PREPARATION METHOD FOR AEROLYSIN NANOPORE AND APPLICATION THEREOF
20180067076 ยท 2018-03-08
Inventors
Cpc classification
C12Q2537/164
CHEMISTRY; METALLURGY
G01N33/48721
PHYSICS
C12Q2537/164
CHEMISTRY; METALLURGY
International classification
Abstract
A preparation method for an aerolysin nanopore in this disclosure comprises the following steps; (1) pretreatment of an aerolysin; (2) preparation of a lipid bilayer membrane by pulling process; (3) forming of the aerolysin nanopore: the aerolysin nanopore is obtained at a current of 505 pA. The aerolysin nanopore prepared in the invention is structurally stable and has a high resolution with the whole internal cavity carried with a positive charge, can be used for detection without modification and is easily operated. Further, the aerolysin nanopore can be applied in DNA sequencing, DNA damage and Micro-RNA detection.
Claims
1. A preparation method for an aerolysin nanopore, comprising the following steps: (1) pretreatment of an aerolysin, in which: a trypsin-EDTA solution and the aerolysin are mixed at a ratio of 1:100 and incubated at room temperature for 10 min to activate the aerolysin, and the activated aerolysin is treated in a PBS buffer and stored in a refrigerator at 20 C. at a concentration ranging from 0.1 to 10 mg/ml; (2) preparation of a lipid bilayer membrane by pulling process, in which: the lipid bilayer membrane is formed at a polyacetal resin chamber as a carrier, wherein the polyacetal resin chamber comprises chamber I (i.e., cis chamber) and chamber II (i.e., trans chamber), with the chamber II embedded in the chamber I; the polyacetal resin chamber is divided into two regions after the lipid bilayer membrane is formed: as the aerolysin nanopore is unidirectional when embedded into the lipid bilayer membrane, the region corresponding to a relatively large opening of the aerolysin nanopore embedded in the lipid bilayer membrane is defined as the chamber I while the other region, corresponding to a relatively small opening of the aerolysin nanopore, is defined as the chamber II; the chamber II provided with a small pore of with the diameter of 50 m, wherein the small pore is configured for forming the lipid bilayer membrane; the chamber I is provided in a lateral side thereof with a pulling pore in communication with an interior of the chamber I, wherein the pulling pore is configured for insertion by an injector for pulling an internal solution; and a 1,2-diglycanoyl phospholipid to be used for forming the lipid bilayer membrane is stored in a chloroform solution in a refrigerator at 20 C.; the step of preparation of the lipid bilayer membrane more specifically comprising the sub-steps of: (a) drying the chloroform in the 1,2-diglycanoyl phospholipid chloroform solution and adding 90 l of n-decane into the chloroform-removed 1,2-diglycanoyl phospholipid to prepare a phospholipid n-decane solution, prior to the step of preparation of the lipid bilayer membrane; (b) smearing the phospholipid n-decane solution evenly on both internal and external sides of the small pore of the chamber 2 of 1 mL with a sable paint brush and drying the applied phospholipid n-decane solution with a flow of N.sub.2 to form a lipid bilayer membrane; (c) putting the chamber I and the chamber II together, adding 1 mL of an electrolyte solution into each the chamber, immersing a pair of Ag/AgCl electrodes into the electrolyte solution, and applying a potential of 100 mV across lipid bilayer membrane via output ends of a current amplifier, wherein the cis chamber is defined as a virtual ground; (d) pulling the electrolyte solution repeatedly to form the lipid bilayer membrane at the small pore of the trans chamber; monitoring the quality of the formed lipid bilayer membrane via capacitance, applying a potential of 400 mV to examine the mechanical strength of the lipid bilayer during formation of the lipid bilayer membrane; If the lipid bilayer membrane is broken, pulling the electrolyte to form another lipid bilayer membrane the capacitance of the another lipid bilayer membrane will be equal to or higher than the capacitance of the broken lipid bilayer membrane such that the another lipid bilayer membrane is capable of forming a nanopore; and if the capacitance of the another lipid bilayer membrane is reduced, the potential of 400 mV is persistently applied; and (5) if the lipid bilayer membrane does not break under the potential of 400 mV, brushing the lipid bilayer membrane with a sable paint brush till the lipid bilayer membrane breaks, further, pulling the electrolyte to form a new lipid bilayer membrane, and then repeating the sub-steps (c) and (d) till a lipid bilayer membrane capable of forming a nanopore is obtained; and (3) formation of the aerolysin nanopore, in which: 1-10 l of the aerolysin is added into the cis chamber after a stable the lipid bilayer membrane is formed, and a potential is applied to embed the aerolysin into the lipid bilayer membrane; the ionic current increases abruptly when the aerolysin forms a stable nanopore in the lipid bilayer membrane; at the same time, the aerolysin nanopore at a current of 505 pA under a potential of 100 mV can be obtained.
