Dermal fillers and applications thereof
12186449 ยท 2025-01-07
Assignee
Inventors
- Oded Shoseyov (Shoham, IL)
- Nadav ORR (Mazkeret Batya, IL)
- Jasmine Seror Maknouz (Tel-Aviv, IL)
- Revital ZARKA (Mazkeret Batya, IL)
Cpc classification
C08L5/08
CHEMISTRY; METALLURGY
A61K8/65
HUMAN NECESSITIES
C08L89/04
CHEMISTRY; METALLURGY
A61K2800/81
HUMAN NECESSITIES
A61K8/735
HUMAN NECESSITIES
C12N15/8257
CHEMISTRY; METALLURGY
A61L27/3687
HUMAN NECESSITIES
International classification
A61K8/65
HUMAN NECESSITIES
A61L27/36
HUMAN NECESSITIES
C08L5/08
CHEMISTRY; METALLURGY
C08L89/04
CHEMISTRY; METALLURGY
Abstract
The disclosure herein relates to photoinitiated dermal fillers, hyaluronic acid-rhCollagen double crosslinked dermal fillers and hyaluronic acid-rhCollagen semi interpenetrated network, each comprising plant-derived human collagen, as well as methods of using the same.
Claims
1. A polymerizable solution comprising: a cross-linkable, plant-derived recombinant type 1 human collagen (rhcollagen); a hyaluronic acid (HA), a modified HA derivative, a poly(vinyl alcohol) (PVA), a modified PVA derivative, a polyethylene glycol (PEG), a modified PEG derivative, oxidized cellulose (OC), a modified OC derivate, polymethylmethacrylate (PMMA) microspheres, modified PMMA microsphere derivatives, tricalcium phosphate (TCP), a modified TCP derivative, calcium hydroxylapatite (CaHA), a modified CaHA derivative, carboxymethylcellulose, a modified carboxymethylcellulose derivative, crystalline nanocellulose (CNC), a modified CNC derivative, or a combination thereof; and a photoinitiator.
2. The polymerizable solution of claim 1, wherein the cross-linkable, plant-derived human collagen is methacrylated or thiolated plant-derived recombinant type 1 human collagen (rhcollagen).
3. The polymerizable solution of claim 1, wherein the modified derivative of hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), polymethylmethacrylate (PMMA) microspheres, tricalcium phosphate (TCP), calcium hydroxylapatite (CaHA), carboxymethylcellulose, or crystalline nanocellulose (CNC) comprises a methacrylated or thiolated derivative.
4. The polymerizable solution of claim 1, wherein the hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), polymethylmethacrylate (PMMA) microspheres, tricalcium phosphate (TCP), calcium hydroxylapatite (CaHA), carboxymethylcellulose, or crystalline nanocellulose (CNC) comprises a crosslinked hyaluronic acid (HA), crosslinked poly(vinyl alcohol) (PVA), crosslinked polyethylene glycol (PEG), crosslinked oxidized cellulose (OC), crosslinked polymethylmethacrylate (PMMA) microspheres, crosslinked tricalcium phosphate (TCP), crosslinked calcium hydroxylapatite (CaHA), crosslinked carboxymethylcellulose, or crosslinked crystalline nanocellulose (CNC).
5. The polymerizable solution of claim 1, comprising: methacrylated or thiolated plant-derived recombinant type 1 human collagen (rhcollagen); a crosslinked hyaluronic acid (HA), crosslinked poly(vinyl alcohol) (PVA), crosslinked polyethylene glycol (PEG), crosslinked oxidized cellulose (OC), crosslinked polymethylmethacrylate (PMMA) microspheres, crosslinked tricalcium phosphate (TCP), crosslinked calcium hydroxylapatite (CaHA), crosslinked carboxymethylcellulose, or crosslinked crystalline nanocellulose (CNC); and said photoinitiator.
6. The polymerizable solution of claim 1, comprising: methacrylated plant-derived recombinant type 1 human collagen (rhcollagen); a hyaluronic acid (HA), a crosslinked hyaluronic acid (HA), a methacrylated or thiolated hyaluronic acid (HA) or any combination of said hyaluronic acid (HA), said crosslinked hyaluronic acid (HA), and said methacrylated or thiolated hyaluronic acid (HA); and a photoinitiator.
7. The polymerizable solution of claim 6, wherein a ratio of said hyaluronic acid (HA), said crosslinked hyaluronic acid (HA), said methacrylated or thiolated hyaluronic acid (HA) or said combination thereof to said methacrylated plant-derived recombinant type 1 human collagen (rhcollagen) ranges from 6:1 to 1:6.
8. The polymerizable solution of claim 7, wherein said ratio ranges from 4:1 to 1:4 or from 3:1 to 1:3, or from 3:1 to 2:1.
9. The polymerizable solution of claim 1, wherein the cross-linkable, plant-derived recombinant type 1 human collagen and the photoinitiator are included together and independently from said hyaluronic acid (HA), said modified HA derivative, said poly(vinyl alcohol) (PVA), said modified PVA derivative, said polyethylene glycol (PEG), said modified PEG derivative, said oxidized cellulose (OC), said modified OC derivate, said polymethylmethacrylate (PMMA) microspheres, said modified PMMA microsphere derivatives, said tricalcium phosphate (TCP), said modified TCP derivative, said calcium hydroxylapatite (CaHA), said modified CaHA derivative, said carboxymethylcellulose, said modified carboxymethylcellulose derivative, said crystalline nanocellulose (CNC), said modified CNC derivative, or said combination thereof.
10. The polymerizable solution of claim 1, wherein the cross-linkable, plant-derived recombinant type 1 human collagen, said hyaluronic acid (HA), said modified HA derivative, said poly(vinyl alcohol) (PVA), said modified PVA derivative, said polyethylene glycol (PEG), said modified PEG derivative, said oxidized cellulose (OC), said modified OC derivate, said polymethylmethacrylate (PMMA) microspheres, said modified PMMA microsphere derivatives, said tricalcium phosphate (TCP), said modified TCP derivative thereof, said calcium hydroxylapatite (CaHA), said modified CaHA derivative, said carboxymethylcellulose, said modified carboxymethylcellulose derivative, said crystalline nanocellulose (CNC), said modified CNC derivative, or said combination thereof, and said photoinitiator are included together.
11. The polymerizable solution of claim 1, further comprising a non-modified plant-derived recombinant type 1 human collagen.
12. The polymerizable solution of claim 1, wherein a concentration of said cross-linkable, plant-derived recombinant type 1 human collagen ranges from 1 to 12 mg/ml.
13. The polymerizable solution of claim 1, being an injectable solution at the temperature of use, and/or having a texture and viscosity which permits flow through a suitable delivery device.
14. The polymerizable solution of claim 1, being a photocurable solution.
15. The polymerizable solution of claim 1, wherein the photoinitiator induces polymerization of the polymerizable solution in response to visible light having a wavelength of 390-800 nm.
16. The polymerizable solution of claim 1, being a dermal filler.
17. The polymerizable solution of claim 1, being capable of augmenting a tissue in a subject.
18. The polymerizable solution of claim 17, wherein said tissue is skin tissue.
19. The polymerizable solution of claim 1, being capable of filling a tissue space under an epidermis.
20. A double crosslinked dermal filler comprising: (a) a plant-derived recombinant human type 1 collagen; and (b) a crosslinked hyaluronic acid; wherein the plant-derived human collagen is crosslinked to the crosslinked hyaluronic acid.
21. The double crosslinked dermal filler of claim 20, further comprising a non-crosslinked hyaluronic acid.
22. The double crosslinked dermal filler of claim 20, wherein the crosslinker linking the crosslinked hyaluronic acid differs from the crosslinker linking the plant-derived recombinant human type 1 collagen with the crosslinked hyaluronic acid.
23. The double crosslinked dermal filler of claim 20, wherein a ratio of said crosslinked hyaluronic acid to said plant-derived recombinant human type-1 collagen ranges from 6:1 to 1:6.
24. The double crosslinked dermal filler of claim 20, wherein a concentration of said crosslinked hyaluronic acid ranges from 5 to 50 mg/ml.
25. The double crosslinked dermal filler of claim 23, wherein a concentration of said crosslinked hyaluronic acid ranges from 5 to 50 mg/ml.
26. The double crosslinked dermal filler of claim 20, wherein the crosslinker crosslinking said hyaluronic acid and the crosslinker crosslinking said plant-derived recombinant human type 1 collagen are each independently selected from 1, 4-butanediol diglycidyl ether (BDDE), 1-[3-(Dimethylamino)propyl]-3-ethylcarbodiimide methiodide (EDC), N,N-dicyclohexylcarbodiimide (DCC), N,N-diisopropylcarbodiimide (DIC), Divinyl Sulfone (DVS) and glutaraldehyde.
27. A method of preparing a double crosslinked dermal filler comprising a plant-derived recombinant human type-1 collagen crosslinked to a crosslinked hyaluronic acid, the method comprising: crosslinking hyaluronic acid; neutralization of the crosslinked hyaluronic acid; neutralization of the plant-derived human collagen; mixing the neutralized crosslinked hyaluronic acid with the neutralized plant-derived human collagen; adding lower molecular weight hyaluronic acid (MW HA); crosslinking the mix of crosslinked hyaluronic acid and plant-derived human collagen; and dialyzing double crosslinked hyaluronic acid-plant-derived human collagen dermal filler.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
DETAILED DESCRIPTION
(60) Disclosed herein are photoinitiated dermal fillers and double crosslinked dermal fillers, and cellular growth promoting scaffolds, and methods of using the same, for example but not limited to, for soft tissue augmentation.
(61) Collagen-producing plants can be used to produce collagen chains as well as collagen, but such chains are incorrectly hydroxylated and thus self-assembly thereof, whether in planta or not, leads to collagen which is inherently unstable in contrast to the plant-derived human collagen of the present application.
(62) While reducing the present polymerizable and double crosslinked solutions, and methods of use, to practice, the practitioners have devised a plant expression approach which ensures correct hydroxylation of collagen chains and thus enables in-planta production of collagen which closely mimics the characteristics (e.g. molecular structure, temperature stability, cellular interactions) of human type I collagen.
(63) In one aspect, disclosed herein is a method of filling a tissue space under an epidermis comprising: (a) introducing a polymerizable solution into the tissue space, the polymerizable solution comprising: (i) a cross-linkable, plant-derived human collagen; and (ii) a photoinitiator; and (b) applying light to the surface of the epidermis superficial to said space to induce polymerization.
(64) In a particular embodiment, the method further comprises, prior to, or concomitant with, the step of applying light, molding or sculpting the polymerizable solution into a desired configuration in the tissue space. In another particular embodiment, the molding or sculpting step reduces lines, folds, fine lines, wrinkles, or scars.
(65) In yet another particular embodiment, the polymer solution further comprises a filler comprising a hyaluronic acid (HA) or a modified derivative thereof, a poly(vinyl alcohol) (PVA) or a modified derivative thereof, polyethylene glycol (PEG) or a modified derivative thereof, oxidized cellulose (OC) or a modified derivative thereof, or a combination thereof. In one particular embodiment, the isolated plant-derived human collagen is optionally formulated, such as with hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), polymethylmethacrylate (PMMA) microspheres, tricalcium phosphate (TCP), calcium hydroxylapatite (CaHA), carboxymethylcellulose, crystalline nanocellulose (CNC) or a combination thereof.
(66) Modified derivatives include, but are not limited to, photopolymerizable versions of, e.g., HA, PVA, PEG, or OC. Modifications include, but are not limited to, methacrylation or thiolation. In yet another particular embodiment, the light source is selected from light-emitting diode (LED), laser, xenon lamp, and the like.
(67) In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions only to itself. In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions to thiolated rhCollagen. In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions to any MA/thiolated additive. In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions to methacrylated HA. In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions to thiolated HA. In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions to methacrylated PVA. In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions to thiolated PVA. In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions to methacrylated PEG. In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions to thiolated PEG. In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions to methacrylated OC. In some embodiments, in formulations disclosed herein methacrylate rhCollagen crosslinks under illumination conditions to thiolated OC.
(68) A skilled artisan would appreciate that a photocurable formulation is actually a semi IPN before curing and becomes an IPN (interpenetrated network) after curing. An IPN may encompass two entangled networks, each one crosslinked to itself and not crosslinked to the other.
(69) In some embodiments, crosslinked formulation includes a ratio of non-modified rhCollagen to tune the stiffness following crosslinking (with light) without reducing the final total amount of rhCollagen, as non modified rhCollagen cannot crosslink under illumination, therefore does not enhance the final stiffness. Methacrylated HA may also be added to this final formulation.
(70) In some embodiments, the HA or MA-HA may be crossedlinked to itself using a crosslinker, for example but not limited to BDDE, as described in Example 23. In some embodiments, the crosslinker crosslinking HA or MA-HA comprises Divinyl Sulfone (DVS) or glutaraldehyde. In certain embodiments, the BDDE crosslinked HA or MA-HA is not further crosslinked to rhCollagen or MA-rhCollagen, creating what is called an interpenetrated network (
(71) In still another particular embodiment, the plant-derived collagen comprises rhCollagen. In another particular embodiment, the plant-derived collagen is obtained from a genetically modified plant. In another particular embodiment, the genetically modified plant is a genetically modified plant selected from the group consisting of tobacco, maize, alfalfa, rice, potato, soybean, tomato, wheat, barley, canola, carrot, and cotton. In particular, the genetically modified plant is a tobacco plant.
(72) In still another particular embodiment, the genetically modified plant comprises an expressible sequence of at least one gene sequence of human deoxyribonucleic acid (DNA) selected from the group consisting of: COL1, COL2, P4H-alpha, P4H-beta, and LH3. In another particular embodiment, the plant-derived human collagen comprises at least modified one human collagen alpha-1 chain as set forth in SEQ ID NO: 3 and as expressed in the genetically modified plant; and at least one modified human collagen alpha-2 chain as set forth in SEQ ID NO: 6 and as expressed in the genetically modified plant; and wherein the genetically modified plant further expresses an exogenous prolyl-4-hydroxylase (P4H). In another particular embodiment, the method further comprises expressing an exogenous polypeptide selected from the group consisting of lysyl hydroxylase (LH), protease N, and protease C. In yet another particular embodiment, the human collagen alpha-1 chain is encoded by a sequence as set forth in SEQ ID NO: 1. In another particular embodiment, the human collagen alpha-2 chain is encoded by a sequence as set further in SEQ ID NO: 4.
(73) In still another embodiment, the exogenous P4H is a mammalian P4H. In particular, the exogenous P4H is a human P4H. In yet another embodiment, the method further comprises targeting the human collagen alpha-1 to a vacuole of the plant or the genetically modified plant and digesting it with ficin. In yet another embodiment, the method further comprises targeting the human collagen alpha-2 to a vacuole of the plant or the genetically modified plant and digesting it with ficin.
(74) In still another embodiment, the plant-derived human collagen is atelocollagen. In another embodiment, the plant-derived human collagen is atelocollagen having an amino acid (AA) sequence derived from SEQ ID NO: 1 and SEQ ID NO: 4. Atelocollagen is derived by enzymatic digestion (e.g., with ficin) of procollagen, which is the product of SEQ ID NO: 1 and SEQ ID NO: 4.
(75) In yet another embodiment, the photoinitiator induces polymerization of the polymerizable solution in response to visible light. In particular, the visible light has a wavelength of 390-800 nm. In particular, the photoinitiator is selected from the group consisting of Eosyn Y+triethanolamine, riboflavin, and the like.
(76) In another embodiment, the photoinitiator induces polymerization of the polymerizable solution in response to ultraviolet (uv) light. In particular, the photoinitiator is selected from the group consisting of lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP) or 1-[4 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methylpropan-1-one (IRGACURE 2959).
(77) In another embodiment, the photoinitiator induces polymerization of the polymerizable solution in response to infrared light.
(78) In still another embodiment, the polymerizable solution is introduced into the tissue space via a hollow needle or cannula in the range of 27 gauge to 33 gauge.
(79) In still another embodiment, the polymerizable solution in the tissue space is molded or sculpted into the desired configuration via manual massage. In another embodiment, the polymerizable solution in the tissue space is molded or sculpted into the desired configuration using a molding or sculpting implement.
