Method of reducing cancer cell proliferation by administering recombinant alpha-fetoprotein

Abstract

Disclosed are pharmaceutical and synergistic compositions human recombinant alpha-fetoprotein expressed in eukaryotic cells for preparation of therapeutic agents for use in oncology, immunotherapy, stem cell therapy, and cosmetology and also for the diagnosis of cancer and embryogenic pathologies.

Claims

1. A method for reducing cancer cell proliferation in vitro, the method comprising the steps of: a) transforming a Saccharomyces cervisiae cell with an expression cassette comprising the nucleic acid sequence according to SEQ ID NO:1; b) culturing the eukaryotic cell in a culture medium, wherein the cell secretes a recombinant mature human fetoprotein consisting of the amino acid sequence according to SEQ ID NO:2 into the culture medium; c) isolating the recombinant mature human alpha-fetoprotein (rhAFP) from the culture medium; d) providing a non-covalent complex of the recombinant mature human alpha-fetoprotein (rhAFP) isolated from the culture medium and curcumin or genistein, and e) contacting a cancer cell culture with the non-covalent complex.

2. The method of claim 1, wherein the cancer cell culture is human hepatocarcinoma HepG2 cell culture.

3. The method of claim 1, wherein in step d) rhAFP and curcumin, or rhAFP and genistin are mixed in equimolar concentrations, and the mixture is purified from unbound curcumin or genistin.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The following drawings illustrate the present subject matters of the invention.

(2) FIG. 1 shows the structure of a pKX plasmid encoding the sequence of a mature human alpha-fetoprotein, comprising an expression cassette with a human alpha-protein gene; a fragment of a bacterial plasmid pUC18; a region of initiation of replication of a 2 m yeast plasmid; a selective PGK1 yeast marker, a pD11 gene encoding an disulfidisomerase enzyme and a KAR2 gene providing correct assembly of the protein and secretion of the desired product into a culture medium.

(3) FIG. 2. (a-g) Shows the structure of an expression cassette comprising a sequence encoding a human alpha-fetoprotein within the composition of a pKX plasmid (SEQ ID NO:1). The promoter region of the GAL1 yeast gene is shown by italics. The pre-pro region of secretion of the MF1 yeast gene is shown by dark print. The amino acid sequence of the human alpha-fetoprotein molecule (SEQ ID NO:2) is shown by capital letters.

(4) FIG. 3. (a-f) Demonstrates the structure of a synthetic gene encoding AFP and consisting of the most often used yeast codones. The AFP amino acid sequence of serum human AFP (SEQ ID NO:2), is singled out with dark print.

(5) FIG. 4 shows the results of SDS-PAGE electrophoresis (A) and immunoblotting-analysis (B) of different amounts, applied onto a line, of a purified recombinant alpha-fetoprotein obtained from a yeast culture Saccharomyces cervisiae YBS723/pKX cultural liquid. 1. Marker proteins (94, 67, 43, 30, 20 kD). 2. rAFP after affinity chromatography on a column with anti-AFP-sepharose (0.3 g) 3. rAFP after gel-chromatography on a column with Sephacryl S-200 (0.4 g). 4. rAFP (0.1 g). 5. rAFP after Sephacryl S-200 (0.6 g). 6. rAFP after Sephacryl S-200 (0.5 g) 7. Embryonic eAFP (0.4 g).

(6) FIG. 5 shows a dose dependence of the proliferation of B-cellular Raji lymphoma cells on the AFP concentration for two different samples of purified AFP, which are obtained from embryonic serum eAFP and recombinant rAFP, that is expressed by yeast strain producer Saccharomyces cervisiae YBS723/pKX. Proliferation of the cells was measured by [H.sup.3]-thymidine incorporation and expressed in percentage of inhibition of growth in experimental cultures after 12-hour incubation with AFP in respect to a control without activities.

(7) FIG. 6 demonstrates: (A) synergistic enhancement of oncosuppressive action of doxorubicine in respect to myeloblastoma U937 cells with the combined use with rAFP according to the instant invention; (B) synergistic enhancement of the general oncosuppressive effect with combined use of rAFP according to the instant invention and retinoic acid (pro-vitamin A, acid). Proliferation of the cells was measured by [H.sup.3]-thymidine incorporation and expressed in percentage of inhibition of growth in experimental cultures after 12-hour incubation with AFP in respect to a control without additives.

(8) FIG. 7 shows the stimulating effect of rAFP according to the instant invention on the growth of stem embryonic cells obtained form a primary culture of cells of embryonic lung and retina. Proliferation of the cells was measured by a standard method of [H.sup.3]-thymidine incorporation during the last four hours of culture and expressed in percent of the stimulation of growth in test cultures in respect of a control without AFP.

(9) FIG. 8 A-C shows effect of combined 48-hrs treatment with various doses of rhAFP/doxorubicin (8B); rhAFP/cisplatin (8C), rhAFP/etoposide (8A) of human breast cancer cell MCF-7 in vitro. Cell proliferation was assessed by H3-thymidine incorporation assay or by MTT technique.

(10) FIG. 9 shows microscopic image of cytotoxic effect after combined treatment with suboptimal doses of doxorubicin and rhAFP against human breast cancer cells MCF-7 in vitro demonstrating effectiveness of rhAFP/Dox therapy. Cells were plated at 80% of confluence and thereafter treated with rhAFP/Dox for 48 hrs. Cells were visualized in fluorescence microscope Axioplan (Zeiss) in 100-fold magnification after staining with crystal violet.

(11) FIG. 10 A-D shows the combined synergistic suppression of the PHA-mediated thymocyte proliferation in vitro induced by combined treatment with rhAFP and cyclosporine A (A); the combined synergistic suppression the proliferation of alloantigen-activated mice spleen cells induced by combined AFP/CsA treatment (B); rhAFP-induced cancellation of the cytotoxic effects of CsA treatment of resting mouse T-cells (C); synergistic inhibition of IgG and IgM antibody production by SRBC-activated mouse B-cells induced by combined treatment with rhAFP/CsA. Doses of rhAFP and CsA are shown in the pictures. The description of the experiment is given in Example 12.

(12) FIG. 11 shows the stimulation of regeneration potential of human umbilical vein cells (HUVEC) by rhAFP or human serum albumin. HUVECs were plated onto the gelatin-coated 24-well plates, and grown for confluence. Than monolayers were wounded by scrapper, and cells were incubated in the serum-free medium with 0.1-0.5 mg/ml of rhAFP or HSA. Healing was observed microscopically after 18-hrs incubation with HSA (top) or rhAFP (bottom) after staining with crystal violet. rhAFP significantly activated the migration of HUVEC to the wounded area.

