Method for producing L-lysine using microorganisms having ability to produce L-lysine

09938546 ยท 2018-04-10

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a modified polynucleotide encoding aspartate kinase (EC:2.7.2.4; hereinafter, referred to as LysC), transketolase (EC:2.2.1.1; hereinafter, referred to as Tkt) or pyruvate carboxylase (EC:6.4.1.1; hereinafter, referred to as Pyc), in which the initiation codon is substituted with ATG, a vector including the same, a microorganism transformed with the vector, and a method for producing L-lysine using the same.

Claims

1. A modified polynucleotide encoding aspartate kinase (LysC), transketolase (Tkt), or pyruvate carboxylase (Pyc), wherein an initiation codon of the polynucleotide is substituted with ATG, wherein the polynucleotide is derived from a microorganism of the genus Corynebacterium, and wherein the polynucleotide whose initiation codon is substituted with ATG comprises the nucleotide sequences of SEQ ID NOS:16, 17 or 18.

2. The modified polynucleotide according to claim 1, wherein the initiation codon of the polynucleotide encoding aspartate kinase (LysC) or pyruvate carboxylase (Pyc) prior to the substitution is GTG and the initiation codon of the polynucleotide encoding transketolase (Tkt) prior to substitution is TTG.

3. A lysine-producing microorganism of the genus Corynebacterium that has enhanced activity of an enzyme selected from a group consisting of aspartate kinase (LysC), transketolase (Tkt) and pyruvate carboxylase (Pyc) compared to endogenous activitv thereof, wherein the initiation codon of a polynucleotide encoding the enzyme is substituted with ATG, wherein the polynucleotide whose initiation codon is substituted with ATG comprises the nucleotide sequences of SEQ ID NOS:16, 17 or 18, and wherein the microorganism produces more lysine than an unmodified microorganism.

4. The lysine-producing microorganism according to claim 3, wherein the initiation codon of the polynucleotide encoding aspartate kinase (LysC) or pyruvate carboxylase (Pyc) prior to the substitution is GTG and the initiation codon of the polynucleotide encoding transketolase (Tkt) prior to the substitution is TTG.

5. The lysine-producing microorganism according to claim 3, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

6. A method for producing L-lysine, comprising the steps of culturing the microorganism of claim 3; and recovering L-lysine from the cultured microorganism or the culture broth.

7. A method for producing L-lysine, comprising the steps of culturing the microorganism of claim 4; and recovering L-lysine from the cultured microorganism or the culture broth.

8. A method for producing L-lysine, comprising the steps of culturing the microorganism of claim 5; and recovering L-lysine from the cultured microorganism or the culture broth.

9. The modified polynucleotide according to claim 1, wherein the polynucleotide whose initiation codon has been substituted with ATG encodes aspartate kinase (LysC) and comprises SEQ ID NO: 16.

10. The modified polynucleotide according to claim 1, wherein the polynucleotide whose initiation codon has been substituted with ATG encodes transketolase (Tkt) and comprises SEQ ID NO: 17.

11. The modified polynucleotide according to claim 1, wherein the polynucleotide whose initiation codon has been substituted with ATG encodes pyruvate carboxylase (Pyc) and comprises SEQ ID NO: 18.

12. The lysine-producing microorganism according to claim 3, wherein the polynucleotide whose initiation codon has been substituted with ATG encodes aspartate kinase (LysC) and comprises SEQ ID NO: 16.

13. The lysine-producing microorganism according to claim 3, wherein the polynucleotide whose initiation codon has been substituted with ATG encodes transketolase (Tkt) and comprises SEQ ID NO: 17.

14. The lysine-producing microorganism according to claim 3, wherein the polynucleotide whose initiation codon has been substituted with ATG encodes pyruvate carboxylase (Pyc) and comprises SEQ ID NO: 18.

Description

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

(1) In one aspect, the present invention provides a modified polynucleotide encoding aspartate kinase (EC:2.7.2.4; hereinafter, referred to as LysC), transketolase (EC:2.2.1.1; hereinafter, referred to as Tkt) or pyruvate carboxylase (EC:6.4.1.1; hereinafter, referred to as Pyc), in which the initiation codon of the polynucleotide is substituted with ATG.

(2) Each polynucleotide encoding aspartate kinase, transketolase or pyruvate carboxylase may also include a partial substitution, deletion, insertion or addition in the polynucleotide, as long as each of them has the enzymatic activity, and may have 70% or more homology, specifically 80% or more homology, more specifically 90% or more homology, and much more specifically 95% or more homology, and most specifically 100% homology based on the known polynucleotide.

(3) As used herein, the term homology (homologous) means the degree of similarity between nucleotide sequences of lysC gene, tkt gene or pyc gene of the wild-type and nucleotide sequences of the corresponding modified genes thereof, that is, modified lysC gene, tkt gene or pyc gene, in which a part of the polynucleotides is substituted, deleted, inserted or added.

(4) As used herein, the term initiation codon means 3 nucleotides corresponding to a translation start point when a coding sequence of mRNA (messenger RNA) is translated into a protein. In general, initiation codons found in the chromosome of microorganisms are ATG (AUG on mRNA), GTG (GUG on mRNA) and TTG (UUG on mRNA), and they exist in a ratio of 62.5%?66.5%, 23.1%?24.3% and 10.3%?13.2% according to the analysis result of the entire genome sequence of Corynebacterium glutamicum (reference: Handbook of Corynebacterium glutamicum, 40 p, Lothar Eggeling & Michael Bott, 2005).

