1569 component G or formate hydrogen lyase 1.204795 2.281342 1.760033 fdh2-mfh2-mnh2 TON_1570 formate hydrogen lyase subunit 6 1.257649 2.427962 1.99559 fdh1-mfh1-mnh1 TON_0287 hydrogenase expression/formation protein HypE 0.851301 1.399569 1.257059 sufII TON_0055 sulfhydrogenase II, beta chain 0.84527 1.44889 1.452254 frh TON_1562 Formate dehydrogenase, subunit FdhD 0.908701 1.54082 1.468288 sufII TON_0053 Sulfhydrogenase II, delta chain 0.896129 1.898148 1.337585 sulfI TON_0539 probable formate dehydrogenase, alpha subunit 1.158997 1.791123 1.314525 codh-mch-mnh3 TON_1021 component B or format hydrogen lyase 1.112538 1.711122 1.250867 fdh1-mfh1-mnh1 TON_0263 hydrogenase maturation protease HycI 0.775719 1.531337 1.090123 fdh1-mfh1-mnh1 TON_0289 cysteine desulfurase 0.666768 1.534991 1.148004 mbx TON_0493 Multisubunit Na.sup.+/H.sup.+ antiporter, putative 0.70216 1.591408 1.138149 fdh2-mfh2-mnh2 TON_1581 molybdopterin-guanine dinucleotide biosynthesis protein A 0.61468 1.708744 1.243367 codh-mch-mnh3 TON_1019 putative ATP-binding protein 0.824732 2.016924 0.974466 sulfI TON_0542 glutamate synthase beta chain-related oxidoreductase 0.842213 1.602828 0.936949 mbh TON_1592 NiFe-hydrogenase large subunit 1 0.940698 1.573248 0.956935 fdh1-mfh1-mnh1 TON_0284 367aa long hypothetical hydrogenase protein hypD 1.036497 1.385466 1.182663 sulfI TON_0537 Sulfhydrogenase beta subunit 1.025726 1.458113 1.160718 sulfI TON_0534 cytosolic NiFe-hydrogenase, alpha subunit 1.283309 1.334781 1.071667 fdh2-mfh2-mnh2 TON_1564 4Fe4S cluster-binding protein 1.178705 1.221574 1.445098 fdh2-mfh2-mnh2 TON_1567 component B or formate hydrogen lyase 1.091992 1.057076 1.184573 fdh2-mfh2-mnh2 TON_1568 component C or formate hydrogen lyase 1.471267 1.365925 1.382301 fdh2-mfh2-mnh2 TON_1573 probable formate transporter 1.451628 1.459657 1.158131 fdh2-mfh2-mnh2 TON_1574 Na.sup.+/H.sup.+ antiporter MnhF subunit, putative 1.53015 1.602287 1.244315 sulfI TON_0541 4Fe4S cluster-binding protein 1.112648 1.320761 0.855465 sulfI TON_0536 hydrogenase (gamma subunit) 1.100959 1.192121 0.759086 codh-mch-mnh3 TON_1028 Multisubunit Na.sup.+/H.sup.+ antiporter, putative MnhB subunit 1.019583 1.203407 0.836452 sulfI TON_0540 oxidoreductase iron-sulfur protein 0.987581 1.525167 0.82485 codh-mch-mnh3 TON_1027 hypothetical protein 0.991048 1.43866 0.778446 sulfI TON_0543 4Fe4S cluster-binding protein 0.9185 1.257283 1.019564 sulfI TON_0538 probable formate transporter 0.989789 1.113613 0.960108 fdh2-mfh2-mnh2 TON_1578 Putative integral membrane protein, DUF67 family 0.989286 1.061599 0.900044 fdh1-mfh1-mnh1 TON_0282 putative transcriptional regulator 1.340444 1.195043 0.883294 mbh TON_1590 MbhI subunit 1.334732 1.227655 0.904813 mbh TON_1591 NiFe-hydrogenase small subunit 1.627315 1.158127 0.856929 mbh TON_1589 MbhH subunit 1.362042 0.948034 0.71984 mbh TON_1595 4Fe4S cluster-binding subunit 1.589684 1.280298 0.491906 codh-mch-mnh3 TON_1030 Putative integral membrane protein, DUF68 family 3.779798 4.956998 1.592196 codh-mch-mnh3 TON_1024 NADH dehydrogenase (ubiquinone), 20 kDa subunit 1.816315 3.578841 2.009973 codh-mch-mnh3 TON_1025 Na.sup.+/H.sup.+ antiporter MnhF subunit, putative 2.443938 3.389037 1.333503 codh-mch-mnh3 TON_1029 Putative integral membrane protein, DUF67 family 2.648286 2.171138 1.123898 mbh TON_1593 NiFe-hydrogenase large subunit 2 1.609483 2.286207 1.354849 codh-mch-mnh3 TON_1020 hypothetical protein 3.375546 9.366047 5.425704 codh-mch-mnh3 TON_1017 4Fe4S ferredoxin, iron-sulfur binding domain 1.713085 4.46107 3.621394 codh-mch-mnh3 TON_1023 component G or formate hydrogen lyase 1.927395 6.118015 4.270288