(13) FIG. 12 shows the experimental demonstration of formation of non-covalent complex of rhAFP and curcumin (A) with demonstration of synergistic anti-tumor effects of combined administration of rhAFP with curcumin (B) and genistin (C). Absorption spectra of aqueous solutions containing 30 M of curcumin and various doses of rhAFP: (1) 30 M of curcumin; (2) 30 M of curcumin+20 M rhAFP; (3) 30 M of curcumin+40 M rhAFP. Panel at the top (A): absorption spectra of non-covalent complex of rhAFP/curcumin after chromatography through a column with Sephadex G-25.

(14) The list of sequences comprises sequence SEQ ID NO: 1 and SEQ ID NO: 2, which are respectively the nucleotide sequence of an expression cassette comprising the encoding sequence of human alpha-fetoprotein in the composition of a pKX plasmid and the amino acid sequence of a mature human AFP.

(15) The nucleotide sequence of an expression cassette comprises a promoter region of GAL1 yeast gene, a pre-pro region of secretion of a MF.alpha.1 yeast gene, the encoding sequence of a human alpha-fetoprotein gene and a field of termination of transcription of a CYC1 yeast gene. This expression cassette is included in the composition of the pKX plasmid encoding the sequence of a mature human alpha-fetoprotein in a yeast strain-producer of Saccharomyces cervisiae YBS723/pKX

DETAILED DESCRIPTION OF THE INVENTION

(16) In order to realize the instant invention, the main technical object was the creation of a strain of yeast-producer of AFP, capable of effectively secreting the desired protein into a cultural liquid. This object is solved by constructing a recombinant DNA pKX plasmid encoding the regulated synthesis of human AFP and the strain Saccharomyces cerevisiae YBS723/pKX providing the synthesis and production of AFP in a secreted dissolved form with a level of expression not less than 10 mg/l. The high level of synthesis of the desired protein in secreted dissolved form is provided in that the pKX plasmid comprises a promoter of the GAL1 gene with simultaneous amplification of the KAR2 gene (Robinson A. S., et al. 1996, J. Biol. Chem. 271: 10017-10022), encoding a chaperon heavy chain binding protein BiP. In the genome of the strain of the recipient, there is amplification of the PD11 gene (Robinson A. S., et al., 1996, J. Biol. Chem. 271: 10012-10022), encoding a disulfidisomerase enzyme, which participates in the formation of disulfide bonds during the secretory process of the proteins.

(17) The recombinant plasmid DNA comprises a human AFP gene under the control of a GAL1 promoter gene, providing a high level of transcription of the gene, and a KAR2 gene, encoding a chaperon heavy chain binding protein BiP, participating in folding proteins during the secretory process for the proteins, and providing a high level of production of the desired protein into the cultural liquid, Furthermore, in order to provide the correct formation of disulfide bonds and the formation of a native tertiary structure of the protein, a PS11 gene encoding disulfideisomarase is used.

(18) A recombinant pKX plasmid DNA (FIG. 1), encoding a human AFP gene, is characterized by the following features: it is an expression plasmid for the effective secretion of human AFP; it has a size of 13301 bp; it comprises a fragment encoding the amino acid sequence of a mature human alpha-fetoprotein SEQ ID NO:2; it comprises a fragment of the bacterial plasmid pUC18; a region of initiation of a 2 m yeast plasmid; a selective yeast marker PGK1; a KAR2 yeast gene encoding a chaperon heavy chain binding protein BiP; a PD11 gene encoding a disulfisomerase enzyme; an expression cassette with an AFP genome; in the structure of the expression cassette presented by the nucleotide sequence SEQ ID:NO:1 is included: a promoter region of GAL1 yeast gene; a pre-pro region of secretion of Mf 1 yeast gene; a region encoding a mature human AFP; a field of termination of transcription of a CYC1 yeast gene. When this plasmid is introduced into a cell, a high level of transcription of the AFP gene is achieved due to the use of a highly effective GAL1 promoter. The introduction of a pre-pro region of secretion of Mf1 provides for the correct secretory processing of AFP accompanied by the effective secretion of the protein with the expected amino acid sequence SEQ ID NO: 2, if the encoding region will correspond to the DNA sequence encoding a mature human AFP in a cultural liquid; a significant distinction of the proposed plasmid construction is that an AFP gene is under the control of a highly effective GAL1 promoter, and in order to provide the correct formation of disulfide bonds and the formation of a native tertiary structure of the protein, PD11 and KAR2 genes are used.

(19) Any eukaryotic cell susceptible to such a transformation with the indicated plasmid may be transformed with the aid of the created plasmid. The selection to the cell is not critical since the methods and steps of transformation are well known to those skilled in the art. However, depending on the type of cell and the conditions for culturing the obtained transformant, the level of expression of AFP may vary, but the fact of expression of the required peptide will take place under condition of successful transformation of the parent cells.

(20) A recipient strain YBS723 of the genotype pgk1/pgk1 is used to obtain the strain Saccharomyces cerevisiae YBS723/pKX. The homozygosis of pgk1/pgk1 makes this strain incapable of growth in all mediums containing any single source of carbon within the norm digestible by yeasts S. cerevisiae. The homozygosis of gal80::PD11/gal80::PD11 results in a change of regulation of the promoter of the GAL1 gene with simultaneous amplification in the genome of the PD11 gene encoding the disulfidisomerase enzyme and participating in the formation of disulfide bonds during the secretory process of the proteins.

(21) The YBS723 strain is transformed by the pKX plasmid according to the method (Ito H., et al., 1983, J. Bacteriol. 153:163-168). Transformants were selected according to the capability to grow on a full-value yeast medium (bactopeptone20 g/l, yeast extract10 g/l, bactoagar20 g/l) comprising 2% glucose as a source of carbon. One of such clones is designated as YBS723/pKX.

(22) The obtained diploid yeast strain Saccharomyces cerevisiae YBS723/pKX is characterized by the following features:

(23) Genetic features: Genotype pgk1/pgk1 gal180::PD11/gal80::PD11; Morphological features: Vegetative cells of a 48-hour culture grown on a solid nutrient medium with 2% sucrose as the only source of carbon have an oval form, cell size of 3.67.1 m, the protoplasma is homogenous, reproduction is by gemmation. When growing on a solid medium comprising a yeast extract and peptone (YEP) at 30 C. after 72 hours of growth, the columns have the following appearance: 1) on a YEP medium with glucosea white color column with a smooth edge, shining surface, cone-shaped profile, cream-like consistency; 2) on a YEP medium with starcha white color column with a pattered edge, dull surface, lens-like profile and grain consistency; 3) on a YEP medium with molassesa white color column with a dull wrinkled surface, patterned edge, convex profile and cream-like consistency.

