Markers for the epithelial and proliferative or mesenchymal invasive phenotype of human neoplasia
09939426 · 2018-04-10
Assignee
Inventors
Cpc classification
G01N33/57492
PHYSICS
International classification
C12Q1/00
CHEMISTRY; METALLURGY
G01N33/50
PHYSICS
Abstract
The present invention relates to a new Ena/VASP protein isoform, uses thereof, diagnostic methods and kits comprising the same.
Claims
1. A method of screening for a candidate compound that might inhibit invasive behaviour of a pre-neoplastic or neoplastic lesion or cells thereof, said method comprising: (a) contacting compounds with a cell line or tissue culture expressing hMenav6; (b) measuring hMenav6 expression in said cell line or tissue culture; and (c) selecting among the compounds at least one that reduces hMenav6 expression, which is indicative that said at least one compound is a candidate compound that might inhibit invasive behaviour of a pre-neoplastic or neoplastic lesion or cells thereof.
2. The method according to claim 1, wherein said lesion is selected from the group consisting of pancreatic, breast, colorectal, gastric, ovarian, lung, prostate, urothelial, head and neck, esophageal, and skin tumours.
3. The method according to claim 2, wherein said lesion is a melanoma.
4. The method according to claim 1, wherein hMenav6 expression is measured by detection of its protein product, transcription product, spliced transcript mRNA, or cDNA obtained by reverse transcription of mRNA.
5. The method according to claim 4 further comprising measuring hMena11a expression in said cell line or tissue culture, wherein lack of such expression in the presence of hMenav6 expression is indicative of invasive behaviour.
6. The method according to claim 5, wherein detection of one or both hMena splicing variants is carried out by detecting corresponding protein(s) by immunohistochemistry.
7. The method according to claim 6, wherein a polyclonal or a monoclonal antibody or an immunologically active fragment thereof specific for isoform v6 of the hMena protein is used for hMenav6 detection, and a polyclonal or a monoclonal antibody or an immunologically active fragment thereof specific for isoform 11a of the hMena protein is used for hMena11a detection.
8. The method according to claim 7, wherein said antibody or fragment thereof specific for hMenav6 is specific for an epitope comprised in SEQ ID NO: 2 or SEQ ID NO: 3.
9. The method according to claim 7, wherein said antibody or fragment thereof specific for hMena11a is specific for an epitope comprised in SEQ ID NO: 9.
10. The method according to claim 3, wherein said detection is carried out by detecting transcription products comprising SEQ ID NO: 8 or fragments thereof, and transcription products comprising the junction between exon 5 and 7 of the hMena gene.
11. The method according to claim 10, wherein said detection is carried out by hybridising a mRNA or cDNA with an oligonucleotide comprising SEQ ID NO: 8 and/or its complementary sequence or a fragment thereof, and with another oligonucleotide comprising from 797 to 807 of SEQ ID NO: 1 or and/or of their complementary nucleotides in the sequence complementary to SEQ ID NO: 1.
12. The method according to claim 10, wherein said detection is carried out by amplifying mRNA or cDNA with a primer pair amplifying SEQ ID NO: 8 or a fragment thereof, and with another primer pair amplifying a fragment of SEQ ID NO: 1 comprising nucleotides from 797 to 807 of SEQ ID NO: 1.
13. A method of screening for a candidate compound, said method comprising: (a) contacting compounds with cells or tissue expressing hMenav6; (b) measuring said cells or tissue, tetramers of Ena/VASP family members that contain hMenav6; and (c) selecting among the compounds at least one that reduces tetramers that contain hMenav6 interacting with other members of the Ena/VASP family, which is indicative that said at least one compound is a candidate compound that might inhibit invasive behaviour of a pre-neoplastic or neoplastic lesion or cells thereof.
14. The method according to claim 13, wherein said reduction is detected by displacement of hMenav6 from tetramers in which hMenav6 interacts with other hMena isoforms.
15. The method according to claim 13, wherein said lesion is selected from the group consisting of pancreatic, breast, colorectal, gastric, ovarian, lung, prostate, urothelial, head and neck, esophageal, and skin tumours including melanoma.
16. The method according to claim 15, wherein said lesion is a melanoma.
17. The method according to claim 13, wherein said cells expressing hMenav6 are blood-free circulating neoplastic lesion cells.
18. The method according to claim 13, wherein said reduction is detected by displacement of hMenav6 from tetramers in which hMenav6 interacts with other Ena/VASP family members.
19. The method according to claim 13, wherein said reduction is detected by formation of tetramers in which hMenav6 interacts with other hMena isoforms.
20. The method according to claim 13, wherein said reduction is detected by formation of tetramers in which hMenav6 interacts with other of Ena/VASP family members.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2) A. Diagrammatic representation of hMenav6 protein isoform. Protein domains are indicated with the enumeration of relative amino acids. Sequence and position of peptide V6, absent in hMenav6 isoform is indicated.
(3) B. In vitro translated hMena and hMenav6 analyzed by Western blot analysis using the CKLK1 Ab (10 g/ml). Protein extracts (30 g) of MDAMB231 (used to obtain hMenav6 and hMena cDNAs) breast cancer cell line were also tested by Western blot to identify the corresponding in vitro translated protein bands in whole cell lysates.
(4) C. RT-PCR performed with primers (MTC1f and MTC4r) flanking the region of alternative splicing on MDAMB231; BT549; MCF7 and SBT RNA. PCR experiment was also done on the pcDNA3.1 vectors containing the three hMena variants. PCR products were analyzed by agarose gel electrophoresis and ethidium bromide staining.
(5)
(6) Western Blot analysis of lysates of normal keratynocytes (NHK), fibroblasts (NHF) and platelets and of tumor cell lines with hMena isoform specific antibodies, anti E-Cadherin and N-Cadherin antibodies, indicating that normal human keratinocytes expressed hMena11a and the epithelial marker E-Cadherin whereas fibroblast expressing the mesenchymal marker N-cadherin are negative for hMena11a and expressed hMenav6. Normal cells showed a very low level of hMena expression and platelets were negative as described. All the breast and lung cancer cell lines expressing hMena11a show a concomitant expression of E-Cadherin. Conversely, the lack of hMena11a expression is always correlated with the absence of E-Cadherin the expression of the mesenchymal markers as N-Cadherin and the expression of hMenav6 isoform.
(7)
(8) Matrigel invasion assay performed on BT549 cells transfected with the indicated siRNA. The ability of invasion has been measured during the last 24 h of transfection by the use of Matrigel coated transwell filters (BD Biosciences) toward a gradient of EGF or serum. The assay was repeated three times each time performed in triplicate. Histograms represent the mean of invading cells counted in ten different fieldsSD. Representative images are shown. Inset: Western blot analysis of lysates of BT549 cells collected following 72 h of siRNA transfection. The experiment reported in this figure demonstrates that the knock down of hMena isoforms in invasive breast tumor cells expressing hMena/hMenaDv6 significantly reduces the invasive behaviour of the cells.
(9)
(10) Matrigel invasion assay performed on MDA-MB-231 (hMena11a negative, hMena/hMenav6 positive), DAL (expressing an undetectable levels of hMena isoforms) and MCF7 (hMena/hMena11a positive, hMenav6 negative) cells stably transfected with the empty vector or hMenav6 toward serum. The ability of invasion has been measured by the use of Matrigel coated transwell filters (BD Biosciences) toward a gradient of serum. Results shown indicate that hMenav6 overexpression increases the invasive behaviour of the hMena11a negative MDAMB231 and DAL cells, but has no effect on hMena11a positive MCF7 cells. The assay was repeated three times each time performed in triplicate. Histograms represent the mean of invading cells counted in ten different fieldsSD. Western blot analysis of lysates of transfected cells indicating the efficiency of hMenaDv6 transfection are shown on the top of the histograms.
(11)
(12) A. Matrigel invasion assays of MDA-MB-231 (hMena11a negative hMena/hMenav6 positive) stably transfected with empty vector or hMena11a. The ability of invasion has been measured by the use of Matrigel coated transwell filters (BD Biosciences) toward a gradient of serum. The assay was repeated three times each time performed in triplicate. P value and standard deviations are indicated. Western blot analyses of lysates of transfected cells is shown on the top of the histograms.
(13) B. Matrigel invasion assays of BT549 cells (hMena11a negative hMena/hMenav6 positive) stably transfected with empty vector or hMena11a performed as described in panel A. Western blot analyses of lysates of transfected cells is shown on the top of the histograms.
(14) C. Immunofluorescence analysis of BT549 cells transfected with the empty vector or with hMena11a and of MCF7 cells with phalloidin (red). Cells were imaged using immunofluorescence microscopy DMIRE2 (Leica Microsystems) and processed using FW4000 Software. Magnification: 63.
(15)
(16) A-B. Consecutive sections of a breast cancer tissue expressing hMena11a decorated with anti-hMena11a antibody pretreated with irrelevant peptide (v6) (A) or with the specific 11a peptide (B).
(17) C-D. Consecutive sections of a breast cancer tissue expressing hMena v6 decorated with anti-hMenav6antibody pretreated with irrelevant peptide (11a) (C) or with the specific v6 peptide (D).
(18)
(19) The case reported in panel A is positive for the staining with pan-hMena and expresses hMena11a, but is negative for hMenaDv6. The case reported in panel B is positive for the staining with pan-hMena and expresses hMenaDv6, but is negative for hMena11a.
(20) The tumour is an epithelial tumour.
(21) According to an embodiment of the invention the method for detecting both said splicing variants is carried out by detection of the corresponding protein by immunohistochemistry.