2. The method for preparing an aerolysin nanopore as claimed in claim 1, the range of the potential applied in Step (3) is 100-300 mV.
3. The method for preparing an aerolysin nanopore as claimed in claim 1, more than one nanopore can be obtained simultaneously via the preparation method, wherein the insertion of a nanopore corresponds to the current increase of 505 pA under a potential of 100 mV.
4. Applications of the aerolysin nanopore prepared by the method as claimed in claim 1 in DNA sequencing, DNA damage and Micro-RNA detection.
5. The application as claimed in claim 4, the method of the detection is as follows: (1) a potential is applied across the nanopore, and the analyte is added to one side of the chamber, the analyte is driven into the aerolysin nanopore and interacts with the aerolysin nanopore to generate a blocking current signal corresponding to its structural variation; (2) changing the applied potential, and recording the blocking current signal generated at different potentials; (3) by making a statistic on the duration time, blocking current and signal frequency of recorded signals, the information about the analyte can be obtained.
6. The application as claimed in claim 4, DNA sequences, such as AGA, GGA, CGA and TGA, having only one base difference can be distinguished.
7. The application as claimed in claim 4, the application enables DNA sequencing: the inner diameter of the aerolysin nanopore can be smaller and have a higher resolution for single base by embedding the -cyclodextrin into the aerolysin nanopore.
8. The application as claimed in claim 4, the application enables DNA sequencing: different combinations of four bases are detected by taking four bases as a unit, and the DNA sequence is determined according to the characteristic current value corresponding to each combination.
9. The application as claimed in claim 4, the DNA cleavage enzyme is ligated at the mouth of aerolysin nanopore, and the determination and cleavage of DNA is realized at the same time in the process that DNA passes through the aerolysin nanopore.
10. The application as claimed in claim 4, the phi29 DNA polymerase is bound at the mouth of aerolysin nanopore, and DNA interacts with the phi29 DNA polymerase when entering into the aerolysin nanopore which reduces the speed of the DNA passing through the nanopore.
11. The application as claimed in claim 4, the application can detect the DNA damage including the replacement, disappearance and insertion of the base which is specifically divided into: (1) the tautomerism of the base, such as the mismatch by tautomerism between the enol and the keto bases: (2) the deamination of the base, that is, the exocyclic amino of the base will spontaneously fall off, so that the cytosine will become the uracil, the adenine will become the hypoxanthine (H), and the guanine will become the xanthine (X); (3) depurination and depyrimidination, the spontaneous hydrolysis can make the purine and the pyrimidine fall from the DNA-chain ribosyl phosphate skeleton; (4) base modification and chain breakage, the cell respiration not only generates the thymine glycol, hydroxymethyl uracil and other base modifiers, but also may cause structural changes such as the breakage of DNA single chain and other damage, the methylation inside DNA and hydroxymethylation; (5) base alkylation caused, the loss of base and the breakage of the DNA chain by the alkylating agent.
12. The application as claimed in claim 4, characterized in that the application can be used for the detection of different lengths of the telomere.
13. The application as claimed in claim 4, characterized in that the application can be used for the detection of various Micro-RNAs without labeling.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055] The reference numbers in figures are as follows: 1. cis chamber; 2. pulling pore; 3. trans chamber; 4. small pore; 5. polyacetal resin chamber; 6. electrolyte solution; 7. lipid bilayer membrane; 8. cyclodextrin; 9. cleavage enzyme; 10. single nucleotide; 11. template chain; 12. primer chain; 13. oligomeric DNA chain; 14. DNA polymerase.