(24) Growth on a liquid mediumon YEP medium with starch at 32 C. during the first 24 hours of culturinga cloudy liquid, white residue, does not cake, does not form parietal films.

(25) Physicochemical features: Facultative anaerobe. Temperatures of growth: 23-33 C. (optimum31 C.). pH of culturing3.8-6.7 (optimum5.0). Highest level of secretion of AFP is observed at pH 6.8-7.0.

(26) Assimilation of carbon sources: ferments glucose, galactose, fructose, maltose, saccharose, dextrine, starch.

(27) Assimilation of nitrogen sources: assimilates amino acids, urea, ammonium, sulphate, ammonium nitrate.

(28) Distinctive specificities: in the case of culturing on a rich medium with starch (2%), zones of fading starch surrounded by a dark rim after incubation of dish at +4 C. for 24 h.

(29) Pathogenicity: the strain Saccharomyces cerevisiae YBS723/pKX is not pathogenic.

(30) Method of storage: The strain is stored on an agarized rich medium with glucose for 3 months at +4 C.

(31) The obtained strain Saccharomyces cerevisiae YBS723/pKX-producer of AFP in a secreted form is deposited in the Russian Collection of Industrial Microorganisms (VKPM) under NO. Y-3115.

(32) The cell strain producer of recombinant AFP proposed by the Applicants has a number of advantages over already existing prototypes: production of the desired product is carried out in a secreted form into a cultural liquid. the amino acid sequence of the final product corresponds to the sequence of a mature human AFPSEQ ID NO:2; similar to the serum embryonal analog, rAFP, produced by the strain producer Saccharomyces cerevisiae YBS723/pKX, is glycosylated; the yield of the desired product is significantly increased due to an increase of expression of the gene encoding the disulfidisomearase enzyme PD11 providing for the formation of disulfide bonds and the KAR2 gene encoding chaperon heavy chain binding protein BiP providing for correct assembly of the protein and secretion of the desired product into the cultural medium.

(33) It is clear to one skilled in the art that the sequence encoding the DNA may comprise replacement related to the degeneration of the genetic code, an also some replacements, insertions, deletions, which as a whole do not result in the obtainment of inactive forms of the fetoprotein. Possible variations are known to those skilled in the art. The obtained polypeptide may also include within the frame of the amino acid sequence conservative amino acid replacement presuming the replacement of one amino acid with another having similar properties. However, within the limits of the claimed features of the instant invention there are only those polypeptides which have primary, secondary and tertiary structure, that does not disturb the required activity of obtained polypeptide, in particularto have properties identical or similar to the properties of a mature human AFP, determined in an immunological analysis and in accordance with its capability to suppress the growth of cells of a B-cellular lymphoma Raji in culture in vitro.

(34) The indexed of functional activity, at which it is regarded that the obtained polypeptide will have the properties of a mature human serum AFP are determined according to the immunological reaction and according to its capability of inhibiting in vitro the growth of cells of the B-cellular lymphoma Raji at a level not less than 10% of the activity of a mature human serumal AFP cells of the B-cellular lymphoma Raji at a level not less than 10% of the activity of a mature human serum AFP.

(35) In the case of practical use of the obtained polypeptide within the makeup of a composition, traditional additional components are used, such as excipients, diluents, preservatives, buffer solutions, physiological solutions, a 0.9% solution of sodium chloride, technological additives used during the production of drug forms, etc. Compositions may be fluid (solutions, suspensions, creams, emulsions, etc.), solid (lyophilized powder, reconstituted prior to use, an absorbed preparation of a carrier etc.), serving for parental, oral, intravenous, intramuscular, etc. administration or for external use. Wherein, the compositions for external use may comprise additives promoting the absorption and diffusion of the active substance in tissue.

(36) The synergic compositions of the instant invention provide for the presence in the compositions of another active substance, wherein in the case where two active substances are present at the same time, on of which is the rhAFP according to the instant invention, the effect of their action is reliably higher than in the case where each substance is used separately.

(37) It is evident that synergic compositions are one of the preferable variants of embodiment of the inventions, since to one skilled in the art the variant of administering each active component separately is clear. For example, in the case of anticancer therapy, each preparation of an active component may be administered separately and together simultaneously, with separation by time or by different manners of administrations. The concrete selection depends on the state of the patient, the seriousness of the illness, prior treatment, etc.

(38) The selection of the therapeutic doses for treatment may be any doses in a wide range from 0.001-10 mg/kg of a patient's weight, with the evidence that the required therapeutic effect is obtained. It corresponds to the traditional dosages of human serum AFP, since the obtained rhAFP will have properties that are similar or close in respect to activity of its serum analogue. The limiting dosages of rhAFP according to the invention correspond to the dosages of human AFP, since they have a similar amino acid sequence, which is not recognized by a normal immune system of human as foreign.

(39) The instant invention is illustrated by the following examples, which are not of a restrictive character, but are intended to demonstrate embodiment of the invention and realization of the best variant of the embodiment.

EXAMPLE 1

Isolation of Sum RNA and Construction of Intermediate Recombinant Plasmid DNA pTrcafp

(40) The total mRNA was isolated from the cellular line of human hepatoma HepG2 with the aid of Trizol Reagent (Gibco BRL, USA) in accordance with a method of the producer. The cDNA was obtained using First Strand cDNA Synthesis Kit (MBI Fermentas) in the presence of primers oligo (dT).sub.18 or GAAGTAATTTAAACTCCCAAAGC(3R) (SEQ ID NO:7), complementary to the 3 end of the gen afp. Amplifications of the obtained matrix for subsequent cloning was carried out in the presence of primers:

(41) TABLE-US-00001 (SEQIDNO:3) CTTCAATCGATATGACACTGCATAGAAATG(Cla) (SEQIDNO:4) CTTCCAAGCTTAAACTCCCAAAGCAG(Hind),
the first of which corresponds to the 5-sequence of mature protein gene (singled out by dark print) and comprises a recognition site for restrictase Cla I, while the second is complementary to the 3-end section of the gene (singled out by dark print) and comprises a recognition site for Hind III. Amplification of the gene was carried out in a volume of 100 l. The reaction mixture compressed 10 ng of cDNA, 30 pM of each of the primers (1) and (2), a mixture of dNTP (0.2 mM of each), 10 mM of Tris-HCL, pH 8.8, 10 mM of KCl, 2.5 mM of MgSO.sub.4, 2.5 unit Pfu DNA-polymerases (Stratagene firm) and 1 unit Taq DNA-polymerase (Fermentase firm). There were 25 cycles carried out according to the scheme: 95 C./40 sec, 39 C./40 sec, 72 C./1 min. The products of the reaction were analyzed by electrophoresis in a 1% agarous gel; strips of a length of about 1790 bp were cut, DNA was extracted from the gel, treated with restrictases Cla I and Hind III and cloned into the plasmid pTrcTEGF, earlier obtained with those same restrictases. As a result the plasmid pTrcafp was obtained; its structure was confirmed by restrictase analysis, using restrictase Cla I and Hind III, in respect to which cloning was carried out, and also Spe I, Mun I, Sec I and Sty I, the recognition sites of which are is inside the AFP gen, and by determination of the nucleotide sequence of the DNA section cloned with the aid of PCR. Sequencing was carried out according to the method and with use of the Cycle Reader DNA Sequencing Kit (Fermentas, Lithuania).

