METHOD FOR PRODUCING PROTEIN
20180118796 ยท 2018-05-03
Inventors
Cpc classification
C07K14/70553
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
International classification
C07K14/705
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
Abstract
It has been believed that promoting the assembly of polysomes composed of many ribosomes attached to mRNA is very effective for highly efficient protein synthesis. However, the mechanism for p180 protein's capability of promoting polysome formation has been yet to be elucidated.
The inventors of the present application newly discovered SF3b4 protein as a protein that specifically interacts with the coiled-coil domain of p180 protein, a responsible region for its capability of promoting polysome formation, and which is capable of promoting mRNA localization to an endoplasmic reticulum (ER). The inventors also found that, in cells capable of highly expressing both p180 protein and a protein promoting mRNA localization to an endoplasmic reticulum (ER) (e.g., SF3b4 protein), the mRNA localization to the endoplasmic reticulum can be significantly elevated so that the secretory capacity in cultured cells can be enhanced. Further, the inventors demonstrated that when a particular nucleotide sequence is inserted into an expression plasmid, SF3b4 protein exhibiting protein expression enhancing ability can be localized onto the endoplasmic reticulum membrane, and the mRNA distribution in polysomes can be shifted towards heavier fractions, whereby the secretory capacity in cells can be enhanced.
Claims
1-30. (canceled)
31. A method for increasing an amount of a protein product of interest expressed in a cell expression system comprising inserting a cis-element recognized by or interacting with an RNA-binding protein in an expression unit for expressing the protein product of interest, wherein the expression unit comprises a cDNA encoding a protein of interest consisting of a nucleic acid sequence encoding the full-length of the protein of interest, wherein the cis-element is inserted downstream of a promoter and upstream of a start codon of the cDNA encoding the protein of interest, whereby the amount of the protein product of interest expressed in the cell expression system is increased, wherein the cis-element comprises two or more motifs consisting of a nucleotide sequence containing 9mer to 12mer sequence of GAN1-(X)n-ACN2, wherein n=3 to 6, N1 and N2 are independently selected from adenine (A), thymine (T), cytosine (C), or guanine (G), and X is selected from adenine (A), thymine (T), cytosine (C), or guanine (G), wherein the RNA-binding protein is (1) a protein consisting of an amino acid sequence of splicing factor 3B subunit 4 (SF3b4) set forth in SEQ ID NO: 4; (2) a protein consisting of an amino acid sequence with at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO: 4, and which, when expressed in the cell, has an ability to enhance capacity of the cell for synthesis or secretion of the protein product of interest, wherein the ability is comparable to that of SF3b4 having the amino acid sequence set forth in SEQ ID NO: 4; or (3) a protein consisting of an amino acid sequence encoded by a nucleotide sequence with at least 90% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3, and which, when expressed in the cell, has an ability to enhance capacity of the cell for synthesis or secretion of the protein product of interest, wherein the ability is comparable to that of SF3b4 having the amino acid sequence set forth in SEQ ID NO: 4.
32. The method according to claim 31, wherein the cis-element comprises (i) a nucleotide sequence containing 9mer to 12mer sequence motifs of GAG-(X)n-ACV, wherein n=3 to 6 and V is A, G, or C; and (ii) a nucleotide sequence set forth in one of SEQ ID NOs: 17 to 20.
33. The method according to claim 31, wherein the cis-element comprises a sequence selected from the group consisting of: a sequence derived from the nucleotide sequence of the 5 untranslated region of a type I collagen gene; a sequence derived from the nucleotide sequence of the 5 untranslated region of a fibronectin gene; a sequence derived from the nucleotide sequence of the 5 untranslated region of a matrix metalloproteinase 14 (MMP14) gene; and a sequence derived from the nucleotide sequence of the 5 untranslated region of a prolyl 4-hydroxylase A2 (P4HA2) gene.
34. The method according to claim 31, wherein the cis-element comprises SEQ ID NO: 5, or nucleotides at positions 1 to 102, positions 1 to 78, positions 1 to 60, positions 61 to 126, positions 16 to 57, positions 79 to 126, positions 103 to 126, positions 58 to 78, positions 51 to 78, positions 1 to 27, or positions 70 to 78 of SEQ ID NO: 5.
35. The method according to claim 31, wherein the cell expression system is an intact host cell, a cell having enhanced expression of a p180 protein, a cell having enhanced expression of a SF3b4 protein, or a cell having enhanced expression of both a p180 protein and a SF3b4 protein.
36. An expression unit for expressing a protein product of interest comprising (a) a cDNA encoding a protein of interest consisting of a nucleic acid sequence encoding the full-length of the protein of interest, and (b) a cis-element recognized by or bound by an RNA-binding protein, wherein the cis-element is inserted into the expression unit downstream of a promoter and and upstream of a start codon of the cDNA encoding the protein of interest, whereby the amount of the protein product of interest expressed in a cell expression system is increased, wherein the cis-element comprises two or more motifs consisting of a nucleotide sequence containing 9mer to 12mer sequence of GAN1-(X)n-ACN2, wherein n=3 to 6, N1 and N2 are independently selected from adenine (A), thymine (T), cytosine (C), or guanine (G), and X is selected from adenine (A), thymine (T), cytosine (C), or guanine (G), wherein the RNA-binding protein is (1) a protein consisting of an amino acid sequence of splicing factor 3B subunit 4 (SF3b4) set forth in SEQ ID NO: 4; (2) a protein consisting of an amino acid sequence with at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO: 4, and which, when expressed in the cell, has an ability to enhance capacity of the cell for synthesis or secretion of the protein product of interest, wherein the ability is comparable to that of SF3b4 having the amino acid sequence set forth in SEQ ID NO: 4; or (3) a protein consisting of an amino acid sequence encoded by a nucleotide sequence with at least 90% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3, and which, when expressed in the cell, has an ability to enhance capacity of the cell for synthesis or secretion of the protein product of interest, wherein the ability is comparable to that of SF3b4 having the amino acid sequence set forth in SEQ ID NO: 4.
37. An expression vector comprising the expression unit according to claim 36.
38. The method according to claim 31, and wherein the cell expression system is a recombinant cell transfected with a nucleic acid encoding an RNA-binding protein containing an RNA recognition motif (RRM), or transfected with both a nucleic acid encoding a p180 protein and a nucleic acid encoding an RNA-binding protein containing an RRM, wherein said transfection provides for enhanced intracellular synthetic or secretory capacity of a protein product of interest.
39. The expression unit according to claim 38, wherein the cell expression system is a recombinant cell transfected with a nucleic acid encoding an RNA-binding protein containing an RNA recognition motif (RRM), or transfected with both a nucleic acid encoding a p180 protein and a nucleic acid encoding an RNA-binding protein containing an RRM, wherein said transfection provides for enhanced intracellular synthetic or secretory capacity of a protein product of interest.
40. An expression vector comprising the expression unit according to claim 39.
41. The method according to claim 31, wherein the cell expression system comprises a cis-element comprising four of the motifs.
42. The expression unit according to claim 36 comprising a cis-element comprising four of the motifs.
43. A method for increasing an amount of a protein product of interest expressed in a cell expression system comprising: (a) inserting a cis-element recognized by or interacting with an RNA-binding protein in an expression unit for expressing the protein product of interest, wherein the cis-element is inserted downstream of a promoter and upstream of a start codon in a nucleotide sequence encoding the protein product of interest, whereby the amount of the protein product of interest expressed in the cell expression system is increased, wherein the cis-element comprises one or more motif(s) consisting of a nucleotide sequence containing 9mer to 12mer sequence of GAN1-(X)n-ACN2, wherein n=3 to 6, N1 and N2 are independently selected from adenine (A), thymine (T), cytosine (C), or guanine (G), and X is selected from adenine (A), thymine (T), cytosine (C), or guanine (G), and (b) expressing the protein product of interest in the cell expression system, wherein the cell expression system is a recombinant cell transfected with a nucleic acid encoding an RNA-binding protein containing an RNA recognition motif (RRM) and transfected with both a nucleic acid encoding a p180 protein, wherein the RNA-binding protein is (1) a protein consisting of an amino acid sequence of splicing factor 3B subunit 4 (SF3b4) set forth in SEQ ID NO: 4; (2) a protein consisting of an amino acid sequence with at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO: 4, and which, when expressed in the cell, has an ability to enhance capacity of the cell for synthesis or secretion of the protein product of interest, wherein the ability is comparable to that of SF3b4 having the amino acid sequence set forth in SEQ ID NO: 4; or (3) a protein consisting of an amino acid sequence encoded by a nucleotide sequence with at least 90% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3, and which, when expressed in the cell, has an ability to enhance capacity of the cell for synthesis or secretion of the protein product of interest, wherein the ability is comparable to that of SF3b4 having the amino acid sequence set forth in SEQ ID NO: 4.
44. An expression unit for expressing a protein product of interest comprising (a) a cDNA encoding a protein of interest consisting of a nucleic acid sequence encoding the full-length of the protein of interest, and (b) a cis-element recognized by or bound by an RNA-binding protein, wherein the cis-element is inserted into the expression unit downstream of a promoter and upstream of a start codon of the cDNA encoding the protein of interest, whereby the amount of the protein product of interest expressed in a cell expression system is increased, wherein the cis-element comprises one or more motif(s) consisting of a nucleotide sequence containing 9mer to 12mer sequence of GAN1-(X)n-ACN2, wherein n=3 to 6, N1 and N2 are independently selected from adenine (A), thymine (T), cytosine (C), or guanine (G), and X is selected from adenine (A), thymine (T), cytosine (C), or guanine (G), wherein the RNA-binding protein is (1) a protein consisting of an amino acid sequence of splicing factor 3B subunit 4 (SF3b4) set forth in SEQ ID NO: 4; (2) a protein consisting of an amino acid sequence with at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO: 4, and which, when expressed in the cell, has an ability to enhance capacity of the cell for synthesis or secretion of the protein product of interest, wherein the ability is comparable to that of SF3b4 having the amino acid sequence set forth in SEQ ID NO: 4; or (3) a protein consisting of an amino acid sequence encoded by a nucleotide sequence with at least 90% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3, and which, when expressed in the cell, has an ability to enhance capacity of the cell for synthesis or secretion of the protein product of interest, wherein the ability is comparable to that of SF3b4 having the amino acid sequence set forth in SEQ ID NO: 4; and wherein the cell expression system is a recombinant cell transfected with a nucleic acid encoding an RNA-binding protein containing an RNA recognition motif (RRM) and transfected with both a nucleic acid encoding a p180 protein, wherein said transfection provides for enhanced intracellular synthetic or secretory capacity of a protein product of interest.