(80) In still another embodiment, the polymerizable solution in the tissue space is essentially non-gellable at room temperature. In another embodiment, the polymerizable solution in the tissue space is essentially non-gellable at 37 C. In yet another embodiment, the polymerizable solution comprising the plant-derived human collagen has a reduced viscosity at room temperature in comparison with an analogous polymerizable solution comprising a tissue-extracted human or animal-derived collagen, for example but not limited to bovine or procine or equine collagen in the same concentration and formulation. In another embodiment, the polymerizable solution comprising the plant-derived human collagen has a reduced viscosity at 37 C. in comparison with an analogous polymerizable solution comprising a tissue-extracted human or animal-derived collagen in the same concentration and formulation.
(81) As used throughout, the term animal-derived collagen may encompass bovine or procine or equine collagen or rat tail collagen and is in contrast to human derived collagen.
(82) In still another embodiment, the polymerizable solution comprising the plant-derived human collagen is introduced into the tissue space with a reduced force at room temperature as compared with an analogous polymerizable solution comprising a tissue-extracted human or animal-derived collagen in the same concentration and formulation. In still another embodiment, the polymerizable solution comprising the plant-derived human collagen is introduced into the tissue space with a reduced force at 37 C. as compared with an analogous polymerizable solution comprising a tissued-extracted human or animal-derived collagen in the same concentration and formulation.
(83) In another aspect, disclosed herein is a use of a polymerizable solution injected into a tissue space under an epidermis to reduce lines, folds, fine lines, wrinkles, or scars, the polymerizable solution comprising a methacrylated or thiolated cross-linkable, plant-derived human collagen and a photoinitiator to induce polymerization prior to, on concomitant with, application of visible light, and molding or sculpting the polymerizable solution into a desired configuration to reduce lines, folds, fine lines, wrinkles, or scars. In a particular embodiment, the polymer solution further comprises a filler comprising a hyaluronic acid (HA) or a modified derivative thereof, a poly(vinyl alcohol) (PVA) or a modified derivative thereof, polyethylene glycol (PEG) or a modified derivative thereof, oxidized cellulose (OC) or a modified derivative thereof, polymethylmethacrylate (PMMA) microspheres or a modified derivative thereof, tricalcium phosphate (TCP) or a modified derivative thereof, calcium hydroxylapatite (CaHA) or a modified derivative thereof, carboxymethylcellulose or a modified derivative thereof, crystalline nanocellulose (CNC) or a modified derivative thereof, or a combination of any of these.
(84) Modified derivatives include, but are not limited to, photopolymerizable versions of, e.g., HA, PVA, PEG, OC, PMMA, TCP, CaHA, carboxymethylcellulose, or CNC. Modifications include, but are not limited to, methacrylation or thiolation.
(85) In another aspect, disclosed herein is a method of filling a tissue space under an epidermis comprising: (a) introducing a polymerizable solution into the tissue space, the polymerizable solution comprising a cross-linkable, plant-derived human collagen.
(86) The instant technology relates, in part, to cosmetic and medical collagen-based polymerizable fillers that form a moldable composition, polymerizable on photoactivation with a light source, such as a visible light source. The polymerizable filler comprises a cross-linkable, plant-derived human collagen along with a photoinitiator.
(87) The present technology of interest has the advantage of permitting in situ formation of a custom, contoured dermal filler or implant, typically without invasive surgical intervention or general anesthesia. Generally, the collagen-based polymerizable solution is introduced into a tissue space under the skin (that is, under the epidermis), and polymerization is induced by exposure to visible light applied to the skin surface, that is, from outside of the body or outside of the skin, or to the epidermis.
(88) The in situ polymerization methods provide cosmetic and medical corrective and/or enhancement procedures using a polymerizable solution comprising a polymer component capable of forming an insoluble crosslinked crosslinking network on activation with a visible light source.
(89) In some embodiments, a dermal filler or cellular growth promoting scaffold disclosed herein is for cosmetic use. In some embodiments, a dermal filler or cellular growth promoting scaffold disclosed herein is for medical corrective use. In some embodiments, a dermal filler or cellular growth promoting scaffold disclosed herein is for use in an enhancement procedure, for example but not limited to tissue augmentation. In some embodiments, a double crosslinked dermal filler disclosed herein is for cosmetic use. In some embodiments, a double crosslinked dermal filler disclosed herein is for medical corrective use. In some embodiments, a double crosslinked dermal filler disclosed herein is required as a result of a medical or or dental (gum implants/gum disease) condition. In some embodiments, a double crosslinked dermal filler disclosed herein is required as a result of a medical condition requiring skin augmentation. In some embodiments, a double crosslinked dermal filler disclosed herein is for use in an enhancement procedure, for example but not limited to tissue augmentation. In some embodiments, a photocurable dermal filler disclosed herein is for cosmetic use. In some embodiments, a photocurable dermal filler disclosed herein is for medical corrective use. In some embodiments, a photocurable dermal filler disclosed herein is required as a result of a medical or or dental (gum implants/gum disease) condition. In some embodiments, a photocurable dermal filler disclosed herein is required as a result of a medical condition requiring skin augmentation. In some embodiments, a photocurable dermal filler disclosed herein is for use in an enhancement procedure, for example but not limited to tissue augmentation. In some embodiments, a cellular growth promoting scaffold disclosed herein is for cosmetic use. In some embodiments, a cellular growth promoting scaffold disclosed herein is for medical corrective use. In some embodiments, a cellular growth promoting scaffold dermal filler disclosed herein is required as a result of a medical or or dental (gum implants/gum disease) condition. In some embodiments, a cellular growth promoting scaffold dermal filler disclosed herein is required as a result of a medical condition requiring skin augmentation. In some embodiments, medical corrective use includes treating tendinitis. In some embodiments, a cellular growth promoting scaffold disclosed herein is for use in an enhancement procedure, for example but not limited to tissue augmentation.
(90) In some embodiments, tissue augmentation is of a skin tissue.
(91) In some embodiments, use of the dermal fillers including cellular growth promoting scaffolds disclosed herein is in a human. In some embodiments, use of the dermal fillers including cellular growth promoting scaffolds disclosed herein in a human reduces lines, folds, fine lines, wrinkles, or scars, or any combination thereof. In some embodiments, the reduction of lines, folds, fine lines, wrinkles, or scars, or any combination thereof is for cosmetic purposes. In some embodiments, the reduction of lines, folds, fine lines, wrinkles, or scars, or any combination thereof is for cosmetic purposes. In some embodiments, use of the dermal fillers including cellular growth promoting scaffolds disclosed herein in a human augments tissue, for example but not limited to, epidermal or dermal tissue. In some embodiments, tissue augmentation is for cosmetic purposes. In some embodiments, tissue augmentation is for medical treatment. In some embodiments, tissue augmentation is part of an enhancement procedure. In some embodiments, tissue augmentation is part of a skin enhancement procedure.
(92) In some embodiments, tissue augmentation is required as a result of any medical or dental (gum disease/gum implants) condition.
(93) In certain embodiments, a dermal filler for use described herein comprises an interpenetrated (IPN) network or a semi-interpenetrated (Semi-IPN) network, in which the different components may be crosslinked to themselves but are not crosslinked to each other. In some embodiments, an IPN or semi-IPN dermal filler comprises rhCollagen and a filler, such as hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), or a derivative thereof, or a combination thereof. In some embodiments, an IPN or semi-IPN comprises rhCollagen and a crosslinked HA. In some embodiments, an IPN or semi-IPN comprises a rhCollagen derivative, for example but not limited to a methacrylated rhCollagen or a thiol rhCollagen and or a derivative of a filler, for example but not limited to a methacrylated HA, PVA, PEG, or OC, or a thiolated HA, PVA, PEG, or OC, or a combination thereof.
(94) In some embodiments, an IPN or Semi-IPN network or a double crosslinked network comprising a dermal filler comprises a ratio of filler, for example but not limited to HA, PVA, PEG, or OC to rhCollagen of 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, an IPN or Semi-IPN network comprising a dermal filler comprises a ratio of MA-filler, for example but not limited to HA, PVA, PEG, or OC to rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, an IPN or Semi-IPN network comprising a dermal filler comprises a ratio of filler, for example but not limited to HA, PVA, PEG, or OC to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, an IPN or Semi-IPN network comprising a dermal filler comprises a ratio of MA-filler to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1.
(95) In some embodiments, an IPN or Semi-IPN or double crosslinked network comprising a dermal filler comprises a ratio of HA to rhCollagen of 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, an IPN or Semi-IPN or double crosslinked network comprising a dermal filler comprises a ratio of MA-HA to rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, an IPN or Semi-IPN network comprising a dermal filler comprises a ratio of HA to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, an IPN or Semi-IPN network comprising a dermal filler comprises a ratio of MA-HA to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1.
(96) In some embodiments, an IPN or Semi-IPN or double crosslinked network comprising a dermal filler comprises a ratio of filler to rhCollagen of 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, an IPN or Semi-IPN or double crosslinked network comprising a dermal filler comprises a ratio of MA-HA, or MA-PVA, or MA-PEG, or MA-OC to rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, an IPN or Semi-IPN network comprising a dermal filler comprises a ratio of MA-HA, or MA-PVA, or MA-PEG, or MA-OC to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, an IPN or Semi-IPN network comprising a dermal filler comprises a ratio of MA-HA, or MA-PVA, or MA-PEG, or MA-OC to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1.
(97) In some embodiments, an IPN or Semi-IPN network comprising a dermal filler or a double crosslinked dermal filler comprises a cellular growth promoting scaffold.
(98) In certain embodiments, a dermal filler for use described herein comprises an photocurable dermal filler, in which at least one of the component, for example but not limited to rhCollagen comprises a methacrylate-rhCollagen derivative or a thiol-rhCollagen derivative. In some embodiments, a curable dermal filler comprises rhCollagen and a filler, such as hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), or a derivative thereof, or a combination thereof. In some embodiments, photocurable dermal filler comprises MA-rhCollagen and a HA or a derivative thereof. In some embodiments, photocurable dermal filled comprises a rhCollagen derivative, for example but not limited to a methacrylated rhCollagen or a thiol rhCollagen and or a derivative of a filler, for example but not limited to a methacrylated HA, PVA, PEG, or OC, or a thiolated HA, PVA, PEG, or OC, or a combination thereof.
(99) In some embodiments, photocurable dermal filler comprises a ratio of filler, for example but not limited to HA, PVA, PEG, or OC, or a derivative thereof, to rhCollagen of 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, a photocurable dermal filler comprises a ratio of filler, for example but not limited to HA, PVA, PEG, or OC, or a derivative thereof, to MA-rhCollagen of 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, a photocurable dermal filler comprises a ratio of filler, for example but not limited to HA, PVA, PEG, or OC to Thiol-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, a photocurable dermal filler comprises a ratio of MA-filler to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1.
(100) In some embodiments, a photocurable dermal filler comprises a ratio of HA to MA-rhCollagen of 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1, 1:3, 1:4, 1:5, or 0:1. In some embodiments, a photocurable dermal filler comprises a ratio of MA-HA to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, a photocurable dermal filler comprises a ratio of PVA, PEG, or OC to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, a photocurable dermal filler comprises a ratio of MA-PVA, MA-HA-, or OC to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In some embodiments, the HA components of a photocurable dermal filler comprises a crosslinked HA or a crosslinked MA-HA.
(101) Throughout this application, various embodiments of dermal fillers and their uses, may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub ranges as well as individual numerical values within that range. For example, description of a range such as from 1:1 to 6:1 should be considered to have specifically disclosed sub ranges such as from 1.1:1, 1.2:1, 1.3:1 to 5.9:1, from 1:1.1 to 1:1.9, etc., as well as individual numbers within that range and fractions thereof, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
(102) Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases ranging/ranges between a first indicate number and a second indicate number and ranging/ranges from a first indicate number to a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals there between.
(103) For example, the instant disclosure provides a dermal filler that for a tissue space under an epidermis comprising a cross-linkable, plant-derived human collagen, either alone or together with a filler, such as hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), or a combination thereof, which may be crosslinked, to provide a dermal filler that forms a water insoluble, crosslinked polymer preparation in situ on visible light activation in the presence of a photoinitiator. In some embodiments, the collagen is methacrylated or thiolated.
(104) In some embodiments, the dermal filler provide for uses described herein forms an IPN or semi-IPN network. In some embodiments, the dermal filler provide for uses described herein forms a double crosslinked network.
(105) In certain embodiments, a double crosslinked dermal filler provided for uses described herein comprises rhCollagen that is crosslinked to a crosslinked filler, such as crosslinked hyaluronic acid (HA), crosslinked poly(vinyl alcohol) (PVA), crosslinked polyethylene glycol (PEG), or crosslinked oxidized cellulose (OC), or a crosslinked derivative thereof, or a combination thereof. In certain embodiments, a double crosslinked dermal filler provided for uses described herein comprises rhCollagen that is further crosslinked to methacrylated or thiolated-crosslinked filler, such as HA, PVA, PEG, or OC.
(106) In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked filler to rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of MA-filler to rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked filler to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of MA-filler to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of thiolated-filler to rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked filler to thiolated-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of thiolated-filler to thiolated-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1.
(107) In certain embodiments, in a double crosslinked dermal filler, crosslinked HA or crosslinked MA-HA is further crosslinked to rhCollagen or methacrylated rhCollagen or thiol rhCollagen, resulting in a double crosslinked dermal filler. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked HA to rhCollagen or methacrylated rhCollagen or thiol rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked MA-HA to rhCollagen or methacrylated rhCollagen or thiol rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked MA-HA to rhCollagen or methacrylated rhCollagen or thiol rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1.
(108) In certain embodiments, in a double crosslinked dermal filler, crosslinked PVA, PEG, or OC or crosslinked MA-PVA, MA-PEG, or MA-OC is further crosslinked to rhCollagen or methacrylated rhCollagen, resulting in a double crosslinked dermal filler. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked PVA, PEG, or OC to rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked MA-PVA, MA-PEG, or MA-OC to rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked PVA, PEG, or OC to MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked MA-PVA, MA-PEG, or MA-OC to MArhCollagen or thiol rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1.
(109) In certain embodiments, in a double crosslinked dermal filler, crosslinked thiol-PVA, thiol-PEG, or thiol-OC is further crosslinked to rhCollagen or methacrylated rhCollagen, resulting in a double crosslinked dermal filler. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked thiol-PVA, thiol-PEG, or thiol-OC to rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. In certain embodiments, in a double crosslinked dermal filler, the ratio of crosslinked thiol-PVA, thiol-PEG, or thiol-OC to MArhCollagen or thiol rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1.
(110) In some embodiments, any water-soluble coupling agent may be used that can crosslink hyaluronic acid to collagen. Some non-limiting examples of a coupling agent include carbodiimides such as N,N-dicyclohexylcarbodiimide (DCC), N,N-diisopropylcarbodiimide (DIC), or 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), etc. Carbodiimide coupling agents may facilitate ester or amide bond formation without becoming part of the linkage. In other words, an ester bond or an amide bond may comprise atoms from a carboxylate group from one of hyaluronic acid or collagen, and a hydroxyl group or an amine group from the other. However, other coupling agents that become part of the crosslinking group may be used. The concentration of a coupling agent may vary. In some embodiments, a coupling agent may be present at about 2 mM to about 150 mM, about 2 mM to about 50 mM, about 20 mM to about 100 mM, or about 50 mM. In some embodiments, the coupling agent is EDC that is present at a concentration of about 20 mM to about 100 mM, about 2 mM to about 50 mM, or about 50 mM. In some embodiments, the coupling agent is EDC that is present at an amount of EDC equal to 10 to 100-fold the number of free amines in the rhcollagen. In some embodiments, the coupling agent is EDC that is present at an amount of EDC equal to 50-fold the number of free amines in the rhcollagen. Increasing the carbodiimide concentration up to about 50 mM may result in a crosslinked macromolecular matrix with greater hydrogel stiffness and/or less swelling.
(111) A skilled artisan would appreciate that a dermal filler comprising double crosslinking, wherein the filler is crosslinked to itself and then also crosslinked to the rhCollagen, is distinct from a dermal filler that comprises direct cross linking of collagen and HA using a single type of cross linker in a single reaction. The properties of such dermal fillers differ.
(112) By way of example, the present polymerizable solution can be used to block or fill various lumens and voids just below a skin surface. Thus, the instant technology provides a method of tissue augmentation in a host, such as a human patient, wherein said polymerizable solution of interest is introduced at a site of interest using methods known in the art, such as injecting the polymerizable solution at or in a tissue site in need of augmentation and once applied, exposing the overlying body surface to a visible light to cause polymerization of the deposited polymerizable solution.