(88) 3) Gene Disruption and Phenotype Analysis of Disruption Mutants

(89) Transcriptome analysis suggests that the mch hydrpogenase clustered close to codh (FIG. 9A) can play an important role in carboxydotrophic hydrogenogenesis in T. onnurineus NA1. However, the up-regulation of the fdh2-mfh2-mnh2 cluster and the high copy number of mRNA of other clusters raise a question about whether codh-mch-mnh3 alone is involved in carboxydotrophic hydrogenogenesis or whether other hydrogenases can become alternative pathways for mch by forming complexes in combination with dehydrogenases or recycling electronic carriers such as FADH.sub.2 or NADH. Thus, the present inventors constructed disruption mutants of the large subunit of each of mch and mfh2 hydrogenases (Matsumi, R., K. Manabe, T. Fukui, H. Atomi, and T. Imanaka. 2007. Disruption of a sugar transporter gene cluster in a hyperthermophilic archaeon using a host-marker system based on antibiotic resistance. J. Bacteriol. 189:2683-2691). The method of constructing the disruption mutants are shown in FIG. 9A. The large subunit of the Mch or Mfh2 hydrogenase gene cluster was disrupted by insertional inactivation of the P.sub.gdh-hmg.sub.Pfu cassette by homologous recombination in the targeted region and the resulting overexpression of the hmg-CoA gene. The targeted gene disruption was confirmed by examining the presence of the P.sub.gdh-hmg.sub.Pfu cassette through PCR amplification after screening candidate groups in a YPS medium supplemented with 10 M simvastatin (FIG. 9B). P.sub.gdh-hmg.sub.Pfu could be amplified in the disruption candidate groups (.sup.mch.sub.TNA1 and .sup.mfh2.sub.TNA1), whereas the amplification of the large subunits of mch or mfh2 was failed. Such results show that the gene disruption system reported in T. kodakaraensis KOD1 (Sapra, R., K. Bagramyan, and M. W. W. Adams. 2003. A simple energy-conserving system: Proton reduction coupled to proton translocation. Proc. Natl. Acad. Sci. USA 100:7545-7550) can also be applied to T. onnurinues NA1.

(90) Because the disruption mutants (mch.sub.TNA1 and mfh2.sub.TNA1) could be obtained in the YPS medium, it can be seen that Mch or Mfh2 is not essential for the metabolic consumption of the YPS medium. As can be seen in FIGS. 10A-10D, the changes in the growth and morphology of the mutant strains mch.sub.TNA1 and mfh2.sub.TNA1 confirm that the genes are not necessarily essential in the YPS medium. In addition, the mfh2.sub.TNA1 strain was able to grow and produce hydrogen in the CO-containing growth condition at a level similar to the wild-type strain (FIGS. 7B and 10D). On the other hand, the mch.sub.TNA1 mutant was not able to grow in the CO-containing growth condition and did not produce hydrogen in this condition (FIG. 10C). This indicates that the absence of the large subunit of Mch leads to complete disruption of the carboxydotrophic survival ability of T. onnurineus NA1 in the presence of CO. Putting these results together, it appears that, when CO is fed as a substrate, only Mch hydrogenase is involved in growth and hydrogen production.

(91) As described above, the novel hydrogenases of the present invention can produce a large amount of hydrogen by responding specifically to various substrates such as carbon monoxide, formate or starch. According to the hydrogen production methods of the present invention, a large amount of hydrogen can be produced merely by culturing the above-described strain in specific culture conditions. Thus, the methods of the present invention have advantages in that they are more economic and efficient than existing hydrogen production methods and can produce hydrogen even at high temperature.