45. An expression vector comprising an expression unit for expressing a protein product of interest comprising (a) a cDNA encoding a protein of interest consisting of a nucleic acid sequence encoding the full-length of the protein of interest, and (b) a cis-element recognized by or bound by an RNA-binding protein, wherein the cis-element is inserted into the expression unit downstream of a promoter and upstream of a start codon of the cDNA encoding the protein of interest, whereby the amount of the protein product of interest expressed in a cell expression system is increased, wherein the cis-element comprises one or more motif(s) consisting of a nucleotide sequence containing 9mer to 12mer sequence of GAN1-(X)n-ACN2, wherein n=3 to 6, N1 and N2 are independently selected from adenine (A), thymine (T), cytosine (C), or guanine (G), and X is selected from adenine (A), thymine (T), cytosine (C), or guanine (G), wherein the RNA-binding protein is (1) a protein consisting of an amino acid sequence of splicing factor 3B subunit 4 (SF3b4) set forth in SEQ ID NO: 4; (2) a protein consisting of an amino acid sequence with at least 90% sequence identity to the amino acid sequence set forth in SEQ ID NO: 4, and which, when expressed in the cell, has an ability to enhance capacity of the cell for synthesis or secretion of the protein product of interest, wherein the ability is comparable to that of SF3b4 having the amino acid sequence set forth in SEQ ID NO: 4; or (3) a protein consisting of an amino acid sequence encoded by a nucleotide sequence with at least 90% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3, and which, when expressed in the cell, has an ability to enhance capacity of the cell for synthesis or secretion of the protein product of interest, wherein the ability is comparable to that of SF3b4 having the amino acid sequence set forth in SEQ ID NO: 4; and wherein the cell expression system is a recombinant cell transfected with a nucleic acid encoding an RNA-binding protein containing an RNA recognition motif (RRM) and transfected with both a nucleic acid encoding a p180 protein, wherein said transfection provides for enhanced intracellular synthetic or secretory capacity of a protein product of interest.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
DESCRIPTION OF EMBODIMENTS
[0072] The present inventors demonstrated that, in the first mode of the present invention, there can be provided a recombinant cell having enhanced intracellular expression of the full length or a portion of p180 protein and/or the full length or a portion of splicing factor 3B subunit 4 (SF3b4) protein, and having enhanced intracellular synthetic or secretory capacity of a protein as a product of interest.
[0073] In this mode of the present invention, the full length or a portion of p180 protein and/or the full length or a portion of SF3b4 protein are/is caused to be expressed in a cell, thereby making it possible to promote polysome formation on an intracellular endoplasmic reticulum, which is involved by mRNA, an expression product of a nucleic acid molecule encoding a protein as a product of interest. As referred to herein, the polysome refers to a complex in which multiple ribosomes on the intracellular endoplasmic reticulum are bound to one mRNA molecule. Such up-regulated polysome formation results in an enhancement of a biosynthetic or secretory capacity of a protein as a product of interest, thereby enabling production of the protein.
[0074] The aforementioned recombinant cell of the present invention is firstly characterized by having enhanced intracellular expression of the full length or a portion of p180 protein, particularly mammalian p180 protein. The p180 protein refers to an essential endoplasmic reticulum membrane protein which is abundantly expressed in secretory tissues and capable of promoting polysome formation.
[0075] In this connection, it is known that as compared to human p180 protein (GenBank Accession No. AB287347), murine p180 protein has 87% similarity in amino acid sequence, rat p180 protein has 87% similarity, Chinese hamster p180 protein has 88% similarity, canine p180 protein has 91% similarity, equine p180 protein has 89% similarity, simian p180 protein has 91-92% similarity, chimpanzee p180 protein has 98% similarity, and porcine p180 protein has 86% similarity. It is reported that the amino acid identities of all mammalian p180 proteins fall within a range not lower than 84%, and that even those of the p180 proteins of other living organisms fall within a range not lower than 76%.
TABLE-US-00001 TABLE 1 Sequence homologies of p180 of various species to human p180 Protein similarity Gene to identity human to (%): human amino (%): Organism Classification acid nucleotide Gene ID Pan paniscus chimpanzee Mammalia 98 98 XM_003810595 Mus musculus mouse Mammalia 87 75 NM_024281 Bos mutus yak Mammalia 38 78 XM_005904566 Bos taurus cow Mammalia 87 74 XM_003582930 Canis familiaris dog Mammalia 91 84 NM_001003179 Monodelphis domestica oppossum Mammalia 83 68 XM_001382073 Pongo abelii orangutan Mammalia 92 85 XM_003779288 Macaca mulatta monkey Mammalia 91 85 XM_001086541 Macaca fascicularis monkey Mammalia 92 85 XM_005568285 Cricetulus griseus Chinese hamster Mammalia 88 78 XM_003496471 Jaculus jaculus rodent Mammalia 86 76 XM_004668728 Otolemur garnettii galago Mammalia 90 79 XM_003801321 Spermophilus gopher Mammalia 88 78 XM_005320449 tridecemlineatus Myotis brandtii bat Mammalia 88 79 XM_005860586 Rattus norvegicus rat Mammalia 87 75 XM_230637 Mustela putorius furo ferret Mammalia 88 78 XM_004754183 Microtus ochrogaster vole Mammalia 87 74 XM_005365517 Octodon degus rodent Mammalia 85 74 XM_004635679 Ochotona princeps pica Mammalia 87 74 XM_004585968 Heterocephalus glaber rat Mammalia 86 75 XM_004909847 Callithrix jacchus marmoset Mammalia 84 69 XM_002806762 Papio anubis baboon Mammalia 91 83 XM_003905099 Gorilla gorilla gorilla gorilla Mammalia 93 88 XM_004061840 Saimiri boliviensis monkey Mammalia 92 84 XM_003933177 boliviensis Odobenus rosmarus walrus Mammalia 87 76 XM_004412293 divergens Orcinus orca whale Mammalia 87 76 XM_004270397 Myotis lucifugus bat Mammalia 88 76 XM_006087977 Equus caballus horse Mammalia 89 82 XM_005604466 Ceratotherium rhinoceros Mammalia 90 81 XM_004433726 simum simum Dasypus novemcinctus armadillo Mammalia 88 77 XM_004472392 Felis catus cat Mammalia 90 81 XM_003983802 Sus scrofa pig Mammalia 86 74 XM_005672713 Trichechus manatus Trichechidae Mammalia 88 77 XM_004376447 latirostris Condylura cristata mole Mammalia 89 78 XM_004687152 Pantholops hodgsonii antelope Mammalia 87 77 XM_005985103 Chinchilla lanigera chinchilla Mammalia 86 73 XM_005380908 Echinops telfairi tenrec Mammalia 88 75 XM_004697814 Ovis aries sheep Mammalia 84 73 XM_004014691 Chrysemys pieta bellii turtle Reptilia 82 63 XM_005287452 Geospiza fortis bird Aves 82 66 XM_005426202 Zonotrichia albicollis bird Aves 82 66 XM_005488513 Pseudopodoces humilis bird Aves 81 64 XM_005523241 Taeniopygia guttata Finch Aves 82 65 XM_002196328 Gallus gallus Junglefowl Aves 82 64 NM_001257346 Ficedula albicollis Flycatcher Aves 81 65 XM_005042941 Alligator sinensis alligator Reptilia 81 62 XM_006030436 Pelodiscus sinensis turtle Reptilia 80 61 XM_006118575 Sarcophilus harrisii Tasmanian Mammalia 81 62 XM_003758168 devil Melopsittacus undulatus budgerigar Aves 81 63 XM_005152037 Latimeria chalumnae coelacanth Sarcopterygii 81 59 XM_005992924 Capra hircus goat Mammalia 80 62 XM_005688109 Xenopus tropicalis frog Amphibia 78 55 BC074706 Xenopus laevis frog Amphibia 78 55 NM_001089623 Mesocricetus auratus hamster Mammalia 80 57 XM_005068495 Danio rerio zebrafish Actinopterygii 76 50 AY398408 Perca flavescens yellow perch Actinopterygii 78 58 HQ206468
[0076] Thus, as referred to in the present invention, the p180 protein refers to:
[0077] (a) a protein that consists of an amino acid sequence with at least 70% sequence identity to the amino acid sequence (SEQ ID NO: 2) of human-derived p180 protein, and which has a capability of promoting polysome formation on an intracellular endoplasmic reticulum membrane;
[0078] (b) a protein that consists of an amino acid sequence derived from the amino acid sequence (SEQ ID NO: 2) of the human-derived p180 protein by deletion, substitution, or addition of one or more amino acids, and which has a capability of promoting polysome formation on the intracellular endoplasmic reticulum membrane;
[0079] (c) a protein that consists of an amino acid sequence specified by a nucleotide sequence with at least 70% sequence identity to the nucleotide sequence (SEQ ID NO: 1) of a gene encoding the human-derived p180 protein, and which has a capability of promoting polysome formation on the intracellular endoplasmic reticulum membrane;
[0080] (d) a protein that consists of an amino acid sequence specified by a nucleotide sequence derived from the nucleotide sequence (SEQ ID NO: 1) of the gene encoding the human-derived p180 protein by deletion, substitution, or addition of one or more nucleotides, and which has a capability of promoting polysome formation on the intracellular endoplasmic reticulum membrane; or
[0081] (e) a protein that consists of an amino acid sequence specified by a nucleotide sequence hybridizable under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence (SEQ ID NO: 1) of the gene encoding the human-derived p180 protein, and which has a capability of promoting polysome formation on the intracellular endoplasmic reticulum membrane.
[0082] With regard to (a) in this mode, by the statement regarding amino acid sequence identity, which reads with at least 70% sequence identity to the amino acid sequence (SEQ ID NO: 2) of human-derived p180 protein, it is meant that any value for percent sequence identity can be selected from 70% to 100%, and examples of the percent sequence identity value that can be selected include 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%.
[0083] With regard to (b) in this mode, by deletion, substitution, or addition of one or more amino acids, it is meant that the number of amino acids to be deleted, substituted or added ranges from 1 to about 10, and examples of the number of amino acids that can be selected include 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.
[0084] With regard to (c) in this mode, by with at least 70% sequence identity to the nucleotide sequence (SEQ ID NO: 1) of a gene encoding the human-derived p180 protein, it is meant that any value for percent sequence identity can be selected from 70% to 100%, and examples of the percent sequence identity value that can be selected include 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%.
[0085] With regard to (d) in this mode, by deletion, substitution, or addition of one or more nucleotides, it is meant that the number of nucleotides to be deleted, substituted or added ranges from 1 to about 10, and examples of the number of nucleotides that can be selected include 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. Additionally, it is presupposed that such deletion, substitution, or addition of one or more nucleotides makes it possible to specify a protein having a desired function, without introduction of a stop codon.
[0086] With regard to (e) in this mode, by under stringent conditions, it is meant that the hybridization conditions can be easily determined by a person having an ordinary skill in the art on the basis of, for example, the nucleotide sequence length of a gene. As typically described in Current Protocols in Molecular Biology, vol. 1 (John Wiley and Sons, Inc.) and Molecular Cloning, 2nd Edition (Sambrook, et al. (1989)), exemplary basic hybridization conditions are hybridization in 5SSC, 5Denhardt's solution, and 1% SDS at 25-68 C. for several hours to overnight. In this case, the hybridization temperature is preferably in the range of 45-68 C. (no formamide) or 30-42 C. (50% formamide). Exemplary washing conditions are washing in 0.2SSC at 45-68 C. It is well known to those skilled in the art that determining hybridization conditions including formamide concentration, salt concentration and temperature as appropriate enables cloning of nucleic acid molecules comprising a nucleotide sequence with a sequence identity above a certain level; and the thus cloned nucleic acid molecules are all included in the scope of the present invention.