(5) Among the lysine biosynthesis genes derived from Corynebacterium reported until now, lysC and pyc have the initiation codon of GTG, and tkt has the initiation codon of TTG. The initiation codon of these genes is not ATG, which is regarded as a unique characteristic of Corynebacterium.

(6) The modified polynucleotide according to the present invention is characterized in that the initiation codon of the lysC, tkt or pyc gene is substituted with ATG, and these modified polynucleotides having such substituted initiation codon have been first modified by the present inventors. In more detail, GTG initiation codon of the polynucleotide encoding aspartate kinase (LysC) or pyruvate carboxylase (Pyc) is substituted with ATG, and TTG initiation codon of the polynucleotide encoding transketolase (Tkt) is substituted with ATG in the present invention. More specifically, the sequences of lysC, tkt, and pyc genes are SEQ ID NOs. 13, 14, and 15, respectively, the sequences of the genes having the substituted initiation codon as ATG are represented by SEQ ID NOs. 16, 17, and 18, respectively.

(7) The base substitutions of the initiation codons may be performed by any method known in the art, for example, site-specific mutagenesis, homologous recombination, but is not limited thereto.

(8) In another aspect, the present invention provides a vector comprising one or more modified polynucleotides of the modified polynucleotides encoding aspartate kinase, transketolase or pyruvate carboxylase, in which the initiation codon of the polynucleotide is substituted with ATG.

(9) The modified polynucleotides having the substituted initiation codon as ATG and encoding aspartate kinase, transketolase or pyruvate carboxylase, which is comprised in the vector of the present invention, may include those in which a part of the polynucleotides is substituted, deleted, inserted or added, as long as they have enzymatic activity, and may have 70% or more homology, specifically 80% or more homology, more specifically 90% or more homology, much more specifically 95% or more homology, and most specifically 100% homology.

(10) Further, the modified polynucleotides having the substituted initiation codon as ATG and encoding aspartate kinase, transketolase or pyruvate carboxylase, which is comprised in the vector of the present invention, may also include only a part of the gene encoding aspartate kinase, transketolase or pyruvate carboxylase, as long as they have the substituted initiation codon as ATG.

(11) As used herein, the term vector refers to a DNA construct that contains a base sequence which is operably linked to a suitable control sequence, to expresses a target gene in a suitable host. The control sequences may include a promoter to initiate transcription, a certain operator sequence to control such transcription, a sequence encoding a suitable ribosome-binding site on the mRNA, and a sequence to control termination of transcription and translation. The vector used in the present invention is not particularly limited, and may be any vector known in the art, as long as it is replicable in the host. For example, the vector may be a plasmid, a phage particle, or a potential genome insert, and is specifically pDZ (Korean Patent No. 10-0924065), but is not limited thereto. Once transformed into a suitable host, the vector may be replicated or function independently of the host genome, or may be integrated into the genome itself.

(12) Specifically, a nucleotide sequence (SEQ ID NO. 13, 14 or 15) comprising the initiation codon of the lysC, tkt or pyc gene was acquired, and based on this sequence, primers having the substituted initiation codon as ATG were synthesized. PCR was carried out using the primers and a chromosomal DNA of an L-lysine-producing strain as a template, so as to obtain DNA of which one end is substituted with ATG. This DNA fragment thus obtained was cloned into a vector to obtain a final recombinant vector. More specifically, in the present invention, pDZ-lysC(ATG), pDZ-tkt (ATG) and pDZ-pyc(ATG) vectors were constructed, respectively.

(13) In still another aspect, the present invention provides a microorganism which includes one or more modified polynucleotides having the substituted initiation codon as ATG and encoding an enzymes selected from the group consisting of aspartate kinase, transketolase and pyruvate carboxylase, and then improved in translation levels of mRNAs transcribed from the polynucleotides into proteins, resulting in enhanced activities of one or more of the enzymes compared to endogenous activities thereof. The microorganism of the present invention may have enhanced activities of aspartate kinase, transketolase or pyruvate carboxylase by using the modified polynucleotides in combinations of one, two, or three thereof, in which the modified polynucleotides encode the corresponding enzymes and are substituted with ATG on initiation codon.

(14) In order to substitute ATG for the initiation codons of the target genes on the chromosome of the microorganism, various methods known in the art can be used. For example, the initiation codon sequences of endogenous lysC, tkt and pyc genes in the microorganism can be substituted on the chromosome. Alternatively, the corresponding genes having substituted initiation codon sequences can be introduced into the microorganism in the form of a plasmid.

(15) The microorganism may be any strain, as long as it has L-Iysine productivity. Specifically it may be a microorganisms of Corynebacterium sp. or Brevibacterium sp. Examples of the microorganisms of Corynebacterium sp. or Brevibacterium sp. include Corynebacterium glutamicum ATCC13032, Corynebacterium thermoaminogenes FERM BP-1539, Brevibacterium flavum ATCC 14067, Brevibacterium lactofermentum ATCC 13869. Further, L-lysine-producing variants or stains derived therefrom, for example, Corynebacterium glutamicum KCCM11016P (this microorganism was disclosed as KFCC10881, and re-deposited to an International Depositary Authority under the Budapest Treaty with Accession No. KCCM11016P, Korean Patent No. 10-0159812, Korean Patent No. 10-0397322) and Corynebacterium glutamicum KFCC 11001, may be included. Further more may be Corynebacterium glutamicum with Accession No. KCCM11016P.