DESCRIPTION OF THE INVENTION
[0056] Specific embodiments of the preparation method for an aerolysin nanopore in the disclosure are described with reference to the accompanying drawings as follows, with five embodiments and seven application examples provided. Notably, however, the implementation of the disclosure is not limited to the following embodiments.
Embodiment 1
[0057] Referring to
[0058] (1) pretreatment of an aerolysin, in which:
[0059] a trypsin-EDTA solution and the aerolysin are mixed at a ratio of 1:100 and incubated at room temperature for 10 min for activating the aerolysin, and the activated aerolysin is treated in a PBS buffer and stored in a refrigerator at 20 C. at a concentration of 0.1 mg/ml;
[0060] (2) preparation of a lipid bilayer membrane by pulling process, in which:
[0061] the lipid bilayer membrane 7 is formed at a polyacetal resin chamber 5 as a carrier, wherein the polyacetal resin chamber 5 comprises chamber I (i.e., cis chamber 1, as shown in
[0062] {circle around (1)} smearing of the phospholipid n-decane solution: removing the chloroform in the 1,2-diglycanoyl phospholipid chloroform solution and adding 90 l of n-decane into the chloroform-removed 1,2-diglycanoyl phospholipid to prepare a phospholipid n-decane solution, prior to the step of preparation of the lipid bilayer membrane;
[0063] {circle around (2)} smearing of the phospholipid n-decane solution: smearing the phospholipid n-decane solution evenly on both internal and external sides of the small pore 4 of the chamber II (1 mL) with a sable paint brush and drying the applied phospholipid n-decane solution with a flow of N.sub.2 to form a lipid bilayer membrane;
[0064] {circle around (3)} application of potential, putting the chamber I and the chamber II together, adding 1 mL of an electrolyte solution 6 into each the chamber, immersing a pair of Ag/AgCl electrodes into the electrolyte solution 6, and applying a potential of 100 mV across lipid bilayer membrane 7 via output ends of a current amplifier, wherein the cis chamber 1 is defined as a virtual ground;
[0065] {circle around (4)}0 pulling the electrolyte solution repeatedly (the pulling principle is as shown in
[0066] {circle around (5)} testing and repetition, if the lipid bilayer membrane does not break under the potential of 400 mV, brushing the lipid bilayer membrane with a sable paint brush till the lipid bilayer membrane breaks, further, pulling the electrolyte to form a new lipid bilayer membrane, and then repeating the sub-steps {circle around (3)} and {circle around (4)} till a lipid bilayer membrane capable of forming a nanopore is obtained; and
[0067] (3) formation of the aerolysin nanopore, in which:
[0068] 10 l of the aerolysin is added into the cis chamber 1 after a stable lipid bilayer membrane is formed, and a potential of 100 mV is applied to embed the aerolysin into the lipid bilayer membrane. The ionic current increases abruptly when the aerolysin forms a stable nanopore in the lipid bilayer membrane. At the same time, the aerolysin nanopore at a current of 505 pA under a potential of 100 mV can be obtained.
[0069] The detection analysis on the prepared aerolysin nanopore in Embodiment 1:
[0070] To determine whether the resulting aerolysin nanopore can be used for detection, firstly we should check whether the displayed current value of the prepared aerolysin nanopore remains in the normal range, that is, the current value corresponding to a single nanopore at a potential of 100 mV is at 505 pA; second, the time-current curve without analyte at a different potential of (200 mV+200 mV) should be recorded after the preparation of the aerolysin nanopore, so as to determine whether the resulting aerolysin nanopore is stable, the stability of the recorded time-current curve means the resulting aerolysin nanopore can be used for detection.
[0071] Embodiment 1: the results of the detection analysis on the prepared aerolysin nanopore show that the aerolysin can be used for detection applications.
Embodiment 2
[0072] A method for preparing an aerolysin nanopore comprises the following steps:
[0073] (1) pretreatment of an aerolysin, substantially consistent with Embodiment 1; the difference is that the stored concentration of aerolysin after activation is 10 mg/ml.
[0074] (2) preparation of a lipid bilayer membrane by pulling process (consistent with Embodiment 1).
[0075] (3) formation of the aerolysin nanopore, substantially consistent with Embodiment 1; the difference is that 1 l of the aerolysin is added into the cis chamber 1 after a stable lipid bilayer membrane is formed, and a potential of 200 mV is applied to embed the aerolysin into the lipid bilayer membrane, wherein an ionic current increases abruptly when the aerolysin forms a stable nanopore in the lipid bilayer membrane, and wherein the aerolysin nanopore is obtained at a current of 1005 pA under a potential of 200 mV.