(22) In a still alternative embodiment of the invention the detection of hMena splicing variants is carried out by detecting transcription products comprising SEQ ID NO: 8 or fragments thereof and transcription products comprising the junction between exon 5 and 7 of hMena.
DETAILED DESCRIPTION OF THE INVENTION
(23) The present description discloses a method for predicting the proliferative or invasive behaviour of a pre neoplastic lesion or of a neoplastic lesion comprising the step of detecting in vitro or in vivo the expression of hMena11a and hMenav6 splicing variants of hMena in a biological sample comprising cells of said lesion
(24) wherein detecting the expression of hMena11a and not of hMenav6 indicates a proliferative behaviour, whereas detecting the expression of hMenav6 and not of hMena11a indicates an invasive behaviour.
(25) Human Mena11a isoform of hMena (herein also defined as hMena11a) (F. Di Modugno et al. 2007) is a splicing variant of hMena resulting in the corresponding hMena11a protein isoform. This splicing variant contains the additional exon 11a of 63 nucleotides, corresponding to an additional peptide of 21 amino acids in the EVH2 domain characterizing the isoform. The hMena11a has the nucleotide sequence of SEQ ID NO: 6 coding for the amino acid sequence of SEQ ID NO: 7, whereas the exon 11a has the nucleotide sequence of SEQ ID NO: 8 that codes for a peptide of SEQ ID NO: 9.
(26) The present inventors have identified a new hMena splicing variant in a human breast cancer cell line with a mesenchymal phenotype. Said splicing variant (GEN BANK NO EU255274) has been called the human Menav6 and is characterized, compared to hMena, by the lack of the internal exon 6 of 111 nucleotides (
(27) The absence of this peptide puts two crucial regions, the LERER domain and PKA Ser phosphorylation site (Ser 236 in mice) with the pro-rich domain close to each other in the v6 protein.
(28) Exon 6 spans from nucleotide 803 to nucleotide 813 included of SEQ ID NO: 6 coding hMena11a. The sequence coding for hMena 11a is identical to hMena sequence up to nucleotide 1540.
(29) In the present description the expression invasive behaviour of a pre neoplastic or of a neoplastic lesion refers to pre neoplastic or neoplastic lesions comprising cells that tend to leave the primary tumor and to acquire migratory and invasive capabilities, spread and migrate form an original site to one or more sites elsewhere in the body.
(30) The expression pre neoplastic lesion (i.e. pre cancer lesion) refers to lesions preceding the formation of a malignant neoplasm, i.e. a lesion from which a malignant tumour is presumed to develop in a significant number of instances and that may or may not be recognizable clinically or by microscopic changes in the affected tissue, i.e. a condition that tends to become malignant but does not necessarily do so.
(31) The expression neoplastic lesion refers to a lesion pertaining to a neoplasm or a neoplasia, i.e. an abnormal growth of cells, which may lead to a neoplasm, or tumor.
(32) The experiments carried out by the inventors showed that said two splicing variants, namely hMena11a and hMena v6, are mainly expressed in an alternative manner and characterize two different cellular phenotypes. In particular, hMena11a is expressed in the cells showing an epithelial phenotype, i.e. cells expressing the major component of the epithelial adherent junctions E-Cadherin, whereas hMenav6 is only present in cells showing a migratory ability, such as fibroblasts and tumor cells, lacking E-Cadherin and hMena11a expression but expressing the mesenchymal marker N-Cadherin and or vimentin. As shown in
(33) Conversely, the lack of hMenav6 expression is always correlated with the presence of hMena11a and the expression of markers such as E-Cadherin.
(34) The results obtained by the authors allow demonstrating that the detection of hMena11a expression and not of hMenav6 expression indicates a proliferative anti invasive behaviour, whereas the detection of hMenav6 expression and not of hMena11a expression indicates an invasive behaviour of a pre neoplastic or neoplastic lesion in a human patient.
(35) For the purpose of the invention the neoplastic lesion can be a tumour originating from any tissue of the body;
(36) In a particular embodiment of the invention the lesion can be a tumour selected from the group comprising: pancreatic, breast, colorectal, gastric, ovarian, lung, prostate, urothelial, head and neck, esophageal, skin tumour including melanoma.
(37) Biological sample comprising lesion cells within the meaning of the invention means a specimen of a pre neoplastic or neoplastic lesion tissue, pre neoplastic or neoplastic lesion cells or blood free-circulating neoplastic cells collected from samples of body fluids such as blood, serum, lymphatic liquid. The said biological samples may be obtained form subjects by standard techniques, such as biopsy, surgery or aspiration, well known to the person skilled in the art.
(38) The method of the invention can also be carried out on blood samples of patients, in order to detect the presence of circulating tumour cells (CTC) i.e. cells of the neoplastic lesion that are freely circulating in blood. Said cells, in fact, can be detected in the peripheral blood of patients with a variety of solid cancers. Because of their very low frequency, these tumour cells are not easily detected using conventional cytology methods. In the past decade, numerous groups have attempted to detect CTC of solid malignancies using the highly sensitive reverse transcriptase polymerase chain reaction, which has been shown to be superior to conventional techniques. However, the biological significance of CTC and the therapeutic relevance of their detection are still debated. The method herein described, allows identifying CTC of tumours that are proliferating or invasive thus enabling also researchers to further investigate the potential of identification and molecular characterization of the subset of CTC responsible for metastasis development. The prognostic value of CTC would provide clinicians with a unique tool for better stratification of patients' risk and provide basic researchers with a new target for the development of novel therapeutic approaches. The method of the invention advantageously enables the detection of a large group of CTC of different tumours.
(39) The detection of said two splicing variants may be carried out at different stages of the expression process. In other words it is possible to detect hMena variants either by detecting the expressed protein isoforms or by detecting the transcription products, namely the spliced transcript mRNA of hMena variants or alternatively the cDNA obtained by reverse transcription of said mRNA. Therefore, said detection can be carried out by detecting directly or indirectly either nucleotide sequences or amino acid sequences of hMena variants. In any case the hMena11a and hMenav6 expression shall be normalized with respect to other proteins or transcription products whose expression does not change in proliferative or invasive/metastatic tumors. Examples of such controls include hMena isoform (88 kDa) and VASP.
(40) Methods suitable for the detection are either qualitative or quantitative ones.
(41) In one embodiment of the invention the detection of one or both said splicing variants is carried out identifying the protein variants by immunohistochemistry or immunocytochemistry.
(42) The immunohistochemistry or immunocytochemistry allows the localization of a target antigen in cells, tissues etc. by using an antibody and exploiting the specific antigen-antibody interaction. Therefore some suitable methods for the detection of hMena variants by direct cellular analysis with immunochemistry techniques are, for illustrative purposes, western blot, immunofluorescence techniques etc.
(43) The immunohistochemistry is carried out directly on a tissue sample and as well known by the skilled person; all the stages of this technique are described in detail in most laboratory manuals.
(44) The method according to the present invention may be carried out by using a polyclonal or a monoclonal antibody or an immunologically active fragment thereof specific for the isoform 11a of the hMena protein for hMena11a detection and a polyclonal or a monoclonal antibody or an immunologically active fragment thereof specific for the isoform v6 of the hMena protein for hMenav6 detection.
(45) The polyclonal or monoclonal antibodies can be obtained by the skilled person following standard techniques, by way of example, by immunising rabbits, or mice, or other suitable animals so to obtain antibodies specific for the desired variants. For the preparation of anti hMena11a antibodies, the animals can be immunised, by way of example, with an immunogenic peptide specific for hMena 11a, e.g. a peptide comprising or comprised in exon 11a of SEQ ID NO: 9 or an antigenic portion of hMena11a SEQ ID NO: 7 specific for hMena 11a or by conformational epitopes specific for the desired isoform. For the preparation of anti hMena 4v6 antibodies, the animals can be immunised, by way of example, with an immunogenic peptide specific for hMena 4v6 e.g. with a peptide encoded by a fragment of SEQ ID NO: 1 comprising nucleotides from 797 to 807 or with an antigenic portion of SEQ ID NO: 2 specific for hMena4v6 or with any suitable immunopeptide specific for hMena4v6 as the peptide of SEQ ID NO: 3 or by conformational epitopes specific for the desired isoform. In an embodiment of the present description, said antibody or fragment thereof specific for the hMena11a isoform is specific for an epitope comprised in or consisting of SEQ ID NO: 9 and said antibody or fragment thereof specific for the hMena4v6 isoform is specific for an epitope comprised in or consisting of SEQ ID NO: 2 or SEQ ID NO: 3.
(46) An effective polyclonal antibody for carrying out the methods herein described can be obtained by immunising rabbits with the antigen conjugated with a protein carrier such as for example KLH or BSA.
(47) The immune sera thus obtained can be purified by affinity chromatography for example on Sepharose resin CnBr conjugated with the immunogenic peptide. The immunogenic peptide used in affinity chromatography for purifying anti-hMena4v6 may be, by way of example, the peptide of SEQ ID NO: 4. The anti-hMena11a or the hMena4v6 thus obtained will specifically recognise the hMena11a or the hMena4v6 isoform without cross reacting with other hMena isoforms.
(48) Suitable monoclonal antibodies can be manufactured by ablating the spleen of animals immunised with the above described immunogens and by fusing the spleen cells with mieloma cells in order to form an hybridome that, once cultured, will produce the monoclonal antibody. The antibody can be an IgA, IgD, IgE, IgG or IgM. The IgA antibody can be an IgA1 or IgA2, the IgG can be an IgG1, IgG2, IgG2a, IgG2b, IgG3 or IgG4. Also a combination of antibodies subtypes can be used. The antibody can be a human, mouse, goat or rabbit antibody. The antibodies can be humanised by using standard techniques of recombinant DNA known to the skilled person.