(16) Specifically, Corynebacterium glutamicum with Accession No. KCCM11016P was transformed with a vector comprising the polynucleotide encoding aspartate kinase, transketolase or pyruvate carboxylase wherein the initiation codon is substituted with ATG, to obtain recombinant Corynebacterium glutamicum. More Specifically, pDZ-lysC(ATG) , pDZ-tkt(ATG) or pDZ-pyc(ATG) vector was introduced into Corynebacterium glutamicum with Accession No. KCCM11016P, respectively so as to obtain each recombinant Corynebacterium glutamicum.

(17) Further, the microorganism can be transformed with a vector comprising two or more polynucleotides of the polynucleotides encoding aspartate kinase, transketolase or pyruvate carboxylase and having the substituted initiation codon as ATG. Specifically, the pDZ-tkt(ATG) vector comprising the gene of which the initiation codon has been substituted with ATG and encodes transketolase is transformed into Corynebacterium glutamicum KCCM11016P-lysC, in which GTG initiation codon of lysC is substituted with ATG, and through second crossover, the initiation codons of lysC and tkt on the chromosome are substituted with ATG so as to obtain Corynebacterium glutamicum KCCM11016P-lysC-tkt. Further, the pDZ-pyc(ATG) vector comprising the polynucleotide of which the initiation codon has been substituted with ATG and encodes pyruvate carboxylase is transformed into KCCM11016P-lysC, in which GTG initiation codon of lysC is substituted with ATG, and through second crossover, the initiation codons of lysC and pyc on the chromosome are substituted with ATG so as to obtain KCCM11016P-lysC-pyc. Furthermore, the pDZ-tkt(ATG) vector is transformed into KCCM11016P-lysC-pyc as prepared above, in which GTG initiation codon of lysC and pyc is substituted with ATG, and through second crossover, the initiation codons of lysC, pyc and tkt on the chromosome are substituted with ATG so as to obtain KCCM11016P-lysC-pyc-tkt. It was confirmed that the initiation codons of lysC, pyc and tkt can be also substituted with ATG in another lysine-producing strains belonging to Corynebacterium glutamicum, KFCC10750 (this microorganism was disclosed as KFCC10750, and re-deposited to an International Depositary Authority under the Budapest Treaty with Accession No. KCCM11347P, Korean Patent No. 10-0073610), KCCM10770P (Korean Patent No. 10-0924065), CJ3P (Genome Biology 2012, 13:R40) in the same manner. These results suggest that the modified introduced into various strains belonging to Corynebacterium sp., thereby increasing L-lysine productivity.

(18) Specifically, the transformant KCCM11016P-lysC-pyc-tkt, which was obtained by introducing pDZ-lysC(ATG), pDZ-tkt(ATG) and pDZ-pyc(ATG) vectors including the polynucleotides encoding aspartate kinase, transketolase and pyruvate carboxylase into Corynebacterium glutamicum KCCM11016P, was designated as Corynebacterium glutamicum CA01-2059, and deposited on May 2, 2011 at the Korean Culture Center of Microorganisms (hereinafter, abbreviated to KCCM), which is an International Depositary Authority under the Budapest Treaty, under Accession No. KCCM11188P. It is deposited by an International Depositary Authority under the Budapest Treaty.

(19) The microorganism according to the present invention is characterized in that the initiation codons of the wild-type genes encoding the above enzymes are substituted with ATG, and therefore, the microorganism has enhanced activities of aspartate kinase, transketolase and pyruvate carboxylase compared to endogenous activities thereof, resulting from remarkable improvement in translation levels of mRNAs transcribed from the lysC, tkt and pyc genes into the proteins.

(20) As used herein, the term endogenous activity means the activity of an enzyme in a native microorganism, and for example, the activity of aspartate kinase, transketolase or pyruvate carboxylase in a native microorganism belonging to Corynebacterium sp. The term enhanced endogenous activity means that the activity is further improved compared to that of the native enzyme.

(21) Specifically, when the aspartate kinase activity of the strain in which the initiation codon of lysC gene was substituted with ATG was compared to that of the parent strain KCCM11016P, 2.73-fold increase in the aspartate kinase activity was observed (Table 4). Further, when the transketolase activity of the strain in which the initiation codon of tkt gene was substituted with ATG was compared to that of the parent strain KCCM11016P, 3.5-fold increase in the transketolase activity was observed (Table 5). Furthermore, when the pyruvate carboxylase activity of the strain in which the initiation codon of pyc gene is substituted with ATG was compared to that of the parent strain KCCM11016P, 1.89-fold increase in the pyruvate carboxylase activity was observed (Table 6).

(22) It was found that L-lysine productivity of the microorganism can be increased by improving the activity of aspartate kinase, transketolase, pyruvate carboxylase or a combination thereof.

(23) In the present invention, the amounts of L-lysine produced in the L-lysine-producing strains, Corynebacterium glutamicum KCCM11016P-lysC, KCCM11016P-tkt, KCCM11016P-pyc, KCCM11016P-lysC-tkt, KCCM11016P-lysC-pyc, and KCCM11016P-lysC-pyc-tkt were measured, and as a result, they showed a remarkable improvement in the L-lysine production compared to the parent strain KCCM11016P (Table 7). Also, another lysine-producing strains belonging to Corynebacterium glutamicum, KFCC10750 (Korean Patent No. 10-0073610), KCCM10770P (Korean Patent No. 10-0924065), and CJ3P (Genome Biology 2012, 13:R40), in which initiation codons of lysC, pyc and tkt were substituted with ATG, showed a remarkable improvement in the L-lysine production compared to the parent strain (Tables 8?10). These results suggest that microorganisms having one type of modified polynucleotides encoding LysC, Tkt, or Pyc, or having two types of the modified polynucleotides encoding the enzymes, or having three types of modified polynucleotides encoding the enzymes and having the substituted initiation codon as ATG on the chromosome, also showed remarkably improved L-lysine productivity compared to the wild-type microorganism having GTG or TTG initiation codon.