[0087] The full length of the human p180 protein is the protein having the amino acid sequence of SEQ ID NO: 2 (GenBank Accession No. AB287347), and this protein is encoded by the nucleotide sequence of SEQ ID NO: 1 (GenBank Accession No. AB287347). Also, the aforementioned murine p180 protein is encoded by the nucleotide sequence of GenBank Accession No. NP_077243, the aforementioned rat p180 protein is encoded by the nucleotide sequence of GenBank Accession No. XP_230637, the aforementioned Chinese hamster p180 protein is encoded by the nucleotide sequence of GenBank Accession No. XM_003496471, the aforementioned canine p180 protein is encoded by the nucleotide sequence of GenBank Accession No. NP_001003179, the aforementioned equine p180 protein is encoded by the nucleotide sequence of GenBank Accession No. XP_001915027, the aforementioned simian p180 protein is encoded by the nucleotide sequence of GenBank Accession No. XP_002798281, the aforementioned chimpanzee p180 protein is encoded by the nucleotide sequence of GenBank Accession No. XP_514527, and the aforementioned porcine p180 protein is encoded by the nucleotide sequence of GenBank Accession No. XP_001926148.
[0088] For example, when the p180 protein used is the human p180 protein, polysome formation on an intracellular endoplasmic reticulum can be promoted by expressing a portion comprising any of the following regions: a region consisting of the amino acids at positions 27 to 157 of a protein having the amino acid sequence of SEQ ID NO: 2 (human p180 protein); a region consisting of the amino acids at positions 623 to 737 of said protein; a region consisting of the amino acids at positions 738 to 944 of said protein; and a region consisting of the amino acids at positions 945 to 1540 of said protein (Patent Literature 1).
[0089] Thus, as referred to in the present invention, the portion of p180 protein refers to, for example: a portion comprising an amino acid sequence corresponding to a region consisting of the amino acids at positions 27 to 157 of a protein having the amino acid sequence of SEQ ID NO: 2 (human p180 protein); a portion comprising an amino acid sequence corresponding to a region consisting of the amino acids at positions 623 to 737 of said protein; a portion comprising an amino acid sequence corresponding to a region consisting of the amino acids at positions 738 to 944 of said protein; or a portion comprising an amino acid sequence corresponding to a region consisting of the amino acids at positions 945 to 1540 of said protein. Proteins comprising such a portion can have a capability of promoting polysome formation. With regard to humans, examples of the thus-specified portion of the p180 protein include not only such portions as mentioned above, per se, including: a portion comprising a region consisting of the amino acids at positions 27 to 157 of a protein having the amino acid sequence of SEQ ID NO: 2 (human p180 protein); a portion comprising a region consisting of the amino acids at positions 623 to 737 of said protein; a portion comprising a region consisting of the amino acids at positions 738 to 944 of said protein; and a portion comprising a region consisting of the amino acids at positions 945 to 1540 of said protein, but also MTB-2 domain adjacent to the C-terminal side of the N-terminal transmembrane domain of the human p180 protein, or a highly basic N-terminal region containing a ribosome-binding repeat domain, a highly basic tandem repeat domain, or a microtubule binding and bundling domain (MTB-1 domain) (Patent Literature 1).
[0090] As mentioned above, also in the cases of using portions of other mammalian p180 proteins, since the amino acid sequence of the human p180 protein and the amino acid sequences of other mammalian p180 proteins are generally highly conserved, the amino acid sequences of fragments comprising portions or regions corresponding to the amino acid sequences of the proteins (a) to (e) mentioned above can also be used as the portion of the p180 protein.
[0091] The aforementioned recombinant cell of the present invention is secondly characterized by having enhanced intracellular expression of a protein promoting mRNA localization to an endoplasmic reticulum (ER). Examples of such a protein promoting mRNA localization to an endoplasmic reticulum (ER) include SF3b4 protein, especially the full length or a portion of a mammalian SF3b4 protein (e.g., the full-length amino acid sequence 424 AA of SEQ ID NO: 4; RRM1 consisting of 13 to 91 AA of SEQ ID NO: 4; RRM2 consisting of 100 to 179 AA of SEQ ID NO: 4; a C-terminal region consisting of 180 to 424 AA of SEQ ID NO: 4).
[0092] In particular, the SF3b4 protein is a protein that is generally detected only in the nucleus. However, further detailed investigation found that in fibroblasts actively secreting collagen, most of the SF3b4 protein is detected in the nucleus but some of said protein is found in the membrane fraction containing cytoplasmic endoplasmic reticulum. The SF3b4 protein (also referred to as SAP49/SF3b49) is a substance that is classified as an RNA recognition motif (RRM)-type RNA-binding protein (RBP) family due to containing two RNA recognition motifs (RRM) on its amino-terminal side, and which has a proline-rich domain with an unknown function on its carboxy-terminal side. The normal splicing reaction process requires both of these two RNA recognition motifs (RRM) (RRM1, RRM2). These motifs are highly conserved even in yeast, and are presumed to constitute an important functional domain. Further, the SF3b4 protein binds to the other constitutional protein of an SF3b complex, i.e., SAP145 protein, and this binding is also shown to require both of the two RNA recognition motifs (RRM) (RRM1, RRM2) (Champion-Arnaud & Reed, 1994). Thus, it is considered that the RRM domain of the SF3b4 protein not only requires RNA recognition but also acts on a protein-protein interaction.
[0093] In this connection, speaking of the comparison between the amino acid sequences of SF3b4 proteins, it is known that the SF3b4 proteins of all the mammalian species investigated show 100% amino acid sequence similarity to the human SF3b4 protein, and that also in the case of other species, the yeast and insect SF3b4 proteins have amino acid sequence similarities of 40 to 54% and 63 to 81%, respectively, to the human SF3b4 proteinthus, the SF3b4 protein is reported to be a very conservative protein in all living organisms.
TABLE-US-00002 TABLE 2 Sequence homologies of SF3b4 of various species to human SF3b4 Protein Gene similarity identity to human to human (%): (%): Organism Classification amino acid nucleotide Gene ID Pan troglodytes chimpanzee Mammalia 100 99 XM_513768 Gorilla gorilla gorilla gorilla Mammalia 100 99 XM_004026557 Papio anubis baboon Mammalia 100 97 XM_003892563 Pan paniscus bonobo Mammalia 100 97 XM_003817322 Callithrix jacchus marmoset Mammalia 100 98 XM_002759857 Mus musculus mouse Mammalia 100 92 NM_153053 Bos mutus yak Mammalia 100 95 XM_005894874 Bos taurus cow Mammalia 100 95 NM_001205584 Tursiops truncatus dolphin Mammalia 100 96 XM_004315506 Macaca mulatta monkey Mammalia 100 99 NM_001261232 Macaca fascicularis monkey Mammalia 100 97 XM_005542035 Canis lupus wolf Mammalia 100 93 XM_540295 Cricetulus griseus Chinese hamster Mammalia 100 91 XM_003498632 Jaculus jaculus rodent Mammalia 100 88 XM_004668225 Otolemur garnettii galago Mammalia 100 95 XM_003800416 Spermophilus tridecemlineatus gopher Mammalia 100 94 XM_005331144 Rattus norvegicus rat Mammalia 100 91 NM_001011951 Mustela putorius furo ferret Mammalia 100 94 XM_004776825 Microtus ochrogaster vole Mammalia 100 91 XM_005356945 Ochotona princeps pica Mammalia 100 91 XM_004588838 Heterocephalus glaber rat Mammalia 100 94 XM_004853946 Saimiri boliviensis boliviensis monkey Mammalia 100 96 XM_003941980 Odobenus rosmarus divergens walrus Mammalia 100 94 XM_004404182 Orcinus orca whale Mammalia 100 95 XM_004285129 Myotis lucifugus bat Mammalia 100 94 XM_006095177 Equus caballus horse Mammalia 100 95 XM_001488599 Capra hircus goat Mammalia 100 95 XM_005677701 Mesocricetus auratus Golden hamster Mammalia 100 92 XM_005084248 Sarcophilus harrisii Tasmanian devil Mammalia 100 86 XM_003769946 Cavia porcellus guinea pig Mammalia 100 93 XM_003478880 Sorex araneus shrew Mammalia 100 92 XM_004618056 Ceratotherium simum simum rhinoceros Mammalia 100 95 XM_004435941 Dasypus novemcinctus armadillo Mammalia 100 91 XM_004461651 Felis catus cat Mammalia 100 95 XM_004001496 Sus scrota pig Mammalia 100 95 XM_001926489 Trichechus manatus latirostris Trichechidae Mammalia 100 94 XM_004389600 Condylura cristata mole Mammalia 100 92 XM_004689571 Pantholops hodgsonii antelope Mammalia 100 95 XM_005970739 Chinchilla lanigera chinchilla Mammalia 100 93 XM_005378708 Echinops telfairi tenrec Mammalia 100 93 XM_004716571 Ovis aries sheep Mammalia 100 95 XM_004002436 Geospiza fortis bird Aves 98 77 XM_005430326 Pseudopodoces humilis bird Aves 98 84 XM_005533471 Gallus gallus Junglefowl Aves 98 81 XM_423721 Falco peregrinus Peregrine Falcon Aves 97 74 XM_005244315 Chrysemys picta bellii turtle Reptilia 97 83 XM_005293645 Alligator sinensis alligator Reptilia 96 79 XM_006033517 Danio rerio zebrafish Actinopterygii 92 79 NM_153661 Pundamilia nyererei lapsus Actinopterygii 91 80 XM_005728504 Maylandia zebra Mbuna Actinopterygii 91 80 XM_004549154 Capsaspora owczarzaki monotypic genus Filasterea 88 77 XM_004345599 Xenopus tropicalis frog Amphibia 88 79 NM_203785 Xenopus laevis frog Amphibia 87 78 NM_001086631 Aplysia californica California sea hare Gastropoda 77 66 XM_005109109 Drosophila melanogaster fruit fly Insecta 81 63 NM_078503.41 Anopheles gambiae mosquito Insecta 75 65 XM_321584.4 Apis mellifera honey bee Insecta 63 57 Group13.4(31702- 33391) Caenorhabditis elegans worm Secernentea 73 65 II(8034428-8035787) Daphnia pulex common water flea Crustacea 79 65 scaffold_1(3898136- 3899124) Trichoplax adhaerens Trichoplax Tricoplacia 76 64 scaffold_6(4430698- 4432902) Nematostella vectensis sea anemone Anthozoa 68 62 scaffold_59(938974- 944852) Strongylocentrotus purpuratus sea urchin Echinoidea 66 62 scaffold_1412 Schistosoma mansoni schistosome parasite Trematoda 65 60 Smp_scaff000217(455 137-459876) Arabidopsis thaliana thale cress eudicotyledons 65 60 NM_127407.3 Phytophthora infestans Chromalveolata Oomycota 62 56 Supercont1.42(913888- 914494) Neurospora crassa bread mold Ascomycetes 52 53 XM_956049.1 Schizosaccharomyces pombe fission yeast Schizosaccharomycetes 54 55 NM_001019427 Saccharomyces cerevisiae baker's yeast Saccharomycetes 41 50 NP_014964 Ashbya gossypii A. gossypii yeast Saccharomycetes 41 50 NM_208241.1 Kluyveromyces lactis K. lactis yeast Saccharomycetes 40 47 XM_452844.1 Chlamydomonas reinhardtii green algae Chlorophyceae 50 46 DS496110 Chlamydomonas reinhardtii green alga Chlorophyceae 50 56 XM_001696328
[0094] Given the aforementioned fact that the primary amino acid sequence of the SF3b4 protein is widely and highly conserved beyond biological species, it is easily presumed that a function verified using the human SF3b4 protein would be reproduced also in the case of using SF3b4 proteins derived from other biological species.