[0076] For Embodiment 2, the detection and analysis of the prepared aerolysin nanopore are substantially consistent with Embodiment 1.
[0077] The potential is adjusted to 100 mV to verify whether the current of the aerolysin nanopore prepared in Embodiment 2 is in the range of 505 pA.
Embodiment 3
[0078] A method for preparing an aerolysin nanopore comprises the following steps:
[0079] (1) pretreatment of an aerolysin, substantially consistent with Embodiment 1; the difference is that the stored concentration of aerolysin after activation is 1.5 mg/ml.
[0080] (2) preparation of a lipid bilayer membrane by pulling process (consistent with Embodiment 1).
[0081] (3) formation of the aerolysin nanopore, substantially consistent to Embodiment 1; the difference is that 3 l of the aerolysin is added into the cis chamber 1 after a stable lipid bilayer membrane is formed, and a potential of +300 mV is applied to embed the aerolysin into the lipid bilayer membrane, wherein an ionic current increases abruptly when the aerolysin forms a stable nanopore in the lipid bilayer membrane, and wherein the aerolysin nanopore is obtained at a current of 1505 pA under a potential of 300 mV.
[0082] For Embodiment 3, the detection and analysis of the prepared aerolysin nanopore are substantially consistent with Embodiment 1.
[0083] The potential is adjusted to 100 mV to verify whether the current of the aerolysin nanopore prepared in Embodiment 3 is in the range of 505 pA.
Embodiment 4
[0084] A method for preparing an aerolysin nanopore comprises the following steps:
[0085] (1) pretreatment of an aerolysin, substantially consistent with Embodiment 1; the difference is that the stored concentration of aerolysin after activation is 0.5 mg/ml;
[0086] (2) preparation of a lipid bilayer membrane by pulling process (consistent with Embodiment 1);
[0087] (3) formation of the aerolysin nanopore (substantially consistent to Embodiment 1); the difference is that 5 l of the aerolysin is added into the cis chamber 1 after a stable lipid bilayer membrane is formed, and a potential of 150 mV is applied to embed the aerolysin into the lipid bilayer membrane, wherein an ionic current increases abruptly when the aerolysin forms a stable nanopore in the lipid bilayer membrane, and wherein the aerolysin nanopore is obtained at a current of 755 pA under a potential of 150 mV.
[0088] For Embodiment 4, the detection and analysis of the prepared aerolysin nanopore are substantially consistent with Embodiment 1.
[0089] The potential is adjusted to 100 mV to verify whether the current of the aerolysin nanopore prepared in Embodiment 4 is in the range of 505 pA.
Embodiment 5
[0090] A method for preparing an aerolysin nanopore comprises the following steps:
[0091] (1) pretreatment of an aerolysin, substantially consistent with Embodiment. 1; the difference is that the stored concentration of aerolysin after activation is 1.5 mg/ml;
[0092] (2) preparation of a lipid bilayer membrane by pulling process (consistent with Embodiment 1);
[0093] (3) formation of the aerolysin nanopore, substantially consistent with Embodiment 1; the difference is that 3 l of the aerolysin is added into the cis chamber 1 after a stable lipid bilayer membrane is formed, and a potential of 100 mV is applied to embed the aerolysin into the lipid bilayer membrane, wherein an ionic current increases abruptly when the aerolysin forms a stable nanopore in the lipid bilayer membrane, and wherein the aerolysin nanopore is obtained at a current of 1505 pA under a potential of 100 mV.
[0094] For Embodiment 5, the detection and analysis of the prepared aerolysin nanopore are substantially consistent with Embodiment 1.
Application Example 1
[0095] Single base discrimination can be carried out via an aerolysin nanopore as follows:
[0096] (1) a potential is applied across the nanopore, and a single stranded DNA with only one different base site is added to one end of the polyacetal resin chamber 5, wherein the sequence may be AGA, GGA, CGA, TGA; or AAA, TAA, CAA, GAA, or any other DNA sequence having a different length and a different base site. An applicable DNA sequence is shown in
[0097] (2) changing the potential applied across the aerolysin nanopore, and recording the blocking current signal generated at different potentials;
[0098] (3) by performing a statistical analysis on the blocking extent of the collected signals (i.e., the ratio of the blocking current to the open pore current), DNA sequences containing different bases can be clearly distinguished. Furthermore, the difference between a single or multiple bases resulting from DNA damage could be detected.