(24) In still another aspect, the present invention provides a method for producing L-lysine, comprising the steps of culturing the microorganism as described above; and recovering L-lysine from the cultured microorganism or the culture broth.

(25) For the cultivation, various methods of producing L-lysine using a microorganism which are widely known in the art can be used. The cultivation can be carried out according to the widely known method, and conditions for the cultivation, including temperature, time, pH of medium, etc. may be controlled properly. A detailed description of the cultivation is given in the following document [Chmiel; Bioprozesstechnik 1. Einfuhrung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991), and Storhas; Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)]. Further, the cultivation may include batch culture, continuous culture, and fed-batch culture. Specifically, a batch, fed batch or repeated fed batch process may be operated in a continuous manner, but the present, invention is not limited thereto.

(26) For use in the cultivation, a medium must satisfy the requirement of a particular strain employed. Culture media for microorganisms belonging to Corynebacterium sp. are well known (e.g., Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981). Carbon sources to be used may include saccharides and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose; oils and lipids such as soybean oil, sunflower seed oil, castor oil and coconut oil; fatty acids such as palmitic acid, stearic acid, linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used separately or in combination. Nitrogen sources to be used may include peptone, yeast extract, meat broth, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. These nitrogen sources may be used separately or in combination. Phosphorus sources to be used may include dipotassium hydrogen phosphate, potassium dihydrogen phosphate, and corresponding sodium salts. In addition, culture media may contain metal salts such as magnesium sulfate or iron sulfate essential for the growth. Lastly, essential nutrients such as amino acids and vitamins may be used in addition to the above substances. In addition, proper precursors may be added into the culture media. These materials may be properly added into the culture during cultivations in a batch or continuous mode.

(27) The pH of the culture media may be adjusted with a basic compound such as sodium hydroxide, potassium hydroxide or ammonia, or an acidic compound such as phosphoric acid or sulfuric acid. The generation of foam may be restrained using an anti-foaming agent such as fatty acid polyglycol ester. The culture media may be kept under aerobic conditions by introducing oxygen or an oxygen-containing gas (e.g., air) thereto. The culture temperature is typically between 20 and 45? C. and specifically between 25 and 40? C. The culturing is continued until a maximal amount of L-lysine is produced. In this regard, it may be accomplished within 10 to 160 hrs. After being produced, L-lysine may be exported into the culture media or may remain within the cells.

(28) Further, the method for producing L-lysine of the present invention comprises the step of recovering L-lysine from the cultured microorganism or the culture broth. The method of recovering L-lysine from the microorganism or the culture broth is widely known in the art. Examples of the L-lysine recovering method may include filtration, anion exchange chromatography, crystallization and HPLC, but are not limited thereto.

EXAMPLES

(29) Hereinafter, the present invention will be described in more detail with reference to Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.

(30) In the Examples, recombinant vectors for substituting ATG for GTG or TTG initiation codon of lysC gene encoding aspartate kinase, tkt gene encoding transketolase, and pyc gene encoding pyruvate carboxylase derived from the lysine-producing strain, Corynebacterium glutamicum KCCM11016P, were constructed. The vector was transformed into Corynebacterium glutamicum KCCM11016P strain to obtain a strain having the substituted initiation codon on the chromosome, thereby preparing a strain having improved lysine productivity.

(31) Corynebacterium glutamicum KCCM11016P strain used in the present invention is a strain which is resistant to S-(2-aminoethyl) cysteine (hereinafter, referred to as AEC) and is homoserine-leaky, prepared by artificial mutation using wild-type Corynebacterium glutamicum (ATCC 13032) as a parent strain (disclosed as KFCC10881. See Korean Patent No. 10-0159812 and Korean Patent No. 10-0397322). Further, KFCC10750 strain is a Corynebacterium glutamicum L-lysine-producing strain which is homoserine auxotroph and resistant to an L-leucine analog, 4-azaleucine and an antibiotic rifampicin, prepared by artificial mutation (Korean Patent No. 10-0073610), KCCM10770P strain is an L-lysine-producing strain derived from KCCM11016P, which retains two copies of 6 types of the genes constituting the lysine biosynthesis pathway on the chromosome (Korean Patent No. 10-0924065), and CJ3P strain is a Corynebacterium glutamicum strain which has L-lysine productivity by introducing each of P458S, V59A, and T311I mutations into three types of pyc, hom, and lysC genes of the wild type, based on the description by Binder et al. (Genome Biology 2012, 13:R40).

Example 1

Construction of Recombinant Vector (pDZ-lysC(ATG)) having Substituted ATG Initiation codon in lysC Derived from Corynebacterium glutamicum and Preparation of Strain having Substituted Initiation codon

(32) pDZ (see Korean Patent No. 10-0924065) was used as a basic vector for the recombinant vector, which was constructed as follows.