[0095] Thus, as referred to in the present invention, the SF3b4 protein refers to:
[0096] (i) a protein that consists of an amino acid sequence with at least 70% sequence identity to the amino acid sequence (SEQ ID NO: 4) of human-derived SF3b4 protein, and which has a capability of promoting mRNA localization to an endoplasmic reticulum;
[0097] (ii) a protein that consists of an amino acid sequence derived from the amino acid sequence (SEQ ID NO: 4) of the human-derived SF3b4 protein by deletion, substitution, or addition of one or more amino acids, and which has a capability of promoting mRNA localization to the endoplasmic reticulum;
[0098] (iii) a protein that consists of an amino acid sequence specified by a nucleotide sequence with at least 70% sequence identity to the nucleotide sequence (SEQ ID NO: 3) of a gene encoding the human-derived SF3b4 protein, and which has a capability of promoting mRNA localization to the endoplasmic reticulum;
[0099] (iv) a protein that consists of an amino acid sequence specified by a nucleotide sequence derived from the nucleotide sequence (SEQ ID NO: 3) of the gene encoding the human-derived SF3b4 protein by deletion, substitution, or addition of one or more nucleotides, and which has a capability of promoting mRNA localization to the endoplasmic reticulum; or
[0100] (v) a protein that consists of an amino acid sequence specified by a nucleotide sequence hybridizable under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence (SEQ ID NO: 3) of the gene encoding the human-derived SF3b4 protein, and which has a capability of promoting mRNA localization to the endoplasmic reticulum.
[0101] With regard to (i) in this mode, by the statement regarding amino acid sequence identity, which reads with at least 70% sequence identity to the amino acid sequence (SEQ ID NO: 4) of human-derived SF3b4 protein, it is meant that any value for percent sequence identity can be selected from 70% to 100%, and examples of the percent sequence identity value that can be selected include 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%.
[0102] With regard to (ii) in this mode, by deletion, substitution, or addition of one or more amino acids, it is meant that the number of amino acids to be deleted, substituted or added ranges from 1 to about 10, and examples of the number of amino acids that can be selected include 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.
[0103] With regard to (iii) in this mode, by with at least 70% sequence identity to the nucleotide sequence (SEQ ID NO: 3) of a gene encoding the human-derived SF3b4 protein, it is meant that any value for percent sequence identity can be selected from 70% to 100%, and examples of the percent sequence identity value that can be selected include 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%.
[0104] With regard to (iv) in this mode, by deletion, substitution, or addition of one or more nucleotides, it is meant that the number of nucleotides to be deleted, substituted or added ranges from 1 to about 10, and examples of the number of nucleotides that can be selected include 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. Additionally, it is presupposed that such deletion, substitution, or addition of one or more nucleotides makes it possible to specify a protein having a desired function, without introduction of a stop codon.
[0105] With regard to (v) in this mode, by under stringent conditions, it is meant that the hybridization conditions that can be adopted are as described above in relation to the p180 protein.
[0106] The full length of the human SF3b4 protein is the protein having the amino acid sequence of SEQ ID NO: 4 (GenBank Accession No. NP_005841.1), and this protein is encoded by the nucleotide sequence of SEQ ID NO: 3 (GenBank Accession No. NP_005841.1). Also, the aforementioned murine SF3b4 protein is encoded by the nucleotide sequence of GenBank Accession No. NP_694693.1, the aforementioned rat SF3b4 protein is encoded by the nucleotide sequence of GenBank Accession No. NP_001011951.1, the aforementioned Chinese hamster SF3b4 protein is encoded by the nucleotide sequence of GenBank Accession No. XP_003498680.1, the aforementioned canine SF3b4 protein is encoded by the nucleotide sequence of GenBank Accession No. XP_540295.3, the aforementioned equine SF3b4 protein is encoded by the nucleotide sequence of GenBank Accession No. XP_001488649.2, the aforementioned simian SF3b4 protein is encoded by the nucleotide sequence of GenBank Accession No. NP_001097793.1, the aforementioned chimpanzee SF3b4 protein is encoded by the nucleotide sequence of GenBank Accession No. XP_513768.2, and the aforementioned porcine SF3b4 protein is encoded by the nucleotide sequence of GenBank Accession No. XP_001926524.1.
[0107] When a DNA encoding a protein as a product of interest which is required to be expressed in the present invention is transformed into the cell to be used in a protein expression system, the mRNA (precursor) transcribed from the DNA is converted into a mature mRNA through removal of introns with no genetic information on amino acids by splicing. This process is assumed by a spliceosome, a small nuclear RNA (snRNA)-protein macrocomplex. The spliceosome has five types of low-molecular-weight ribonucleoprotein complexes (snRNPs), and among these snRNPs, the SF3b4 protein is a constituent of U2-snRNP, which contains an RNA-binding domain.
[0108] There had hitherto been no report that splicing factors including SF3b4 protein perform some function at the protein translation level. However, the analysis made by the present inventors found that levels of SF3b4 protein in the membrane fraction containing endoplasmic reticulum significantly increases, which occurs concomitantly with the SF3b4 protein association with mRNA and binding to the coiled-coil domain of p180 protein, thereby promoting mRNA localization to the endoplasmic reticulum, and consequently the secretory capacity in the cultured cells can be enhanced.
[0109] In other words, it was found that, when a nucleic acid molecule encoding a protein as a product of interest is transformed in the recombinant cell having enhanced expression of either or both of these two types of proteins, the mRNA transcribed from the DNA encoding the protein as a product of interest acts with the SF3b4 protein expressed intracellularly or interacts with the p180 protein expressed intracellularly, or the mRNA transcribed from the DNA encoding the protein as a product of interest interacts with the SF3b4 protein and then the coiled-coil domain of the p180 protein interacts with the SF3b4 protein, whereupon mRNA localization to an endoplasmic reticulum is promoted thereby enhancing the cell's synthetic or secretory capacity of the protein as a product of interest.
[0110] All types of fibrosis which can cause long-term injury to various tissues to fibrose them are unknown as to their cause, detailed mechanism of development, and effective therapy, and are poor in prognosis. For example, in the case of idiopathic pulmonary fibrosis, the fibrosis is believed to progress because of an increase in the production of collagen and the like to repair alveolar epithelium injury resulting from various stimuli, which leads to an abnormal repair reaction, but no effective therapy has been established. There had not been a clue to the prevention of abnormal increase in collagen production under such pathological conditions, but it was newly found in the present invention that the SF3b4 protein, which was hitherto believed to function as a splicing factor, plays an essential role in collagen synthesis/secretion, which indicated that collagen synthesis can be suppressed by functional inhibition or expression suppression of SF3b4. Since it is believed that the expression suppression of SF3b4 can be achieved by administration of its specific shRNA or the like and that the functional inhibition of SF3b4 can be induced by various agents inhibiting a splicing process, a possibility was suggested that the functional inhibition or expression suppression of SF3b4 may suppress an abnormal accumulation of collagen in fibrosis and prevent aggravation of fibrosis.
[0111] The cell that can be used to prepare a recombinant cell in the present invention can be of any type as long as it is suitable for protein expression, and examples of the source cell that can be used include mammal-derived cells such as CHO cell, HEK293 cell and HeLa cell. By transfecting the aforementioned full length or portion p180 protein and/or the aforementioned full length or portion of SF3b4 protein into these cells using a method commonly used in the art, the full length or portion of p180 protein and/or the full length or portion SF3b4 protein can be expressed in said cells.
[0112] In order to express the aforementioned full length or portion of p180 protein and/or the full length or portion of SF3b4 protein in these cells, a transformation method commonly used in the art can be used. For the purpose of the transformation, the following method can be used: a DNA encoding the full length or portion of p180 protein and/or a DNA encoding the full length or portion of SF3b4 protein are/is incorporated into an expression vector such as pcDNA, pEGFP or pCAGGS, and each expression vector is transformed into the cells.
[0113] In the present invention, the CHO cell-derived cell line CHO 5 g was prepared as a recombinant cell stably expressing p180 protein, the CHO cell-derived cell line CHO 3D5 was prepared as a recombinant cell stably expressing SF3b4 protein; and the CHO cell-derived cell line CHO YA7 was prepared as a recombinant cell having enhanced expression of these two proteins at the same time (refer to Example 1 described below), and these cell lines were deposited to the Patent Microorganisms Depositary of the National Institute of Technology and Evaluation (the accession number for the CHO 3D5 is NITE BP-01753; the accession number for the CHO YA7 cell is NITE BP-1535; or the accession number for the CHO 1B2 cell is NITE ABP-01811).
[0114] The present inventors also demonstrated that there can be provided a method in which, in a recombinant cell having enhanced expression of the full length or a portion of p180 protein and/or the full length or a portion of SF3b4 protein, a nucleic acid molecule encoding the protein as a product of interest is transformed or production of the protein as a product of interest is increased, whereby a synthetic or secretory capacity of a protein as a product of interest is enhanced and consequently the protein as a product of interest is produced.
[0115] In this method, the protein as a product of interest which is produced as a result of enhancing a synthetic or secretory capacity can be any protein intended to be produced by a biotechnological technique. For example, the protein as a product of interest can be exemplified by glycoproteins, and examples of the glycoproteins that can be selected include, but are not limited to, antibodies, collagens, fibronectins, and laminins.
[0116] The present inventors provide, in the second mode of the present invention, a method for increasing an amount of a protein as a product of interest to be expressed in a cell as an expression system, wherein, in an expression unit for expressing the protein as a product of interest, a cic-element is inserted, downstream of a promoter and upstream of the start codon in the nucleotide sequence of a DNA encoding the protein as a product of interest, whereby the amount of the protein as a product of interest to be expressed in the cell as an expression system is increased. The aforementioned insertion of the sequence of a cis-element into an expression unit can be exemplified not only by inserting the sequence of a cis-element downstream of a promoter and upstream of the start codon in the nucleotide sequence of a DNA encoding the protein as a product of interest, in an expression plasmid for the protein as a product of interest, but also by inserting the sequence of a cis-element downstream of a promoter and upstream of the ORF start codon of the gene of interest, in a site-specific manner in a case where the promoter and the product of interest have already been genetically introduced into the cell.