EXAMPLE 2

Preparation of Synthetic cDNA, Encoding a Human AFP Gene

(42) In order to obtain a synthesized AFP gene, 36 oligonucleotides having a length of 62-68 b were chemically synthesized. On the basis of these oligonucleotides size double-chain fragments were obtained by the method of polymerase chain reaction, each of which was cloned to a vector pUC18. The primary structure of all the cloned fragments was confirmed by sequencing. Fragments with the correct nucleotide structure were then sequentially collected into a desired gene by the method of restriction/ligation in the form of a fragment of the plasmid pUC18. In a similar manner a cDNA was obtained for expression of modified forms of AFP, comprising deletion, mutation or added amino acid residues.

EXAMPLE 3

Construction of a Recombinant Plasmid DNApKX

(43) The plasmid pTrcafp was used as a matrix for PCT in the presence of primers:

(44) TABLE-US-00002 (SEQIDNO:5) CAACCCTCGAGTTAAAACTCCCAAAGC (SEQIDNO:6) CCAACCCATGGCTAAGAGAACACTGCATAGAAA-TG.

(45) Restriction sites NcoI and XhoI (underlined) are set in the sequence of primers. The DNA fragment obtained as a result of amplification after treatment with endonucleasase of restriction NcoI/XhoI were cloned onto vector pUC18/GAL1-pp, comprising a promoter GAL1 and pre-pro region of secretion MF.alpha.1. As a result the plasmid pUC18/GAL1-ppafp was obtained. In order exclude possible errors of PCR the NcoI/XhoI fragment of the plasmid was sequenced. The HindIII/XhoI fragment of the plasmid pUC18/GAL1-pp/afp, comprising the promoter GAL1, pre-pro region of secretion of MF.alpha.1 and encoding part of the human AFP gene (FIG. 2) were transferred to the HindIII/XhoI bireplicon (yeast-E. coli) vector pPDX. As a is result the plasmid pPDX/GAL1-pp/afp was obtained. The ClaI/XhoI fragment of the plasmid pPDX/GAL1-pp/afp was transferred to ClaI/XhoI vector of pPK, differing from pPDX by the presence of the KAR2 gene. The plasmid obtained as a result is named pKX (FIG. 1). In a similar manner the plasmid pKX-1 was obtained, comprising the synthetic human AFP gene consisting of the most widely used yeast codons (FIG. 3). The plasmid pKX-1 differs from pKX in that it comprises the synthetic gene of a mature human AFP.

EXAMPLE 4

Obtainment of a Strain-Producer of Human AFP

(46) In order to obtain the strain Saccharomyces cervisiae YBS723/pKX, the recipient strain YBS723 was transformed by the plasmid pKX in accordance with the method (Ito H., et al., 1983, J. Bacteriol. 153: 163-168). The transformants were selected by the capability to grow on a full-value yeast medium (bactopepton20 g/l, yeast extract10 g/l, bactoagar20 g/l), comprising 2% glucose as the source of carbon. One of such clones is designated YBS723/pKX.

EXAMPLE 5

Determination of Productivity of Strain-Producers of Human AFP Saccharomyces cerevisiae YBS723/pKX

(47) Cells of the strain-producer YBS723/pKX were grown in vials at 26.degree. C. on a rocker (250 rpm) on a medium of the following composition: glucose2%, glycerine1.5%, yeast extract1%, peptone2%, distilled water. The pH of the medium was maintained at 7.0 by the addition of 0.1M of a phosphate buffer. The initial titer of the cells was 510.sup.6. Samples were taken after 72 hours of growth of the culture after transition to the stationary phase of growth at a titer of 7-810.sup.8. A sample of the cultural liquid was obtained after centrifugation of the culture at 10 0000 rpm for 1 min and was used in the following analyses. Samples of the CL were analyzed by electrophoresis in a 12.5% polyacrylamide gel with sodium dodecyl sulphate. The gels were colored Coomassie R-250 (FIG. 4) and scanned to determine the total protein and relative content of the AFP specific protein. According to the data of electrophoresis and scanning, the total content of AFP in the CL is about 10-25% of the total protein, but there is partial intracellular degradation of the protein. The relative content of AFP in the CP was determined by the method of immunoblotting in the presence of polyclonal antibodies to AFP (FIG. 4). Also, the quantitative content of AFP in the cultural liquid was determined by the method of immunoenzymatic analysis (IEA), with the use of a set of monoclonal and polyclonal antibodies to human AFP. According to the IEA data, the average content of AFP in the CL in liquid mediums reached 5 mg/ml.

EXAMPLE 6

Determination of Productivity of Strain-Producer of Human AP Saccharomyces cerevisiae YBS723/pKX in High-Density Mediums

(48) Feed-back culturing the strain YBS723/pKX was carried out in a fermenter at 26 C. and pH 7.0 (automatic maintenance). The content of dissolved oxygen dO was maintained >20%. During fermentation, replenishment with a medium of the following composition was carried out: yeast extract30 g/l, peptone60 g/l, glucose100 g/l. The rate of feeding the replenishment was such as to provide a rate of growth of the culture =0.03. After achievement of ID50, equal to 280 optical units, the content of AFP in the CL was analyzed.

(49) The relative and total content of AFP in the CL of high-density cultures of YB723/pKX was determined as described above in example 4. In the case of culturing in high-density mediums, the content of rAFP in the CL according to IFA data reached 70 mg/l.

EXAMPLE 7

Isolation and Characterization for Recombinant Human AFP from CL of a Strain Producer YBS723/pKX

(50) Isolation of rAFP from the CL of the strain procures YBS723/pKX was carried out as described earlier (Dudich et al., 1999, Biochemistry, 38: 10406-10414) with slight changes. The cultural liquid was concentrated from 31 to 200 ml by ultrafiltration on a concentrating cell millpore and dialyzed against 0.005M Tris-HCl, a pH 7.5, 0.1 M NaCl buffer, 4 C., then centrifuged for 0.5 hours at 10 000 rpm.