(113) Augmentation means the repair, prevention or alleviation of defects, particularly defects due to loss or absence of tissue, by providing, augmenting, or replacing such tissue with a polymer or network or interest. Augmentation is also meant to include supplementation of a natural structure or feature, that is, a building of adding to an existing body part, for example, to increase the size thereof, such as lips, nose, breast, ears, portions of organs, chin, cheeks and so on. Thus, tissue augmentation can include the filling or reduction of lines, folds, wrinkles, scars, minor facial depressions, cleft lips, superficial wrinkles and the like, such as, in or on the face, neck, hands, feet, fingers, and toes; the correction of minor deformities due to aging or disease, including in the hands and feet, fingers and toes; the augmentation of the vocal cords or glottis to rehabilitate speech; the dermal filling of sleep lines and expression lines; the replacement of dermal and subcutaneous tissue lost due to aging; the augmentation of lips; the filling of wrinkles and the orbital groove around the eye; the augmentation of the breast; the augmentation of the chin; the augmentation of the cheek and/or nose; the filling of indentations in soft tissue, dermal or subcutaneous, due to, e.g., overzealous liposuction or other trauma; the filling of acne or traumatic scars and rhytids; the filling of nasolabial lines, nasoglabellar lines and infraoral lines and so on.
(114) The polymerizable solution of interest, in some embodiments, encompasses a polymerizable solution which has a viscosity suitable for ready extrusion through a delivery means, such as a fine surgical needle (e.g., needles having a gauge of at least 27 gauge, at least 33 gauge or finer) at the temperature of use. Thus, a solution that is, injectable is one having a texture and viscosity which permits flow through a suitable delivery device, such as, a surgical needle, other surgical instrument, or other delivery means such as an equipment used in endoscopic or percutaneous discectomy procedures. The polymerizable solution of interest thus is injectable through a suitable applicator, such as a catheter, a cannula, a needle, a syringe, tubular apparatus and so on, as known in the art.
(115) Once injected into the tissue space, the polymerizable solution can be manipulated, massaged, molded, or sculpted into the desired contours in the tissue space, typically after photoinitiation of polymerization has been triggered. In one embodiment, the manipulation, massage, molding, or sculpting takes place during the gelation process. The polymerizable, polymerizing, or partially polymerized solution can be shaped by external manipulation, using, for example, a shaping means, such as, a surgical depressor or other tool or instrument with a flat or curved surface, fingers, the palm, a knuckle and so on.
(116) Surprisingly, the genetically modified, cross-linkable, plant-derived human collagen of the present method provides an improved collagen-containing dermal filler and improved methods of dermal filling by enabling the use of smaller gauge needles and a decreased force of injection, as well as by its ability to fill smaller tissue spaces.
(117) The expression force of an injection (newtons, N) includes the force required for injection from the needle or cannula.
(118) Absolute viscosity (dynamic viscosity) is a fluid's resistance to flow when a force is applied. It is proportional to the force to velocity ratio. The Greek letter 11 (eta) represents absolute viscosity in calculations. It is commonly measured in cP because many common fluids have viscosities between 0.5 cP and 1000 cP.
(119) A gel is a semirigid slab or cylinder of an organic polymer used as a medium for the separation of macromolecules. A gel is a substantially dilute cross-linked system, which exhibits no flow when in the steady-state. Gels are principally liquid by weight yet behave as partly as solids due to a three-dimensional cross-linked network within the liquid while retaining some properties of a liquid, such as deformability. It is the crosslinking within the fluid that gives a gel its structure (hardness) and contributes to the adhesive stick (tack). As a result, gels can be viewed as a dispersion of liquid molecules within a solid, i.e., liquid particles dispersed within a solid medium. Gelation time is the time it takes for the polymerizable solution to form a gel.
(120) A hydrogel is a network of polymer chains that are hydrophilic, sometimes found as a colloidal gel in which water is the dispersion medium. Hydrogels are highly absorbent (e.g., able to contain over 90% water) polymeric networks and have a flexibility very similar to natural tissue, due to their significant water content.
(121) A polymer is a macromolecule composed of a series of repeating subunits. The basic repeating subunit is known as a monomer. As a group, polymers are known for their tensile strength and elasticity.
(122) A photoinitiator is a molecule that creates reactive species (free radicals, cations or anions) when exposed to radiation (UV or visible). The photoinitiator of the present invention induces polymerization of the polymerizable solution. Examples of photoinitiators useful in the present method include, but are not limited to lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP), 1-[4 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methylpropan-1-one (IRGACURE 2959), Eosin Y+Triethanolamin, or riboflavin.
(123) Methacrylate is an ester or salt derived from methacrylic acid. Methacrylates are common monomers in polymer plastics, forming the acrylate polymers. Addition of methacrylate groups to collagen results in collagen methacrylate (rhCollagen-MA or MA-rhCollagen) which is photocurable. Addition of methacrylate groups to hyaluronic acid (HA) results in hyaluronic acid-methacrylate (HAMA or MA-HA) which is photocurable.
(124) In some embodiments, rhCollagen used in a dermal filler described herein comprises a combination of non-modified rhCollagen and MA-rhCollagen. In some embodiments, the ratio of non-modified rhCollagen to MA-rhCollagen is about 1:0, 1:1, 1:2, 1:3, 1:4, 0:1, 2:1, 3:1, or 4:1. In some embodiments, the final concentration range of MA-rhCollagen comprises between about 0-12 mg/ml. In some embodiments, the final concentration range of non-modified rhCollagen comprises between about 0-12 mg/ml. In some embodiments, the final concentration range of MA-rhCollagen comprises between about 0-12 mg/ml, and the final concentration range of non-modified rhCollagen comprises between about 0-12 mg/ml. In some embodiments, the final concentration range of MA-rhCollagen comprises between about 0 mg/ml-6 mg/ml. In some embodiments, the final concentration range of non-modified rhCollagen comprises between about 0 mg/ml-6 mg/ml. In some embodiments, the final concentration of MA-rhCollagen comprises about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mg/ml. In some embodiments, the final concentration of non-modified-rhCollagen comprises about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mg/ml.
(125) A thiol is an organosulfur compound that contains a carbon-bonded sulfhydryl (R-SH) group (where R represents an alkyl or other organic substituent). Thiolation of collagen can improve cohesion and mucoadhesion properties and affects swelling ability.
(126) Light is a form of electromagnetic radiation. Visible light is light having a wavelength in the range of 380-800 nm or at least 390-700 nm. Ultraviolet light has shorter wavelengths, while infrared has longer wavelengths.
(127) An illuminating means can be a light source suitable for activating the photoinitiator used, and which can activate the photoinitiator from outside of the body. While thermal initiators can be used and thus, an infrared source used, and ultraviolet-activated initiators can be used, and thus, a suitable ultraviolet source used, a preferred light source is a white light source. Thus, a suitable photoinitiator is used, so that the maximum absorption of the initiator and the light source are tuned. As mentioned hereinabove, one such visible light source is light-emitting diode (LED). Other suitable light sources can be used so long as gelation occurs in the body, at the site, under the skin surface and so on, such as, by applying the electromagnetic radiation to the body, to the site as needed, or from above the skin surface. The electromagnetic radiation is applied at an intensity, for a time and for a duration that enables gelation. The light source can be situated above the skin surface or directly on the skin surface, typically above the location of the molded or sculpted polymerizable solution.
(128) The monomer solution of some embodiments, can contain any of a variety of other materials, such as, inert materials, such as, preservatives, fillers, excipients or diluents, pharmacologically active molecules or agents, such as a small molecule or a biological, cells and so on, as known in the pharmaceutic arts. Thus, a suitable inert or biologically active agent can be added to the monomer solution. In the case of the latter, the active agent may exert a pharmacologic action locally at the site or in the vicinity of the polymerized or networked structure of interest, or can be released from the formed scaffold, matrix or network to move though the adjoining tissue spaces or may enter the circulatory system for a less local effect.
(129) As discussed above, the polymerizable solution methods of interest also can be used in combination with other dermatology, orthopedic, cosmetic, and other medical treatments.
(130) In some embodiments, the polymerizable solution is mixed with a known filler to provide a composition which is moldable, contourable, has a long residence time and so on. Examples of fillers include, but are not limited to, hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), or modified derivatives thereof, or a combination thereof. In some embodiments, the polymerizable solution in a semiliquid phase, is independently injected into the dermis as is a known filler also in a semiliquid phase, that together will provide a composition which is moldable, contourable, has a long residence time and so on. Examples of fillers that may be injected independently include, but are not limited to, hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), or modified derivatives thereof, or a combination thereof. In some embodiments, the polymerizable solution in a semiliquid phase, is injected into the dermis as a mixture that together will provide a composition which is moldable, contourable, has a long residence time and so on. Examples of fillers that may be injected mixed with rhCollagen include, but are not limited to, hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), or modified derivatives thereof, or a combination thereof.
(131) In yet another aspect, disclosed herein is methods of inducing a cellular growth promoting scaffold in a tissue space under an epidermis comprising introducing a solution into the tissue space, the solution comprising: (a) a plant-derived human collagen; and (b) at least one growth factor or source thereof.
(132) In one embodiment, the source of the at least one growth factor comprises a plasma or a platelet-rich plasma.
(133) In one embodiment, the cellular growth promoting scaffold promotes healing or replacement due to degradation or injury of a collagen-comprising tissue. In one embodiment, the collagen-comprising tissue is selected from the group consisting of a tendon, a ligament, skin, a cornea, a cartilage, a blood vessel, an intestine, an intervertebral disc, a muscle, a bone, or a tooth. In a particular embodiment, the cellular growth promoting scaffold promotes healing of tendinitis.
(134) In one embodiment, the plant-derived collagen comprises rhCollagen. In one embodiment, the plant-derived collagen is obtained from a genetically modified plant. In various embodiments, the genetically modified plant is a genetically modified plant selected from the group consisting of tobacco, maize, alfalfa, rice, potato, soybean, tomato, wheat, barley, canola, carrot, and cotton. In one embodiment, the genetically modified plant is a tobacco plant.
(135) In one embodiment, the genetically modified plant comprises an expressible sequence of at least one gene sequence of human deoxyribonucleic acid (DNA) selected from the group consisting of: COL1, COL2, P4H-alpha, P4H-beta, and LH3.
(136) In a particular embodiment, the plant-derived human collagen comprises at least modified one human collagen alpha-1 chain as set forth in SEQ ID NO: 3 and as expressed in the genetically modified plant; and at least one modified human collagen alpha-2 chain as set forth in SEQ ID NO: 6 and as expressed in the genetically modified plant; and the genetically modified plant further expresses an exogenous prolyl-4-hydroxylase (P4H).
(137) In another particular embodiment, the method further comprises expressing an exogenous polypeptide selected from the group consisting of lysyl hydroxylase (LH), protease N, and protease C.
(138) In one particular embodiment, the human collagen alpha-1 chain is encoded by a sequence as set forth in SEQ ID NO: 1. In another particular embodiment, the human collagen alpha-2 chain is encoded by a sequence as set forth in SEQ ID NO: 2.
(139) In one embodiment, the exogenous P4H is a mammalian P4H. In one particular embodiment, the exogenous P4H is a human P4H.
(140) In one embodiment, the method further comprises targeting the human collagen alpha-1 to a vacuole of the plant or the genetically modified plant and digesting it with ficin. In one embodiment, the method further comprises targeting the human collagen alpha-2 to a vacuole of the plant or the genetically modified plant and digesting it with ficin.
(141) In one particular embodiment, the plant-derived human collagen is atelocollagen.
(142) A skilled artisan would appreciate that the term dermal filler encompasses in some embodiments a solution comprising a plant-derived human collagen, for example a type 1 recombinant human collagen (rhCollagen) or a derivative thereof. The term dermal filler also encompass in some embodiments, a solution comprising a plant-derived human collagen, for example a type 1 recombinant human collagen (rhCollagen) or a derivative thereof, and a filler or a derivative thereof, or a crosslinked filler or a derivative thereof, having all the same meanings and qualities, wherein a dermal filler may be used to augment tissue structure, or may be used for reducing lines, folds, fine lines, wrinkles, or scars, or any combination thereof.
(143) A skilled artisan would appreciate that dermal fillers described herein comprise different formulation, for example but not limited to: An rhCollagen or a MA or Thiol derivative thereof; an IPN or semi-IPN or double crosslinked network comprising rhCollagen or rhCollagen-MA or rhCollagen-Thiol, and a filler or derivative thereof; an IPN or semi-IPN or double crosslinked network comprising rhCollagen or rhCollagen-MA or rhCollagen-Thiol, and HA or MA-HA or Thiol-HA; an IPN or semi-IPN or double crosslinked network comprising rhCollagen or rhCollagen-MA or rhCollagen-Thiol, and PVA or MA-PVA or Thiol-PVA; an IPN or semi-IPN or double crosslinked network comprising rhCollagen or rhCollagen-MA or rhCollagen-Thiol, and PEG or MA-PEG or Thiol-PEG; an IPN or semi-IPN or double crosslinked network comprising rhCollagen or rhCollagen-MA or rhCollagen-Thiol, and OC or MA-OC or thiol-OC; an IPN or semi-IPN or double crosslinked network or a cellular growth promoting scaffold comprising rhCollagen, and an autologous platelet rich plasma (PRP) fraction of blood containing high concentration of platelets; an IPN or semi-IPN or double crosslinked network or a cellular growth promoting scaffold, each comprising rhCollagen and an autologous platelet rich plasma (PRP) fraction of blood containing high concentration of platelets, wherein the platelets release various types of growth factors (GFs) comprising vasculo-endothelial growth factor (VEGF), transforming beta growth factor (TGF-beta), platelet derived growth factor (PDGF), platelet derived epidermal growth factor (PDEGF), fibroblast growth factors (bFGF), epidermal growth factors (EGF) or hepatocyte growth factors (HGF), or a combination thereof; a double crosslinked dermal filler comprising rhCollagen or rhCollagen-MA or rhCollagen-Thiol crosslinked to a crosslinked filler or derivative thereof; a double crosslinked dermal filler comprising a rhCollagen or rhCollagen-MA or rhCollagen-Thiol crosslinked to a crosslinked HA or crosslinked MA-HA or crosslinked Thiol-HA; a double crosslinked dermal filler comprising a rhCollagen or rhCollagen-MA or rhCollagen-Thiol crosslinked to a crosslinked PVA or crosslinked MA-PVA or crosslinked Thiol-PVA; a double crosslinked dermal filler comprising a rhCollagen or rhCollagen-MA or rhCollagen-Thiol crosslinked to a crosslinked PEG or crosslinked MA-PEG or crosslinked Thiol-PEG; or a double crosslinked dermal filler comprising a rhCollagen or rhCollagen-MA or rhCollagen-Thiol crosslinked to a crosslinked OC or crosslinked MA-OC or crosslinked thiol-OC.
(144) A skilled artisan would appreciate that in some embodiments, the term cellular growth promoting scaffold encompasses dermal fillers comprising collagen and an autologous platelet rich plasma (PRP) fraction of blood or components thereof. In some embodiments, PRP does not include cells but membranous vesicles (of cellular origin) containing growth factors and plasma components like fibrinogen and pro-thrombin. in some embodiments, a cellular growth promoting scaffold encompasses dermal fillers comprising collagen and an autologous platelet rich plasma (PRP) fraction of blood or components thereof, and an at least additional filler component.
(145) In some embodiments, a cellular growth promoting scaffold comprises a dermal filler that may be an IPN networks, a semi-IPN networks, or a double crosslinked dermal filler that further comprises an autologous platelet rich plasma (PRP) fraction of blood containing high concentration of platelets, wherein the autologous PRP fraction of blood containing high concentration of platelets, wherein the platelets release various types of growth factors (GFs) comprising vasculo-endothelial growth factor (VEGF), transforming beta growth factor (TGF-beta), platelet derived growth factor (PDGF), platelet derived epidermal growth factor (PDEGF), fibroblast growth factors (bFGF), epidermal growth factors (EGF) or hepatocyte growth factors (HGF), or a combination thereof. In some embodiments, a cellular growth promoting scaffold comprises a dermal filler comprising an IPN networks, a semi-IPN networks, or a double crosslinked dermal filler that further comprises, and at least one growth factor comprising vasculo-endothelial growth factor (VEGF), transforming beta growth factor (TGF-beta), platelet derived growth factor (PDGF), platelet derived epidermal growth factor (PDEGF), fibroblast growth factors (bFGF), epidermal growth factors (EGF) or hepatocyte growth factors (HGF), or a combination thereof. In some embodiments, a cellular growth promoting scaffold comprises a dermal filler comprising an IPN networks, a semi-IPN networks, or a double crosslinked dermal filler that further comprises, and a subset or fraction of PRP components.