[0117] As described in the Background Art section, it has been shown that the mRNAs for some proteins, including collagen genes, have a tendency to form a polysome in which multiple ribosomes, machines for protein synthesis, are attached to each other (Patent Literature 1, Non-patent Literature 2). However, there have often been problems where only a small amount of a protein as a product of interest was synthesized or secreted in spite of the fact that a gene transcript encoding the protein as a product of interest was expressed at a high level in cells transfected with a DNA encoding the protein as a product of interest. This was presumed to be possibly because mRNA was not provided in an adequate manner to be used to machines for translation on the endoplasmic reticulum membranes in used cells.
[0118] The analysis made based on these considerations found that a cic-element present in the 5 untranslated region of a collagen gene has a capability of increasing an expressed protein amount. More specifically, it was considered that an RRM protein recognizing the cis-element sequence in the 5 untranslated region of a mature mRNA binds to said sequence, thereby leading to an augmentation of mRNA transport/localization onto the endoplasmic reticulum membrane, a place of synthesis of secretory proteins, and to a further increase in translation efficiency.
[0119] The cis-element observed in the present invention was proved from the results of the analysis of a type I collagen gene, and the nucleotide sequence of this cis-element was found to be present in the 5 untranslated region of a type I collagen gene. Therefore, in the present invention, the nucleotide sequence of such a cis-element can be exemplified by a sequence derived from the nucleotide sequence of the 5 untranslated region of a type I collagen gene, but cis-element sequences derived from other genes, such as those listed below, can also be used as long as they have a desired effect: a sequence derived from the nucleotide sequence of the 5 untranslated region of a fibronectin gene; a sequence derived from the nucleotide sequence of the 5 untranslated region of the matrix metalloproteinase 14 (MMP14) gene; a sequence derived from the nucleotide sequence of the 5 untranslated region of the prolyl 4-hydroxylase A2 (P4HA2) gene; and a sequence derived from the nucleotide sequence of the 5 untranslated region of the prolyl 4-hydroxylase A1 (P4HA1) gene.
[0120] The cis-element that can be used in the present invention is structurally characterized by containing one or more 9- to 12-nucleotide motifs GAN.sub.1-(X).sub.n-ACN.sub.2 (n=3 to 6) (N.sub.1 and N.sub.2 can be independently any of the nucleotides A, T, C and G) in the 5 untranslated region of a gene present in an expression plasmid for expressing a protein as a product of interest. Specific examples of the motifs include motifs present as native cis-elements, which are characterized in that N.sub.1 is G and that N.sub.2 is A or G or C. More specifically, such motifs can be expressed as GAG xxx ACV (SEQ ID NO: 17), GAG xxxx ACV (SEQ ID NO: 18), GAG xxxxx ACV (SEQ ID NO: 19), and GAG xxxxxx ACV (SEQ ID NO: 20) (in these sequences, V represents A or G or C). For example, it was found that in the case of a type I collagen gene, four motifs are included in the 5 untranslated region.
[0121] In the case of using a cis-element derived from a type I collagen gene, the nucleotide sequence of the cis-element that can be used is any sequence selected from the group consisting of the full length of SEQ ID NO: 5 or the full length of SEQ ID NO: 7, and the nucleotides at positions 1 to 102, positions 1 to 78, positions 1 to 60, positions 61 to 126, positions 16 to 57, positions 79 to 126, positions 103 to 126, positions 58 to 78, positions 51 to 78, positions 1 to 27, and positions 70 to 78 of SEQ ID NO: 5.
[0122] Also, in the case of using a cis-element derived from a fibronectin gene, the nucleotide sequence of the cis-element that can be used is any sequence selected from the group consisting of the full length of SEQ ID NO: 6 and the full length of SEQ ID NO: 8.
TABLE-US-00003 TABLE3 Table3:Listofthesequencesofcis-elements Cis- SEQ ele- ID ment Sequence NO #1 tcgtcggagcagacgggagtttctcctcggggtcggagca 5 ggaggcacgcggagtgtgaggccacgcatgagcggacgct aaccccctccccagccacaaagagtctacatgtctagggt ctagac #2 gcccgcgccggctgtgctgcacagggggaggagagggaac 6 cccaggcgcgagcgggaagaggggacctgcagccacaact tctctggtcctctgcatcccttctgtccctccacccgtcc ccttccccaccctctggcccccaccttcttggaggcgaca acccccgggaggcattagaagggatttttcccgcaggttg cgaagggaagcaaacttggtggcaacttgcctcccggtgc gggcgtctctcccccaccgtctcaac #3 tcgtcggagcagacgggagtttctcct 7 #4 ccaccttcttggaggcgacaacccccgggagg 8 #5 tcgtcggagcagacgggagtttctcctcggggtcggagca 21 ggaggcacgcggagtgtgag #6 gccacgcatgagcggacgctaaccccctccccagccacaa 22 agagtctacatgtctagggtctagac #7 aacgggcgccgcggcggggagaagacgcagagcgctgctg 23 ggctgccgggtctcccgcttccccctcctgctccaagggc ctcctgcatgagggcgcggtagagacccggacccgcgccg tgctcctgccgtttcgctgcgctccgcccgggcccggctc agccaggccccgcggtgagcc #8 cagggggaggagagggaaccccaggcgcga 24 #9 gagcgggaagaggggacctgcagccacaactt 25 #10 cagggggaggagagggaaccccaggcgcgagcgggaagag 26 gggacctgcagccacaactt #11 tcgtcggagcagacgggagtttctcctcggggtcggagca 27 ggaggcacgcggagtgtgaggccacgcatgagcggacgct aaccccctccccagccacaaagagtctacatgt
[0123] Expression plasmids containing such a cis-element can be used not only in intact host cells, but also in the cells prepared in the present invention: i.e., a cell having enhanced expression of the full length or a portion of p180 protein, a cell having enhanced expression of the full length or a portion of splicing factor 3B subunit 4 (SF3b4) protein, or a cell having enhanced expression of both of these proteins.
[0124] Examples are provided herein below for the purpose of more specifically describing the present invention described above, but the examples provided below are not intended to limit this invention.
EXAMPLES
Example 1: Establishment of a Cell Line Expressing SF3b4 Protein, or Coexpressing p180 Protein and SF3b4 Protein
[0125] Preparation of Plasmids
[0126] Establishment of a cell line expressing SF3b4 protein, or coexpressing p180 protein and SF3b4 protein was achieved by separately preparing an expression plasmid containing a nucleic acid encoding p180 protein and an expression plasmid containing a nucleic acid encoding SF3b4 protein, and sequentially transfecting these plasmids into CHO cells.
[0127] The expression plasmid encoding the full length of human p180 protein (GenBank Accession No. AB287347), pcDNA-p180/54R, was prepared according to the procedure described in Patent Literature 1 (JP 2005-312409).
[0128] The expression plasmid encoding the full length of human SF3b4 protein, pEF-SF3b4, was prepared according to the procedure described below. More specifically, the cDNA sequence encoding the full length of human SF3b4 protein (GenBank Accession No. NP_005841.1) was amplified by PCR, and then inserted and ligated into the KpnI-EcoRV site of pEF1/Myc-His vector (produced by Life Technologies) to thereby obtain the plasmid pEF-SF3b4.
[0129] The expression plasmid encoding the full length of Chinese hamster SF3b4 protein, pEF-CHO-SF3b4, was prepared according to the procedure described below. More specifically, total RNA was extracted from CHO cells, and the cDNA sequence encoding the full length of Chinese hamster SF3b4 protein (GenBank Accession No. XP_003498680.1) was amplified by PCR. Then, the cDNA sequence was inserted and ligated into the KpnI-EcoRV site of pEF1/Myc-His vector to thereby obtain the plasmid pEF-CHO-SF3b4.
[0130] The expression plasmid encoding the sequence of a human cis-element (e.g., cis-elements #1 to #11), pEF-Cis, was prepared according to the procedure described below. More specifically, a nucleic acid sequence encoding a human cis-element (e.g., SEQ ID NO: 5 in the case of cis-element #1) was amplified by PCR, and then inserted and ligated into the BglII-HindIII site of pEGFP vector (produced by Clontech) to thereby obtain the plasmid prCMV-cis#-SEAP. The details of expression vectors each containing a different cis-element will be described in Example 9.
[0131] Preparation of Cells Stably Expressing p180 Protein
[0132] Establishment of CHO cells stably expressing human p180 protein was achieved according to the procedure described in Patent Literature 1. More specifically, the human p180 protein-expressing plasmid pcDNA-p180/54R was transfected into CHO cells by a lipofection method, and then the transfected cells were cultured in the presence of 400 g/mL of zeocin, whereby drug selection was done. After the culture for 10 days, zeocin-resistant cell line colonies were isolated to establish the cell line CHO 5 g which stably expresses p180 protein.
[0133] Preparation of Cells Stably Expressing SF3b4 Protein
[0134] To prepare CHO cells stably expressing human SF3b4 protein, the human SF3b4 protein-expressing plasmid pEF-SF3b4 was transfected into CHO cells by a lipofection method, and then the transfected cells were cultured in the presence of 400 g/mL of G418, whereby drug selection was done. After the culture for 10 days, G418-resistant cell line colonies were isolated to establish the cell line CHO 3D5 which stably expresses SF3b4 protein (deposited to the Patent Microorganisms Depositary of the National Institute of Technology and Evaluation (NPMD), 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Japan; Accession Number: NITE BP-01753; Deposit date: Nov. 21, 2013).
[0135] Preparation of Cells Stably Coexpressing p180 Protein and SF3b4 Protein
[0136] Next, to establish CHO cells stably coexpressing human p180 protein and human SF3b4 protein, the SF3b4 protein-expressing plasmid pEF-SF3b4 was transfected into the cell line CHO 5 g by a lipofection method. Then, the transfected cells were cultured in the presence of 400 g/mL of G418 and 100 g/mL of zeocin, whereby drug selection was done. After the culture for 14 days, G418- and zeocin-resistant cell line colonies were isolated to establish the cell line CHO YA7 which stably coexpresses human p180 protein and human SF3b4 protein (deposited to the Patent Microorganisms Depositary of the National Institute of Technology and Evaluation (NPMD), 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Japan; Accession Number: NITE BP-1535; Deposit date: Feb. 13, 2013).
[0137] Thereafter, to establish CHO cells stably coexpressing human p180 protein and Chinese hamster SF3b4 protein, a plasmid expressing human p180 and Chinese hamster SF3b4 was transfected into CHO cells by a lipofection method. Then, the transfected cells were cultured in the presence of 300 g/mL of hygromycin, whereby drug selection was done. After the culture for 14 days, hygromycin-resistant cell line colonies were isolated to establish the cell line CHO 1B2 which stably expresses human p180 protein and Chinese hamster SF3b4 protein (deposited to the Patent Microorganisms Depositary of the National Institute of Technology and Evaluation (NPMD), 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba, Japan; Accession Number: NITE ABP-01811; Deposit date: Mar. 4, 2014).
[0138] Verification of Cell Properties
[0139] To verify that CHO 5 g cells stably expressed p180 protein, that CHO 3D5 cells stably expressed SF3b4 protein, and that CHO YA7 cells and CHO 1B2 cells coexpressed p180 protein and SF3b4 protein, CHO 5 g cells, CHO 3D5 cells, CHO YA7 cells, and CHO 1B2 cells were each cultured in a Dulbecco's modified Eagle's medium (DMEM) supplemented with 5% fetal bovine serum at 37 C. in the presence of 5% CO.sub.2. CHO cells were also cultured as control cells.