(33) (1) Construction of pDZ-lysC (ATG) Recombinant Vector

(34) In order to acquire lysC gene derived from Corynebacterium glutamicum, chromosomal DNA of a lysine-producing strain (Corynebacterium glutamicum KCCM11016P) prepared by artificial mutation was used as a template. Based on the genbank at the U.S. National Institutes of Health (NIH GenBank), a nucleotide sequence (SEQ ID NO. 13) containing the initiation codon region of lysC gene (NCBI Accession No. NC_003450, Ncg10247) was acquired, and based on this sequence, two pairs of primers (Table 1, SEQ ID NOs. 1?4) for substituting the initiation codon GTG with ATG were synthesized.

(35) PCR was carried out using chromosomal DNA of KCCM11016P as a template and primers of the following Table 1. PfuUltra? High-Fidelity DNA polymerase (Stratagene) was used as a polymerase, and PCR was performed with 30 cycles of denaturation at 96? C. for 30 seconds; annealing at 55? C. for 30 seconds; and polymerization at 72? C. for 30 seconds. Two DNA fragments thus obtained were cloned into pDZ vector treated with restriction enzyme XbaI using an In-Fusion PCR cloning kit (Clontech), and finally, a pDZ-lysC(ATG) recombinant vector was constructed.

(36) (2) Preparation of Strain

(37) The pDZ-lysC(ATG) vector thus constructed was transformed into KCCM11016P by an electric pulse method (by use of the transformation method according to Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then strains, in which the gene was inserted into the chromosome by homologous recombination, were selected on a selection medium containing 25 mg/L of kanamycin. The successful chromosomal insertion of the vector was confirmed by the blue color of the colonies on a solid medium containing X-gal (5-bromo-4-chloro-3-indolyl-(?-D-galactoside). The strain with the first chromosomal insertion was shaking-cultured (30? C., 8 hours) in a nutrient medium. Then, the cultured strain was serially diluted from 10.sup.?4 to 10.sup.?10, and the diluted culture was plated on a solid medium containing X-gal. Most colonies exhibited blue color, whereas white colonies also existed at a low level. By selecting the white colonies, strains in which the nucleotide sequence at the initiation codon region of lysC was substituted via a second crossover were selected. The nucleotide substitution of the initiation codon in the selected strain was finally confirmed by PCR using the primers of SEQ ID NOs. 1 and 4 and then by analyzing the nucleotide sequence of the target site.

(38) TABLE-US-00001 TABLE1 SEQ ID Primer Nucleotidesequence NO. lysC/ATG/ CCGGGGATCCTCTAGActtagggagccatcttttgg 1 FX lysC/ATG/ CCAGGGCCATCTTTGTGC 2 R lysC/ATG/ GCACAAAGATGGCCCTGG 3 F lysC/ATG/ GCAGGTCGACTCTAGAAGTGACATCAACAATGCGTG 4 RX

Example 2

Construction of Recombinant Vector (pDZ-tkt(ATG) ) having Substituted ATG Initiation Codon in tkt Derived grom Corynebacterium glutamicum and Preparation of Strain having Substituted Initiation codon

(39) There are two codons which are expected as an initiation codon on the sequence of tkt gene. Based on the distance from RBS (Ribosomal binding site) and proteomics, the downstream codon was determined as the initiation codon in the present invention.

(40) (1) Construction of pDZ-tkt(ATG) Recombinant Vector

(41) In order to acquire tkt gene derived from Corynebacterium glutamicum, chromosomal DNA of KCCM11016P was used as a template. Based on the genbank at the U.S. National Institutes of Health (NIH GenBank), a nucleotide sequence (SEQ ID NO. 14) containing the initiation codon region of tkt gene (NCBI Accession No. NC_003450, Ncg11512) was acquired, and based on this sequence, two pairs of primers (Table 2, SEQ ID NOs. 5?8) for substituting the initiation codon TTG with ATG were synthesized.

(42) PCR was carried out using chromosomal DNA of KCCM11016P as a template and primers of the following Table 2 under the conditions of Example 1-1. Two DNA fragments thus obtained were cloned into pDZ vector treated with restriction enzyme XbaI using an In-Fusion PCR cloning kit (Clontech), and finally, a pDZ-tkt(ATG) recombinant vector was constructed.

(43) (2) Preparation of Strain

(44) The pDZ-tkt(ATG) vector thus constructed was transformed into the lysine-producing strain KCCM11016P in the same manner as in Example 1-2, and KCCM11016P-tkt, in which the initiation codon of tkt on the chromosome was substituted with ATG via a second crossover, was obtained. The nucleotide substitution of the initiation codon of the gene was finally confirmed by PCR using the primers of SEQ ID NOs. 5 and 8 and then by analyzing the nucleotide sequence of the target site.

(45) TABLE-US-00002 TABLE2 SEQ ID Primer Nucleotidesequence NO. tkt/ATG/ CCGGGGATCCTCTAGAGAAATAGAT 5 FX GGGTGTAGACG tkt/ATG/ GTGACAGCGTCATGGTGGTCAAT 6 R4 tkt/ATG/ ATTGACCACCATGACGCTGTCAC 7 F4 tkt/ATG/ GCAGGTCGACTCTAGACGCAGAGCC 8 RX TTCAGGTCATC

Example 2

Construction of Recombinant Vector (pDZ-pyc(ATG)) having Substituted ATG Initiation codon in pyc Derived From Corynebacterium Glutamicum and Preparation of Strain having Substituted Initiation codon

(46) (1) Construction of pDZ-pyc(ATG) Recombinant Vector

(47) In order to acquire pyc gene derived from Corynebacterium glutamicum, chromosomal DNA of KCCM11016P was used as a template. Based, on the genbank at the U.S. National Institutes of Health (NTH GenBank), a nucleotide sequence (SEQ ID NO. 15) containing the initiation codon region of pyc gene (NCBI Accession No. NC_003450, Ncg10659) was acquired, and based on this sequence, two pairs of primers (Table 3, SEQ ID NOs. 9?12) for substituting the initiation codon GTG with ATG were synthesized.