(49) As used herein, the term antibody encompasses whole antibodies and fragment thereof wherein the fragment specifically binds to one of the said hMena protein isoforms.
(50) The fragment according to the present description can be, without being limited to it, an F(ab)2 fragment, a Fab fragment or single chained antibodies.
(51) Aptamers may also be used in order to detect the hMena protein isoforms. Aptamers are single strand oligonucleotides that bind to a particular target molecule, such as a protein. Thus, aptamers are functionally similar to antibodies. Aptamers that bind a target molecule can be selected using, for example, the SELEX process or the like.
(52) The reagent binding the hMena isoforms (deriving from the hMena RNA splicing variants) can be complexed with a detectable marker or alternatively be detectable itself by a second labelled reagent such as a second antibody. The labelling can be carried out through many know techniques including but not limited to, peroxydase, chemoluminescence, radioactive markers. The marker can be a non radioactive or a fluorescent marker such as biotin, fluorescein (FITC), acridine, carboxy-X-rhodamine and others known to the skilled person, that can be detected by means if fluorescence techniques or other image analysis techniques.
(53) Alternatively, the marker can be a radioisotope emitting radiations such as, by way of example .sup.35S, .sup.32P, o .sup.3H. The emitted radioactivity can be detected by means of know standard techniques, such as, by way of example, scintigraphy.
(54) The detection of hMena splice variants can be also carried out at transcriptional level. Thus, it is possible to detect transcription products such as mRNA or the relative cDNA. Protocols to obtain mRNA or cDNA from a sample comprising cells of interest are well known by the skilled person and furthermore they are described in detail in laboratory manuals and in commercially available kits for mRNA extraction and cDNA amplification. The detection of transcription products may be carried out by any suitable method such as northern blot, microarray, PCR, Real-Time PCR, hybridization on solid support etc.
(55) According to the present invention, the detection of one or both said splicing variants is carried out by detecting transcription products comprising SEQ ID NO: 8 or fragments thereof for the detection of the hMena11a variant and transcription products comprising nucleotides from 797 to 807 of SEQ ID NO: 1 for the detection of the hMenav6 variant.
(56) The expression of the hMena11a and hMenav6 splicing variants can be detected by nucleic acids hybridisation analysis using one or more probes hybridising in a specific manner with the mRNA or cDNA of said variants.
(57) In one embodiment of the invention, the detection is carried out by hybridising the mRNA or cDNA obtained from the sample with a labelled oligonucleotide comprising SEQ ID NO: 8 and/or its complementary sequence or a fragment thereof and with another labelled oligonucleotide comprising nucleotides from 797 to 807 of SEQ ID NO: 1 or and/or of their complementary nucleotides in the sequence complementary to SEQ ID NO: 1.
(58) The oligonucleotide may be DNA or RNA and may be prepared by a variety of techniques known to those skilled in the art, including, without limitation, restriction enzyme digestion of hMena variants, automated synthesis of oligonucleotides. It is clear that the skilled person, knowing the nucleotide sequences (SEQ ID NO: 6 of hMena11a and the sequence of exon 11a SEQ ID NO: 8 and SEQ ID NO: 1 of hMena4v6 and the exact sequence of the exon 5 and exon 7 junction comprised between nucleotides 797 to 807 of SEQ ID NO: 1) will be capable, without use of inventive skill, to design probes suitable for carrying out the hybridization method.
(59) The oligonucleotides for hybridisation may be vary in length form about 8 nucleotides to the entire sequence SEQ ID NO: 8 for hMena 11a detection and may vary from nucleotides 797 to 807 (plus or minus one nucleotide per side) to a fragment of about 10-500 nucleotides of SEQ ID NO: 1 comprising nucleotides 797-807 according to the specific hybridization technique used.
(60) In general, the length of the probe can be a length suitable for hybridisation. Suitable length can be between, by way of example, 500 and 10 nucleotides, such as about 400, 300, 200, 150, 100, 60, 50, 40, 30, 20, 10 nucleotides, as known to the skilled person.
(61) The hybridization may be carried out by different methods such as northern blot (for RNA detection), southern blot (for cDNA detection), hybridization on a solid phase, i.e. on a solid support such as microtiter, microarray chip and the like. The detection is due to a luminous signal in correspondence to the hybridization between the target molecules or fragments thereof and the corresponding probe. As well known to the skilled person it is possible to label either the probe or the target molecules according to the particular method used.
(62) So, by way of example, the detection of one of both hMena variants, when carrying out hybridization on solid support, is due to the luminous signal (emitted by a fluorophore) in correspondence to the hybridization between the target molecule labelled and the corresponding probe bound on the support. Each variant will be labelled with a different fluorophore in order to enable direct identification of the variant expressed.
(63) Conversely, the oligonucleotide probes are labelled in southern and northern blot techniques.
(64) Protocols suitable for carrying out any of these hybridization techniques are described in details in laboratory manuals and the skilled person will be capable, without use of inventive skill, to carry out the detection of hMena variants according to this embodiment of the invention.
(65) In another embodiment of the invention, said detection is carried out by PCR by amplifying the mRNA or cDNA obtained from the sample with a primer pair amplifying SEQ ID NO: 8 or a fragment thereof and with another primer pair amplifying a fragment of SEQ ID NO: 1 comprising nucleotides from 797 to 807 of SEQ ID NO: 1.
(66) Even in this case, the skilled person, knowing the nucleotide sequences (SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 1, and sequence from 797 to 807 of SEQ ID NO: 1) will be capable to design primers suitable for carrying out the amplification. Further the primers may be labelled with detectable markers such as fluorophores and others known to the skilled person in order to identify the specific amplicons, by way of example, after an RT-PCR. The detection of amplicons related to more than one variant, obtained by PCR carried out with unlabelled primers, may be possible by designing, as well known to the skilled person, primers capable of amplifying sequences with a different number of nucleotides. Thus, the obtained amplicons may be detected by their different migration pattern on electrophoresis gel.
(67) In Real-time PCR the detection of the target sequence is based on to the study of melting curves so, indifferently from the method used for the revelation, the obtained amplicons may be of the same length.
(68) The present description also provides a method for predicting the proliferative or invasive behaviour of a pre neoplastic lesion or of a neoplastic lesion comprising the step of detecting in vitro or in vivo the presence of antibodies specific for hMena11a and antibodies specific for hMenav6 isoforms of hMena in a body fluid sample. As used herein, the term antibody encompasses whole antibodies and fragment thereof specifically capable of binding to one of the said hMena protein isoforms or fragments thereof. For illustrative purpose, detectable antibodies useful for carrying out the method above described, are detectable antibodies capable of recognizing and specifically binding SEQ ID NO: 2 or fragments thereof, SEQ ID NO: 9, SEQ ID NO: 7 or fragments thereof or SEQ ID NO: 10.
(69) Detecting the presence of antibodies specific for hMena11a and not of hMenav6 isoforms in a body fluid sample indicates a proliferative behaviour of a pre neoplastic lesion or of a neoplastic lesion, whereas detecting the presence of antibodies specific for hMenav6 and not of hMena11a indicates an invasive behaviour of said lesion.
(70) In one embodiment said lesion is a neoplastic lesion and said lesion is selected from the group comprising: pancreatic, breast, colorectal, gastric, ovarian, lung, prostate, urothelial, head and neck, esophageal and skin tumours including melanoma.
(71) The antibodies specific for said hMena isoforms can be detectable in a body fluid sample. Body fluids suitable for carrying out the method above comprise: blood, serum, breast milk, peritoneal fluid, pleural fluid, pericardial fluid, lymph.
(72) As well known by the skilled person, techniques for detecting antibodies in a fluid are described in detail in most laboratory manuals and therefore, herein they don't need any other technical detail. Anyway, by way of example, a suitable technique for carrying out said method is the ELISA assay.
(73) The present description also discloses a kit for carrying out the method of the invention. The kit herein described allows predicting the proliferative or invasive behaviour of a pre neoplastic or neoplastic lesion by detecting the expression of hMena11a and hMenav6 isoforms in a biological sample of said pre neoplastic or neoplastic lesion or cells thereof.
(74) The kit of the present description will comprise reagents suitable for the detection of both variants and optionally positive and negative controls.
(75) In an embodiment, the kit will comprise a polyclonal or a monoclonal antibody or an immunologically active fragment thereof specific for the isoform 11a of the hMena protein and a polyclonal or a monoclonal antibody or an immunologically active fragment thereof specific for the isoform v6 of the hMena protein.
(76) The antibody or antibodies of the kit can be aliquoted in one or more vials, in master solutions or ready-to-use solutions, they can be labelled in any of the above described manners. Depending on the labelling selected, the kit of the invention can further comprise the reagents suitable for the detection of said antibody. All the labelling options are well-known in the art and the detection protocols and reagents are also well known to the skilled person.
(77) In one embodiment of the invention, the antibody or fragment thereof specific for the hMena11a isoform is specific for an epitope comprised in SEQ ID NO: 9 or any other epitope specific for hMena11a isoform, and wherein said antibody or fragment thereof specifically binds a protein having SEQ ID NO: 2 or any other epitope specific for the hMenav6 isoform or a peptide having SEQ ID NO: 3
(78) Alternatively, the kit can comprise a labelled oligonucleotide comprising SEQ ID NO: 8 and/or its complementary sequence or a fragment thereof and another labelled oligonucleotide comprising nucleotides from 797 to 807 of SEQ ID NO: 1 or and/or their complementary nucleotides in the sequence complementary to SEQ ID NO: 1.