(146) In some embodiments, a dermal filler described herein comprises a polymerizable solution. In some embodiments, a dermal filler described herein comprises a non-polymerizable solution. In some embodiments, polymerization of a dermal filler solution occurs in vivo. In some embodiments, components of a polymerizable dermal filler solution are injected together and then polymerized to form the cured dermal filler. In some embodiments, components of a polymerizable dermal filler solution are injected independently and then polymerized to form the cured dermal filler. An example of the unique approach of independently injection dermal filler components may in some embodiments comprising, injecting a filler into the skin dermis, for example but not limited to HA or a deriviatives thereof, and separately injecting a methacrylated or thiol-rhCollagen into the skin dermis within close proximity of the first injection, wherein the components are in a semiliquid phase, and then crosslinking in situ. This approach, in some embodiments allows for easier injection and in situ sculturing prior to curing the dermal filler components together by light polymerization.
(147) In some embodiments, a dermal filler provided herein is used in a method of soft tissue augmentation. In some embodiments, a dermal filler provided herein enhances cell proliferation. In some embodiments, a dermal filler provided and used in a method of soft tissue augmentation, degrades over time. In some embodiments, a dermal filler provided herein is used in a method of soft tissue augmentation wherein the dermal filler fills a tissue space under an epidermis. In some embodiments, a dermal filler provided herein is used in a method of soft tissue augmentation, wherein the use reduces lines, folds, fine lines, wrinkles, or scars.
(148) In one embodiment, the solution comprising the plant-derived human collagen has a reduced viscosity at room temperature in comparison with an analogous solution comprising a tissue-extracted human or animal-derived collagen in the same concentration and formulation. In another embodiment, the solution comprising the plant-derived human collagen has a reduced viscosity at 37 C. in comparison with an analogous solution comprising a tissue-extracted human or animal-derived collagen in the same concentration and formulation. In yet another embodiment, the solution comprising the plant-derived human collagen is introduced into the tissue space with a reduced force at room temperature as compared with an analogous solution comprising a tissue-extracted human or animal-derived collagen in the same concentration and formulation. In still another embodiment, the solution comprising the plant-derived human collagen is introduced into the tissue space with a reduced force at 37 C. as compared with an analogous solution comprising a tissued-extracted human or animal-derived collagen in the same concentration and formulation. In one particular embodiment, the solution comprising the plant-derived human collagen has an increased scaffolding formation or promotes an increase in cellular growth as compared with an analogous solution comprising a tissue-extracted human or animal-derived collagen in the same concentration and formulation.
(149) In yet another aspect, disclosed herein is a use of a solution injected into a tissue space under an epidermis to induce a cellular growth promoting scaffold, the solution comprising a plant-derived human collagen and at least one growth factor or source thereof, to promote healing or replacement due to degradation or injury of a collagen-comprising tissue. In a particular embodiment, the source of the at least one growth factor comprises a plasma or a platelet-rich plasma.
(150) In embodiment, the collagen-comprising tissue is selected from the group consisting of a tendon, a ligament, skin, a cornea, a cartilage, a blood vessel, an intestine, an intervertebral disc, a muscle, a bone, or a tooth. In another embodiment, the cellular growth promoting scaffold promotes healing of tendinitis. In embodiment, the collagen-comprising tissue is skin.
(151) In some embodiments, there is provided a genetically modified plant which is capable of expressing at least one type of a collagen alpha chain and accumulating it in a subcellular compartment which is devoid of endogenous P4H activity.
(152) As used herein, the phrase genetically modified plant refers to any lower (e.g. moss) or higher (vascular) plant or a tissue or an isolated cell thereof (e.g., of a cell suspension) which is stably or transiently transformed with an exogenous polynucleotide sequence. Examples of plants include tobacco, maize, alfalfa, rice, potato, soybean, tomato, wheat, barley, canola, cotton, carrot as well as lower plants such as moss.
(153) As used herein, the phrase collagen chain refers to a collagen subunit such as the alpha 1 or 2 chains of collagen fibers, preferably type I fibers. As used herein, the phrase collagen refers to an assembled collagen trimer, which in the case of type I collagen includes two alpha 1 chains and one alpha 2 chain. A collagen fiber is collagen which is devoid of terminal propeptides C and N.
(154) As is used herein, the phrase subcellular compartment devoid of endogenous P4H activity refers to any compartmentalized region of the cell which does not include plant P4H or an enzyme having plant-like P4H activity. Examples of such subcellular compartments include the vacuole, apoplast and cytoplasm as well as organelles such as the chloroplast, mitochondria and the like.
(155) Any type of collagen chain can be expressed by the genetically modified plant of the present invention. Examples include fibril-forming collagens (types I, II, III, V, and XI), networks forming collagens (types IV, VIII, and X), collagens associated with fibril surfaces (types IX, XII, and XIV), collagens which occur as transmembrane proteins (types XIII and XVII), or form 11-nm periodic beaded filaments (type VI).
(156) In one embodiment, the collagen chain expressed is an alpha 1 and/or 2 chain of type I collagen. The expressed collagen alpha chain can be encoded by any polynucleotide sequences derived from any mammal. In a particular embodiment, the sequences encoding collagen alpha chains are human and are set forth by SEQ ID NOs: 1 and 4.
(157) Typically, alpha collagen chains expressed in plants may or may not include their terminal propeptides (i.e. propeptide C and propeptide N).
(158) Processing of procollagen by plant proteolytic activity is different then normal processing in human and that propeptide C is removed by plant proteolytic activity although the cleavage site is unknown. Cleavage of the C propeptide may take place on a procollagen peptide before the assembly of trimmer (association of three C-Propeptides is essential for initiating the assembly of trimmers).
(159) N-propeptide cleavage by plant proteolytic activity takes place in mature plants but not in plantlets. Such cleavage removes 2 amino acids from the N telopeptide (2 out of 17).
(160) The C-propeptides (and to a lesser extent the N-propeptides) maintain the procollagen soluble during its passage through the animal cell (Bulleid et al., 2000) and are expected to have a similar effect in the plant cell. Following or during secretion of procollagen molecules into the extracellular matrix, propeptides are removed by procollagen N- and C-proteinases, thereby triggering spontaneous self-assembly of collagen molecules into fibrils. Removal of the propeptides by procollagen N- and C-proteinases lowers the solubility of procollagen by >10000-fold and is necessary and sufficient to initiate the self-assembly of collagen into fibers. Crucial to this assembly process are short non-triple-helical peptides called telopeptides at the ends of the triple-helical domain, which ensure correct registration of the collagen molecules within the fibril structure and lower the critical concentration for self-assembly. Pepsin can cleave the propeptides during production of collagen. However, pepsin damages the telopeptides and as a result, pepsin-extracted collagen is unable to form ordered fibrillar structures.
(161) Protein disulfide isomerase (PDI) that forms the beta subunit of human P4H was shown to bind to the C-propeptide prior to trimmer assembly thereby also acting as a molecular chaperone during chain assembly.
(162) The use of human Procollagen I N-proteinase and Procollagen C-proteinase expressed in different plants may generate collagen that is more similar to the native human collagen and can form ordered fibrillar structures.
(163) In a case where N or C propeptides or both are included in the expressed collagen chain, the genetically modified plant of the present invention can also express the respective protease (i.e. C or N or both). Polynucleotide sequences encoding such proteases are exemplified by SEQ ID NOs: 18 (Protease C) and 20 (Protease N). Such proteases can be expressed such that they are accumulated in the same subcellular compartment as the collagen chain.
(164) Accumulation of the expressed collagen chain in a subcellular compartment devoid of endogenous P4H activity can be effected via any one of several approaches.
(165) For example, the expressed collagen chain can include a signal sequence for targeting the expressed protein to a subcellular compartment such as the apoplast or an organelle (e.g. chloroplast). Examples of suitable signal sequences include the chloroplast transit peptide (included in Swiss-Prot entry P07689, amino acids 1-57) and the mitochondrion transit peptide (included in Swiss-Prot entry P46643, amino acids 1-28). The Examples section which follows provides additional examples of suitable signal sequences as well as guidelines for employing such signal sequences in expression of collagen chains in plant cells.
(166) Alternatively, the sequence of the collagen chain can be modified in a way which alters the cellular localization of collagen when expressed in plants.
(167) As is mentioned hereinabove, the ER of plants includes a P4H which is incapable of correctly hydroxylating collagen chains. Collagen alpha chains natively include an ER targeting sequence which directs expressed collagen into the ER where it is post-translationally modified (including incorrect hydroxylation). Thus, removal of the ER targeting sequence will lead to cytoplasmic accumulation of collagen chains which are devoid of post translational modification including any hydroxylations.
(168) Example 1 of the Examples section which follows describes generation of collagen sequences which are devoid of ER sequences.
(169) Still alternatively, collagen chains can be expressed and accumulated in a DNA containing organelle such as the chloroplast or mitochondria. Further description of chloroplast expression is provided hereinbelow.
(170) As is mentioned hereinabove, hydroxylation of alpha chains is required for assembly of a stable type I collagen. Since alpha chains expressed by the genetically modified plant of the present invention accumulate in a compartment devoid of endogenous P4H activity, such chains must be isolated from the plant, plant tissue or cell and in-vitro hydroxylated. Such hydroxylation can be achieved by the method described by Turpeenniemi-Hujanen and Myllyla (Concomitant hydroxylation of proline and lysine residues in collagen using purified enzymes in vitro. Biochim Biophys Acta. 1984 Jul. 16; 800(1):59-65).
(171) Although such in-vitro hydroxylation can lead to correctly hydroxylated collagen chains, it can be difficult and costly to achieve.
(172) To overcome the limitations of in-vitro hydroxylation, the genetically modified plant of the present invention preferably also co-expresses P4H which is capable of correctly hydroxylating the collagen alpha chain(s) [i.e., hydroxylating only the proline (Y) position of the Gly-X-Y triplets]. P4H is an enzyme composed of two subunits, alpha and beta. Both are needed to form an active enzyme while the Beta subunit also posses a chaperon function.
(173) The P4H expressed by the genetically modified plant of the present invention is preferably a human P4H which is encoded by, for example, SEQ ID NOs:12 and 14. In addition, P4H mutants which exhibit enhanced substrate specificity, or P4H homologues can also be used.
(174) A suitable P4H homologue is exemplified by an Arabidopsis oxidoreductase identified by NCBI accession NP 179363. Pairwise alignment of this protein sequence and a human P4H alpha subunit conducted by the present inventors revealed the highest homology between functional domains of any known P4H homologs of plants.
(175) Since P4H needs to co-accumulate with the expressed collagen chain, the coding sequence thereof is preferably modified accordingly (addition of signal sequences, deletions which may prevent ER targeting etc).
(176) In mammalian cells, collagen is also modified by Lysyl hydroxylase, galactosyltransferase and glucosyltransferase. These enzymes sequentially modify lysyl residues in specific positions to hydroxylysyl, galactosylhydroxylysyl and glucosylgalactosyl hydroxylysyl residues. A single human enzyme, Lysyl hydroxylase 3 (LH3) can catalyze all three consecutive steps in hydroxylysine linked carbohydrate formation.
(177) Thus, the genetically modified plant of the present invention preferably also expresses mammalian LH3. An LH3 encoding sequence such as that set forth by SEQ ID NO: 22 can be used for such purposes.
(178) The collagen chain(s) and modifying enzymes described above can be expressed from a stably integrated or a transiently expressed nucleic acid construct which includes polynucleotide sequences encoding the alpha chains and/or modifying enzymes (e.g. P4H and LH3) positioned under the transcriptional control of plant functional promoters. Such a nucleic acid construct (which is also termed herein as an expression construct) can be conFIG.d for expression throughout the whole plant, defined plant tissues or defined plant cells, or at define developmental stages of the plant. Such a construct may also include selection markers (e.g. antibiotic resistance), enhancer elements and an origin of replication for bacterial replication.
(179) It will be appreciated that constructs including two expressible inserts (e.g. two alpha chain types, or an alpha chain and P4H) preferably include an individual promoter for each insert, or alternatively such constructs can express a single transcript chimera including both insert sequences from a single promoter. In such a case, the chimeric transcript includes an IRES sequence between the two insert sequences such that the downstream insert can be translated therefrom.
(180) Numerous plant functional expression promoters and enhancers which can be either tissue specific, developmentally specific, constitutive or inducible can be utilized by the constructs of the present invention, some examples are provided hereinunder.
(181) As used herein in the specification and in the claims section that follows the phrase plant promoter or promoter includes a promoter which can direct gene expression in plant cells (including DNA containing organelles). Such a promoter can be derived from a plant, bacterial, viral, fungal or animal origin. Such a promoter can be constitutive, i.e., capable of directing high level of gene expression in a plurality of plant tissues, tissue specific, i.e., capable of directing gene expression in a particular plant tissue or tissues, inducible, i.e., capable of directing gene expression under a stimulus, or chimeric, i.e., formed of portions of at least two different promoters.
(182) Thus, the plant promoter employed can be a constitutive promoter, a tissue specific promoter, an inducible promoter or a chimeric promoter.
(183) Examples of constitutive plant promoters include, without being limited to, CaMV35S and CaMV19S promoters, FMV34S promoter, sugarcane bacilliform badnavirus promoter, CsVMV promoter, Arabidopsis ACT2/ACT8 actin promoter, Arabidopsis ubiquitin UBQI promoter, barley leaf thionin BTH6 promoter, and rice actin promoter.
(184) Examples of tissue specific promoters include, without being limited to, bean phaseolin storage protein promoter, DLEC promoter, PHS promoter, zein storage protein promoter, conglutin gamma promoter from soybean, AT2S1 gene promoter, ACT11 actin promoter from Arabidopsis, napA promoter from Brassica napus and potato patatin gene promoter.
(185) The inducible promoter is a promoter induced by a specific stimuli such as stress conditions comprising, for example, light, temperature, chemicals, drought, high salinity, osmotic shock, oxidant conditions or in case of pathogenicity and include, without being limited to, the light-inducible promoter derived from the pea rbcS gene, the promoter from the alfalfa rbcS gene, the promoters DRE, MYC and MYB active in drought; the promoters INT, INPS, prxEa, Ha hsp17.7G4 and RD21 active in high salinity and osmotic stress, and the promoters hsr203J and str246C active in pathogenic stress.
(186) Preferably the promoter utilized by the present invention is a strong constitutive promoter such that over expression of the construct inserts is effected following plant transformation.
(187) It will be appreciated that any of the construct types used in the present invention can be co-transformed into the same plant using same or different selection markers in each construct type. Alternatively, the first construct type can be introduced into a first plant while the second construct type can be introduced into a second isogenic plant, following which the transgenic plants resultant therefrom can be crossed and the progeny selected for double transformants. Further self-crosses of such progeny can be employed to generate lines homozygous for both constructs.
(188) There are various methods of introducing nucleic acid constructs into both monocotyledonous and dicotyledenous plants (Potrykus, I., Annu. Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42:205-225; Shimamoto et al., Nature (1989) 338:274-276). Such methods rely on either stable integration of the nucleic acid construct or a portion thereof into the genome of the plant, or on transient expression of the nucleic acid construct in which case these sequences are not inherited by a progeny of the plant.
(189) In addition, several methods exist in which a nucleic acid construct can be directly introduced into the DNA of a DNA containing organelle such as a chloroplast.
(190) There are two principle methods of effecting stable genomic integration of exogenous sequences such as those included within the nucleic acid constructs of the present invention into plant genomes: (i) Agrobacterium-mediated gene transfer: Klee et al. (1987) Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 2-25; Gatenby, in Plant Biotechnology, eds. Kung, S. and Arntzen, C. J., Butterworth Publishers, Boston, Mass. (1989) p. 93-112. (ii) direct DNA uptake: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 52-68; including methods for direct uptake of DNA into protoplasts, Toriyama, K. et al. (1988) Bio/Technology 6:1072-1074. DNA uptake induced by brief electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988) 7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection into plant cells or tissues by particle bombardment, Klein et al. Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology (1988) 6:923-926; Sanford, Physiol. Plant. (1990) 79:206-209; by the use of micropipette systems: Neuhaus et al., Theor. Appl. Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79:213-217; or by the direct incubation of DNA with germinating pollen, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad. Sci. USA (1986) 83:715-719.
(191) The Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiation of whole plant differentiation. Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicotyledenous plants.
(192) There are various methods of direct DNA transfer into plant cells. In electroporation, protoplasts are briefly exposed to a strong electric field. In microinjection, the DNA is mechanically injected directly into the cells using very small micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals, tungsten particles or gold particles, and the microprojectiles are physically accelerated into cells or plant tissues.