(51) Ion exchange chromatography. The supernatant obtained after centrifugation was applied onto an ion exchange column DEAE-Sepharose Fast Flow (Pharmacia, 274 cm), balanced with 0.01 M Tris-HCl, pH 7.5, 0.1 M NaCl. The components not bond to sorbent were washed from the column with a starting buffer, while the elution of the desired product was carried out by 0.2M of NaCl in a Tris-HCl buffer, pH 7.5 at a rate of 1 ml/min.

(52) Affinity chromatography. The fractions comprising rAFP were combined, the concentration of NaCl was brought to 0.5M and applied to an affinity column with Sepharose CL-4B conjugated with polyclonal anti-AFP rabbit antibodies, which was balanced with 0.05M Tris-HCl, pH 7.5 and 0.5M NaCl. After the output of the protein not bonded to the antibodies of the proteins, the absorbed rAFP was eluted with 0.005M HCl. The peak of the output of the material upon achievement of pH from 5.0 to 3.5 was determined by absorption at 280 nm. The solution of rAFP was neutralized to pH 7.5 by the addition of a 2M solution of Tris-HCl, pH 7.5.

(53) Gel chromatography. Further purification of rAFP was carried out by gel chromatography on a column with Sephacryl S-200 (1.870 cm) in a 0.1 M phosphatebuffer, pH 7.0; 0.15M NaCl, at a rate of 0.5 ml/min. The solution of purified rAFP was concentration in a cell Amicon (membrane YM-30) under the pressure of nitrogen.

(54) Analysis of samples. The identification and purity of the obtained rAFP preparation were controlled by methods of gel electrophoresis according to Lammly in 12.5% SDS-PAGE with -mercaptoethanol with subsequent coloring by Coomassie (FIG. 4A), Western-blot analysis on a PVDF-membrane with a titer of primary antibodies 1:1500 and secondary 1:5000, dot-blot on a Hybond ECL-nitrocellulose membrane (FIG. 4B), IFA.

(55) Determination of the concentration of the protein in the solution was carried out in accordance with the Bredford method, using a standard solution of embryonal AFP as the control, and also spectrophotometrically at 278 nm, taking the coefficient of extinction E.sub.1%278 nm=0.53 into account.

EXAMPLE 8

Determination of Biological Activity of Recombinant Human AFP In Vitro

(56) The functional activity of rAFP and the modified forms thereof were determined according to its capability of suppressing the growth of cells of B-cellular lymphoma Raji in the culture in vitro, as earlier described (Semenkova, L. 1997, Tumor Biol. 18, 261-274; Dudich E. I., et al., 1998, Tumor Biol. 198, 30-40). Preliminarily washed by a fresh medium, Raji cells were placed into each cell of a 96-alverolar plate according to 510.sup.3 in 0.1 ml of a medium RPMI-1640 in the presence of a 10% fetal calf serum, then different doses of AFP were added for 12 hours. Proliferation of the cells was measured by a standard method by the introduction of [H.sup.3]-thymidine during the last 4 hours of culturing. For comparison, the dose-dependent reactivity was studies for two samples of AFP of embryonal origin embrAFP and yeast rAFP (FIG. 5). It is evident that both preparations manifest an expressed cytostatic activity in respect to these cells. Similarly, in order to determine the activity to preparations on the base of AFP in vitro, any other lines of cancer cells may be used that are sensitive to the suppressive action of AFP, such as human hepatocarcinoma HepG2, breast cancer MCF-7, prostate cancer LnCap, myeloblastoma U-937 and others (Semenkova, L. 1997, Tumor Biol. 18, 261-274; Dudich E. I., et al., 1998, Tumor Biol. 198, 30-40).

EXAMPLE 9

Use of Recombinant AFP as Anticancer Preparation

(57) Anticancer preparations on the base of rAFP and of modified forms thereof may be used for inhibition of the growth of malignant neoplasms, such as primary or metastatic cancer of the liver, blood cancer (leucosis, myeloblastoma, lymphoma), breast cancer, prostate cancer. In order to determine the sensitivity of tumor cells to rAFP, it is possible to use different methods both in vitro and also in vivo. The method of determining activity in vitro is described in the preceding example 8. In order to determine the oncosuppressive action of preparations on the base of AFP in vivo, animal models may be used, for example Nude mice with subcutaneously or intraperitoneally implanted human lines of cancer cells, such as Raji, HepG2, LnCap, MCF-7 and others. For example, cells of B-cellular lymphoma Raji were administered subcutaneously in an amount of 1-5.times.10.sup.6 per mouse. Administration of the rAFP and derivatives thereof was begun 7 days prior to implantation of tumor cells intraperioneally or intravenously in an amount of 1-10 mg/kg. The physiological buffered solution (PBS) was used as a control. The size of the tumor was evaluated by daily measurements with the aid of a micrometer.

(58) TABLE-US-00003 TABLE 1 Results of tests for AFP on models of Nude line mice implanted with cells of B-cellular lymphoma Raji Number Dose of of AFP per animals injection Method of administration Results 10 1 mg Intraperitoneally daily 2-stabilizaton for 20 days 5-50% inhibition 3-tumor did not develop 5 PBS Intraperitoneally daily 10-100% development of for 20 days tumor 10 0.5 mg Intraperitoneally daily 2-stabilization for 20 days 5-50% inhibition 3-tumor did not develop 10 2 mg Intraperitoneally daily 2-stabilization for 20 days 5-50% inhibition 3-tumor did not develop

(59) The method of administering preparations on the base of yeast rAFP or derivatives thereof may also comprise therein the administration of chemotherapeutic preparations simultaneously or sequentially. The following may be presented as examples of such chemotherapeutic preparations: doxorubicin, vincristine, fluorouracil, metatreaxate, actinomycin D, mitomycin C, tamoxifen, flutamid, vincrsitine, vinblastine, cyclosporine, retinoids, carotenoids, and others. Usually, a chemotherapeutic preparation may be administered in standard dose or in suboptimum doses, below the usual therapeutic. The effect of the combined action of rAFP and doxorubicin (A) and rAFP and all-trans-Retinoic acid (tRA) is presented as an example in FIG. 6. In the case of simultaneous administration of the preparations, synergic oncosuppressive action in the case of use of suboptimum doses is observed.

EXAMPLE 10

Combined Therapy with rhAFP/Doxorubicin of Syngeneic Leukemia in BDF1 Mice In Vivo

(60) We demonstrated earlier that oncofetal marker alpha-fetoprotein (AFP) activates apoptosis in tumor cells by blocking of XIAP activity [Dudich, E. et al. (2006) FEBS J., 273:3837-3849; Semenkova L N et al. (2003) Eur. J. Biochem. 270: 4388-4399]. Human recombinant AFP (rhAFP) was isolated from the culture medium of yeast-producer S. cerevisae and used to study its tumor-suppressive effects in vitro and in vivo both in monotherapy and combined regimens.