(79) When due to hybridise on cDNA the probes can be designed in order to hybridise to the sense or the antisense strand, and will comprise a region of at least part of the sequence coding for hMena11a cDNA said region comprising SEQ ID NO: 8 or a region of at least part of the sequence coding for hMena6 cDNA said region comprising nucleotides from 797 to 807 of SEQ ID NO: 1.
(80) As before, the labelling can be any suitable labelling indicated above. The kit may hence further comprise reagents suitable for the detection of the labelled probe.
(81) Alternatively, the kit can comprise a primer pair amplifying SEQ ID NO: 8 or a fragment thereof and another primer pair amplifying a fragment of SEQ ID NO: 1 comprising nucleotides from 797 to 807 of SEQ ID NO: 1.
(82) The kit may further comprise further reagents suitable for the detection of the expression of hMena11a and hMenav6 splicing variants such as buffers, supports, gels, membranes and others. In other words, the kit of the present invention can comprise any and all reagents necessary for carrying out one or more of the detection methods described above. Reagents, by way of example, may be one o more aliquots of suitable buffers (Tris buffer), dNTPs, Taq polymerase, MgCl.sub.2, reverse transcriptase, microarray, microtiter, gels, membranes, specific enzymes etc. The kit of the present invention may be a partial kit which comprises only a part of the necessary reagents or enzymes an in this case the users may provide the remaining components.
(83) The kit may comprise means for carrying out one or more methods described above. For example, the kit may include microtiter, solid support, precasting gels (electrophoresis gel, northern gel, southern gel) etc.
(84) The kit may further comprise positive and/or negative control samples such as ready to use tissue or cell samples expressing hMena 11a or hMena v6 fixed or fresh hMena isoform transfected or knock down tumor cells or tumor cell lysates and/or cDNA from cells and or tissues expressing hMena 11a or of hMena v6. The samples can be provided for both isoforms or for one of the two isoforms.
(85) The presence of positives and/or negative controls will allow the user to verify the effectiveness of the reagents and the presence of a possible background signal in the detection assay.
(86) The invention also provides a nucleotide sequence as set forth in SEQ ID NO: 1 coding for the v6 isoform of hMena or fragments thereof said fragments comprising nucleotides from 797 to 807 of SEQ ID NO: 1 or the complementary sequence of SEQ ID NO: 1 or of said fragments.
(87) These nucleotide sequences may be used as a diagnostic tool, for example, to identify, to determine the nature, the cause, the behaviour (proliferative or invasive behaviour) of a pre neoplastic lesion or of a neoplastic lesion.
(88) Another embodiment of the invention is an amino acid sequence as set forth in SEQ ID NO: 2 coding for the v6 isoform of hMena or fragments thereof comprising the amino acids from 267 to 270. These amino acid sequences, as the corresponding nucleotide sequences, may be used as a diagnostic tool or for the preparation of isoform specific antibodies or aptamers.
(89) An embodiment of the present invention is also a polyclonal or monoclonal antibody or fragments thereof specifically binding a protein having SEQ ID NO: 2 or an epitope specific for hMenav6 isoform or a peptide having SEQ ID NO: 3.
(90) Said polyclonal or monoclonal antibody or fragments thereof may be used as a medicament. The expression as a medicament means, in present description, that said antibody is capable to modify the functionality or oligomerization of hMena v6 protein and then causing an alteration of actin cytoskeleton of the cell both in vivo and in vitro thus inhibiting its invasive behaviour.
(91) The invention still further provides a siRNA specific for SEQ ID NO: 1 or a fragment thereof comprising nucleotides from 797 to 807 of SEQ ID NO: 1 as a medicament.
(92) RNA interference (RNAi) is a process by which double-stranded RNA (dsRNA) is used to silence gene expression. RNAi begins with the cleavage of longer dsRNA into small interfering RNAs (siRNAs) by an RNaseIII-like enzyme, dicer. siRNAs are dsRNAs that are usually about 19 to 28 nucleotides or 20 to 25 nucleotides. A single dsRNA is incorporated into a ribonucleoprotein complex known as RNA-induced silence complex (RISC). RISC uses the antisense strand (or guide strand) of siRNA to identify mRNA molecules that are at least partially complementary to said siRNA strand, and then inhibits their translation. Therefore, the other siRNA strand, known as passenger strand or sense strand, is eliminated from the siRNA as it is partially homologus to the target mRNA.
(93) RISC-mediated cleavege of mRNA having a sequence at least partially complementary to the guide strand leads to decrease in the steady level of that mRNA and of the corresponding protein encoded by this mRNA. Alternatively, RISC can also decrease expression of a protein via translation repression without cleavage of mRNA molecule.
(94) The present invention relates to the use of interfering RNA to inhibit or reduce the expression of hMena, in particular hMenav6 splicing variant by either cleaving or repressing translation of hMenav6 mRNA.
(95) In order to carry out the interference process described above, the skilled person in the art can readily deduce the mRNA sequence of hMena v6 from the corresponding DNA sequence of SEQ ID NO: 1. The mRNA sequence is identical to the DNA sense strand sequence with T bases replaced with U bases. Therefore, the mRNA sequence of hMena is known from SEQ ID NO: 1.
(96) In one embodiment of the invention the siRNA has a sense strand identical to SEQ ID NO: 1 or a fragment thereof comprising nucleotides from 797 to 807 of SEQ ID NO: 1.
(97) Suitable siRNAs for hMena v6 can be designed using available design tools such as Ambion o Genscript programs freely available online at: http://www.ambion.com/techlib/misc/siRNA_finder.html http://www.genscript.com/design_center.html) or can be ordered to specialized commercial suppliers. Techniques for selecting suitable siRNA are provided by Tuschl, T et al. The siRNA user guide available on the Rockefeller University web site; and by other web-based design tools at, for example, Invitrogen, Integrated DNA Techologies, Genscript web site.
(98) Designed siRNAs corresponding to the target molecule may be tested by measuring the mRNA levels or corresponding protein levels in the cells treated with said siRNAs, by techniques well known to the skilled person such, for example, western blot, PCR etc.
(99) A siRNA according to the present description for targeting hMena v6 mRNA may be, by way of example, sense strand siRNA: UAUCAAGUGCUGGCAUUG UUU (SEQ ID NO: 17); Antisense strand siRNA: ACAAUGCCAGCACUUGAU AUU (SEQ ID NO: 18).
(100) For the purpose of the invention herein described the antisense strand of siRNA may have between 80% up to 100% complementary, for example 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% complementary, to the hMena v6 mRNA sequence.
(101) According to present invention single strand interfering RNAs (ssRNA) may be used in order to achieve the inhibition of hMena v6 expression. Therefore, embodiments of the present invention are also ssRNAs that specifically hybridise to SEQ ID NO: 1 or a fragment thereof comprising nucleotides from 797 to 807 of SEQ ID NO: 1.
(102) Alternatively, the interference may be carried out by an expression vector having a coding sequence that is transcribed to produce one or more transcriptional products that produce double or single strand siRNA specific for hMena v6 in the cells.
(103) Optionally, a hairpin RNA (shRNA) which is processed to a siRNA may be used.
(104) In the meaning of the invention, siRNA includes all the embodiments above, double stranded, single stranded (ssRNA) and hairpin (shRNA) interfering RNAs suitable for silencing the expression of the desired gene.
(105) Examples of making and using such hairpin RNAs for silencing in mammalian cells are described in McCaffrey at al. Nature 2002 (see below for detail).
(106) Interfering RNAs (double or single strand or hsRNA) may be synthesized chemically or expressed endogenously from viral or plasmid vectors or expression cassettes. Examples of commercially available plasmid-based expression vector include members of pSilencer series (Ambion, Austin Tex.) and pCpG-siRNA (InvivoGen, San Diego). Viral vector for interfering RNA may be drived from varieties of viruses including retrovirus, adenovirus, lentivirus, baculovirus and herpes virus. Examples of commercially available viral vectors for interfering RNA include pSilencer adeno (Ambion, Austin Tex.) and pLenti6/BLOCK-iT-DEST (Invitrogen). Selections of plasmid or viral vector, methods for expressing interfering RNA from the vector are within the ordinary skills of one in the art.
(107) Interfering RNAs may be different form the naturally-occurring RNA by the addition, deletion, substitution of one or more nucleotides. Non-nucleotides material may be bound to siRNA in order to increase nuclease resistance, to improve cellular uptake, to enhance cellular targeting, to further improve stability.
(108) In particular, mechanisms to delivery siRNA to the target molecules and cells include viral or plasmid vectors, liposomes, nanoparticles but also chemical modifications.
(109) Liposomes and nanoparticles represent efficient delivery systems in vivo and in vitro.
(110) Unmodified siRNA has a half-life of less than 1 hour in human plasma and siRNA is rapidly excreted by the kidneys. Liposomes and nanoparticles can act as envelopes to protect the siRNA from metabolism and excretion, but can also carry specific molecules designed to target the siRNA to specific tissue types. Liposomes made of cationic lipids such as DOTAP (1,2-bis(oleoyloxy)-3,3-(trimethylammonium)propane), neutral lipids such as DOPE (dioleoylphosphatidylethanolamine) may be used to carry siRNA into cells.
(111) Nanoparticles such as the cationic polymer, polyethyleneimine (PEI) may be used to successfully deliver siRNA to target cells.