(193) Following transformation plant propagation is exercised. The most common method of plant propagation is by seed. Regeneration by seed propagation, however, has the deficiency that due to heterozygosity there is a lack of uniformity in the crop, since seeds are produced by plants according to the genetic variances governed by Mendelian rules. Basically, each seed is genetically different, and each will grow with its own specific traits. Therefore, it is preferred that the transformed plant be produced such that the regenerated plant has the identical traits and characteristics of the parent transgenic plant. Therefore, it is preferred that the transformed plant be regenerated by micropropagation which provides a rapid, consistent reproduction of the transformed plants.
(194) Transient expression methods which can be utilized for transiently expressing the isolated nucleic acid included within the nucleic acid construct of the present invention include, but are not limited to, microinjection and bombardment as described above but under conditions which favor transient expression, and viral mediated expression wherein a packaged or unpackaged recombinant virus vector including the nucleic acid construct is utilized to infect plant tissues or cells such that a propagating recombinant virus established therein expresses the non-viral nucleic acid sequence.
(195) Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, TMV and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants, is described in WO 87/06261.
(196) Construction of plant RNA viruses for the introduction and expression of non-viral exogenous nucleic acid sequences in plants is demonstrated by the above references as well as by Dawson, W. O. et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J. (1987) 6:307-311; French et al. Science (1986) 231:1294-1297; and Takamatsu et al. FEBS Letters (1990) 269:73-76.
(197) When the virus is a DNA virus, the constructions can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.
(198) Construction of plant RNA viruses for the introduction and expression in plants of non-viral exogenous nucleic acid sequences such as those included in the construct of the present invention is demonstrated by the above references as well as in U.S. Pat. No. 5,316,931.
(199) In one embodiment, a plant viral nucleic acid is provided in which the native coat protein coding sequence has been deleted from a viral nucleic acid, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral nucleic acid, and ensuring a systemic infection of the host by the recombinant plant viral nucleic acid, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the non-native nucleic acid sequence within it, such that a protein is produced. The recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or nucleic acid sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Non-native (foreign) nucleic acid sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included. The non-native nucleic acid sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.
(200) In a second embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non-native coat protein coding sequence.
(201) In a third embodiment, a recombinant plant viral nucleic acid is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native nucleic acid sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that said sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.
(202) In a fourth embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.
(203) The viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus. The recombinant plant viral nucleic acid or recombinant plant virus is used to infect appropriate host plants. The recombinant plant viral nucleic acid is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (isolated nucleic acid) in the host to produce the desired protein.
(204) A technique for introducing exogenous nucleic acid sequences to the genome of the chloroplasts is known. This technique involves the following procedures. First, plant cells are chemically treated so as to reduce the number of chloroplasts per cell to about one. Then, the exogenous nucleic acid is introduced via particle bombardment into the cells with the aim of introducing at least one exogenous nucleic acid molecule into the chloroplasts. The exogenous nucleic acid is selected such that it is integratable into the chloroplast's genome via homologous recombination which is readily effected by enzymes inherent to the chloroplast. To this end, the exogenous nucleic acid includes, in addition to a gene of interest, at least one nucleic acid stretch which is derived from the chloroplast's genome. In addition, the exogenous nucleic acid includes a selectable marker, which serves by sequential selection procedures to ascertain that all or substantially all of the copies of the chloroplast genomes following such selection will include the exogenous nucleic acid. Further details relating to this technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507 which are incorporated herein by reference. A polypeptide can thus be produced by the protein expression system of the chloroplast and become integrated into the chloroplast's inner membrane.
(205) The above described transformation approaches can be used to produce collagen chains and/or modifying enzymes as well as assembled collagen (with or without propeptides) in any species of plant, or plant tissue or isolated plants cell derived therefrom.
(206) Preferred plants are those which are capable of accumulating large amounts of collagen chains, collagen and/or the processing enzymes described herein. such plants may also be selected according to their resistance to stress conditions and the ease at which expressed components or assembled collagen can be extracted. examples of preferred plants include tobacco, maize, alfalfa, rice, potato, soybean, tomato, wheat, barley, canola and cotton.
(207) Collagen fibers are extensively used in the food and cosmetics industry. thus, although collagen fiber components (alpha chains) and modifying enzymes expressed by plants find utility in industrial synthesis of collagen, complete collagen production in plants is preferred for its simplicity and cost effectiveness.
(208) Several approaches can be used to generate type I collagen in plants. For example, collagen alpha 1 chain can be isolated from a plant expressing collagen alpha 1 and P4H (and optionally LH3) and mixed with a collagen alpha 2 chain which is isolated from a plant expressing collagen alpha 2 and P4H (and optionally LH3 and protease C and/or N). Since collagen alpha 1 chain self assembles into a triple helix by itself, it may be necessary to denature such a homo-trimer prior to mixing and renaturation with the collagen alpha 2 chain.
(209) Preferably, a first plant expressing collagen alpha 1 and P4H (and optionally LH3 and protease C and/or N) can be crossed with a second (and preferably isogenic) plant which expresses collagen alpha 2 or alternatively, a first plant expressing both alpha chains can be crossed with a second plant expressing P4H and optionally LH3 and protease C and/or N.
(210) It should be noted that although the above described plant breeding approaches utilize two individually transformed plants, approaches which utilize three or more individually transformed plants, each expressing one or two components can also be utilized.
(211) One of ordinary skill in the art would be well aware of various plant breeding techniques and as s such no further description of such techniques is provided herein.
(212) Although plant breeding approaches are preferred, it should be noted that a single plant expressing collagen alpha 1 and 2, P4H and LH3 (and optionally protease C and/or N) can be generated via several transformation events each designed for introducing one more expressible components into the cell. In such cases, stability of each transformation event can be verified using specific selection markers.
(213) In any case, transformation and plant breeding approaches can be used to generate any plant, expressing any number of components. Presently preferred are plants which express collagen alpha 1 and 2 chains, P4H, LH3 and at least one protease (e.g. protease C and/or N). As is further described in the Examples section which follows, such plants accumulate collagen which exhibits stability at temperatures of up to 42 C.
(214) Progeny resulting from breeding or alternatively multiple-transformed plants can be selected, by verifying presence of exogenous mRNA and/or polypeptides by using nucleic acid or protein probes (e.g. antibodies). The latter approach is preferred since it enables localization of the expressed polypeptide components (by for example, probing fractionated plants extracts) and thus also verifies a potential for correct processing and assembly. Examples of suitable probes are provided in the Examples section which follows
(215) Once collagen-expressing progeny is identified, such plants are further cultivated under conditions which maximize expression of the collagen chains as well as the modifying enzymes.
(216) Since free proline accumulation may facilitate over production of different proline-rich proteins including the collagen chains expressed by the genetically modified plants of the present invention, preferred cultivating conditions are those which increase free proline accumulation in the cultivated plant.
(217) Free proline accumulates in a variety of plants in response to a wide range of environmental stresses including water deprivation, salinization, low temperature, high temperature, pathogen infection, heavy metal toxicity, anaerobiosis, nutrient deficiency, atmospheric pollution and UV-irradiation (Hare and Cress, 1997).
(218) Free proline may also accumulate in response to treatment of the plant or soil with compounds such as ABA or stress inducing compounds such as copper salt, paraquate, salicylic acid and the like.
(219) Thus, collagen-expressing progeny can be grown under different stress conditions (e.g. different concentrations of NaCl ranging from 50 mM up to 250 mM). In order to further enhance collagen production, the effect of various stress conditions on collagen expression will examined and optimized with respect to plant viability, biomass and collagen accumulation.
(220) Plant tissues/cells are preferably harvested at maturity, and the collagen fibers are isolated using well know prior art extraction approaches, one such approach is detailed below.
(221) Leaves of transgenic plants are ground to a powder under liquid nitrogen and the homogenate is extracted in 0.5 M acetic acid containing 0.2 M NaCl for 60 h at 4 C. Insoluble material is removed by centrifugation. The supernatant containing the recombinant collagen is salt-fractionated at 0.4 M and 0.7 M NaCl. The 0.7 M NaCl precipitate, containing the recombinant heterotrimeric collagen, is dissolved in and dialyzed against 0.1 M acetic acid and stored at 20 C. (following Ruggiero et al., 2000).
(222) In one embodiment, disclosed herein is a method of processing procollagen in order to generate homogeneous, soluble, fibril-forming atelocollagen.
(223) In some embodiments, as shown herein by analysis of proteolysis results by SDS PAGE, certain plant-derived proteases, (e.g. papain), are not capable of cleaving the propeptide portion from soluble procollagen without proteolytic cleavage within the helical region (even though they are capable of removing telopeptides from telocollagen originating from animal sources), while other proteases (e.g. esperase, savinase) do not effectively cleave the propeptide region from soluble procollagen, thereby hindering effective fibrillogenesis. Through meticulous experimentation, the present inventors uncovered that only particular plant-derived proteases such as ficin, and bacterial-derived proteases such as neutrase and subtilisin may be used to correctly cleave the propeptide portion (including the telopeptides) from soluble procollagen to generate a homogeneous preparation of soluble atelocollagen (
(224) Thus, according to one aspect, there is provided a method of generating atelocollagen. The method comprises contacting a human recombinant telopeptide-comprising collagen with a protease selected from the group consisting of neutrase, subtilisin, recombinant trypsin, recombinant pepsin and ficin, wherein the human recombinant telopeptide-comprising collagen is expressed in a non-animal cell, thereby generating the atelocollagen.
(225) As used herein, the phrase telopeptide-comprising collagen refers to a soluble collagen molecule which comprises telopeptides that are longer than the telopeptide remnants comprised in atelocollagen. Thus, the telopeptide-comprising collagen may be procollagen which comprises full length propeptides. Alternatively, the telopeptide-comprising collagen may be a procollagen molecule which comprises partially digested propeptides. Still alternatively, the telopeptide-comprising collagen may be telocollagen.
(226) The term procollagen as used herein, refers to a collagen molecule (e.g. human) that comprises either an N-terminal propeptide, a C-terminal propeptide or both. Exemplary human procollagen amino acid sequences are set forth by SEQ ID NOs: 30, 31, 36, and 37.
(227) The term telocollagen as used herein, refers to collagen molecules that lack both the N- and C-terminal propeptides typically comprised in procollagen but still contain the telopeptides. As mentioned in the Background section herein above, the telopeptides of fibrillar collagen are the remnants of the N- and C-terminal propeptides following digestion with native N/C proteinases.
(228) Recombinant human telocollagen may be generated in cells which have been transformed to express both exogenous human procollagen and the respective protease (i.e. C or N or both). Polynucleotide sequences encoding such proteases are exemplified by SEQ ID NOs: 39 (Protease C) and 40 (Protease N). Such proteases can be expressed such that they are accumulated in the same subcellular compartment as the collagen chain, as further described herein below.
(229) As used herein, the term atelocollagen refers to collagen molecules lacking both the N- and C-terminal propeptides typically comprised in procollagen and at least a portion of its telopeptides but including a sufficient portion of its telopeptides such that under suitable conditions it is capable of forming fibrils.
(230) Any type of atelocollagen may be generated according to the methods disclosed herein. Examples include fibril-forming collagens (types I, II, III, V, and XI), network-forming collagens (types IV, VIII, and X), collagens associated with fibril surfaces (types IX, XII, and XIV), collagens which occur as transmembrane proteins (types XIII and XVII), or form 11-nm periodic beaded filaments (type VI). According to one embodiment, the atelocollagen comprises an alpha-1 and/or alpha-2 chain of type I collagen.
(231) It will be appreciated that in some embodiments, disclosed herein are genetically modified forms of collagen/atelocollagenfor example collagenase-resistant collagens and the like.
(232) The recombinant human procollagen or telocollagen may be expressed in any non-animal cell, including but not limited to plant cells and other eukaryotic cells such as yeast and fungus.
(233) Plants in which the human procollagen or telocollagen may be produced (i.e. expressed) may be of lower (e.g. moss and algae) or higher (vascular) plant species, including tissues or isolated cells and extracts thereof (e.g. cell suspensions). Preferred plants are those which are capable of accumulating large amounts of collagen chains, collagen and/or the processing enzymes described herein below. Such plants may also be selected according to their resistance to stress conditions and the ease at which expressed components or assembled collagen can be extracted. Examples of plants in which human procollagen may be expressed include, but are not limited to tobacco, maize, alfalfa, rice, potato, soybean, tomato, wheat, barley, canola, carrot, lettuce and cotton.
(234) Production of recombinant human procollagen is typically effected by stable or transient transformation with an exogenous polynucleotide sequence encoding human procollagen.
(235) Exemplary polynucleotide sequences encoding human procollagen are set forth by SEQ ID NOs: 32, 33, 41, and 42.
(236) As mentioned, production of human telocollagen is typically effected by stable or transient transformation with an exogenous polynucleotide sequence encoding human procollagen and at least one exogenous polynucleotide sequence encoding the relevant protease.
(237) The stability of the triple-helical structure of collagen requires the hydroxylation of prolines by the enzyme prolyl-4-hydroxylase (P4H) to form residues of hydroxyproline within the collagen chain. Although plants are capable of synthesizing hydroxyproline-containing proteins, the prolyl hydroxylase that is responsible for synthesis of hydroxyproline in plant cells exhibits relatively loose substrate sequence specificity as compared with mammalian P4H. Thus, production of collagen containing hydroxyproline only in the Y position of Gly-X-Y triplets requires co-expression of collagen and human or mammalian P4H genes.
(238) Thus, according to one embodiment, the procollagen or telocollagen is expressed in a subcellular compartment of a plant that is devoid of endogenous P4H activity so as to avoid incorrect hydroxylation thereof. As is used herein, the phrase subcellular compartment devoid of endogenous P4H activity refers to any compartmentalized region of the cell which does not include plant P4H or an enzyme having plant-like P4H activity. According to one embodiment, the subcellular compartment is a vacuole.
(239) Accumulation of the expressed procollagen in a subcellular compartment devoid of endogenous P4H activity can be affected via any one of several approaches.
(240) For example, the expressed procollagen/telocollagen can include a signal sequence for targeting the expressed protein to a subcellular compartment such as the apoplast or an organelle (e.g. chloroplast). Examples of suitable signal sequences include the chloroplast transit peptide (included in Swiss-Prot entry P07689, amino acids 1-57) and the Mitochondrion transit peptide (included in Swiss-Prot entry P46643, amino acids 1-28).
(241) Alternatively, the sequence of the procollagen can be modified in a way which alters the cellular localization of the procollagen when expressed in plants.
(242) In some embodiments, disclosed herein are genetically modified cells co-expressing both human procollagen and a P4H, capable of correctly hydroxylating the procollagen alpha chain(s) [i.e. hydroxylating only the proline (Y) position of the Gly-X-Y triplets]. P4H is an enzyme composed of two subunits, alpha and beta as set forth in Genbank Nos. P07237 and P13674. Both subunits are necessary to form an active enzyme, while the beta subunit also possesses a chaperon function.
(243) The P4H expressed by the genetically modified cells of the present invention is preferably a human P4H which is encoded by, for example, SEQ ID NOs: 34 and 35. In addition, P4H mutants which exhibit enhanced substrate specificity, or P4H homologues can also be used. A suitable P4H homologue is exemplified by an Arabidopsis oxidoreductase identified by NCBI accession no: NP_179363.
(244) Since it is essential that P4H co-accumulates with the expressed procollagen chain, the coding sequence thereof is preferably modified accordingly (e.g., by addition or deletion of signal sequences).
(245) In mammalian cells, collagen is also modified by Lysyl hydroxylase, galactosyltransferase and glucosyltransferase. These enzymes sequentially modify lysyl residues in specific positions to hydroxylysyl, galactosylhydroxylysyl and glucosylgalactosyl hydroxylysyl residues at specific positions. A single human enzyme, Lysyl hydroxylase 3 (LH3), as set forth in Genbank No. 060568, can catalyze all three consecutive modifying steps as seen in hydroxylysine-linked carbohydrate formation.
(246) Thus, the genetically modified cells disclosed herein, may also express mammalian LH3. An LH3 encoding sequence such as that set forth by SEQ ID NO: 38 can be used for such purposes.
(247) The procollagen (s) and modifying enzymes described above can be expressed from a stably integrated or a transiently expressed nucleic acid construct which includes polynucleotide sequences encoding the procollagen alpha chains and/or modifying enzymes (e.g. P4H and LH3) positioned under the transcriptional control of functional promoters. Such a nucleic acid construct (which is also termed herein as an expression construct) can be configured for expression throughout the whole organism (e.g. plant, defined tissues or defined cells), and/or at defined developmental stages of the organism. Such a construct may also include selection markers (e.g. antibiotic resistance), enhancer elements and an origin of replication for bacterial replication.