[0140] After 40 hours, 110.sup.5 of each type of the cells suspended by trypsin treatment were harvested by centrifugation as samples for analysis, and then analyzed by Western blotting for intracellularly expressed p180 protein using an anti-p180 antibody (refer to Ogawa-Goto, K. et. al., J. Virol., 76 (2002) 2350-2362), and for intracellularly expressed SF3b4 protein using an anti-SF3b4 antibody (produced by Santacruz).
[0141] According to
Example 2: Activation of Secretion by p180 Protein Expression and/or SF3b4 Protein Expression
[0142] Using the cell lines prepared in Example 1, i.e., the CHO 5 g cells expressing p180 protein, the CHO 3D5 cells expressing SF3b4 protein, and the cell line CHO YA7 coexpressing p180 protein and SF3b4 protein, investigation was made of p180 protein expression and/or SF3b4 protein expression, and activation of protein secretion.
[0143] An expression plasmid for human placental secreted alkaline phosphatase (SEAP) as a secretory marker was constructed according to the procedure described below. More specifically, a cDNA fragment encoding the full length of SEAP protein (GenBank Accession No. NP_001623.3) was inserted and ligated into the NheI-XhoI site of an expression vector for mammalian cells (pEGFP-C3; produced by Clontech) to thereby obtain the SEAP protein expression plasmid prCMV-SEAP.
[0144] To evaluate the respective types of cells for the secretory capacity of SEAP protein, the SEAP expression plasmid and a -galactosidase-expressing plasmid for internal normalization, pEF1-LacZ (produced by Life Technologies), were cotransfected into each of the CHO 3D5 cells, the CHO 5 g cells, the CHO YA7 cells, and the CHO cells using the Lipofectamine LTX reagent (produced by Life Technologies). The transfected cells were cultured in a DMEM supplemented with 0.1% fetal bovine serum for 20 hours, and then the culture supernatant was mixed with a substrate solution containing p-Nitrophenyl phosphate (pNPP; produced by Sigma). After the reaction at room temperature for 30 minutes, the mixture was measured for absorbance at a wavelength of 405 nm using an absorbance spectrophotometer. The -galactosidase activity in cell fractions was measured according to the standard protocol for the -Galactosidase Enzyme Assay System (produced by Promega).
[0145] The SEAP activities normalized by the measured -galactosidase values are shown in
[0146] Also, as compared to the SEAP activity of the CHO cells, which was taken as 1, the SEAP activity ratio of the CHO 1B2 cells was 3.1, which indicates that the CHO 1B2 cells showed a remarkable increase in SEAP activity. This fact demonstrated that Chinese hamster SF3b4 highly similar to human SF3b4 has comparable secretion enhancement activity to human SF3b4.
Example 3: Promotion of mRNA Localization to a Membrane Fraction by Coexpression of p180 Protein and SF3b4 Protein
[0147] Using the cell lines prepared in Example 1, i.e., the cell line CHO 5 g expressing p180 protein, the cell line CHO 3D5 expressing SF3b4 protein, and the cell line CHO YA7 coexpressing p180 protein and SF3b4 protein, investigation was made of the relationship of p180 protein expression and/or SF3b4 protein expression with promotion of mRNA localization to a membrane fraction.
[0148] The aforementioned SEAP expression plasmid was transfected into each of the CHO YA7 cells and the control cells using the Lipofectamine LTX reagent, and after 40 hours, the transfected cells were fractionated into a cytoplasmic fraction and a membrane fraction. The fractionation was performed according to the procedure described in Non-patent Literature 1 (Ueno, et al., (2010) J Biol Chem 285, 29941-29950). RNA was extracted from each of these fractions according to the standard protocol for the Trizol-LS reagent (produced by Life Technologies). Then, quantitative PCR was performed with SEAP-specific primers to quantitate SEAP mRNA (
[0149] The results showed that the total mRNA content in both of the cytoplasmic and membrane fractions was almost the same among the CHO 3D5 cells, the CHO 5 g cells, the CI-TO YA7 cells, and the CI-TO cells. However, about 30% of the total mRNA was present in the membrane fraction in the cases of the CHO cells, the CHO 3D5 cells, and the CHO 5 g cells, whereas in the case of the CHO YA7 cells, about 70% of the total mRNA was localized in the membrane fractionmRNA localization was greatly shifted from the cytoplasm to the membrane fraction.
[0150] These facts demonstrated that the CHO YA7 cells coexpressing p180 protein and SF3b4 protein have a capability of actively localizing mRNA to a membrane fraction during biosynthesis of secretory proteins.
Example 4: Construction of an Expression Vector in which a Cis-Element is Inserted into a Secreted Alkaline Phosphatase Expression Unit
[0151] In this example, using the cell lines prepared in Example 1, i.e., the cell line CHO 3D5 expressing SF3b4 protein, and the cell line CHO YA7 coexpressing p180 protein and SF3b4 protein, investigation was made of the structure of an expression plasmid for the purpose of further increasing protein expression efficiency.
[0152] An expression vector in which a cis-element was inserted into the SEAP expression plasmid prCMV-SEAP mentioned in Example 2 was constructed according to the procedure described below. RNA derived from human fibroblasts was prepared according to the procedure described in Non-patent Literature 1 (Ueno, et al., (2010) J Biol Chem 285, 29941-29950), and RT-PCR was performed using the prepared RNA as a template. In the process of amplification, cis-element #1 (SEQ ID NO: 5) derived from human type I collagen 1 was amplified using the primers (SEQ ID NO: 15, SEQ ID NO: 16) in which the BglII and HindIII recognition sequences were added towards the 5 and 3 ends, respectively. The amplified fragment was treated with BglII-HindIII, and then inserted and ligated into the BglII-HindIII site located between the CMV promoter and SEAP ORF in prCMV-SEAP. Thus, there was obtained the expression plasmid prCMV-cis#1-SEAP in which cis-element #1 was inserted between the CMV promoter and the SEAP start methionine codon (
Example 5: Activation of Protein Secretion by Cis-Element
[0153] Using the cis-element-containing expression plasmid prepared in Example 4, investigation was made of the influence on secretion of expression protein. The two expression plasmids provided in Example 4, i.e. prCMV-cis#1-SEAP and prCMV-SEAP, were transfected using the Lipofectamine LTX reagent (produced by Life Technologies). The cells used in the transfection were the four cell lines prepared in Example 1. The transfected cells were cultured in a DMEM supplemented with 0.1% FBS for 20 hours, and then the culture supernatant was mixed with a substrate solution containing the fluorescent substrate 4-Methylumbelliferyl phosphate (4-MUP; produced by Sigma). After the reaction at room temperature for 30 minutes, the mixture was measured for fluorescence intensity (excitation at 360 nm, emission at 440 nm) using a fluorophotometer. Also, in order to correct transfection efficiency by total SEAP cDNA content, total mRNA was extracted from cell fractions using a Trizol reagent (produced by Life Technologies), and quantitative PCR was performed with SEAP-specific primers to quantitate SEAP cDNA. The SEAP activity ratio of prCMV-cis#1-SEAP to prCMV-SEAP, which was corrected by total SEAP cDNA content, is shown in
[0154] According to the results of this investigation, in the case of using the CHO cells, SEAP activity was increased by 2.7 times by insertion of cis-element #1. Also in all the cases of using the CHO 3D5 cells, the CHO 5 g cells, and the CHO YA7 cells, SEAP activity was increased by 3.0 to 3.2 times by insertion of cis-element #1. These results showed that in the different types of CHO cells, the amount of protein synthesized and secreted per transcript can be increased by inserting cis-element #1 into an expression unit.
[0155] Thereafter, in order to compare the SEAP activity ratios of the aforementioned different types of cells after insertion of cis-element #1 with the SEAP activity of the CHO cells without insertion of cis-element #1, the SEAP activities of these types of cells upon introduction of prCMV-cis#1-SEAP were determined, with the SEAP activity of the CHO cells upon introduction of prCMV-SEAP being taken as 1 (
[0156] Hence, it was demonstrated that the activity for secreting a protein expressed from an expression plasmid can be increased by the coexistence of cis-element #1 and SF3b4 protein or the coexistence of cis-element #1 and p180 protein, and that the protein secretory activity of cells can be more remarkably enhanced by the coexistence of the three factors cis-element #1, SF3b4 protein and p180 protein.
Example 6: Activation of Collagen Secretion by Cis-Element #1
[0157] In this example, using a cis-element-containing expression plasmid, investigation was made of the influence on collagen expression.
[0158] An expression plasmid for human type I collagen 1 (COL1A1) was constructed according to the procedure described below. More specifically, a cDNA fragment encoding the full length of COL1A1 (GenBank Accession No. NM_000088.3) was inserted and ligated into the NheI-XhoI site of an expression vector for mammalian cells (pEGFP-C3; produced by Clontech) to thereby obtain the cis-element #1-containing and COL1A1 (1 to 5297 nt)-expressing plasmid prCMV-COL1A1 under the control of a CMV promoter. Also, gene fragments each consisting of 127 to 4251 nt or 127 to 5297 nt, which encode the full length of COL1A1 ORF alone instead of the full length of the COL1A1 gene, were amplified in the same way to construct prCMV-COL1A1-ORF and prCMV-COL1A1-ORF-UTR. Further, expression plasmids for human type II collagen 1 (COL2A1) and human type III collagen 1 (COL3A1) were constructed according to the procedure described below. More specifically, a cDNA fragment encoding the full length of COL2A1 (GenBank Accession No. NP_001835.3) or COL3A1 (GenBank Accession No. NP_000081.1) was inserted and ligated into the EcoRV-NotI site of pcDNA-cis#1 in which cis-element #1 was inserted into an expression vector for mammalian cells (pcDNA; produced by Invitrogen), whereby the COL2A1 (1 to 4464 nt)-expressing plasmid pcDNA-cis#1-COL2A1 or the COL3A1 (1 to 4401 nt)-expressing plasmid peDNA-cis#1-COL3A1 was obtained under the control of a CMV promoter.
[0159] Next, in order to investigate the ability of cis-element #1 to activate procollagen secretion, prCMV-COL1A1 was transfected by a lipofection method into the three cell lines prepared in Example 1. After the transfected cells were cultured for 40 hours in a DMEM supplemented with 0.1% fetal bovine serum and 200 M ascorbic acid, COL1A1 procollagen content in culture supernatant was analyzed by Western blotting (
[0160] According to the results of this analysis, as compared to the procollagen content in the control CHO cells, which was taken as 1, the procollagen content in the CHO YA7 cells increased by about 20 times. Also, for the purpose of evaluation of cis-element #1, the cis-element #1-free plasmid prCMV-COL1A1-ORF or prCMV-COL1A1-ORF-UTR was genetically introduced into the control CHO cells in the same way. In these cases, the procollagen contents in culture supernatant were below the limit of detection by Western blotting.