(112) Instead, examples of chemical modifications include a 3 terminal biotin molecule, a peptide to known to have cell penetrating properties, or 3 cholesterol conjugation. Furthermore, it is possible to modify either the phosphate-sugar backbone or the nucleotide so, by way of example, the phosphodiester linkages of natural RNA may be modified to include at least one heteroatom (phosphotothioate, phosphoramidate etc).
(113) In order to allow the entry of siRNAs into the target cells, trasfection reagents such as Lipofectamine, Lipofectin may be used.
(114) However, any routine suitable method or chemical modification, comprising in the art and known to the skilled person, for delivering and/or enhancing the ability of siRNA (dsRNAs, ssRNAs, hsRNA, expression RNAi vector) to pass the cell membrane, and thus elicit its biological activity, is part of the present description.
(115) Various strategies for delivering siRNA to specific tissue and organ systems in vivo and in vitro may be used, including the direct local injection of siRNA into a pre neoplastic or neoplastic lesion. Alternatively, the siRNA, for example, formulated with liposomes can be associated with one or more ligands effective to bind to a specific surface cell protein on the target cell, thereby enhancing, in some case, uptake of the siRNA by the cells. Merely to illustrate, folate, VEGF, EGF are examples of ligands suitable for targeting epithelial carcinoma.
(116) According to the present description, siRNAs (dsRNA, ssRNA, shRNA and expressing siRNA vector) are used in a treatment for inhibiting the invasiveness of a pre neoplastic or neoplastic lesion or cells thereof.
(117) In another embodiment of the invention, the polyclonal or monoclonal antibody binding hMenav6 isoform protein may be used in a treatment for inhibiting of the invasiveness of a pre neoplastic or neoplastic lesion or cells thereof.
(118) In particular, said polyclonal or monoclonal antibody or fragments thereof specifically binding a protein having SEQ ID NO: 2 or a fragment thereof specific for hMenav6 isoform or a peptide having SEQ ID NO: 3.
(119) Polyclonal or monoclonal antibodies according to the present invention are described in detail above.
(120) The invention still further provides a method for the inhibition of the invasive behaviour of a pre neoplastic or neoplastic lesion or cells thereof comprising the step of inhibiting the expression or the functionality or the oligomerisation of hMena v6.
(121) The method may involve intervention at DNA, RNA or protein level by using suitable inhibitors. hMena v6 isoform interacts with the other hMena isoforms and with other members of Ena/VASP family to form functional tetramers which regulate actin cytoskeleton dynamics Inhibition of hMenav6 inclusion into the tetramers or exogeneous inclusion of hMena11a may change the function of the tetramer in terms of actin network and ultimately in the ability of the cell to invade.
(122) Thus, the inhibition of hMena v6 may be achieved by using for example, siRNAs, antibodies or aptamers, as described above. These inhibitors may be added directly or indirectly on either a biological sample or lesion to be treated both in vitro and in vivo.
(123) An embodiment of the present invention is also a pharmaceutical composition comprising at least one inhibitor of hMena v6 expression or functionality or oligomerisation and at least a pharmaceutically acceptable carrier and/or excipient.
(124) Pharmaceutical composition according to the present invention may comprise inhibitors such as siRNAs and/or antibodies and/or aptamers specific for the hMena v6 isoform.
(125) The composition will be formulated for delivering a therapeutically effective amount of said inhibitors to a target site.
(126) In particular, composition comprising siRNAs within said siRNAs or salt thereof may be formulated, for example, in cationic or neutral lipids vehicles, liposomes, polymers, nanoparticles. The administration may be carried out by any means suitable for delivering the siRNA to the target site known in the art. For example, siRNA may be administrated by electroporation, or by other suitable parental or enteral administration routes. Suitable administration routes, for example, include intravascular administration; intra-tissue administration (e.g. intra-tumour or intra-lesion injection); direct application to the area or near the area of the target site; inhalation. One skilled in the art can also readily define the appropriate administration routes according to the target site to be reached. The present pharmaceutical composition comprises the siRNAs of the invention (e.g. 0.1 to 90% in weight) or a physiological acceptable salt thereof, mixed with a physiologically acceptable carrier such as water, buffer, saline solution, glycine, hyaluronic acid, mannitol, lactose, glucose and the like. Said compositions also comprise pharmaceutical excipients and/or additives such as stabilizers, antioxidants, osmolality adjusting agents, pH adjusting agents. Pharmaceutical composition comprising siRNAs can be also lyophilized.
(127) Alternatively, the pharmaceutical composition comprises an antibody capable of specifically binding (and inhibiting the functionality or the mere capability to oligomerise) the v6 isoform of the hMena protein. In one embodiment of the invention said antibody binds the amino acid sequence of SEQ ID NO: 2 coding for the v6 isoform of hMena or fragments thereof comprising the amino acids from 267 to 270.
(128) Pharmaceutical compositions comprising said antibody are prepared by mixing the antibody having the desire degree of purity with one or more pharmaceutical acceptable carrier and/or excipient and/or stabilizer.
(129) Acceptable carriers or excipients or stabilizers include buffer such as phosphate, citrate, and other organic acid, antioxidants such as ascorbic acid and methionine; preservatives; proteins such as serum albumin, gelatine; monosaccharides, disaccharides, glucose, mannose, dextrin, sorbitol. Methods for preparing pharmaceutical composition comprising antibody and acceptable carriers and/or excipients and/or stabilizers are well known to the skilled person that, without inventive skill, is capable to prepare a pharmaceutical composition according to the present invention.
(130) The antibody may be entrapped in drug delivery system, for example, liposomes, nanoparticles, albumine microspheres in order to induce the internalization by target cells resulting in therapeutic effective of the pharmaceutical composition.
(131) The pharmaceutical composition comprising said antibody according to the present invention may be administered in any suitable administration way including parental, enteral, namely intramuscular, subcutaneous, intravenous, intraarterial, topic, nasal, buccal, etc administration. Said composition will be formulated, dosed and administrated by the skilled person taking into account, for example, the target site to be reached, the clinical conditions of the patient to be treated.
(132) The invention also provides a method for the screening of a candidate compound that inhibits the invasive behaviour of a pre neoplastic or neoplastic lesion or cells thereof comprising the step of contacting the compound with a cell line or tissue culture expressing the hMena v6 isoform of hMena, wherein the reduction in the expression of said isoform or its displacement from Ena/VASP tetramers is indicative that the compound is a candidate compound for inhibiting the invasive behaviour of a pre neoplastic or neoplastic lesion or cells thereof.
(133) In other words, lack of reduction (or conversely the increase) in expression of hMena v6 isoform or its displacement in said lesion or cells, following contact with a compound, indicates that the compound is not a suitable candidate molecule for inhibiting the invasive behaviour of a pre neoplastic or neoplastic lesion or cells thereof.
(134) Since, hMena has been isolated as a tumor antigen able to induce an antibody response in neoplastic patients and not in healthy donors, the present invention also provides a method for the detection of antibodies specific for each hMena isoform from the sera of preneoplastic or neoplastic cancer patients. Presence of specific antibodies in the sera of patients may represent not only an early marker of cancerogenesis but also may help in the understanding the proliferative or invasive behaviour of the tumor, helping the clinicians in the correct choice of efficacious therapeutic treatment.
(135) The present invention is illustrated in the following experiments, which are set forth to aid in the understanding of the invention, and should not to be intended to limit in any way the scope of the invention herein described.
EXAMPLES
Example 1: Molecular Cloning and Characterization of hMenav6 Coding Sequence
(136) RT-PCR experiments on the breast cancer cell line MDA-MB-231 with two primers designed on the human Mena coding sequence and possessing the ATG and the stop codon respectively were performed. PCR products sequencing revealed that these cells express hMena (1713nt) and in addition, a not yet described transcript of 1602 nucleotides from the ATG to the stop codon. This sequence is identical to hMena, but lacks the internal exon 6 of 111 nucleotides, thus we named this splice variant hMena v6 (GenBank, Accession: 1030575), SEQ ID NO: 1.
(137) hMena v6 cDNA encodes a protein of 533aa (SEQ ID NO: 2) without an internal peptide of 37aa located between the LERER and the Proline-rich region of hMena (
(138) At protein level the Western analysis of hMena and hMena v6 in vitro translated proteins by the use of an anti-hMena antibody recognizing all the isoforms (pan-hMena) revealed that, as shown in
Example 2: hMena11a and hMena v6 are Alternatively Expressed and Correlate with an Epithelial and Mesenchymal Phenotype Respectively
(139) We then analyzed by RT-PCR experiments the expression of hMena, hMena11a and hMenav6 by two primers located in the exons 5 and 12 respectively (MTC1f; MTC4r) on a panel of breast cancer cell lines. Whereas hMena is always present, the two splice variants hMena11a and hMena v6 are mutually exclusive expressed (
(140) At protein level the characterization of hMena isoform expression lines with specific antibodies we produced demonstrate, in a large panel of cell, that hMena11a and hMena v6 correlate with an epithelial or mesenchymanl phenotype respectively (
(141) Glyoma and melanoma are highly invasive forms of neoplasia, and we tested the hMena isoforms expression in 6 melanoma and 3 glioma cell lines (T98G, U87MG, U373). Five out of six melanoma cell lines show hMena v6 expression in concomitance with N-Cadherin (ME10538 shows a very faint hMena v6 signal). The only melanoma cell line (1007) expressing E-Cadherin doesn't express hMena v6. All the glioma cell lines tested are positive for hMena v6 and negative for hMena11a as revealed by the use of anti-hMena11a antibody (
(142) Collectively, these results indicate that hMena11a expression identifies an epithelial cell phenotype. In line with these results, it has been recently reported that the epithelial specific regulators proteins (ESRPs) are able to induce the inclusion of 11a exon in hMena RNA transcripts of the hMena11a negative MDA-MB-231 cells (Warzecha C C, Sato T K, Nabet B, Hogenesch J B, Carstens R P. ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing. Mol Cell. 2009; 33:591-601).