Application Example 2
[0099] The DNA sequencing can be carried out by way of adding a cleavage enzyme into the mouth of aerolysin nanopore as follows:
[0100] (1) for any DNA sequence, four base sequences are taken as a unit, so there have a total of 64 arrangements, with each corresponding to a characteristic blocking current value. 64 kinds of DNA sequences with different arrangements are added into cis chamber 1 of the polyacetal resin chamber 5 respectively, and the corresponding blocking current values are counted for each arrangement;
[0101] (2) a length of the single stranded DNA to be detected is added into cis chamber 1, the single stranded DNA would be cleaved by taking four bases as a unit under the action of the cleavage enzyme and falls into the aerolysin nanopore to generate its characteristic blocking current value;
[0102] (3) the detected single-stranded DNA sequence can be obtained by comparing the blocking current value generated in Step (2) with the 64 blocking current values measured in Step (1),
Application Example 3
[0103] The DNA sequencing can be carried out by embedding cyclodextrin into the aerolysin nanopore, with the experimental principle as shown in
[0104] (1) The -cyclodextrin 8 is added from cis chamber 1 or trans chamber 3, and the -cyclodextrin 8 can be embedded into the aerolysin nanopore so that the effective inner diameter of the aerolysin nanopore is smaller.
[0105] (2) After the -cyclodextrin 8 is embedded, the open pore current decreases, and at this time, four bases of A, T, C and G are added respectively; the cyclodextrin 8 modified aerolysin nanopore can generate different characteristic currents for the four bases of A, T, C and G.
[0106] (3) The DNA cleavage enzyme 9 is added into cis chamber 1 of the polyacetal resin chamber 5, and then the single stranded DNA to be detected is added; the single stranded DNA to be detected can be cleaved by the DNA cleavage enzyme 9 into single bases (single nucleotides 10) and can be detected sequentially in the aerolysin nanopore that the cyclodextrin 9 is embedded.
[0107] (4) To make the cleavage enzyme 9 close to the mouth of the nanopore in the detection, the method for applying the salt concentration gradient at both ends of the aerolysin nanopore is conducted; the concentration of potassium chloride in cis chamber 1 and trans chamber 3 is 250 mM and 500 mM respectively, and the electrolyte solution at both ends contains 25 mM of Tris-HCl respectively, with the pH adjusted to 7.9.
Application Example 4
[0108] The DNA sequencing can be carried out by way of binding the phi29 DNA polymerase 14 to the aerolysin nanopore.
[0109] As one member of the -family polymerase, the phi29 DNA polymerase 14 can rotate the single strand DNA enter into the nanopore like a gear, and each DNA chain extends into the nanopore in the polymerase proofing process and exits out of the nanopore in the DNA polymerizing process, so as to realize the secondary detection of each nucleotide in the nanopore and improve the time resolution and the accuracy of the DNA sequencing.
[0110] (1) The phi29 DNA polymerase 14 is added into cis chamber 1 and a DNA chain containing the DNA sequence to be read is added additionally; this DNA chain comprises a template chain 11 containing a sequence to be read, a primer chain 12 and a oligomeric DNA chain 13, wherein the primer chain 12 has a length of hairpin structure on its 5-phosphate end to prevent the phi29 DNA polymerase from reacting with the double-stranded end of the DNA after complementary pairing. The oligomeric DNA chain 13 and the template chain 11 both contain abasic residues and thus can be identified through the changes of current at the two ends of the DNA sequence.
[0111] (2) 10 mM of the magnesium chloride and 100 uM of dCTP, dATP, dTTP and dGTP each are added into cis chamber 1 of the polyacetal resin chamber 5 for DNA synthesis; the detection should be conducted at room temperature.
[0112] (3) The principle of DNA sequencing with the phi29 DNA polymerase 14 is shown in
Application Example 5
[0113] DNA damage can be detected via an aerolysin nanopore.