[0161] Further, in order to investigate the secreted amount of homotrimer-forming collagen, pcDNA-cis#1-COL2A1, pcDNA-cis#1-COL3A1, or prCMV-COL1A1 or prCMV-COL1A1-ORF, which were prepared in this example, was transfected by a lipofection method into each of the three cell lines prepared in Example 1. After the transfected cells were cultured for 72 hours in a DMEM supplemented with 2% fetal bovine serum and 200 M ascorbic acid, the culture supernatant was harvested, HCl was added to 0.1 N to make the pH acidic, pepsin (produced by Sigma) was added to 0.5 mg/mL, and digestion reaction was carried out at 4 C. for 16 hours. NaCl was added to the reaction mixture to give a concentration of 1 M, and the mixture was left on ice for 3 hours and then centrifuged. The resulting precipitate was washed with 1 M NaCl and 95% ethanol. The thus-obtained purified collagen samples were subjected to electrophoresis by SDS-PAGE to compare the band intensities of the collagens. According to the results of this comparison, the amounts of the homotrimers COL1A1, COL2A1 and COL3A1 secreted in the CHO YA7 cells significantly increased by 1.8, 1.9 and 3.7 times, respectively, as compared to those in the control CHO cells, which are taken as 1 (
[0162] Hence, it was demonstrated that cis-element #1 is capable of enhancing the expression of collagen molecules in the different types of CHO cells, and that the secreted amount of collagen with maintained triple-helical structure is further increased by using cis-element #1 in the presence of SF3b4 protein and/or p180 protein.
Example 7: Enhancement Effect of Cis-Element on Expression of Antibody Molecules
[0163] The influence of cis-element on antibody expression was investigated according to the procedure described below.
[0164] An expression plasmid for full-length antibody heavy and light chains was constructed according to the procedure described below. More specifically, full-length antibody heavy chain (I-IC) and light chain (LC) sequences encoded by the anti-IL-8 antibody-expressing plasmid (p6G425V11N35A.choSD, ATCC 209552) were synthesized by the gene synthesis service (provided by MBL). Then, the full-length heavy chain ORF and light chain ORF were inserted and ligated into the NheI-SpeI site and the KpnI-EcoRV site of the pEF1/Myc-His vector, respectively. Thereafter, the light chain expression cassette was cleaved with ClaI, and inserted and ligated into the ClaI site of the heavy chain expression vector, whereby the anti-IL-8 antibody (HC, LC) coexpression plasmid pEF-HC-LC was constructed. Further, cis#1 was inserted upstream of the heavy chain and light chain ORFs in this plasmid to construct the expression plasmid pEF-cis#1-HC-LC.
[0165] Each of pEF-HC-LC and pEF-cis#1-HC-LC was transfected by a lipofection method into each of the three cell lines prepared in Example 1. After the transfected cells were cultured in a DMEM supplemented with 0.1% fetal bovine serum for 96 hours, antibody production in culture supernatant was quantified by ELISA using the Human IgG ELISA Quantitation Set (produced by Bethyl). According to the results of this investigation, the secreted antibody amount in the CHO cells was increased by 2.7 times by insertion of cis-element #1. Likewise, the secreted antibody amounts in the CHO 3D5 cells and the CHO YA7 cells were also increased by 2.5 and 1.8 times, respectively, by insertion of cis-element #1 (
[0166] As shown in
[0167] Hence, it was demonstrated that cis-element #1 acts positively on antibody production, and that the activity of this element becomes more significant in the presence of SF3b4 protein or p180 protein, or both of these proteins.
Example 8: Comparison Between Kozak Sequence and Cis-Element #1 in Terms of Secretion Activation Effect
[0168] This example was intended to compare the secretion activation effect of a cis-element with that of the kozak sequence which is known as a consensus sequence involved in the initiation of translation in the mRNA of eukaryocytes.
[0169] The expression plasmids prCMV-SEAP-kozak and prCMV-cis#1-SEAP-kozak, in which the 6-bp sequence TCCTGC immediately preceding the start methionine codon ATG of each of prCMV-SEAP and prCMV-cis#1-SEAP prepared in Example 4 was substituted by the sequence GCCACC, were constructed according to the procedure described below. More specifically, PCR was first performed with SEAP-specific primers to amplify a SEAP fragment (1 to 132 nt) in which the sequence GCCACC was added immediately preceding ATG. Then, a SEAP (1 to 132 nt) region was excised from prCMV-SEAP and prCMV-cis#1-SEAP with HindIII-PstI and replaced with the amplified fragment treated with HindIII-PstI, whereby there were obtained the SEAP expression plasmids prCMV-SEAP-kozak and prCMV-cis#1-SEAP-kozak in which the kozak sequence was inserted upstream of SEAP ORF.
[0170] The plasmids prCMV-SEAP, prCMV-SEAP-kozak, prCMV-cis#1-SEAP, and prCMV-cis#1-SEAP-kozak were each transfected into each of the CHO cells, the CHO 3D5 cells and the CHO YA7 cells, and after the culture for 20 hours, SEAP activity in culture supernatant was measured according to the procedure described in Example 5. The results confirmed that as compared to the case of prCMV-SEAP, the SEAP activity of the CHO cells was enhanced by at least twice with prCMV-cis#1-SEAP and prCMV-cis#1-SEAP-kozak (
[0171] This tendency of enhancement was also strongly observed in the CHO 3D5 cells and the CHO YA7 cells. The SLAP activity ratio increased by 3.3 to 3.4 times in the presence of cis-element #1, and by 3.3 to 4.9 times in the presence of both the kozak sequence and cis-element #1 (
[0172] Hence, it was demonstrated that cis-element #1 has a stronger secretion activation effect on CHO cells, CHO 3D5 cells, and CHO YA7 cells than the kozak sequence, and that the secretory activity of these types of cells can be further enhanced by using the three factors cis-element #1, SF3b4 protein, and p180 protein in combination with the kozak sequence.
Example 9: Protein Expression Enhancement Effect of Addition of Cis-Element
[0173] Expression plasmids containing various types of cis-element were each used in each of the cell lines prepared in Example 1 to investigate the details of cis-element sequences with a protein expression enhancement effect.
[0174] The expression vector prCMV-cis#2-SEAP, in which the cis-element sequence of human-derived fibronectin gene, cis-element #2 (SEQ ID NO: 6), was inserted into prCMV-SEAP, was constructed according to the procedure described below. More specifically, RNA derived from human fibroblasts was prepared according to the procedure described in Non-patent Literature 1 (Ueno, et al., (2010) J Biol Chem 285, 29941-29950), and RT-PCR was performed using the prepared RNA as a template. In the process of amplification, a fragment comprising cis-element #2 was amplified using the primers (SEQ ID NO: 13, SEQ ID NO: 14) in which the BglII and HindIII recognition sequences were added to sites towards the 5 and 3 ends, respectively. The amplified fragment was treated with BglII-HindIII, and then inserted and ligated into the BglII-HindIII site located between the CMV promoter and SEAP ORF in prCMV-SEAP. Thus, there was obtained an expression plasmid in which cis-element #2 was inserted between the CMV promoter and the SEAP start methionine codon.
[0175] The expression vectors prCMV-cis#3-SEAP and the like, in which the cis-element sequence of human-derived type I collagen al gene, cis-element #3, or the cis-element sequence of human-derived fibronectin gene, cis-element #4, was inserted into prCMV-SEAP, were constructed according to the procedure described below. More specifically, cis-element-containing primers designed for cis-element #3 (SEQ ID NO: 9, SEQ ID NO: 10) or cis-element-containing primers designed for cis-element #4 (SEQ ID NO: 11, SEQ ID NO: 12) were subjected to heat treatment at 95 C. for 10 minutes and then the temperature was lowered in stages to 25 C. to anneal the two primers, whereby each type of linker was prepared. These types of linker were each inserted and ligated into the BglII-HindIII site located between the CMV promoter and SEAP ORF in prCMV-SEAP. Thus, there were obtained expression plasmids in which cis-element #3 (SEQ ID NO: 7) or cis-element #4 (SEQ ID NO: 8) was inserted between the CMV promoter and the SEAP start methionine codon.
[0176] The expression vectors prCMV-cis#5-SEAP and prCMV-cis#6-SEAP in which cis-element #5 or #6 was inserted into prCMV-SEAP were constructed according to the procedure described below. Fragments comprising cis-element #5 (1-60) or cis-element #6 (61-126) were amplified using respective sets of primers (SEQ ID NOs: 28 and 29, or SEQ ID NOs: 30 and 31), each having added thereto the partial BglII and HindIII recognition sequences of cis-element #1. The amplified fragments were each treated with BglII-HindIII, and then inserted and ligated into the BglII-HindIII site located between the CMV promoter and SEAP ORF in prCMV-SEAP. Thus, there were obtained expression plasmids in which cis-element #5 or cis-element #6 was inserted between the CMV promoter and the SEAP start methionine codon.
[0177] The expression vector prCMV-cis#7-SEAP, in which cis-element #7 was inserted into prCMV-SEAP, was constructed according to the procedure described below. A COL2A1 gene-derived sequence was synthesized, and then inserted and ligated into the BglII-HindIII site located between the CMV promoter and SEAP ORF in prCMV-SEAP, using the BglII and HindIII recognition sequences added to the ends. Thus, there was obtained an expression plasmid in which cis-element #7 was inserted between the CMV promoter and the SEAP start methionine codon.
[0178] The expression vectors prCMV-cis#8-SEAP, prCMV-cis#9-SEAP, and prCMV-cis#10-SEAP, in which a cis-element #2-derived sequencecis-element #8, #9 or #10was inserted into prCMV-SEAP, were constructed according to the procedure described below. More specifically, cis-element-containing primers designed for cis-element #8 (SEQ ID NO: 32, SEQ ID NO: 33), cis-element-containing primers designed for cis-element #9 (SEQ ID NO: 34, SEQ ID NO: 35), or cis-element-containing primers designed for cis-element #10 (SEQ ID NO: 36, SEQ ID NO: 37) were subjected to heat treatment at 95 C. for 10 minutes and then the temperature was lowered in stages to 25 C. to anneal the two primers, whereby each type of linker was prepared. These types of linker were each inserted and ligated into the BglII-HindIII site located between the CMV promoter and SEAP ORF in prCMV-SEAP. Thus, there were obtained expression plasmids in which cis-element #8 (SEQ ID NO: 24), cis-element #9 (SEQ ID NO: 25), or cis-element #10 (SEQ ID NO: 26) was inserted between the CMV promoter and the SEAP start methionine codon.
[0179] The expression vector prCMV-cis#11-SEAP, in which cis-element #11 was inserted into prCMV-SEAP, was constructed according to the procedure described below. A fragment comprising cis-element #11 (1-113) was amplified using primers (SEQ ID NO: 38, SEQ ID NO: 39) having added thereto the partial BglII and HindIII recognition sequences of cis-element #1. The amplified fragment was treated with BglII-HindIII, and then inserted and ligated into the BglII-HindIII site located between the CMV promoter and SEAP ORF in prCMV-SEAP. Thus, there was obtained an expression plasmid in which cis-element #11 (SEQ ID NO: 27) was inserted between the CMV promoter and the SEAP start methionine codon.