(61) We have studied the effect of combined treatment with AFP+Dox of acute leukemia in mice BDF1 with transplanted intrapleurally syngeneic P388 leukemia cells. BDF-1 mice (84 male, 28 mice per treatment) were implanted with lethal dose of 1210.sup.6 syngeneic leukemia cells P388 in the pleural region. Animals were subjected to monotherapy with Dox and combined therapy with rhAFP/Dox upon simultaneous single injection of drugs in various doses. Animal survival was compared over 30 days.

(62) Results: Combined treatment of P-388 cells in vitro with rhAFP/Dox resulted in synergistic enhance of the total tumor suppressive effect and drastic enhance of the amount of apoptotic cells (>80%) at suboptimal doses of both compounds. Median animal survival was 6.5 days for placebo, 20.5 [15 to 22] days for monotherapy with Dox and 27.7 [19 to >30] days for combined rhAFP/Dox therapy. Effectiveness (T/C %) in rhAFP/Dox group was significantly higher than in monotherapy Dox group.

(63) TABLE-US-00004 TABLE 2 Results of treatment of the BDF1 mice with transplanted synergeneic acute leukemia P388 with doxorubicin and rhAFP/doxorubicin Dose Survival more Treatment (mg/kg) T (survival, days) T/C % 30 days Placebo 6.5 [6.2/6.8] 15.5 100 0 Dox 1.o [13.9/17.1] 19.7 238 0 Dox 3.0 [17.0/22.4] 20.5 303 0 Dox 5.0 [15.7/21.8] 7.7 [6.4/ 315 0 rhAFP 25.0 9.0] 18.8 [17.1/20.5] 118 0 Dox/rhAFP 1.0/25.0 20.5 [19.2/21.8] 289 0 Dox/rhAFP 3.0/25.0 27.7 [20.4/30.0] 315 0 Dox/rhAFP 5.0/25.0 426 3/7

(64) Conclusions: 1) Combined treatment with single injection of rhAFP/Dox resulted a significant enhance of the survival rate and effectiveness, resulting in complete remission in >40% animals as compared to monotherapy with Dox; 2) rhAFP operates by sensitization of tumors to apoptotic signals resulting in synergistic enhance of effectiveness and decrease of effective dose of Dox.

EXAMPLE 11

Protective Effect of Monotherapy with rhAFP Against Human Hepatoma Xenografts Transplanted in Nude Mice In Vivo

(65) To study tumor-suppression upon monotherapy with rhAFP we used in vivo model of human hepatoma xenografts in Nude mice. Balb C/Nude mice 8/group were implanted with 1210.sup.6 human hepatoma cells HepG2 s/c. rhAFP 10 mg/kg was injected i/p 9 times each 48 hrs during 16 days. Effectiveness of treatment was assessed by measuring and weighting of the tumor at the 30.sup.th day of experiment and by comparison of the quantity of mice with tumor during time of observation.

(66) Results: Without treatment, tumors were determined at 5.sup.th-7.sup.th day after transplantation. In the experimental rhAFP group, tumors did not grow in the period of treatment and became detectable at the 25.sup.th-27.sup.th day after beginning of the experiment. Monotherapy with rhAFP was resulted in the notable protective effect and significant suppression of tumor growth reaching of 90% inhibition of total tumor weight relatively to untreated control. Treatment of human hepatoma cells HepG2 in vitro with rhAFP induced dose-dependent growth suppression and apoptosis.

(67) Conclusions: Monotherapy with rhAFP prevented development of human hepatoma xenografts in Nude mice.

EXAMPLE 12

Synergistic Tumor-Suppressive Effect of Combined Treatment of Human Breast Cancer Cells In Vitro with Combinations of rhAFP with Doxorubicin, Cysplatin, Etoposide, Metatrexate

(68) Human breast cancer cells MCF-7 were plated onto 96-well plastic wells (Costar) in 10.sup.4 cells/ml in DMEM medium with addition of 2% fetal calf serum and were treated during 72 hrs with one of chemotherapeutic agents: doxorubicin, cysplatin, etoposide, metatrexate or those with addition of 0.1 mg/ml of rhAFP. Cytotoxic effect was estimated by MTT assay or H3-thymidine incorporation assay. It was observed synergistic enhance of the total tumor-suppressive effect in suboptimal doses of all agents in the presence of AFP (FIG. 8). These data indicate that combined chemotherapeutic regimen by using various cytotoxic agents including doxorubicin, cysplatin, etoposide, metatrexate together with rhAFP results in significant synergistic tumor-suppression.

(69) FIG. 9 shows microscopic image of direct cytotoxic effect of combined treatment with suboptimal doses of doxorubicin and rhAFP against human breast cancer cells MCF-7 in vitro demonstrating effectiveness of rhAFP/Dox therapy.

(70) Our data shows that rhAFP sensitizes tumor cells to chemotherapy by blocking of inhibitory signaling with inhibitor of apoptosis proteins XIAP overexpressed in tumor cells [Dudich E. et al. (2006) FEBS J., 273:3837-3849].

EXAMPLE 13

Synergistic Immunosuppressive Effects of Cyclosporine A and rhAFP

(71) To study combined effect of AFP and CsA on the PHA-mediated thymocyte proliferation in vitro mouse CBA thymocytes were pre-incubated for 48 hrs with 1.5 g/ml of PHA and thereafter various doses of rhAFP and CsA were added to thymocytes for the next 24 hrs and to thereafter assessed for their proliferation (FIG. 10A). Combined effect of AFP/CsA on the proliferation of alloantigen-activated mice spleen cells was estimated by treatment of responding CBA splenocytes with mitomycin C-treated allogeneic C57BL/6 splenocytes in the presence of various doses of rhAFP and CsA for 5 days (FIG. 10B). Control resting splenocytes CBA were treated for the same time with combination of rhAFP/CysA (FIG. 10C). Cytostatic effects were assessed by monitoring of cell proliferation by [.sup.3H]-thymidine incorporation.

(72) Combined effect of AFP/CsA (50 g/ml/10 ng/ml) and of the same doses of these compounds alone on the sheep red blood cells SBRC-specific IgG and IgM humoral immune response in vitro. Spleen cells were obtained from CBA mice preliminary primed with SRBC and additionally stimulated with SRBC in the presence of AFP/CsA for the next 5 days in vitro. Thereafter IgG and IgM plaque forming cells (PFC) were determined by direct and indirect PFC assay. The results of these experiments are shown on FIG. 10 D.