(248) It will be appreciated that constructs including two expressible inserts (e.g. two alpha procollagen chain types, or a procollagen alpha chain and P4H) preferably include an individual promoter for each insert, or alternatively such constructs can express a single transcript chimera including both insert sequences under a single promoter. In such a case, the chimeric transcript may include an intraribosomal entry region (IRES) sequence between the two insert sequences such that the downstream insert can be translated therefrom.
(249) Numerous functional expression promoters and enhancers which can be either tissue specific, developmentally specific, constitutive or inducible can be utilized by the constructs of the present invention, some examples are provided herein under.
(250) Regardless of the transformation technique employed, once procollagen-expressing progeny are identified, such plants are further cultivated under conditions which maximize expression thereof. Progeny resulting from transformed plants can be selected, by verifying presence of exogenous mRNA and/or polypeptides by using nucleic acid or protein probes (e.g. antibodies). The latter approach enables localization of the expressed polypeptide components (by for example, probing fractionated plants extracts) and thus also verifies the plant's potential for correct processing and assembly of the foreign protein.
(251) Following cultivation of such plants, the telopeptide-comprising collagen is typically harvested. Plant tissues/cells are preferably harvested at maturity, and the procollagen molecules are isolated using extraction approaches. Preferably, the harvesting is effected such that the procollagen remains in a state that it can be cleaved by protease enzymes. According to one embodiment, a crude extract is generated from the transgenic plants of the present invention and subsequently contacted with the protease enzymes. An exemplary method for generating a plant crude extract is described in the Examples section herein under.
(252) It will be appreciated that the propeptide or telopeptide-comprising collagen may be purified from the genetically engineered cells of the present invention prior to incubation with protease, or alternatively may be purified following incubation with the protease. Still alternatively, the propeptide or telopeptide-comprising collagen may be partially purified prior to protease treatment and then fully purified following protease treatment. Yet alternatively, the propeptide or telopeptide-comprising collagen may be treated with protease concomitant with other extraction/purification procedures.
(253) Exemplary methods of purifying or semi-purifying the telopeptide-comprising collagen of the present invention include, but are not limited to, salting out with ammonium sulfate or the like and/or removal of small molecules by ultrafiltration.
(254) As described in the Background herein above, there is a risk involved in using animal source material for medical purposes. This risk is also relevant when selecting the proteolytic enzymes used in processing the procollagen expressed in plants to atelocollagen. Application of animal-derived source enzymes such as trypsin or pepsin, may in itself contaminate the final preparation with disease carriers. It is therefore desired to devise a production system where all components are free of animal source.
(255) It has been disclosed herein that only particular proteases are capable of correctly cleaving recombinant propeptide or telopeptide-comprising collagen. These include certain plant derived proteases e.g. ficin (EC 3.4.22.3) and certain bacterial derived proteases e.g. subtilisin (EC 3.4.21.62), neutrase. In some embodiments, disclosed herein is a use of recombinant enzymes such as rhTrypsin and rhPepsin Such enzymes are commercially available e.g. Ficin from Fig tree latex (Sigma, catalog #F4125 and Europe Biochem), Subtilisin from Bacillus licheniformis (Sigma, catalog #P5459) Neutrase from bacterium Bacillus amyloliquefaciens (Novozymes, catalog #PW201041) and TrypZean, a recombinant human trypsin expressed in corn (Sigma catalog #T3449).
(256) The procollagen or telocollagen is preferably contacted with the proteases under conditions such that the proteases are able to cleave the propeptides or telopeptides therefrom. Typically, the conditions are determined according to the particular protease selected. Thus, for example procollagen may be incubated with a protease for up to 15 hours, at a concentration of 1-25 mg/ml and a temperature of about 10-20 C.
(257) Following protease digestion, the generated atelocollagen may be further purified e.g. by salt precipitation, as described in the Examples section below so that the end product comprises a purified composition of atelocollagen having been processed from plant or plant-cell generated procollagen by a protease selected from the group consisting of neutrase, subtilisin, ficin and recombinant human trypsin and analyzed using methods known in the art (e.g. size analysis via Coomassie staining, Western analysis, etc.).
(258) Following purification, the atelocollagen may be resolubilized by addition of acidic solutions (e.g. 10 mM HCl). Such acidic solutions are useful for storage of the purified atelocollagen.
(259) The present inventors have shown that following digestion with ficin, the atelocollagen maintains its ability to form fibrils upon neutralization of the above described acid solutions. According to one embodiment, at least 70% of the purified and resolubilized atelocollagen generated according to the method of the present invention is capable of forming fibrils. According to one embodiment, at least 88% of the purified and resolubilized atelocollagen generated according to the method of the present invention is capable of forming fibrils.
(260) The ability to form fibrils demonstrates that the generated atelocollagen is useful for medical purposes including, but not limited to cosmetic surgery, healing aid for burn patients, reconstruction of bone and a wide variety of dental, orthopedic and surgical purposes.
(261) As noted in the Background section, Type I collagen is considered a perfect candidate for use as a major component of a building material in 3D-bioprinting. Despite the significant advantages offered by this natural polymer, a number of factors hinder its use for 3D bioprinting. The use of tissue extracted collagen for this purpose is limited due to its sensitivity to temperature and ionic strength which drives spontaneous gel formation at temperatures higher than 20 C., under physiological conditions [see, for example, PureCol, Advanced BioMatrix, Inc.]. The typical temperature-dependent formation of gel of tissue extracted-collagens hampers significantly the precise fluidity during printing. Keeping the printing media at low temperature until application is a possible solution for this phenomenon but implies a serious technical limitation. Another solution is the use of gelatin, the denatured form of collagen which does not become gel-like under these conditions. However, gelatin lacks the genuine tissue and cell interactions of native collagen and thus crucial biological functions are lost.
(262) Recent developments in technology have resulted in the development of a system for the purification of nave human Type I collagen (rhCollagen) by introducing into tobacco plants, five human genes encoding heterotrimeric type I collagen (COLLPLANT, Israel; now also available at SIGMA-ALDRICH, St. Louis, MO, USA). The protein is purified to homogeneity through a cost-effective industrial process taking advantage of collagen's unique properties. See also WO 2006/035442, WO 2009/053985, and patents and patent applications deriving therefrom, all of which are incorporated by reference as if fully set forth herein.
(263) Thus, according to one aspect, disclosed herein is a genetically modified plant which is capable of expressing at least one type of a collagen alpha chain and accumulating it in a subcellular compartment which is devoid of endogenous P4H activity.
(264) Type I collagen and rhCollagen are considered candidates for use as a major component of a building material in 3D-bioprinting. Scaffolding of various types has been used for cosmetic and other reconstructive applications.
(265) In addition, there has been an increase in the use of dermal fillers for soft tissue augmentation, e.g., the reduction of wrinkles. One possible method for the use of dermal fillers includes injection of a polymerizable dermal filler material into the desired area, followed by the contouring or molding of the filler into the desired conformation. Polymerization and cross-linking of the material by one of various methods can transform the monomers in the injected material to form polymers and chains, which can form networks, retaining the desired molded conformation. There are a number of methods to form polymers and to crosslink polymers. One method involves light-reactive reagents and light-induced reactions which create reactive species in a monomer solution.
(266) However, at least some of these approaches continue to focus on tissue-derived collagens or non-collagen polymers (e.g., poly(vinyl alcohol) or hyaluronic acid). Moreover, the use of tissue extracted collagen is limited due to its sensitivity to temperature and ionic strength which drives spontaneous gel formation at temperatures higher than 20 C., under physiological conditions [see, for example, PureCol, Advanced BioMatrix, Inc.]. The typical temperature-dependent formation of gel of tissue extracted-collagens hampers significantly the precise fluidity. Keeping the collagens at low temperature until application is a possible solution for this phenomenon but implies a serious technical limitation. Another solution is the use of gelatin, the denatured form of collagen which does not become gel-like under these conditions. However, gelatin lacks the genuine tissue and cell interactions of native collagen and thus crucial biological functions are lost. Moreover, the viscosity makes it more difficult to be injected under the dermis using fine-gauge needles and also makes it more difficult to spread and mold it into smaller cavities.
(267) Embodiments of dermal fillers and uses thereof disclosed herein, include but are not limited to: 1. A method of filling a tissue space under an epidermis comprising: a. introducing a polymerizable solution into the tissue space, the polymerizable solution comprising: i. a cross-linkable, plant-derived human collagen; and ii. a photoinitiator; and b. applying light to the surface of the epidermis superficial to said space to induce polymerization. 2. A method of filling a tissue space under an epidermis, further comprising: (a) a step of molding or sculpting the polymerizable solution into a desired configuration in the tissue space, wherein said step is concomitant with, or subsequent to, the step of applying light. 3. A method of filling a tissue space under an epidermis, wherein the molding or sculpting step reduces lines, folds, fine lines, wrinkles, or scars. 4. A method of filling a tissue space under an epidermis, wherein the cross-linkable, plant-derived human collagen is methacrylated or thiolated. 5. A method of filling a tissue space under an epidermis, the polymer solution further comprising a hyaluronic acid (HA) or modified derivative thereof, a poly(vinyl alcohol) (PVA) or modified derivative thereof, a polyethylene glycol (PEG) or modified derivative thereof, oxidized cellulose (OC) or a modified derivate thereof, polymethylmethacrylate (PMMA) microspheres or a modified derivative thereof, tricalcium phosphate (TCP) or a modified derivative thereof, calcium hydroxylapatite (CaHA) or a modified derivative thereof, carboxymethylcellulose or a modified derivative thereof, crystalline nanocellulose (CNC) or a modified derivative thereof, or a combination thereof. 6. A method of filling a tissue space under an epidermis, wherein the modified derivative of hyaluronic acid (HA), a poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), polymethylmethacrylate (PMMA) microspheres, tricalcium phosphate (TCP), calcium hydroxylapatite (CaHA), carboxymethylcellulose, or crystalline nanocellulose (CNC) comprises a photopolymerizable modified derivative. 7. The method of claim 5, wherein the modified derivative of hyaluronic acid (HA), a poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), polymethylmethacrylate (PMMA) microspheres, tricalcium phosphate (TCP), calcium hydroxylapatite (CaHA), carboxymethylcellulose, or crystalline nanocellulose (CNC) comprises a methacrylated or thiolated derivative. 8. A method of filling a tissue space under an epidermis, wherein the plant-derived collagen comprises rhCollagen. 9. A method of filling a tissue space under an epidermis, wherein the plant-derived collagen is obtained from a genetically modified plant. 10. A method of filling a tissue space under an epidermis, wherein the genetically modified plant is a genetically modified plant selected from the group consisting of tobacco, maize, alfalfa, rice, potato, soybean, tomato, wheat, barley, canola, carrot, and cotton. 11. A method of filling a tissue space under an epidermis, wherein the genetically modified plant is a tobacco plant. 12. A method of filling a tissue space under an epidermis, wherein the genetically modified plant comprises an expressible sequence of at least one gene sequence of human deoxyribonucleic acid (DNA) selected from the group consisting of: COL1, COL2, P4H-alpha, P4H-beta, and LH3. 13. A method of filling a tissue space under an epidermis, wherein the plant-derived human collagen comprises at least modified one human collagen alpha-1 chain as set forth in SEQ ID NO: 3 and as expressed in the genetically modified plant; and at least one modified human collagen alpha-2 chain as set forth in SEQ ID NO: 6 and as expressed in the genetically modified plant; and wherein the genetically modified plant further expresses an exogenous prolyl-4-hydroxylase (P4H). 14. A method of filling a tissue space under an epidermis, further comprising expressing an exogenous polypeptide selected from the group consisting of lysyl hydroxylase (LH), protease N, and protease C. 15. A method of filling a tissue space under an epidermis, wherein the human collagen alpha-1 chain is encoded by a sequence as set forth in SEQ ID NO: 1. 16. A method of filling a tissue space under an epidermis, wherein the human collagen alpha-2 chain is encoded by a sequence as set forth in SEQ ID NO: 2. 17. A method of filling a tissue space under an epidermis, wherein the exogenous P4H is a mammalian P4H. 18. A method of filling a tissue space under an epidermis, wherein the exogenous P4H is a human P4H. 19. A method of filling a tissue space under an epidermis, further comprising targeting the human collagen alpha-1 to a vacuole of the plant or the genetically modified plant and digesting it with ficin. 20. A method of filling a tissue space under an epidermis, further comprising targeting the human collagen alpha-2 to a vacuole of the plant or the genetically modified plant and digesting it with ficin. 21. A method of filling a tissue space under an epidermis, wherein the plant-derived human collagen is atelocollagen. 22. A method of filling a tissue space under an epidermis, wherein the light source comprises a light-emitting diode (LED), laser, or xenon lamp. 23. A method of filling a tissue space under an epidermis, wherein the photoinitiator induces polymerization of the polymerizable solution in response to visible light. 24. A method of filling a tissue space under an epidermis, wherein the visible light has a wavelength of 390-700 nm. 25. A method of filling a tissue space under an epidermis, wherein the photoinitiator is selected from the group consisting of Eosin Y+triethanolamine or riboflavin. 26. A method of filling a tissue space under an epidermis, wherein the photoinitiator induces polymerization of the polymerizable solution in response to ultraviolet (uv) light. 27. A method of filling a tissue space under an epidermis, wherein the photoinitiator is selected from the group consisting of lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP) or 1-[4 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methylpropan-1-one (IRGACURE 2959). 28. A method of filling a tissue space under an epidermis, wherein the photoinitiator induces polymerization of the polymerizable solution in response to infrared light. 29. A method of filling a tissue space under an epidermis, wherein the polymerizable solution is introduced into the tissue space via a hollow needle or cannula in the range of 27-gauge to 33-gauge. 30. A method of filling a tissue space under an epidermis, wherein the polymerizable solution in the tissue space is molded or sculpted into the desired configuration via manual massage. 31. A method of filling a tissue space under an epidermis, wherein the polymerizable solution in the tissue space is molded or sculpted into the desired configuration using a molding or sculpting implement. 32. A method of filling a tissue space under an epidermis, wherein the polymerizable solution in the tissue space is essentially non-gellable at room temperature. 33. A method of filling a tissue space under an epidermis, wherein the polymerizable solution in the tissue space is essentially non-gellable at 37 C. 34. A method of filling a tissue space under an epidermis, wherein the polymerizable solution comprising the plant-derived human collagen has a reduced viscosity at room temperature in comparison with an analogous polymerizable solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 35. A method of filling a tissue space under an epidermis, wherein the polymerizable solution comprising the plant-derived human collagen has a reduced viscosity at 37 C. in comparison with an analogous polymerizable solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 36. A method of filling a tissue space under an epidermis, wherein the polymerizable solution comprising the plant-derived human collagen is introduced into the tissue space with a reduced force at room temperature as compared with an analogous polymerizable solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 37. A method of filling a tissue space under an epidermis, wherein the polymerizable solution comprising the plant-derived human collagen is introduced into the tissue space with a reduced force at 37 C. as compared with an analogous polymerizable solution comprising a tissued-extracted human or bovine collagen in the same concentration and formulation. 38. A method of filling a tissue space under an epidermis, wherein the polymerizable solution comprising the plant-derived human collagen has an increased tissue augmentation as compared with an analogous polymerizable solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 39. Use of a polymerizable solution injected into a tissue space under an epidermis to reduce lines, folds, fine lines, wrinkles, or scars, the polymerizable solution comprising a cross-linkable, plant-derived human collagen and a photoinitiator to induce polymerization prior to, on concomitant with, application of visible light, and molding or sculpting the polymerizable solution into a desired configuration to reduce lines, folds, fine lines, wrinkles, or scars. 40. Use of a polymerizable solution injected into a tissue space under an epidermis to reduce lines, folds, fine lines, wrinkles, or scars, wherein the cross-linkable, plant-derived human collagen is methacrylated or thiolated. 41. Use of a polymerizable solution injected into a tissue space under an epidermis to reduce lines, folds, fine lines, wrinkles, or scars, wherein the polymer solution further comprises a hyaluronic acid (HA) or a modified derivative thereof, a poly(vinyl alcohol) (PVA) or a modified derivative thereof, a polyethylene glycol (PEG) or a modified derivative thereof, polymethylmethacrylate (PMMA) microspheres or a modified derivative thereof, tricalcium phosphate (TCP) or a modified derivative thereof, calcium hydroxylapatite (CaHA) or a modified derivative thereof, carboxymethylcellulose or a modified derivative thereof, crystalline nanocellulose (CNC) or a modified derivative thereof, or a combination thereof. 42. Use of a polymerizable solution injected into a tissue space under an epidermis to reduce lines, folds, fine lines, wrinkles, or scars, wherein the modified derivative of hyaluronic acid (HA), a poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), polymethylmethacrylate (PMMA) microspheres, tricalcium phosphate (TCP), calcium hydroxylapatite (CaHA), carboxymethylcellulose, or crystalline nanocellulose (CNC) comprises a photopolymerizable modified derivative. 