Example 3: hMena11a Transfection Inhibits Matrigel Invasion of hMena11a Negative Breast Cancer Cells
(143) In order to understand whether the lack of hMena11a contributes to the invasive and migratory behaviour of hMena v6 expressing cells, we have transfected MDA-MB-231 cells with hMena11a. Matrigel invasion assays, demonstrate a very significant inhibition of invasion in MDA-MB-231-hMena11a transfected cells respect to the control (
(144) Immunofluorescence analysis (
Example 4: hMena/hMenav6 Knock Down Reduces and hMenav6 Transfection Increases the Cell Migration and Invasion of Breast Cancer Cell Lines hMena11a Negative
(145) At functional level we have previously shown that hMena11a overexpression and phosphorylation leads to increased p42/44 mitogen-activated protein kinase (MAPK) activation and cell proliferation as evidenced in hMena11a transfected breast cancer cell lines.
(146) The two basal breast cancer cell lines (MDA-MB-231, BT549) expressing hMenav6 and lacking hMena11a, show a stellate morphology and an invasive and migratory behaviour. To evaluate whether hMenav6 affect the migratory and invasive behaviour of the cells, we have knock-down hMena/hMenav6 expression by siRNA (SMART pool si-ENAH, Dharmacon) in MDA-MB-231 and BT549 cells for 72 h. Wound healing migration assay was performed on MDA-MB-231 cells during the last 24 hours of transfection and the results indicate that the knock-down of hMena/hMenav6 reduced the migration of MDA-MB-231 cells.
(147) The ability of invasion has been measured in the highly invasive BT549 transfected with hMena/hMenav6 siRNA. We have evaluated the ability of invasion during the last 24 h of transfection by the use of Matrigel coated transwell filters (BD Biosciences) toward a gradient of EGF or FBS. As shown in
(148) Since hMena/hMenav6 knock down inhibits cell migration and invasion of hMenav6 expressing cells we have transfected this isoform in the MDA-MB-231 cells as well as in the hMenav6 negative DAL and MCF7 cells. Results reported in
(149) This result, i.e. the alternative expression of said two splice variants, is confirmed by experiments wherein the transfection of hMenav6 in cancer cell lines negative for hMena11a induces an increase in the migratory and invasive behaviour of the cells. On the contrary, hMena11a exogenous expression induces an increase in the cell proliferative ability. Interestingly, over expression of hMena11a in cancer cells expressing hMenav6, induces a inhibition or a significant reduction of hMenav6 isoform expression as shown in
Experimental Section
(150) Cell Lines
(151) The following cell lines were purchased from the American Type Culture Collection (ATCC, Rockville, Md.): MDAMB468, MDAMB361, T47D, SKBr3, MCF7, BT474, MDA-MB-231 and BT549 (breast cancer), A549, AE2, H1299, Calu3 (lung cancer), T98G, U87MG and U373 (glioma). Other cell lines employed were: melanomas, 4405 and 1007 were developed in our laboratory from a primary melanoma lesion. DAL developed in our laboratory from the ascitic fluid of two breast cancer patients; normal human keratinocytes (NHK) and normal human fibroblasts (NHF) were kindly provided by Dr. A. Venuti (Regina Elena Cancer Institute, Rome, Italy) respectively; melanoma ME10538, VAS, 3046, 4405 and 1007 were kindly provided by Dr. A. Anichini (Istituto Tumori Milano, Italy).
(152) Cloning and Sequencing of hMena and hMena v6
(153) Two micrograms of total RNA extracted from the MDA-MB-231 cell line using Trizol reagent (Life Technologies Inc, Rockville, Md., USA) was used to obtain the relative cDNA by first strand cDNA synthesis kit (Amersham Pharmacia Biotech, Little Chalfont, UK). cDNA was amplified using Platinum Pfx DNA polymerase (Invitrogen) in PCR reactions consisting of 30 cycles at a denaturation temperature of 94 C. (30 sec/cycle), an annealing temperature of 55 C. (1 min/cycle) and an extension temperature of 68 C. (3 min/cycle). The primers utilized (Invitrogen) contained the ATG and stop-codon of hMena, P1-ATG (5-CACCATGAGTGAACAGAGTATC-3) SEQ ID NO: 11 and P8-stop (5-CTGTTCCTCTATGCAGTATTTGAC-3) SEQ ID NO: 12. PCR products were analyzed on a 1% agarose gel, excised from the gel and purified using a gel extraction kit (Qiagen, Crawley, UK). Samples were incubated with 1 unit of AmpliTaq polymerase and 1 l of 10 mM dATP (both, Applied Biosystems, Branchburg, N.J., USA) to add 3 adenines and then cloned by pcDNA3.1/V5-HIS TOPO TA Expression kit (Invitrogen). Plasmid DNA was isolated by Wizard Plus minipreps DNA purification system (Promega Corporation, Madison, Wis., USA) and sequenced initially by T7 and T3 primers. Once the initial sequences were obtained, additional primers were synthesized to sequence into the insert (P4-for 5-GAGCGACTGGAACAAGAACAGCTG-3 SEQ ID NO: 13; P5-for 5-GAGAG-CGCAGAATATCAAGTGCTG-3 SEQ ID NO: 14; P6-rev 5-GGCGATTGTCTT-CTGACATGG-3 SEQ ID NO: 15; P7-for 5-GAATTGCTGAAAAGGGATC-3 SEQ ID NO: 19; P7-rev 5-GATCCCTTTTCAGCAATTC-3 SEQ ID NO: 16). DNA sequencing was performed by the Nucleic Acid Facility Service (Istituto Dermopatico dell'Immacolata, Rome, Italy) with the use of an ABI PRISM 377-96 automated sequencer (Applied Biosystem).
(154) RT-PCR
(155) hMena splice variants were detected by RT-PCR using MTC1f (5-GCTGGAATGGGAGAGAGAGCGCAGAATATC-3 SEQ ID NO: 20) and MTC4r (GTCAAGTCCTTCCGTCTGGACTCCATTGGC-3 SEQ ID NO: 21) primers. PCR reactions consisted of 30 cycles at a denaturation temperature of 94 C. (30 sec/cycle), an annealing and an extension temperature of 68 C. (2 min/cycle). PCR products were analyzed on a 1% agarose gel electrophoresis and ethidium bromide staining.
(156) In Vitro Transcription-Coupled Translation
(157) The in vitro translation of the hMena and hMena v6 cDNA (inserted into the pcDNA3.1 vector) was examined in an in vitro transcription-coupled translation system following the manufacture's instruction (TNT, rabbit reticulocyte lysate system, Promega Corporation).
(158) Antibodies
(159) The rabbit polyclonal antibody specific for the hMena11a isoform was developed against an 18-aa peptide (RDSPRKNQIVFDNRSYDS, SEQ ID NO: 10) of the 11a sequence peculiar of this isoform by the use of Primm Service (Primm srl, Milan, Italy). To obtain antibodies specific for the hMenaDv6 isoform rabbits were immunized with a peptide coded by a region covering the 5 and 7 exon junction (SEQ ID NO: 3). The rabbit antiserum was then purified by two steps of affinity chromatography using peptides coded by the 5 and 6 exon junction or by the 6 and 7 exon junction (SEQ ID NOS: 4 and 5) in order to deplete the serum from the antibodies recognizing regions common to all the hMena isoforms. The specific IgGs were then purified using the immunogenic peptide (SEQ ID NO: 3) by affinity chromatography. The specificity of the antibodies obtained was evaluated by Western blot on MCF7 (hMena11a positive hMena v6 negative) and MDA-MB-231 (hMena11a negative, hMena v6 positive) cells (
(160) Western Blot Analysis
(161) Cells were lysed as reported. Lysates (30 g or 50 g) were resolved on 10% polyacrylamide gel and transferred to nitrocellulose membrane (Amersham Bioscience) as described. Blots were probed with the following antibodies: 10 g/ml of anti-hMena rabbit CKLK1 antibody; anti-hMena11a (0.5 g/ml) and anti-hMena v6 (0.6 g/ml); mouse anti-E-Cadherin from BD Biosciences; mouse anti-N-Cadherin from DakoCytomation (Glostrup, Denmark) in 3% skimmed milk/TBST overnight at 4 C. For actin signal, blots were reprobed with 1 g/ml monoclonal anti-actin, mouse-ascites Fluid clone AC-40 (Sigma Aldrich, Poole, UK).
(162) Western blot analysis was also performed on 5 l of in vitro translated hMena and hMena v6.
(163) Immunofluorescence Analysis
(164) Cells grown on glass coverslips to semiconfluence coated with 100 g/ml Rat Tail Collagen Type 1 (BD Biosciences San Jose, Calif., USA) were fixed in 4% paraformaldehyde (EMS, Fort Washington, Pa., USA) for 15 minutes, permeabilized with 0.2% Triton X-100 in PBS. Following incubation with 1% (w/v) bovine serum albumin (Sigma, St. Louis, Mo., USA) cells were incubated for 1 hour Phalloidin labelled with AlexaFluor 532 (Life Technologies/Invitrogen), washed with PBS and mounted with H-1200 Vectashield mounting medium containing 4,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories Inc., Burlingame, Calif., USA). The images are representative of two independent experiments done in duplicate.