(73) FIG. 10 shows effect of combined rhAFP/CsA treatment on the proliferation of PHA-activated CBA thymocytes (TC). Stimulated by PHA thymocytes showed distinct dose-dependent growth suppression in response to AFP. Addition of CsA together with AFP significantly enhanced total immunosuppressive effect, demonstrating more than two-fold more significant growth suppression in comparison with that induced by AFP or CsA alone.

(74) Malignant human immune cells Jurkat (T-Lymphoma) were also subjected to the combined treatment with CsA/rhAFP. It was observed significant synergy in total growth suppressive activity (data not shown).

(75) Combined effects of AFP and CsA on the various types of activated immune cells and also on the different tumor cell lines cultivated in vitro was investigated. It was revealed that: (i) Low doses of AFP significantly increased low-dose-CsA-mediated immunosuppressive effects in T-cells activated with mitogens or alloantigens; (ii) AFP operates as a highly selective modulator of the CsA-mediated immunosuppressive signals by inducing of targeting suppression of activated cells only, but does not suppress resting immune cells; (iii) Taking into account that AFP simultaneously attenuates cytotoxic effects of CsA in resting T cells by decreasing of the effective concentration of free CsA in the cell surrounding, it could be concluded that AFP significantly decreases unspecific toxicity; (iv) Our data demonstrate, that AFP could serve as a highly effective compound of the targeting immunnosuppressive multicomponent drugs on the base of CsA to deliver immunnosuppressants into the activated cells, expressing AFP-receptors and simultaneously to diminish unwished side toxic effects against resting cells; (v) Data, showing the combined growth-suppressive effects of AFP/CsA in Jurkat cells, suggest the possible use of suboptimal CsA doses in combination with AFP to suppress growth of leukemic cells whereas toxic and suppressive effects against normal resting cells will be negligible. (vi)

(76) TABLE-US-00005 TABLE 3 Targeting modulation of CsA effects by human AFP AFP-mediated Drug Possible medical Unwished side modulation of description Dose Activity in vitro use effects CsA effects CsA 0.1-1.0 M 1. Apoptosis in 1. Preventing of Hepatotoxicity, (high thymocytes graft rejecton at Hyperbilirubinemia; doses) 2. Hepatocytes, organ Cholestatis in 3. Kidney cells 2. Treatment of heart transplant; 4. Lympho- autoimmune immunosuppression blastoma cells diseases 3. Cancer therapy CsA 0.01-0.1 M Cytostatis of No use No effects (low immune cells; doses) Cytostatis of leucemic cells. CsA + CsA: 0.1-1.0 M Abrogation of the 1. Cancertherapy; Significant Targeting AFP AFP: 0.1 M high dose CsA- 2. Abrogation of decrease of enhance of (high induced apoptosis CsA resistance in unspecific toxicity total effect doses) for normal cells cancer cells; against in vitro; 3. Tranplantaion; 4 malignant Sensitization of Autoimmune cells resistant cells to disease treatment CsA CsA + CsA: 0.01-0.1 M Synergistic 1. Cancer therapy; Synergistic AFP AFP: 0.1 M enhance of the 2. Abrogation of targeting (low total immune- CsA resistance in enhance of doses) suppression cancer cells; total 3. Transplantation; suppressive 4. Autoimmune effect disease treatment

EXAMPLE 14

Use of rhAFP for Stimulation of Growth of Adult Stem Cells

(77) Human mesenchymal stromal/stem adipose tissue cells (ATSC) were isolated either from liposuction aspirates or from products of the fat deposit removed during the cosmetic surgery. The tissue was mechanically split to the fragments of several cubic millimeters. A suspension of tissue was mixed with type I Collagenase (200 U/ml) and Dispase (30 U/ml) (Sigma) in solution of 50% DMEM (Sigma, D-5523), 50% F12 (Sigma, N-6760), 1% BSA (Sigma), /100 U/ml penicillin and 100 U/ml ampicilline in 1:1 v/v and incubated for 1 hr at 37 C. to with mixing, following by filtering through 40 m membrane (BD Falcon). The suspension was centrifuged 5 min at 200 g, upper layer was removed, and pellet consisting of separate non-adipose cells was treated by erythrocyte lysis buffer (154 mM NH.sub.4Cl, 10 mM KHCO.sub.3, 0.1 mM EDTA) during 5 min at 37 C., following by 5 min centrifugation at 300 g. Cell pellet was resuspended in DMEM/10% FBS. Resulting cells were cultured in the same medium in plastic flasks in CO.sub.2 incubator (37 C., 5% CO.sub.2). When reaching confluence, the cells were passaged by treatment the cell monolayer with 0.25% trypsin/0.02% EDTA. For the purpose of long-time storage, the cells were frozen in the culture medium supplemented by 15-20% FBS and 10% DMSO. Adipose cells were cultivated in DMEM/F12 medium with the addition 10% FBS 0.1% ECGF on 60 mm Petri dishes at 37 C. and 5% CO.sub.2. For the passages 0.25% trypsin/0.02% EDTA. solution was used. For the purpose of long-time storage, the cells were frozen in the culture medium supplemented by 15-20% FBS and 10% DMSO. Adipose tissue stem cells (ATSC) were cultivated in DMEM/F12 medium with the addition 10% FBS 0.1% ECGF on 60 mm Petri dishes at 37 C. and 5% CO.sub.2. For the passages 0.25% trypsin/0.02% EDTA solution was used. For the purpose of long-time storage, the cells were frozen in the culture medium supplemented by 15-20% FBS and 10% DMSO.

(78) Human donor ATSC were isolated and cultivated as described above, the cells from 2-4 passage were taken in the study. ADSC (310.sup.4) were plated in flat-bottom 96-well plates (Costar, USA) in complete medium with 10% FCS, after 18 h the medium was changed onto the medium with 5% human sera and cells were treated with increasing amounts of rhAFP (0-500 g/ml) for 24 h. The direct effect of rhAFP on proliferation of ATSC was measured by [H.sup.3]-thymidine incorporation. For the last 4 h 1 Ci of methyl-[H.sup.3]-thymidine was added to the cultures. AFP treatment ((0-500 /ml) resulted in enhanced proliferation of ATSC when compared to untreated control (Table 4). Maximum effect was obtained for 300 .mu.g/ml of rhAFP (50%).

(79) TABLE-US-00006 TABLE 4 Stimulation by rhAFP of growth of adipose derived adult stem cells in vitro. Cell proliferation (cpm 10.sub.3) AFP (mg/ml) 0 (control) 0.100 0.300 2 passage 17.8 6.4 20.7 0.7 25.8 4.1 (+16%) (+44%) 3 passage 16.5 1.5 17.7 5.3 22.4 1.4 (+7%) (+35%) 4 passage 0.83 0.1 1.0 0.08 1.2 0.24 (+20%) (+50%)

(80) The data obtained demonstrate that rhAFP operates as a growth factor for adult stem cells and can be employed as a component of culture medium for in vitro cultivation of autological stem cells for auto-transplantation and regenerative stem cell therapy.