43. Use of a polymerizable solution injected into a tissue space under an epidermis to reduce lines, folds, fine lines, wrinkles, or scars, wherein the modified derivative of hyaluronic acid (HA), a poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), polymethylmethacrylate (PMMA) microspheres, tricalcium phosphate (TCP), calcium hydroxylapatite (CaHA), carboxymethylcellulose, or crystalline nanocellulose (CNC) comprises a methacrylated or thiolated derivative. 44. A method of filling a tissue space under an epidermis comprising: introducing a polymerizable solution into the tissue space, the polymerizable solution comprising a cross-linkable, plant-derived human collagen. 45. A method of filling a tissue space under an epidermis, further comprising: (a) a step of molding or sculpting the polymerizable solution into a desired configuration in the tissue space. 46. A method of filling a tissue space under an epidermis, wherein the molding or sculpting step reduces lines, folds, fine lines, wrinkles, or scars. 47. A method of filling a tissue space under an epidermis, the polymerizable solution further comprising a hyaluronic acid (HA) or modified derivative thereof, a poly(vinyl alcohol) (PVA) or modified derivative thereof, a polyethylene glycol (PEG) or modified derivative thereof, oxidized cellulose (OC) or a modified derivate thereof, polymethylmethacrylate (PMMA) microspheres or a modified derivative thereof, tricalcium phosphate (TCP) or a modified derivative thereof, calcium hydroxylapatite (CaHA) or a modified derivative thereof, carboxymethylcellulose or a modified derivative thereof, crystalline nanocellulose (CNC) or a modified derivative thereof, or a combination thereof. 48. A method of filling a tissue space under an epidermis, wherein the plant-derived collagen comprises rhCollagen. 49. A method of filling a tissue space under an epidermis, wherein the plant-derived collagen is obtained from a genetically modified plant. 50. A method of filling a tissue space under an epidermis, wherein the genetically modified plant is a genetically modified plant selected from the group consisting of tobacco, maize, alfalfa, rice, potato, soybean, tomato, wheat, barley, canola, carrot, and cotton. 51. A method of filling a tissue space under an epidermis, wherein the genetically modified plant is a tobacco plant. 52. A method of filling a tissue space under an epidermis, wherein the genetically modified plant comprises an expressible sequence of at least one gene sequence of human deoxyribonucleic acid (DNA) selected from the group consisting of: COL1, COL2, P4H-alpha, P4H-beta, and LH3. 53. A method of filling a tissue space under an epidermis, wherein the plant-derived human collagen comprises at least modified one human collagen alpha-1 chain as set forth in SEQ ID NO: 3 and as expressed in the genetically modified plant; and at least one modified human collagen alpha-2 chain as set forth in SEQ ID NO: 6 and as expressed in the genetically modified plant; and wherein the genetically modified plant further expresses an exogenous prolyl-4-hydroxylase (P4H). 54. A method of filling a tissue space under an epidermis, further comprising expressing an exogenous polypeptide selected from the group consisting of lysyl hydroxylase (LH), protease N, and protease C. 55. A method of filling a tissue space under an epidermis, wherein the human collagen alpha-1 chain is encoded by a sequence as set forth in SEQ ID NO: 1. 56. A method of filling a tissue space under an epidermis, wherein the human collagen alpha-2 chain is encoded by a sequence as set forth in SEQ ID NO: 2. 57. A method of filling a tissue space under an epidermis, wherein the exogenous P4H is a mammalian P4H. 58. A method of filling a tissue space under an epidermis, wherein the exogenous P4H is a human P4H. 59. A method of filling a tissue space under an epidermis, further comprising targeting the human collagen alpha-1 to a vacuole of the plant or the genetically modified plant and digesting it with ficin. 60. A method of filling a tissue space under an epidermis, further comprising targeting the human collagen alpha-2 to a vacuole of the plant or the genetically modified plant and digesting it with ficin. 61. A method of filling a tissue space under an epidermis, wherein the plant-derived human collagen is atelocollagen. 62. A method of filling a tissue space under an epidermis, wherein the polymerizable solution is introduced into the tissue space via a hollow needle or cannula in the range of 27-gauge to 33-gauge. 63. A method of filling a tissue space under an epidermis, wherein the polymerizable solution in the tissue space is molded or sculpted into the desired configuration via manual massage. 64. A method of filling a tissue space under an epidermis, wherein the polymerizable solution in the tissue space is molded or sculpted into the desired configuration using a molding or sculpting implement. 65. A method of filling a tissue space under an epidermis, wherein the polymerizable solution in the tissue space is essentially non-gellable at room temperature. 66. A method of filling a tissue space under an epidermis, wherein the polymerizable solution in the tissue space is essentially non-gellable at 37 C. 67. A method of filling a tissue space under an epidermis, wherein the polymerizable solution comprising the plant-derived human collagen has a reduced viscosity at room temperature in comparison with an analogous polymerizable solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 68. A method of filling a tissue space under an epidermis, wherein the polymerizable solution comprising the plant-derived human collagen has a reduced viscosity at 37 C. in comparison with an analogous polymerizable solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 69. A method of filling a tissue space under an epidermis, wherein the polymerizable solution comprising the plant-derived human collagen is introduced into the tissue space with a reduced force at room temperature as compared with an analogous polymerizable solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 70. A method of filling a tissue space under an epidermis, wherein the polymerizable solution comprising the plant-derived human collagen is introduced into the tissue space with a reduced force at 37 C. as compared with an analogous polymerizable solution comprising a tissued-extracted human or bovine collagen in the same concentration and formulation. 71. A method of filling a tissue space under an epidermis, wherein the polymerizable solution comprising the plant-derived human collagen has an increased tissue augmentation as compared with an analogous polymerizable solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 72. Use of a polymerizable solution injected into a tissue space under an epidermis to reduce lines, folds, fine lines, wrinkles, or scars, the polymerizable solution comprising a cross-linkable, plant-derived human collagen and molding or sculpting the polymerizable solution into a desired configuration to reduce lines, folds, fine lines, wrinkles, or scars. 73. A method of inducing a cellular growth scaffold in a tissue space under an epidermis comprising introducing a solution into the tissue space, the solution comprising: (a) a plant-derived human collagen; and (b) at least one growth factor or source thereof. 74. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the source of the at least one growth factor comprises a plasma or a platelet-rich plasma. 75. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the cellular growth scaffold promotes healing or replacement due to degradation or injury of a collagen-comprising tissue. 76. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the collagen-comprising tissue is selected from the group consisting of a tendon, a ligament, skin, a cornea, a cartilage, a blood vessel, an intestine, an intervertebral disc, a muscle, a bone, or a tooth. 77. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the cellular growth scaffold promotes healing of tendinitis. 78. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the plant-derived collagen comprises rhCollagen. 79. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the plant-derived collagen is obtained from a genetically modified plant. 80. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the genetically modified plant is a genetically modified plant selected from the group consisting of tobacco, maize, alfalfa, rice, potato, soybean, tomato, wheat, barley, canola, carrot, and cotton. 81. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the genetically modified plant is a tobacco plant. 82. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the genetically modified plant comprises an expressible sequence of at least one gene sequence of human deoxyribonucleic acid (DNA) selected from the group consisting of: COL1, COL2, P4H-alpha, P4H-beta, and LH3. 83. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the plant-derived human collagen comprises at least modified one human collagen alpha-1 chain as set forth in SEQ ID NO: 3 and as expressed in the genetically modified plant; and at least one modified human collagen alpha-2 chain as set forth in SEQ ID NO: 6 and as expressed in the genetically modified plant; and wherein the genetically modified plant further expresses an exogenous prolyl-4-hydroxylase (P4H). 84. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, further comprising expressing an exogenous polypeptide selected from the group consisting of lysyl hydroxylase (LH), protease N, and protease C. 85. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the human collagen alpha-1 chain is encoded by a sequence as set forth in SEQ ID NO: 1. 86. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the human collagen alpha-2 chain is encoded by a sequence as set forth in SEQ ID NO: 2. 87. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the exogenous P4H is a mammalian P4H. 88. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the exogenous P4H is a human P4H. 89. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, further comprising targeting the human collagen alpha-1 to a vacuole of the plant or the genetically modified plant and digesting it with ficin. 90. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, further comprising targeting the human collagen alpha-2 to a vacuole of the plant or the genetically modified plant and digesting it with ficin. 91. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the plant-derived human collagen is atelocollagen. 92. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the solution comprising the plant-derived human collagen has a reduced viscosity at room temperature in comparison with an analogous solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 93. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the solution comprising the plant-derived human collagen has a reduced viscosity at 37 C. in comparison with an analogous solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 94. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the solution comprising the plant-derived human collagen is introduced into the tissue space with a reduced force at room temperature as compared with an analogous solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 95. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the solution comprising the plant-derived human collagen is introduced into the tissue space with a reduced force at 37 C. as compared with an analogous solution comprising a tissued-extracted human or bovine collagen in the same concentration and formulation. 96. A method of inducing a cellular growth scaffold in a tissue space under an epidermis, wherein the solution comprising the plant-derived human collagen has an increased scaffolding formation or promotes an increase in cellular growth as compared with an analogous solution comprising a tissue-extracted human or bovine collagen in the same concentration and formulation. 97. Use of a solution injected into a tissue space under an epidermis to induce a cellular growth scaffold, the solution comprising a plant-derived human collagen and at least one growth factor or source thereof, to promote healing or replacement due to degradation or injury of a collagen-comprising tissue. 98. Use of a solution injected into a tissue space under an epidermis to induce a cellular growth scaffold, wherein the source of the at least one growth factor comprises a plasma or a platelet-rich plasma.
Definitions
(268) As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a molecule also includes a plurality of molecules.
(269) As used herein the term about refers to 10% or 5%.
(270) The terms comprises, comprising, includes, including, having and their conjugates mean including but not limited to.
(271) The term consisting of means including and limited to.
(272) The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
(273) As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
(274) As used herein, the phrase genetically modified plant encompasses any lower (e.g. moss) or higher (vascular) plant or a tissue or an isolated cell thereof (e.g., of a cell suspension) which is stably or transiently transformed with an exogenous polynucleotide sequence. Examples of plants include but are not limited to tobacco, maize, alfalfa, rice, potato, soybean, tomato, wheat, barley, canola, cotton, carrot as well as lower plants such as moss.
(275) As used herein, the phrase collagen chain encompasses a collagen subunit such as the alpha 1 or 2 chains of collagen fibers, preferably type I fibers. As used herein, the phrase collagen refers to an assembled collagen trimer, which in the case of type I collagen includes two alpha 1 chains and one alpha 2 chain. A collagen fiber is collagen which is devoid of terminal propeptides C and N.
(276) As used herein, the phrase telopeptide-comprising collagen encompasses a soluble collagen molecule which comprises telopeptides that are longer than the telopeptide remnants comprised in atelocollagen. Thus, the telopeptide-comprising collagen may be procollagen which comprises full length propeptides. Alternatively, the telopeptide-comprising collagen may be a procollagen molecule which comprises partially digested propeptides. Still alternatively, the telopeptide-comprising collagen may be telocollagen.
(277) The term procollagen as used herein, encompasses a collagen molecule (e.g. human) that comprises either an N-terminal propeptide, a C-terminal propeptide or both. Exemplary human procollagen amino acid sequences are set forth by SEQ ID NOs: 1, 2, 7 and 8.
(278) The term telocollagen as used herein, encompasses collagen molecules that lack both the N- and C-terminal propeptides typically comprised in procollagen but still contain the telopeptides. The telopeptides of fibrillar collagen are the remnants of the N- and C-terminal propeptides following digestion with native N/C proteinases. Recombinant human telocollagen may be generated in cells which have been transformed to express both exogenous human procollagen and the respective protease (i.e. C or N or both). Polynucleotide sequences encoding such proteases are exemplified by SEQ ID Nos: 10 (Protease C) and 11 (Protease N). Such proteases can be expressed such that they are accumulated in the same subcellular compartment as the collagen chain, as further described herein below.
(279) As used herein, the term atelocollagen encompasses collagen molecules lacking both the N- and C-terminal propeptides typically comprised in procollagen and at least a portion of its telopeptides, but including a sufficient portion of its telopeptides such that under suitable conditions it is capable of forming fibrils. Any type of atelocollagen may be generated according to the method of the present invention. Examples include fibril-forming collagens (types I, II, III, V, and XI), network-forming collagens (types IV, VIII, and X), collagens associated with fibril surfaces (types IX, XII, and XIV), collagens which occur as transmembrane proteins (types XIII and XVII), or form 11-nm periodic beaded filaments (type VI). According to one embodiment, the atelocollagen comprises an alpha 1 and/or 2 chain of type I collagen.
(280) It will be appreciated dermal fillers disclosed herein may in some embodiments comprise genetically modified forms of collagen/atelocollagenfor example collagenase-resistant collagens and the like.
(281) As used herein, the phrase plant promoter or promoter includes a promoter which can direct gene expression in cells (including DNA-containing organelles) of plants, fungus and yeast. Such a promoter can be derived from a plant, bacterial, viral, fungal or animal origin. Such a promoter can be constitutive, i.e., capable of directing high levels of gene expression in a plurality of tissues, tissue specific, i.e., capable of directing gene expression in a particular tissue or tissues, inducible, i.e., capable of directing gene expression under a stimulus, or chimeric, i.e., formed of portions of at least two different promoters.
(282) As is used herein, the phrase subcellular compartment devoid of endogenous P4H activity refers to any compartmentalized region of the cell which does not include plant P4H or an enzyme having plant-like P4H activity. Examples of such subcellular compartments include the vacuole, apoplast and cytoplasm as well as organelles such as the chloroplast, mitochondria and the like.
(283) Herein throughout, the phrase building material encompasses the phrases uncured building material or uncured building material formulation and collectively describes the materials that are used to sequentially form the layers, as described herein. This phrase encompasses uncured materials which form the final object, namely, one or more uncured modeling material formulation(s), and optionally also uncured materials used to form a support, namely uncured support material formulations. An uncured building material can comprise one or more modeling formulations and can be dispensed such that different parts of the object are made upon curing different modeling formulations, and hence are made of different cured modeling materials or different mixtures of cured modeling materials.
(284) As used herein, bioprinting means practicing an additive manufacturing process while utilizing one or more bio-ink formulation(s) that comprises biological components via methodology that is compatible with an automated or semi-automated, computer-aided, additive manufacturing system as described herein (e.g., a bioprinter or a bioprinting system).
(285) Herein throughout, in the context of bioprinting, the term object describes a final product of the additive manufacturing which comprises, in at least a portion thereof, biological components. This term refers to the product obtained by a bioprinting method as described herein, after removal of the support material, if such has been used as part of the uncured building material. In some embodiments, the biological components include recombinant human collagen, as described, for example, in WO 2006/035442, WO 2009/053985, and patents and patent applications deriving therefrom, all of which are incorporated by reference as if fully set forth herein.
(286) The term object as used herein throughout refers to a whole object or a part thereof.
(287) Herein throughout, a curable material is a compound (monomeric or oligomeric or polymeric compound) which, when exposed to a curing condition, as described herein, solidifies or hardens to form a cured modeling material as defined herein. Curable materials are typically polymerizable materials, which undergo polymerization and/or cross-linking when exposed to a suitable energy source. Alternatively, curable materials are thermo-responsive materials, which solidify or harden upon exposure to a temperature change (e.g., heating or cooling). Optionally, curable materials are biological materials which undergo a reaction to form a hardened or solid material upon a biological reaction (e.g., an enzymatically-catalyzed reaction).
(288) A curing condition encompasses a curing energy (e.g., temperature, radiation) and/or a material or reagent that promotes curing.
(289) In some of any of the embodiments described herein, a curable material is a photopolymerizable material, which polymerizes or undergoes cross-linking upon exposure to radiation, as described herein, and in some embodiments the curable material is a UV-curable or visible light-curable material, which polymerizes or undergoes cross-linking upon exposure to UV-vis radiation, as described herein.
(290) In some of any of the embodiments described herein, a curable material can be a monomer, an oligomer or a short-chain polymer, each being polymerizable as described herein.