(165) Transfections and Small-Interfering RNA Treatment
(166) Cells in exponential growth phase were plated in 6-well plates at a density of 3105 cells/well. After 24 h cells were transfected with 1.5 g/ml hMena+11a, hMena v6 cDNA or with vector alone (pcDNA3) or with 100 nmol/L hMena-specific pooled siRNA duplexes (siENA SMART pool) or control non-specific siRNA (Dharmacon, Lafayette, Colo.) using LipofectAMINE 2000 reagent (Invitrogen) according to the protocol of the manufacturer. Stable transfectants were obtained by selecting transfected cells with 500 g/ml of G418 (Invitrogen, Pisley, UK) in complete culture medium.
(167) Wound-Healing Assay
(168) Cells were seeded on 6-well plates and transfected with the indicated siRNA. Forty-eight hours after transfection the confluent cells were scratched with a pipette tip. In other cases cells were grown to confluence in 6-well plates and then scratched. Depending on the cell type, the cells were photographed after 24 h and 48 h using an inverted microscope. Each experiment was performed in triplicate and repeated at least three times. Cells were then lysate and analyzed in Western blot to ascertain the efficiency of the siRNA transfection.
(169) Cell Invasion Assay
(170) Forty-eight hours after siRNA transfection cells were counted and equal numbers were seeded to Matrigel invasion chamber (24 wells; BD Biocoat Matrigel invasion chamber, BD, Biosciences) in duplicate following the manufacturer's instruction. Cells were allowed to invade for 24 h and in some cases for 72 h, then were stained, photographed and counted. Each experiment was performed thrice.
(171) Statistical Analysis
(172) All experiments were repeated a minimum of three times. Data collected from invasion assays incorporation assay were expressed as meansSD. The data presented in some figures are from a representative experiment, which was qualitatively similar in the replicate experiments. Statistical significance was determined by Student's t test (two tailed) comparison between two groups of data sets. Asterisks indicate significant differences of experimental groups compared with the corresponding control condition (P<0.05, see figure legends). Statistical analysis was performed using GraphPad Prism 4, V4.03 software (GraphPad Inc., San Diego, Calif.).
(173) TABLE-US-00001 SEQUENCELISTING Splicevariantv6ofhMena (SEQIDNO:1) atgagtgaacagagtatctgtcaggcaagagctgctgtgatggtttatgatgatgccaataagaagtgg gtgccagctggtggctcaactggattcagcagagttcatatctatcaccatacaggcaacaacacattc agagtggtgggcaggaagattcaggaccatcaggtcgtgataaactgtgccattcctaaagggttgaag tacaatcaagctacacagaccttccaccagtggcgagatgctagacaggtgtatggtctcaactttggc agcaaagaggatgccaatgtcttcgcaagtgccatgatgcatgccttagaagtgttaaattcacaggaa acagggccaacattgcctagacaaaactcacaactacctgctcaagttcaaaatggcccatcccaagaa gaattggaaattcaaagaagacaactacaagaacagcaacggcaaaaggagctggagcgggaaagg ctggagcgagaaagaatggaaagagaaaggttggagagagagaggttagaaagggaaaggctg gagagggagcgactggaacaagaacagctggagagagagagacaagaacgggaacggcaggaa cgcctggagcggcaggaacgcctggagcggcaggaacgcctggagcggcaggaacgcctggat cgggagaggcaagaaagacaagaacgagagaggctggagagactggaacgggagaggcaagaa agggagcgacaagagcagttagaaagggaacagctggaatgggagagagagcgcagaatatcaagt gctggcattgtcttgggaccacttgcacctccacctcctccaccactcccaccagggcctgcacaggct tcagtagccctccctcctcccccagggccccctccacctcctccactcccatccaccgggcctccaccg ccccctcctccccctcctctccctaatcaagtaccccctcctcctccaccacctcctgccccacccctc cctgcatctggattctttttggcatccatgtcagaagacaatcgccctttaactggacttgcagctgcaatt gccggagcaaaacttaggaaagtgtcacggatggaggatacctctttcccaagtggagggaatgctatt ggtgtgaactccgcctcatctaaaacagatacaggccgtggaaatggaccccttcctttagggggtagt ggtttaatggaagaaatgagtgccctgctggccaggaggagaagaattgctgaaaagggatcaaca atagaaacagaacaaaaagaggacaaaggtgaagattcagagcctgtaacttctaaggcctcttca acaagtacacctgaaccaacaagaaaaccttgggaaagaacaaatacaatgaatggcagcaagtca cctgttatctccagaccaaaatccacacccttatcacagcccagtgccaatggagtccagacggaagga cttgactatgacaggctgaagcaggacattttagatgaaatgagaaaagaattaacaaagctaaaagaa gagctcattgatgcaatcaggcaggaactgagcaagtcaaatactgcatag Aminoacidsequenceofv6hMenaisoform (SEQIDNO:2) MetSerGluGlnSerIleCysGlnAlaArgAlaAlaValMetValTyrAspAspAlaAsn LysLysTrpValProAlaGlyGlySerThrGlyPheSerArgValHisIleTyrHisHis ThrGlyAsnAsnThrPheArgValValGlyArgLysIleGlnAspHisGlnValValIle AsnCysAlaIleProLysGlyLeuLysTyrAsnGlnAlaThrGlnThrPheHisGlnTrp ArgAspAlaArgGlnValTyrGlyLeuAsnPheGlySerLysGluAspAlaAsnVal PheAlaSerAlaMetMetHisAlaLeuGluValLeuAsnSerGlnGluThrGlyProThr LeuProArgGlnAsnSerGlnLeuProAlaGlnValGlnAsnGlyProSerGlnGluGlu LeuGluIleGlnArgArgGlnLeuGlnGluGlnGlnArgGlnLysGluLeuGluArgGlu ArgLeuGluArgGluArgMetGluArgGluArgLeuGluArgGluArgLeuGluArg GluArgLeuGluArgGluArgLeuGluGlnGluGlnLeuGluArgGluArgGlnGlu ArgGluArgGlnGluArgLeuGluArgGlnGluArgLeuGluArgGlnGluArgLeu GluArgGlnGluArgLeuAspArgGluArgGlnGluArgGlnGluArgGluArgLeu GluArgLeuGluArgGluArgGlnGluArgGluArgGlnGluGlnLeuGluArgGlu GlnLeuGluTrpGluArgGluArgArgIleSerSerAlaGlyIleValLeuGlyProLeu AlaProProProProProProLeuProProGlyProAlaGlnAlaSerValAlaLeuPro ProProProGlyProProProProProProLeuProSerThrGlyProProProProProPro ProProProLeuProAsnGlnValProProProProProProProProAlaProProLeu ProAlaSerGlyPhePheLeuAlaSerMetSerGluAspAsnArgProLeuThrGlyLeu AlaAlaAlaIleAlaGlyAlaLysLeuArgLysValSerArgMetGluAspThrSerPhe ProSerGlyGlyAsnAlaIleGlyValAsnSerAlaSerSerLysThrAspThrGlyArg GlyAsnGlyProLeuProLeuGlyGlySerGlyLeuMetGluGluMetSerAlaLeuLeu AlaArgArgArgArgIleAlaGluLysGlySerThrIleGluThrGluGlnLysGluAsp LysGlyGluAspSerGluProValThrSerLysAlaSerSerThrSerThrProGluPro ThrArgLysProTrpGluArgThrAsnThrMetAsnGlySerLysSerProValIleSer ArgProLysSerThrProLeuSerGlnProSerAlaAsnGlyValGlnThrGluGlyLeu AspTyrAspArgLeuLysGlnAspIleLeuAspGluMetArgLysGluLeuThrLys LeuLysGluGluLeuIleAspAlaIleArgGlnGluLeuSerLysSerAsnThrAla Immungenicpeptideusedtoobtainanti-deltav6antibody (SEQIDNO:3) GluArgArgIleSerSerAlaGlyIleValLeuGly Peptideusedinaffinitychromatographyforseparatingthev6specificantibody codedbythe5and6junction (SEQIDNO:4) GluTrpGluArgGluArgArgIleSerSerAlaAlaAla Peptideusedinaffinitychromatographyforseparatingthev6specificantibody codedbythe6and7junction (SEQIDNO:5) SerGlnGlnGlyIleValLeuGlyProLeuAlaProPro Nucleotidesequenceofsplicevariant11aofhMena (SEQIDNO:6) atgagtgaacagagtatctgtcaggcaagagctgctgtgatggtttatgatgatgccaataagaagtgg gtgccagctggtggctcaactggattcagcagagttcatatctatcaccatacaggcaacaacacattc agagtggtgggcaggaagattcaggaccatcaggtcgtgataaactgtgccattcctaaagggttgaag tacaatcaagctacacagaccttccaccagtggcgagatgctagacaggtgtatggtctcaactttggc agcaaagaggatgccaatgtcttcgcaagtgccatgatgcatgccttagaagtgttaaattcacaggaa acagggccaacattgcctagacaaaactcacaactacctgctcaagttcaaaatggcccatcccaagaa gaattggaaattcaaagaagacaactacaagaacagcaacggcaaaaggagctggagcgggaaagg ctggagcgagaaagaatggaaagagaaaggttggagagagagaggttagaaagggaaaggctg gagagggagcgactggaacaagaacagctggagagagagagacaagaacgggaacggcaggaa cgcctggagcggcaggaacgcctggagcggcaggaacgcctggagcggcaggaacgcctggat