TABLE-US-00004 TABLE4 Table4:Listofprimersforcis-element amplification SEQ Target ID cis# Primersequence NO #1 aaaaaaagatcttcgtcggagcagacg 15 #1 aaaaaaaagcttgtctagaccctagac 16 #2 aaaaaaagatctgcccgcgccggctgt 13 #2 aaaaaaaagcttgttgagacggtggggga 14 #3 gatcttcgtcggagcagacgggagtttctccta 9 #3 agcttaggagaaactcccgtctgctccgacgaa 10 #4 gatcttctgcatcccttctgtccctccaca 11 #4 agcttgtggagggacagaagggatgcagaa 12 #5 aaaaaaagatcttcgtcggagcagacgggagt 28 #5 aaaaaaaagcttctcacactccgcgtgcctcc 29 #6 aaaaaaagatctgccacgcatgagcggacgct 30 #6 aaaaaaaagcttgtctagaccctagacatgta 31 #8 gatctcagggggaggagagggaaccccagg 32 cgcgaa #8 agctttcgcgcctggggttccctctcctcc 33 ccctga #9 gatctgagcgggaagaggggacctgcagcc 34 acaactta #9 agcttaagttgtggctgcaggtcccctctt 35 cccgctca #10 gatctcagggggaggagagggaaccccagg 36 cgcgagcgggaagaggggacctgcagccac aactta #10 agcttaagttgtggctgcaggtcccctctt 37 cccgctcgcgcctggggttccctctcctcc ccctga #11 aaaaaaagatcttcgtcggagcagacgggagt 38 #11 aaaaaaaagcttacatgtagactctttgtggc 39
[0180] The thus-obtained plasmids prCMV-cis#1-SEAP, prCMV-cis#2-SEAP, prCMV-cis#3-SEAP, prCMV-cis#4-SEAP, prCMV-cis#5-SEAP, prCMV-cis#6-SEAP, prCMV-cis#7-SEAP, prCMV-cis#8-SEAP, prCMV-cis#9-SEAP, prCMV-cis#10-SEAP, prCMV-cis#11-SEAP, and prCMV-SEAP were each transfected into the CHO YA7 cells, and after the culture for 20 hours, SEAP activity in culture supernatant was measured according to the procedure described in Example 5. As compared to the SEAP activity in the case of using prCMV-SEAP, which was taken as 1, the SEAP secretory activity ratio was increased by about 2.0 to 3.4 times with all the cis-elements used (
[0181] These results showed that SF3b4 protein with a protein expression enhancement effect can be localized onto an endoplasmic reticulum membrane by adding each of cis-elements #1 to #11 to an expression unit, and that the secretory capacity in cells can be enhanced through this localization process.
Example 10: Effect of the Chain Length of Intra-Motif Sequence
[0182] The motif sequence GAN.sub.1-(X).sub.n-ACN.sub.2 identified in cis-element #1 was investigated for an effective chain length n by the following procedure. Different cis-element #3-derived variants of GAG-(X).sub.n-ACV (V represents A, G or C) with n being varied from 1 to 9(mer) were constructed according to the same procedure as in Example 8 (
Example 11: Influences of Nucleotide Substitutions/Insertions in Motif Sequence
[0183] Investigation was made of the influences of nucleotide substitutions and insertions in a motif on expression enhancement activity. Different cis-element #3-derived variants composed of the motif GAN.sub.1-(X).sub.n-ACN.sub.2 in cis-element #3, wherein N.sub.1 and N.sub.2 are independently A, G, C or T, were constructed by the same procedure as in Example 8 (
Example 12: Decrease in Collagen Secretion in Association with Expression Suppression of SF3b4
[0184] Investigation was made of the influence of SF3b4 expression suppression on collagen secretion. First, siRNA directed against SF3b4 (Life Technologies, human SF3b4 siRNA HSS115684) was transfected into human embryonic lung (HEL) fibroblasts according to the standard protocol for the Oligofectamine reagent (produced by Life Technologies). The transfected cells were cultured for 4 days under the condition of DMEM supplemented with 0.1% FBS and 200 M ascorbic acid phosphate ester. Then, the medium was harvested, and the COL1A1 procollagen content in culture supernatant and the SF3b4 protein content in cell fractions were analyzed according to the procedure described in Example 6. According to the results of this analysis, when the amount of SF3b4 expressed intracellularly decreased to 20% of the control, the secreted COL1A1 procollagen amount decreased to 10% (
Example 13: Influence of a p180/SF3b4-Coexpressing Suspension Cell Line on Collagen Secretion
[0185] A CHO-S cell line stably coexpressing human p180 protein and human SF3b4 protein was established according to the procedure described below. First, pCDNA-p180/54R was transfected into CHO-S cells (produced by Life Technologies) by a lipofection method, and the transfected cells were cultured for 14 days in the presence of 300 g/mL of zeocin, whereby drug selection was done. After zeocin-resistant cell line colonies were isolated, pEF-SF3b4 was transfected by a lipofection method, and drug selection was done under the condition of 600 g/mL hygromycin. After the culture for 14 days, cell line colonies resistant to both zeocin and hygromycin were isolated to establish the CHO-S-derived cell line 54#160 which stably coexpresses human p180 protein and human SF3b4 protein.
[0186] The plasmids prCMV-COL1A1 and prCMV-COL1A1-ORF were each transfected by a lipofection method into each of the control CHO-S cells and the prepared 54#160 cells. The transfected cells were cultured for 96 hours in a serum-free CD FortiCHO medium supplemented with 8 mM L-glutamine (Life Technologies), and then the COL1A1 procollagen content in culture supernatant was analyzed by Western blotting. In the case of genetic introduction of prCMV-COL1A1 containing cis-element #1, the procollagen content in the 54#160 cells increased by about 3.5 times as compared to that in the control CHO-S cells, which was taken as 1. In the case of genetic introduction of prCMV-COL1A1-ORF not containing cis-element #1, the procollagen content in culture supernatant was below the limit of detection by Western blotting.
[0187] Hence, it was demonstrated that cis-element #1 is capable of enhancing the synthesis/secretion of collagen macromolecules in suspended CHO-S cells under a serum-free condition, and that the secretory activity of suspended CHO cells can be more remarkably enhanced by the three factors cis-element #1, SF3b4 protein and p180 protein.
Example 14: Shift of mRNA Distribution in Polysome Towards Heavier Fractions by Cis-Element #1
[0188] The plasmids prCMV-COL1A1 and prCMV-COL1A1-ORF were each transfected by a lipofection method into the CHO YA7 cells. After 40 hours, respective membrane fractions were prepared according to the procedure described in Example 3. The resultant membrane fractions were subjected to centrifugation with a sucrose density gradient from 15 to 50% sucrose to fractionate them into a polysome fraction. mRNA was extracted from each of the resultant polysome fractions according to the procedure described in Example 5, and COL1A1 cDNA was quantified by quantitative PCR. Also, the amount of procollagen then secreted was analyzed by the procedure described in Example 6. According to the results of this analysis, the COL1A1 cDNA distribution in polysome fraction showed a peak at fraction 24 in the case of prCMV-COL1A1-ORF not containing a cis-element, and at fraction 26 in the presence of cis#1, which indicated a shift of the distribution towards heavier fractions (
INDUSTRIAL APPLICABILITY
[0189] It was found that, in the recombinant cell of the present invention which has enhanced expression of the full length or a portion of p180 protein and the full length or a portion of SF3b4 protein, a DNA encoding a protein as a product of interest is transformed, whereby a synthetic or secretory capacity of the protein as a product of interest is dramatically enhanced.
SEQUENCE LISTING FREE TEXT
[0190] SEQ ID NO: 1: Nucleotide sequence encoding human p180
[0191] SEQ ID NO: 2: Amino acid sequence of human p180 protein
[0192] SEQ ID NO: 3: Nucleotide sequence encoding human SF3b4
[0193] SEQ ID NO: 4: Amino acid sequence of human SF3b4 protein
[0194] SEQ ID NO: 5: cis-element #1
[0195] SEQ ID NO: 6: cis-element #2
[0196] SEQ ID NO: 7: cis-element #3
[0197] SEQ ID NO: 8: cis-element #4
[0198] SEQ ID NO: 9: cis-element-containing primer designed for cis-element #3
[0199] SEQ ID NO: 10: cis-element-containing primer designed for cis-element #3
[0200] SEQ ID NO: 11: cis-element-containing primer designed for cis-element #4
[0201] SEQ ID NO: 12: cis-element-containing primer designed for cis-element #4
[0202] SEQ ID NO: 13: cis-element-containing primer designed for cis-element #2, in which the BglII recognition sequence is added towards the 5 end
[0203] SEQ ID NO: 14: cis-element-containing primer designed for cis-element #2, in which the HindIII recognition sequence is added towards the 3 end
[0204] SEQ ID NO: 15: Primer for amplifying cis-element #1, in which the BglII recognition sequence is added towards the 5 end
[0205] SEQ ID NO: 16: Primer for amplifying cis-element #1, in which the HindIII recognition sequence is added towards the 3 end
[0206] SEQ ID NO: 17: Motif in cis-element (9mer)
[0207] SEQ ID NO: 18: Motif in cis-element (10mer)
[0208] SEQ ID NO: 19: Motif in cis-element (11mer)
[0209] SEQ ID NO: 20: Motif in cis-element (12mer)
[0210] SEQ ID NO: 21: cis-element #5
[0211] SEQ ID NO: 22: cis-element #6
[0212] SEQ ID NO: 23: cis-element #7
[0213] SEQ ID NO: 24: cis-element #8
[0214] SEQ ID NO: 25: cis-element #9
[0215] SEQ ID NO: 26: cis-element #10
[0216] SEQ ID NO: 27: cis-element #11
[0217] SEQ ID NO: 28: cis-element-containing primer designed for cis-element #5, in which the BglII recognition sequence is added towards the 5 end
[0218] SEQ ID NO: 29: cis-element-containing primer designed for cis-element #5, in which the HindIII recognition sequence is added towards the 3 end
[0219] SEQ ID NO: 30: cis-element-containing primer designed for cis-element #6, in which the BglII recognition sequence is added towards the 5 end
[0220] SEQ ID NO: 31: cis-element-containing primer designed for cis-element #6, in which the HindIII recognition sequence is added towards the 3 end
[0221] SEQ ID NO: 32: cis-element-containing primer designed for cis-element #8
[0222] SEQ ID NO: 33: cis-element-containing primer designed for cis-element #8
[0223] SEQ ID NO: 34: cis-element-containing primer designed for cis-element #9
[0224] SEQ ID NO: 35: cis-element-containing primer designed for cis-element #9
[0225] SEQ ID NO: 36: cis-element-containing primer designed for cis-element #10
[0226] SEQ ID NO: 37: cis-element-containing primer designed for cis-element #10
[0227] SEQ ID NO: 38: cis-element-containing primer designed for cis-element #11, in which the BglII recognition sequence is added towards the 5 end
[0228] SEQ ID NO: 39: cis-element-containing primer designed for cis-element #11, in which the HindIII recognition sequence is added towards the 3 end