(48) PCR was carried, out using chromosomal DNA of KCCM11016P as a template and primers of the following Table 3 under the conditions of Example 1-1. Two DNA fragments thus obtained were cloned into pDZ vector treated with restriction enzyme XbaI using an In-Fusion PCR cloning kit (Clontech), and finally, a pDZ-pyc(ATG)recombinant vector was constructed.

(49) (2) Preparation of Strain

(50) The pDZ-pyc(ATG) vector thus constructed was transformed into the lysine-producing strain KCCM11016P in the same manner as in Example 1-2, and KCCM11016P-pyc, in. which the initiation codon of pyc on the chromosome was substituted with ATG via a second crossover, was obtained. The nucleotide substitution of the initiation codon of the gene was finally confirmed by PCR using the primers of SEQ ID NOs. 9 and 12 and then by analyzing the nucleotide sequence of the target site.

(51) TABLE-US-00003 TABLE3 SEQ ID Primer Nucleotidesequence NO. pyc/ATG/ CCGGGGATCCTCTAGATTTTGGGGAAAA 9 FX GTGCAAAG pyc/ATG/ GAGTCGACAtTAGAGTAAT 10 R pyc/ATG/ ATTACTCTAaTGTCGACTC 11 F pyc/ATG/ GCAGGTCGACTCTAGAGGGCATTTTCAGACAGGAAG 12 RX

Example 4

Measurement of Enzymatic Activity of aspartate kinase in Strain having Substituted ATG Initiation codon in lysC gene

(52) The cells in the exponential phase were collected by centrifugation (5,000 rpm, 15 minutes) and washed three times with 0.1% Tris.KCl (pH 8.0) buffer, and then suspended in the same buffer for a turbidity at 610 nm of 160. The cells were disrupted for 6 minutes using a bead beater after glass beads added at 1.25 g/1.5 ml of the suspension. The supernatant was collected by centrifugation (15,000 rpm, 20 minutes), and quantitatively measured for protein content by a Bradford method (Bradford, M. M 1976. Anal. Biochem. 72:248-254) and used as a crude protein solution for measuring the enzymatic activity of aspartate kinase (LysC). In order to quantify the enzymatic activity of LysC, about 0.05 mL of the crude protein solution was added to a reaction solution containing 0.1 M Tris.HCl (pH 8.0), 0.01 M magnesium chloride (MgCl.sub.2), 0.6 M hydroxylamine.HCl (pH 7.0), 4 mM ATP, and 0.2 M aspartate to initiate the reaction. The mixture was allowed to react at 30? C. for 30 minutes, and a stop solution (10% FeCl.sub.2, 3.3% TCA, 0.7 N HCl) was added to terminate the reaction. The supernatant was collected by centrifugation, and absorbance at 540 nm was measured. The unit (U) of the LysC enzymatic activity was defined as nmole of the aspartate hydroxamate produced by 1 mg of protein for 1 minute.

(53) KCCM11016P-lysC strain was observed to have 2.73-fold higher LysC activity than that of the parent strain KCCM11016P (Table 4).

(54) TABLE-US-00004 TABLE 4 LysC enzymatic activity Enzymatic activity (Fold) Strain LysC KCCM11016P 1.00 KCCM11016P-lysC 2.73

Example 5

Measurement of Enzymatic Activity of transketolase in Strain having Substituted ATG Initiation codon in tkt gene

(55) The cells in the exponential phase were collected by centrifugation (5,000 rpm, 15 minutes) and washed three times with 0.1% Tris.KCl (pH 7.5) buffer, and then suspended in the same buffer for a turbidity at 610 nm of 160. The cells were disrupted for 6 minutes using a bead beater after glass beads added at 1.25 g/1.5 ml of the suspension. The supernatant was collected by centrifugation (15,000 rpm, 20 minutes), and quantitatively measured for protein content by a Bradford method and used as a crude protein solution for measuring the enzymatic activity of transketolase (Tkt). In order to quantify the enzymatic activity of Tkt, the crude protein solution was added to a reaction solution containing 0.1 M Tris.HCl (pH 7.5), 10 mM D-R5P, 2 mM D-Xu5P, 10 ?M ThDP, 1.2 mM MgCl.sub.2, 100 ?M NADH, 1 unit triosephosphate isomerase, 1 unit glycerol-3-phosphate dehydrogenase per 1 ml to initiate the reaction. The mixture was allowed to react at 30? C. for 20?30 minutes, and absorbance at 340 nm was measured. The unit (U) of the Tkt enzymatic activity was defined as the amount (mg) of the enzyme catalyzing production of 1 ?mol of glyceraldehyde 3-phosphate for 1 minute, and specific activity was defined as units/mg (Biochem. J. (2004) 382, 759-767).

(56) KCCM11016P-tkt strain was observed to have 3.5-fold higher Tkt activity than that of the parent strain KCCM11016P (Table 5).