EXAMPLE 15

Use of Recombinant AFP for Simulation of the Growth of Stem Cells

(81) The primary culture of embryonal fibroblasts of the lung and human retina was obtained by treating with 0.25% trypsin solution corresponding tissues of 5-10 week embryos obtained after legal abortions. The cells were cultures in an RPMI-1640 medium in the presence of a 10% calf fetal serum (CFS). The cytostatic activity of AFP was measured as earlier described (Semenkova, L. 1997, Tumor Biol. 18, 261-274; Dudich E. I., et al., 1998, Tumor Biol. 198, 30-40). Cells in an amount of 410.sup.4 in a 0.15 ml medium were intensively washed with a fresh to medium and placed in each cell of a 96-lune plate, then different doses of AFP were added and cultures 24 hours. Proliferation of the cells was measured by a standard method by the inclusion of [H.sup.3]-thymidine during the last four hours of culturing.

EXAMPLE 16

Synergistic Tumor-Suppressive Effect In Vitro for Combinations of rhAFP with Plant-Derived Tumoricidal Compounds, Flavonoids, Isoflavonoids, Flavons, Flavanones, Isoflavanones

(82) AFP can take small hydrophobic ligand molecules to deliver them to developing cells expression AFP-receptors, including stem cells and tumor cells, contributing significantly to physiological functions and acts as carrier protein. Phytochemicals are nonnutritive components of plants that are currently being studies in chemoprevention and combined therapy of cancer. Curcumin is the active component of tumeric, it has been shown to possess anti-inflammatory, antioxidant and antitumor properties. Other plant-derived tumoricidal compoundsflavonoids, isoflavonoids, flavons, flavanones, isoflavanones have been widely investigated for their ability to suppress tumor growth in vitro. Some of them display significant homology with steroids and mimic reveal antagonistic or agonistic activity in mammals. Ability of AFP to bind isoflavanoids was documented by various researches (Deutsch H. F, 1991, Adv. Canc. Res. 56, 253-312). We have documented the ability of rhAFP to form noncovalent complexes with plant derived compounds curcumin and genistin and to synergize in suppression of growth if various types of tumor cells in vitro. By steady-state absorption measurements it was demonstrated the formation of equilibrium noncovalent complexes of rhAFP and curcumin (FIG. 12 A). The absorption spectra of solutions containing curcumin and rhAFP were followed keeping concentration of curcumin constant 30 M and rhAFP varied from 5 M to 40 M. FIG. 12A curve 3 shows absorption spectra for pure 30 M curcumin dissolved in Et-OH followed with 1:5 dilution with phosphate buffer pH 7.4, curve 2 shows absorption spectra of 20 M of rhAFP and 30 M curcumin, and curve 3 shows spectra of 40 M of rhAFP and 30 M curcumin. FIG. 12A gives the absorption spectral changes in curcumin in the presence of rhAFP in the wavelength range of 250-550 nm. It is distinctly seen, that pure curcumin has characteristic absorption spectra with maximum at about 426 nm. Whereas after addition of rhAFP the maximum of absorbance of curcumin blue-shifted from 426 to 350 nm (curve 3). These data indicate significant changes in bound curcumin microenvironment due to its binding to rhAFP. Another experiment was produced to obtain bound form of curcumin/rhAFP complex. RhAFP and curcumin were mixed in equimolar concentrations, incubated for 1 hr and subjected to chromatography on the column with Sephadex G-25 to remove unbound curcumin. Protein peak corresponding to 70 kDa was collected and absorption complex of rhAFP/curcumin was obtained (FIG. 12A, right corner at the top). This complex does not contain free curcumin and shows two distinct absorption maximathat corresponding to protein absorbance at 280 nm, and another one corresponding to bound curcumin at 350 nm. These data shows that curcumin can form complex with rhAFP. Another series of experiments were produced to show synergistic effects of combined administration of rhAFP and plant-derived compounds curcumin and genistin in suppression of tumor cell growth. FIG. 12B, C shows that both curcumin and genistin demonstrated significant enhance of the total tumor suppressive effect upon combined treatment with rhAFP, showing high therapeutic potential for cancer treatment.

EXAMPLE 17

Use of Recombinant AFP in Cosmetology

(83) In view of the fact that AFP has the capability to stimulate the growth of stem cells and is a growth factor for embryonic cells, its possible use is proposed for the preparation of cosmetic masks, creams and lotions. rhAFP may be used as an excipient for liposome, microsome and nanosome. In view of the fact that AFP is capable of binding hydrophobic ligands, in particular, fat-soluble vitamins, steroids, isoflavonoids, polyunsaturated fatty acids (Deutsch H. F., 1991, Adv. Anc. Res. 56, 253-312); Aussel C. & Masseyeff R. 1994, Biochem. Blophys. Res. Commun. 119: 1122-1127; Deutsch H. F., 1994, J. Tumor Marker Oncol. 9:11-14), the combined use of rhAFP with fat-soluble vitamins, such as derivatives of retinoids, carotinoids, tocoferol, vitamin D, with steroids such as derivatives of estrogens and androgens, is shown. Estradiols and others may be used as an example of such steroids.

EXAMPLE 18

Use of rhAFP for Tissue Regeneration and Repairing

(84) To test ability of rhAFP to stimulate regeneration of damaged tissue we established classical wound healing assay with normal Human Umbilical Vein Endothelial Cells (HUVEC) obtained after surgical resection of human vein tissue. HUVEC cells were cultivated in DMEM/F12 medium with addition 10% FBS and 0.1% ECGF on the 60 mm Petri dishes at 37 C. at 5% CO.sub.2 atmosphere. HUVECs were plated on gelatin-coated 24-well plates, and grown for confluence, than monolayers were wounded and cells were incubated in serum-free medium with 50 g/ml rhAFP or 50 g/ml HSA, healing was observed after 18 hrs incubation. Images of wound healing were taken after staining with crystal violet. Representative photomicrographs of cells treated with HSA (control), and cells treated with rhAFP are shown in FIG. 11. RhAFP significantly activated the migration of HUVEC to the wounded area. These data indicate that rhAFP can be used as a component of therapeutic compositions for tissue regeneration after various damage condition.

(85) The dosage dependence of the effect of AFP on cellular growth was also studies for the primary culture of human embryoanal fibroblasts. AFP had a stimulating effect on these cells, reaching 50-90% in respect to the control (FIG. 7).

(86) These data demonstrate potential of use of rhAFP for regeneration of skin and vascular tissues and for therapeutic cosmetics followed after traumatic and age tissue damage.