cgggagaggcaagaaagacaagaacgagagaggctggagagactggaacgggagaggcaagaa agggagcgacaagagcagttagaaagggaacagctggaatgggagagagagcgcagaatatcaagt gctgctgcccctgcctctgttgagactcctctaaactctgtgctgggagactcttctgcttctgagcca ggcttgcaggcagcctctcagccggccgagactccatcccaacagggcattgtcttgggaccactt gcacctccacctcctccaccactcccaccagggcctgcacaggcttcagtagccctccctcctccccca gggccccctccacctcctccactcccatccaccgggcctccaccgccccctcctccccctcctctccct aatcaagtaccccctcctcctccaccacctcctgccccacccctccctgcatctggattctttttggca tccatgtcagaagacaatcgccctttaactggacttgcagctgcaattgccggagcaaaacttaggaaa gtgtcacggatggaggatacctctttcccaagtggagggaatgctattggtgtgaactccgcctcatct aaaacagatacaggccgtggaaatggaccccttcctttagggggtagtggtttaatggaagaaatgagt gccctgctggccaggaggagaagaattgctgaaaagggatcaacaatagaaacagaacaaaaagag gacaaaggtgaagattcagagcctgtaacttctaaggcctcttcaacaagtacacctgaaccaacaaga aaaccttgggaaagaacaaatacaatgaatggcagcaagtcacctgttatctccagacgggattctcca aggaaaaatcagattgtttttgacaacaggtcctatgattcattacacagaccaaaatccacaccctta tcacagcccagtgccaatggagtccagacggaaggacttgactatgacaggctgaagcaggacatt ttagatgaaatgagaaaagaattaacaaagctaaaagaagagctcattgatgcaatcaggcaggaactg agcaagtcaaatactgcatag Aminoacidsequenceofisoform11aofhMena (SEQIDNO:7) MetSerGluGlnSerIleCysGlnAlaArgAlaAlaValMetValTyrAspAspAlaAsn LysLysTrpValProAlaGlyGlySerThrGlyPheSerArgValHisIleTyrHisHis ThrGlyAsnAsnThrPheArgValValGlyArgLysIleGlnAspHisGlnValValIle AsnCysAlaIleProLysGlyLeuLysTyrAsnGlnAlaThrGlnThrPheHisGlnTrp ArgAspAlaArgGlnValTyrGlyLeuAsnPheGlySerLysGluAspAlaAsnVal PheAlaSerAlaMetMetHisAlaLeuGluValLeuAsnSerGlnGluThrGlyProThr LeuProArgGlnAsnSerGlnLeuProAlaGlnValGlnAsnGlyProSerGlnGluGlu LeuGluIleGlnArgArgGlnLeuGlnGluGlnGlnArgGlnLysGluLeuGluArgGlu ArgLeuGluArgGluArgMetGluArgGluArgLeuGluArgGluArgLeuGluArg GluArgLeuGluArgGluArgLeuGluGlnGluGlnLeuGluArgGluArgGlnGlu ArgGluArgGlnGluArgLeuGluArgGlnGluArgLeuGluArgGlnGluArgLeu GluArgGlnGluArgLeuAspArgGluArgGlnGluArgGlnGluArgGluArgLeu GluArgLeuGluArgGluArgGlnGluArgGluArgGlnGluGlnLeuGluArgGlu GlnLeuGluTrpGluArgGluArgArgIleSerSerAlaAlaAlaProAlaSerValGlu ThrProLeuAsnSerValLeuGlyAspSerSerAlaSerGluProGlyLeuGlnAlaAla SerGlnProAlaGluThrProSerGlnGlnGlyIleValLeuGlyProLeuAlaProPro ProProProProLeuProProGlyProAlaGlnAlaSerValAlaLeuProProProPro GlyProProProProProProLeuProSerThrGlyProProProProProProProProPro LeuProAsnGlnValProProProProProProProProAlaProProLeuProAlaSer GlyPhePheLeuAlaSerMetSerGluAspAsnArgProLeuThrGlyLeuAlaAlaAla IleAlaGlyAlaLysLeuArgLysValSerArgMetGluAspThrSerPheProSerGly GlyAsnAlaIleGlyValAsnSerAlaSerSerLysThrAspThrGlyArgGlyAsnGly ProLeuProLeuGlyGlySerGlyLeuMetGluGluMetSerAlaLeuLeuAlaArgArg ArgArgIleAlaGluLysGlySerThrIleGluThrGluGlnLysGluAspLysGlyGlu AspSerGluProValThrSerLysAlaSerSerThrSerThrProGluProThrArgLys ProTrpGluArgThrAsnThrMetAsnGlySerLysSerProValIleSerArgArgAsp SerProArgLysAsnGlnIleValPheAspAsnArgSerTyrAspSerLeuHisArgPro LysSerThrProLeuSerGlnProSerAlaAsnGlyValGlnThrGluGlyLeuAspTyr AspArgLeuLysGlnAspIleLeuAspGluMetArgLysGluLeuThrLysLeuLys GluGluLeuIleAspAlaIleArgGlnGluLeuSerLysSerAsnThrAla Nucleotidesequencecodingforexon11aofthehMena11aisoform (SEQIDNO:8) acgggattctccaaggaaaaatcagattgtttttgacaacaggtcctatgattcattacacag Aminoacidsequencecodingforexon11aofthehMena11aisoform (SEQIDNO:9) ArgAspSerProArgLysAsnGlnIleValPheAspAsnArgSerTyrAspSerLeuHis Arg hMena11aimmunogenicpeptide (SEQIDNO:10) ArgAspSerProArgLysAsnGlnIleValPheAspArgSerTyrAspSer primerforwardP1-ATGforamplyfinghMena SEQIDNO:11 5-CACCATGAGTGAACAGAGTATC-3 primerreversP8-stopforamplyfinghMena SEQIDNO:12 5-CTGTTCCTCTATGCAGTATTTGAC-3 primerP4-forforsequencinghMena SEQIDNO:13 5-GAGCGACTGGAACAAGAACAGCTG-3 primerP5-forforsequencinghMena SEQIDNO:14 5-GAGAGCGCAGAATATCAAGTGCTG-3 primerP6-revforsequencinghMena SEQIDNO:15 5-GGCGATTGTCTTCTGACATGG-3 primerP7-revforsequencinghMena SEQIDNO:16 5-GATCCCTTTTCAGCAATTC-3 sensestrandsiRNAforhMenadeltav6 SEQIDNO:17 uaucaagugcuggcauuguuu antisensestrandsiRNAforhMenadelta6 SEQIDNO:18 acaaugccagcacuugauauu primerP7-forforsequencinghMena SEQIDNO:19 gaattgctgaaaagggatc
REFERENCES
(174) Bear J E et al. Antagonism between Ena/VASP proteins and actin filament capping regulates fibroblast motility. Cell. 2002 May 17; 109(4):509-21 Di Modugno F, Bronzi G, Scanlan M J, et al. Human Mena protein, a serex-defined antigen overexpressed in breast cancer eliciting both humoral and CD8+ T-cell immune response. Int J Cancer 2004; 109:909-18. Di Modugno F, Mottolese M, Di Benedetto A, et al. The cytoskeleton regulatory protein hmena (ENAH) is overexpressed in human benign breast lesions with high risk of transformation and human epidermal growth factor receptor-2-positive/hormonal receptor-negative tumors. Clin Cancer Res 2006; 12:1470-8. Di Modugno F et al. Molecular cloning of hMena (ENAH) and its splice variant hMena+11a: epidermal growth factor increases their expression and stimulates hMena+11a phosphorylation in breast cancer cell lines. Cancer Res 2007; 67:2657-65 Pino M S et al. hMena+11a isoform serves as a marker of epithelial phenotype and sensitivity to EGFR inhibition in human pancreatic cancer cell lines. Clin Cancer Res 2008; 14:4943-50 Gardina P J et al. Alternative splicing and differential gene expression in colon cancer detected by a whole genome exon array. BMC Genomics. 2006 Dec. 27; 7:325 Gertler F B et al. Mena, a relative of VASP and Drosophila Enabled, is implicated in the control of microfilament dynamics. Cell. 1996 Oct. 18; 87(2):227-39 Goswami S et al. Identification of invasion specific splice variants of the cytoskeletal protein Mena present in mammary tumor cells during invasion in vivo. Clin Exp Metastasis. 2009; 26:153-9. McCaffrey A P, Meuse L, Pham T T, Conklin D S, Hannon G J, Kay M A. RNA interference in adult mice. Nature. 2002 4; 418(6893):38-9. Krause M, et al. Ena/VASP proteins: regulators of the actin cytoskeleton and cell migration. Annu Rev Cell Dev Biol 2003; 19:541-64 Olson M F, Sahai E. The actin cytoskeleton in cancer cell motility. Clin Exp Metastasis. 2009; 26(4):273-87 Philippar U et al. A Mena invasion isoform potentiates EGF-induced carcinoma cell invasion and metastasis. Dev Cell. 2008; 15:813-28 Scott J A, et al. Mol Biol Cell 2006; 3:1085-95 Tani K et al. Abl interactor 1 promotes tyrosine 296 phosphorylation of mammalian enabled (Mena) by c-Abl kinase. J Biol Chem. 2003 Jun. 13; 278(24):21685-92 Urbanelli L et al. Characterization of human Enah gene. Biochim Biophys Acta 2006; 1759:99-107 Wang W, Goswami S, Lapidus K, et al. Identification and testing of a gene expression signature of invasive carcinoma cells within primary mammary tumors. Cancer Res 2004; 64:8585-94 2004 Wang G S, Cooper T A. Splicing in disease: disruption of the splicing code and the decoding machinery. Nat Rev Genet. 2007 October; 8(10):749-61. Warzecha C C et al. ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing. Mol Cell. 2009; 33:591-601