(57) TABLE-US-00005 TABLE 5 Tkt enzymatic activity Enzymatic activity (Fold) Strain Tkt KCCM11016P 1.00 KCCM11016P-tkt 3.5

Example 6

Measurement of Enzymatic Activity of pyruvate carboxylase in Strain having Substituted ATG Initiation codon in pyc gene

(58) The cells in the exponential phase were collected by centrifugation (5,000 rpm, 15 minutes) and washed twice with 50 mM Tris.HCl (pH 6.3) buffer containing 50 mM sodium chloride (NaCl), and then suspended in 100 mM HEPES (pH 7.5) buffer containing 20% glycerol, CTAB was added to the suspension to a concentration of 0.3%, and left on ice for 1 minute. The cells were collected by centrifugation (5,000 rpm, 10 minutes) and then suspended in 100 mM Tris.HCl (pH 7.3) buffer. The protein content was quantitatively measured by a Bradford method and used as a crude protein solution for measuring the enzymatic activity of pyruvate carboxylase (Pyc). In order to quantify the enzymatic activity of Pyc, the crude protein solution was added to a reaction solution containing 25 mM NaHCO.sub.3, 5 mM MgCl.sub.2, 3 mM pyruvate, and 4 mM ATP to initiate the reaction. The mixture was allowed to react at 30? C. for 1.5 minutes, and 80 ?l of a stop solution (30% o-phosphoric acid) was added to terminate the reaction. The supernatant was collected by centrifugation (12,000 rpm, 15 min, 4? C.) . 50 ?l of the supernatant, 150 mM Tris.HCl (pH 7.8), 150 ?M NADH, and 2.5 U lactate dehydrogenase were added per 1 ml and absorbance at 340 nm was measured at 37? C. The unit (U) of the Pyc enzymatic activity was defined as nmole of the lactate produced by 1 mg of protein for 1 minute.

(59) KCCM11016P-pyc strain was observed to have 1.89-fold higher Pyc activity than that of the parent strain KCCM11016P (Table 6).

(60) TABLE-US-00006 TABLE 6 Pyc enzymatic activity Enzymatic activity (Fold) Strain Pyc KCCM11016P 1.00 KCCM11016P-pyc 1.89

Example 7

Development of KCCM11016P-Derived Strains having Substituted ATG Initiation codons in Two or More genes of lysC, tkt, and pyc genes

(61) As the recombinant vectors, pDZ-lysC(ATG) pDZ-tkt(ATG) pDZ-pyc(ATG) prepared in Examples 1, 2, and 3 were used, and the preparation process is as follows.

(62) The pDZ-tkt(ATG) vector was transformed into KCCM11016P-lysC of Example 1, in which GTG initiation codon of lysC was substituted with ATG, and through second crossover, the initiation codons of lysC and tkt on the chromosome were substituted with ATG so as to obtain KCCM11016P-lysC-tkt. The nucleotide substitution of the initiation codon of the gene was finally confirmed by PCR using the primers of SEQ ID NOs. 5 and 8 and then by analyzing the nucleotide sequence of the target site.

(63) In the same manner as in Example 1, the pDZ-pyc(ATG) vector was transformed into KCCM11016P-lysC of Example 1, in which GTG initiation codon of lysC was substituted with ATG, and through second crossover, the initiation codons of lysC and pyc on the chromosome were substituted with ATG so as to obtain KCCM11016P lysC-pyc. The nucleotide substitution of the initiation codon of the gene was finally confirmed by PCR using the primers of SEQ ID NOs. 9 and 12 and then by analyzing the nucleotide sequence of the target site.

(64) The pDZ-tkt(ATG) vector was transformed into KCCM11016P-lysC-pyc of the present Example, in which GTG initiation codon of lysC and pyc was substituted with ATG, and through second crossover, the initiation codons of lysC, pyc and tkt on the chromosome were substituted with ATG so as to obtain KCCM11016P-lysC-pyc-tkt. The nucleotide substitution of the initiation codon of the gene was finally confirmed by PCR using the primers of SEQ ID NOs. 5 and 8 and then by analyzing the nucleotide sequence of the target site.

(65) The above combinations of the genes are for illustrative purposes only, and the scope of the gene combinations is not intended to be limited thereto.

Example 8

Production of lysine in Strain having Substituted ATG Initiation codon

(66) KCCM11016P-lysC, KCCM11016P-tkt, KCCM11016P-pyc, KCCM11016P-lysC-tkt, KCCM11016P-lysC-pyc, KCCM11016P-lysC-pyc-tkt finally prepared in Examples 1, 2, 3, and 7 were cultured for L-lysine production by the following method.

(67) The parent strain KCCM11016P and KCCM11016P-lysC, KCCM11016P-tkt, KCCM11016P-pyc , KCCM11016P-lysC-tkt, KCCM11016P-lysC-pyc, KCCM11016P-lysC-pyc-tkt were inoculated in respective 250 ml corner-baffled flasks containing 25 ml of the seed, medium described below, and the resultant was cultured at 30? C. with shaking at 200 rpm for 20 hours. 1 mL of the resulting seed culture broth was inoculated into a 250 ml corner-baffled flask containing 24 ml of the production medium described below, and cultured at 30? C. with shaking (200 rpm) for 120 hours.

(68) After completing the culture, the quantity of produced L-lysine was measured by HPLC. The results of measuring L-lysine in the culture broths of KCCM11016P and KCCM11016P-lysC, KCCM11016P-tkt, KCCM11016P-pyc, KCCM11016P-lysC-tkt, KCCM11016P-lysC-pyc, KCCM11016P-lysC-pyc-tkt are shown in the following Table 7.