[0114] (1) Methylation of DNA, one embodiment is the methylation of cytosine, and the cytosine structure before and after methylation is shown in
[0115] (2) The CG DNA sequence containing the unmethylated cytosine is added into the chamber separately.
[0116] (3) The DNA sequences containing the unmethylated and methylated cytosines are mixed at a ratio of 1:1 and added into the chamber.
[0117] (4) By performing a statistical analysis on the signals obtained from Steps (1), (2) and (3), it should be understood that two DNA sequences can be distinguished via the aerolysin nanopore in the disclosure, so that the peak value of the blocking current when the DNA sequences are added upon mixture can well correspond to that of the blocking current when the DNA sequences are added separately.
Application Example 6
[0118] The telomere detection can be carried out via an aerolysin nanopore.
[0119] The telomere is a small portion of the DNA-protein complex present at the end of the linear chromosome of the eukaryotic cell, which together with the telomere binding protein constitutes a special hat structure that retains the integrity of the chromosome. The telomere DNA is composed of the simple DNA-highly-repetitive sequences, and the telomerase can be used for tailing of the telomere DNA; once DNA molecules split and replicate each time, the telomere will shorten (such as Okazaki fragments). When the telomere is exhausted, the chromosomes are susceptible to mutations which may lead to arteriosclerosis and certain cancers. So the length of the telomere can reflect the history of cell replication and the replication potential, which is known as the mitotic clock of the cell life. The human telomere DNA sequence is composed of repeated units of n TTAGGG sequences. Different ages corresponding to different lengths of telomeres so as to correspond to the signals with different characteristics. According to this principle, people can detect the telomeres in different age groups and detect their corresponding blockade current and duration times, so as to obtain the distribution of human telomere lengths in different ages.
[0120] The step of detection more specifically comprises the sub-steps of:
[0121] (1) different age groups of human cells are taken, and the telomere DNA sequence at the end of its chromosome is extracted, by biological means. Taking 10 years of age as a span, that is, the telomeres in human bodies of people aged 0, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 are detected. 20 people at the same age are randomly selected for sampling, and the samples are centrifuged and diluted and then added into the chamber for detection;
[0122] (2) the statistics on detection results for each age group are conducted: the blocking current and blocking time corresponding to the peaks are taken as two characteristic values for this age group, and the age-blocking current curve and the age-duration times curve are drawn respectively;
[0123] (3) the samples of unknown age to be detected are centrifuged and diluted and then added into the chamber, the statistics on the blocking current and the duration times are conducted. The age of the samples can be obtained corresponding to the age-blocking current curve and the age-blocking time curve.
Application Example 7
[0124] The Micro-RNA detection can be carried out via an aerolysin nanopore.
[0125] Micro-RNA has the role of regulating the expression of genes in the human body, with the Micro-RNA levels in the human body directly related to various diseases. The latest studies show that the levels of Micro-RNA-21-5P and Micro-RNA-92a-3P in rectal cancer patients are on the rise. The application of the aerolysin nanopore in the disclosure not only distinguishs various Micro-RNAs, but also enables the quantitative detection of actual samples so that the level of Micro-RNA in actual samples can be detected at the single molecule level specificity without labeling for the clinical diagnosis of diseases.
[0126] The Micro-RNA sequences to be tested are as follows:
TABLE-US-00001 Micro-RNA21: UAGCUUAUCAGACUGAUGUUGA; Micro-RNA92: UAUUGCACUUGUCCCGGCCUGU.
[0127] The step of detection more specifically comprises the sub-steps of:
[0128] (1) the Micro-RNA21 and the Micro-RNA92 with the same concentration are added into the chamber, and the statistics on the current signals generated by three kinds of Micro-RNAs are conducted;
[0129] (2) the Micro-RNA21 and the Micro-RNA92 with different concentrations are measured, and the concentrations should be linear with the frequency of signals;
[0130] (3) the samples to be detected are centrifuged and then added into the chamber; based on the concentration-frequency curve measured in Step (1), the level of Micro-RNAs in the sample to be detected can be obtained for the early diagnosis of diseases.
[0131] Notably, the foregoing are only preferable embodiments of the disclosure. It will be apparent to those skilled in the art that certain improvements and modifications may be made without departing from the method of the disclosure, and that such improvements and modifications are included in the scope of the disclosure.