(69) TABLE-US-00007 TABLE 7 Lysine (g/l) Strain Batch 1 Batch 2 Batch 3 KCCM11016P 45.2 44.7 45.6 KCCM11016P-lysC 47.5 46.2 47.9 KCCM11016P-tkt 47.4 48.5 47.0 KCCM11016P-pyc 47.9 46.3 47.8 KCCM11016P-lysC-tkt 49.7 49.3 49.2 KCCM11016P-lysC-pyc 50.1 48.9 49.6 KCCM11016P-lysC-pyc-tkt 50.7 50.2 51.1

(70) Seed Medium (pH 7.0)

(71) 20 g of raw sugar, 10 g of peptone, 5 g of yeast extract, 1.5 g of urea, 4 g of KH.sub.2PO.sub.4, 8 g of K.sub.2HPO.sub.4, 0.5 g of MgSO.sub.4 7H.sub.2, 100 ?g of biotin, 1000 ?g of Thiamine-HCl, 2000 ?g of calcium-pantothenate, 2000 ?g of nicotine amide (in 1 liter of distilled water)

(72) Production Medium (pH 7.0)

(73) 100 g of glucose, 40 g of (NH.sub.4).sub.2SO4, 2.5 g of soybean protein, 5 g of corn steep solids, 3 g of urea, 1 g of KH.sub.2PO.sub.4, 0.5 g of MgSO.sub.4 7H.sub.2O, 100 ?g of biotin, 1000 ?g of Thiamine-HCl, 2000 ?g of calcium-pantothenate, 3000 ?g of nicotine amide, 30 g of CaCO.sub.3 (in 1 liter of distilled water)

(74) As shown in Table 7, Corynebacterium glutamicum KCCM11016P -lysC, KCCM11016P-tkt, KCCM11016P-pyc, KCCM11016P-lysC-tkt, and KCCM11016P-lysC-pyc having substituted ATG initiation codon were found to show 4?9% increase in L-lysine productivity, compared with the parent strain KCCM11016P. In particular, KCCM11016P-lysC-pyc-tkt introduced with all three genes was found to show an increase in L-lysine productivity as high as 12%, compared to the parent strain KCCM11016P.

Example 9

Development of KFCC10750-Derived Strain having Substituted ATG Initiation codons in lysC, tkt, and pyc genes and Comparison of lysine Productivity

(75) In order to examine whether substitution of the initiation codons with ATG in lysC, pyc, and tkt genes also affects lysine productivity in other lysine-producing strains belonging to Corynebacterium glutamicum, the L-lysine-producing strain Corynebacterium glutamicum KFCC10750 (Korean Patent No. 10-0073610) was introduced, with all three genes which showed the most excellent effect of increasing lysine productivity in Example 8 so as to prepare a recombinant strain, which was named as KFCC10750-lysC-pyc-tkt. The strain was cultured in the same manner as in Example 8, and the L-lysine concentration was analyzed (Table 8).

(76) TABLE-US-00008 TABLE 8 Lysine (g/l) Strain Batch 1 Batch 2 Batch 3 KFCC10750 38.3 38 38.5 KFCC10750-lysC-pyc-tkt 44.1 43.8 44.5

(77) As shown in Table 8, Corynebacterium glutamicum KFCC10750-lysC-pyc-tkt introduced with all three genes showed 15% increase in the lysine productivity, compared to the parent strain KFCC10750 .

Example 10

Development of KCCM10770P-Derived Strain having Substituted ATG Initiation codons in lysC, tkt, pyc genes and Comparison of lysine Productivity

(78) Another L-lysine-producing strain Corynebacterium glutamicum KCCM10770P (Korean Patent No. 10-0924065) was introduced with all three genes which showed the most excellent effect of increasing lysine productivity in Example 8 so as to prepare a recombinant strain, which was named as KCCM10770P-lysC-pyc-tkt. The strain was cultured in the same manner as in Example 8, and the L-lysine concentration was analyzed (Table 9) .

(79) TABLE-US-00009 TABLE 9 Lysine (g/l) Strain Batch 1 Batch 2 Batch 3 KCCM10770P 47.8 47.2 47.5 KCCM10770P-lysC-pyc-tkt 52.8 52.8 52.4

(80) As shown in Table 9, Corynebacterium glutamicum KCCM10770P-lysC-pyc-tkt introduced with all three genes showed 11% increase in the lysine productivity, compared to the parent strain KCCM10770P.

Example 11

Development of CJ3P-Derived Strain Having Substituted ATG Initiation codons in lysC, tkt, pyc genes and Comparison of lysine Productivity

(81) Still another L-lysine-producing strain Corynebacterium glutamicum CJ3P (Binder et al. Genome Biology 2012, 13:R40) was introduced with all three genes which showed the most excellent effect of increasing lysine productivity in Example 8 so as to prepare a recombinant strain, which was named as CJ3P-lysC-pyc-tkt. The strain was cultured in the same manner as in Example 8, and the L-lysine concentration was analyzed (Table 10).

(82) TABLE-US-00010 TABLE 10 Lysine (g/l) Strain Batch 1 Batch 2 Batch 3 CJ3P 8.3 8 8.4 CJ3P-lysC-pyc-tkt 9.7 9.6 10.0

(83) As shown in Table 10, Corynebacterium glutamicum CJ3P-lysC-pyc-tkt introduced with all three genes showed 18% increase in the lysine productivity, compared to the parent strain CJ3P.

EFFECT OF THE INVENTION

(84) The present invention provides a Corynebacterium sp. microorganism having improved L-lysine productivity, in which initiation codons of one or more genes encoding aspartate kinase, transketolase, or pyruvate carboxylase are substituted to enhance activities of the corresponding enzymes, compared to their endogenous activities in a native microorganism.