(291) Herein, the term curable encompasses the terms polymerizable and cross-linkable.
(292) As used herein, aeroponics is the process of growing plants in an air or mist environment without the use of soil or an aggregate medium (known as geoponics).
(293) As used herein, hydroponics is the process of growing plants without soil (geoponics), using mineral nutrient solutions in a water solvent.
(294) As used herein, the endosphere comprises all endophytes of a plant.
(295) As used herein, an exudate is a fluid emitted by an organism through pores or a wound. Exudation is the process of emitting an exudate.
(296) As used herein, hydroponics is the process of growing plants without soil (geoponics), using mineral nutrient solutions in a water solvent.
(297) As used herein, integression or integression hybridization is the movement of a gene (i.e., gene flow) from the gene pool of one species into the gene pool of another species via repeated backcrossing of an interspecific hybrid with one of its parent species, distinct from simple hybridization and resulting in a complex mix of parental genes.
(298) As used herein, the metabolome is the complete set of small molecule chemicals found within a biological sample (including, but not limited to, a cell, an organelle, an organ, a tissue, a tissue extract, a biofluid, or an organism). The small molecule chemicals of the metabolome may be endogenous metabolites or exogenous chemicals. Endogenous metabolites are naturally produced by an organism and include, but are not limited to, amino acids, organic acids, nucleic acids, fatty acids, amines, sugars, vitamins, cofactors, pigments, and antibiotics. Exogenous chemicals are not naturally produced by the organism and include, but are not limited to, drugs, environmental contaminants, food additives, toxins, and other xenobiotics. The endogenous metabolome is comprised of the endogenous metabolites, while the exogenous metabolome is comprised of the exogenous chemicals. The endogenous metabolome is comprised of a primary metabolome and a secondary metabolome, especially with respect to plants, fungi, and prokaryotes. The primary metabolome is comprised of primary metabolites (i.e., metabolites directly involved in normal growth, development, and reproduction of the organism), while the secondary metabolome is comprised of secondary metabolites (i.e., metabolites not directly involved in the normal growth, development, or reproduction of the organism). Secondary metabolites often have significant ecological functions.
(299) As used herein, a metabolite is usually a small molecule having a molecular weight of less than 1500 Da. A metabolite can include, but is not limited to, a glycolipid, a polysaccharide, a short peptide, a small oligonucleotide, an organic acid, a taxane, an alkaloid, and strigolactone, while very large macromolecules (e.g., proteins, mRNA, rRNA, and DNA) are not generally not metabolites and are not part of the metabolome.
(300) As used herein, the SILVA database is the SILVA ribosomal RNA database.
(301) All samples obtained from an organism, including those subjected to any sort of further processing are considered to be obtained from the organism.
(302) Methods for DNA isolation, sequencing, amplification, and/or cloning are known to a person skilled in the art. Most commonly used method for DNA amplification is PCR (polymerase chain reaction; see, for example, PCR Basics: from background to Bench, Springer Verlag, 2000; Eckert et al., 1991. PCR Methods and Applications 1:17). Additional suitable amplification methods include the ligase chain reaction (LCR), transcription amplification and self-sustained sequence replication, and nucleic acid-based sequence amplification (NASBA). Likewise, methods for RNA and protein isolation, characterization, and the like and for protein expression are known to a person skilled in the art.
(303) The following examples are presented in order to more fully illustrate some embodiments of the dermal fillers and uses thereof, disclosed herein. They should, in no way be construed, however, as limiting the broad scope of dermal fillers disclosed herein nor their uses. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
EXAMPLES
Example 1. Constructs and Transformation Schemes
(304) Constructions of expression cassettes and vectors used in this work are illustrated in
(305) Co-transformations schemes utilizing the expression cassettes described in
Example 2. Plant Collagen Expression
(306) Synthetic polynucleotide sequences encoding the proteins listed in Table 1 below were designed and optimized for expression in tobacco plants.
(307) TABLE-US-00001 TABLE 1 List of expressed proteins Included Encoded Swiss Prot Amino Splicing in SEQ by SEQ Name: accession acids isoform Deletions name ID NO. ID NO. Collagen p02452 1442 One ER signal Col1 3 1 alpha 1(I) version chain [Precursor] Collagen p08123 1342 One ER signal Col2 6 4 alpha 2(I) Two changes version chain done in [Precursor] p08123: D549A and N249I Prolyl 4- p07237 487 One ER signal, P4H 13 12 hydroxylase version KDEL betaHuman beta subunit Prolyl 4- p13674 517 P13674-1 ER signal P4H 15 14 hydroxylase alphaHuman alpha-1 subunit Prolyl 4- No entry in 252 One Mitochondrial P4Hplant 17 16 hydroxylase Swissprot. version signal Plant NCBI predicted accession: as: aa1-39 gi: 15227885 Procollagen p13497 866 P13497-1 ER signal, Proteinase C 19 18 C- BMP1-3 propeptide proteinase Procollagen o95450 958 O95450-1 ER signal, Proteinase N 21 20 I N- LpNPI propeptide proteinase Lysyl o60568 714 One ER signal LH3 23 22 hydroxylase 3 version
Signal Peptides 1. Vacuole signal sequence of barley gene for Thiol protease aleurain precursor (NCBI accession P05167 GI:113603)
(308) TABLE-US-00002 (SEQIDNO:24) MAHARVLLLALAVLATAAVAVASSSSFADSNPIRPVTDRAASTLA. 2. Apoplast signal of Arabidopsis thaliana endo-1,4-beta-glucanase (Cell, NCBI accession CAA67156.1 GI:2440033); SEQ ID NO. 9, encoded by SEQ ID NO. 7.
Construction of Plasmids
(309) Plant expression vectors were constructed as taught in Example 1, the composition of each constructed expression vector was confirmed via restriction analysis and sequencing.
(310) Expression vectors including the following expression cassettes were constructed: 1. Collagen alpha 1 2. Collagen alpha 1+human P4H beta subunit 3. Collagen alpha 1+human P4H beta subunit+human LH3 4. Collagen alpha 2 5. Collagen alpha 2+with human P4H alpha subunit 6. Collagen alpha 2+with Arabidopsis P4H 7. Human P4H beta subunit+human LH3 8. Human P4H alpha subunit
(311) Each of the above described coding sequences was either translationally fused to a vacuole transit peptide or to an apoplasm transit peptide or was devoid of any transit peptide sequences, in which case cytoplasmic accumulation is expected.
(312) Plant Transformation and PCR Screening
(313) Tobacco plants (Nicotiana tabacum, Samsun NN) were transformed with the above described expression vectors according to the transformation scheme taught in
(314) Resultant transgenic plants were screened via multiplex PCR using four primers which were designed capable of amplifying a 324 bp fragment of Collagen alpha 1 and a 537 bp fragment of Collagen alpha 2 (Table 2).
(315) TABLE-US-00003 TABLE2 ListofprimersformultiplexPCRfor amplificationofa324bpfragmentof Collagenalpha1anda537bpfragment ofCollagenalpha2 Col1 5ATCACCAGGAGAACAGGGACCATC3 forward SEQID25 primer (24-mer): Col1 5TCCACTTCCAAATCTCTATCCCTAACAAC3 reverse SEQID26 primer (29-mer): Col2 5AGGCATTAGAGGCGATAAGGGAG3 forward SEQID27 primer (23-mer): Col2 5TCAATCCAATAATAGCCACTTGACCAC3 reverse SEQID28 primer (27-mer):
Example 3. Detection of Human Collagen in Transgenic Tobacco Plants
(316) Total soluble proteins were extracted from tobacco transformants 2, 3 and 4 by grinding 500 mg of leaves in 0.5 ml 50 mM Tris-HCl pH=7.5 with a Complete protease inhibitor cocktail (product #1836145 from Roche Diagnostics GmbH, 1 tablet per 50 ml buffer). The crude extract was mixed with 250 l 4. Sample application buffer containing 10% beta-mercapto-ethanol and 8% SDS, the samples were boiled for 7 minutes and centrifuged for 8 minutes in 13000 rpm. 20 l of the supernatant were loaded in a 10% polyacrylamide gel and tested with anti-Collagen I (denatured) antibody ((#AB745 from Chemicon Inc.) in a standard Western blot procedure (
(317) Plants expressing collagen at the expected molecular weight up to about 1% of the total soluble proteins were detected when collagen was targeted to the vacuole (
(318) In addition, in contrast to the studies of Ruggiero et al. 2000 and Merle et al. 2002 which showed that collagen lacking the N-propeptide was subjected to significant proteolysis, using the present approach full length collagen proteins with C-propeptide and N-propeptide accumulated in subcellular compartments at high levels.
(319) The present data also clearly shows that crossing two plants each expressing a different collagen chain type is advantageous in that it enables selection of plants expressing optimal levels of each chain type and subsequent plant crossing to achieve the desired collagen producing plant.
(320) Collagen produced by the plants of the present invention includes the native propeptides and therefore is expected to form a larger protein then the human control that was purified by proteolysis. The calculated molecular weight of Collagen alpha 1 and alpha 2 chains without hydroxylations or glycosylations are the following: Col1 with propeptides136 kDa, Col1 without propeptides95 kDa, Col2 with propeptides127 kDa, Col2 without propeptides92 kDa.
(321) As can be seen in
Example 4. Collagen Triple Helix Assembly and Thermal Stability in Transgenic Plants
(322) Assembly of collagen triple helix and the helix thermal stability in transgenic plants were tested by thermal denaturation followed by trypsin or pepsin digestion of the total crude protein extract of transgenic plants (
(323) In a first experiment, total soluble proteins from tobacco 2-9 (expressing only col alfa1 and no P4H) and 3-5 (expressing both col alpha1+2 and P4H) were extracted by grinding 500 mg leaves in 0.5 ml of 50 mM Tris-HCl pH=7.5, centrifuging for 10 minutes in 13000 rpm and collecting the supernatant. 0 l of the supernatant were subjected to heat treatment (15 minutes in 33 C. or 43 C.) and then immediately placed on ice. Trypsin digestion was initiated by adding to each sample 6 .mu.l of 1 mg/ml Trypsin in 50 mM Tris-HCl pH=7.5. The samples were incubated for 20 minutes at room temperature (about 22 C.). The digestion was terminated by addition of 20 l 4 sample application buffer containing 10% betamercaptoethanol and 8% SDS, the samples were boiled for 7 minutes and centrifuged for 7 minutes at 13000 rpm. 500 of the supernatant were loaded onto a 10% polyacrylamide gel and tested with anti-Collagen I antibody ((#AB745 from Chemicon Inc.) using a standard Western blot procedure. Positive controls were samples of 500 ng human collagen I (#CC050 from Chemicon Inc., extracted from human placenta by pepsin digestion) which was added to 50 l total soluble proteins extracted from w.t. tobacco.
(324) As shown in
(325) Two bands in transformants #2-9 may represent dimers or trimers, which are stable following 7 minutes of boiling with SDS and mercaptoethanol. Similar bands are visible in human collagen (upper panel) and in transformants #3-5. A possible explanation is a covalent bond between two peptides in different triple helixes (cross link), formed following oxidative deamination of two lysines by Lysine oxidase.
(326) In a second experiment, total soluble proteins from transgenic tobacco 13-6 (expressing collagen I alpha 1 and alpha 2 chainspointed by arrows, human P4H alpha and beta subunits and human LH3) were extracted by grinding 500 mg of leaves in 0.5 ml of 100 mM Tris-HCl pH=7.5 and 300 mM NaCl, centrifuging for 7 minutes at 10000 rpm and collecting the supernatant. 50 l of the supernatant was subjected to heat treatment (20 minutes in 33 C., 38 C., or 42 C.) and then immediately placed on ice. Pepsin digestion was initiated by adding to each sample 4.5 l of 0.1M HCl and 4 l of 2.5 mg/ml Pepsin in 10 mM acetic acid. The samples were incubated for 30 minutes at room temperature (about 22 C.). The digestion was terminated by adding 5 l of unbuffered 1 M Tris. Each sample was mixed with 22 l 4 Sample application buffer containing 10% beta-mercapto-ethanol and 8% SDS, boiled for 7 minutes and centrifuged for 7 minutes in 13000 rpm. 40 l of the supernatant were loaded in a 10% polyacrylamide gel and tested with anti-Collagen I antibody ((#AB745 from Chemicon Inc.) in a standard Western blot procedure. Positive control was sample of about 50 ng human collagen I (#CC050 from Chemicon Inc., extracted from human placenta by pepsin digestion) added to total soluble proteins from w.t. tobacco.
(327) As is illustrated in
Example 5. Plant P4H Expression
(328) Induction of Native Plant P4H
(329) Tobacco P4H cDNA was cloned and used as a probe to determine conditions and treatments that would induce endogenous P4H expression. Northern blot analysis (
(330) Detection of Human P4H Alpha and Beta Subunits and Collagen Alpha 1 and Alpha 2 Chains in Transgenic Tobacco Plants
(331) Detection of human P4H alpha and beta subunits and collagen type I alpha 1 and alpha 2 chains in transgenic tobacco plants was effected using anti-human P4H alpha subunit antibody (#63-163 from ICN Biomedicals Inc.), anti-human P4H beta subunit antibody (#NMAB2701 from Chemicon Inc.) and anti-Collagen I antibody (#AB745 from Chemicon Inc.). The results of a Western blot probed with these antibodies are shown in
(332) Expression of P4H alpha, P4H beta and collagen 1 alpha 1 and alpha 2 bands was confirmed in plant 13-6 (also transformed also with human LH3). The calculated molecular weights of P4H alpha and beta including the vacuolar signal peptide are 65.5 kDa and 53.4 kDa respectively. The calculated molecular weights of Collagen alpha 1 and alpha 2 chains with propeptides, without hydroxylati-ons or glycosylations are 136 kDa and 127 kDa respectively.
Example 6. Vacuolar Targeted Collagen is Stably Expressed in Dark-Grown Plants
(333) Collagen Expressing Plants:
(334) The 20-279 parental tobacco plant line was generated by co-transformation with an expression vector expressing P4Hbeta+LH3 and another expression vector expressing P4Halpha. Each gene is preceded by a vacuolar targeting determinant of aleurain, a plant vacuolar thiol protease,
(335) The 2-300 parental tobacco plant line was generated by co-transformation with an expression vector expressing col1 and another expression vector expressing col2. Each gene is preceded by a vacuolar targeting determinant of aleurain, a plant vacuolar thiol protease.
(336) The 13-652 plant was generated by co-transformation of tobacco plant with an expression vector encoding Col1, P4Hbeta and LH3 and a second expression vector encoding Col2 and P4H alpha. Each gene is preceded by a vacuolar targeting determinant of aleurain, a plant vacuolar thiol protease, Cassette sequences included in the vectors are described in Example 1 above.
(337) Light and Darkness Trial
(338) Analysis of six 13-6/52 homozygote plants. Samples from leaf #4+5/6 were taken daily at the same time (12:30) for 8 days, from 3 plants that were grown at regular conditions (16 hours under light conditions and 8 hours in the dark) and from 3 plants that were grown only in the dark.
(339) Total Protein Extraction and Western Blot Analysis
(340) Ninety mg of tobacco leaves were homogenized by mixer mill Type MM301 (Retsch) in an extraction buffer (100 mM Tris HCl pH=7.5, protease inhibitor cocktail available from Roche Catalog Number, 04-693-116-001) at 4 C. Following 30 min of centrifugation (20,000g at 4 C.), the supernatant was collected. Protein samples were fractionated on 8% SDS-PAGE (Laemmli 1970) and transferred to a nitrocellulose membrane using BIO-RAD Protein TRANS-BLOT apparatus. The membrane was blocked for 30 min at room temperature in 3% (g/v) skim milk (Difco), and then reacted with either commercial rabbit anti-human collagen type I polyclonal antibodies (Chemicon), for overnight (o.n.) at room temperature. The membrane was rinsed with water 3-5 times and then washed for 30 min in TBS. Following incubation with a secondary antibody [goat anti rabbit-IgG antibody conjugated to alkaline phosphatase (AP) (Chemicon)] for 2 hours at room temperature, the membrane was rinsed with water for 3-5 times and washed for 30 min in TBS. Immunodetection was effected with nitrotetrazolium blue chloride (NBT, Sigma) and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Sigma), at room temperature for 2 hour-o.n.
(341) Results
(342) As shown in
Examples 7-13
(343) General Materials and Methods
(344) Collagen extraction and enzymatic reaction: In a blender, 300 g of tobacco leaves were blended in a chilled extraction buffer (600 ml of 100 mM Tris-HCl pH 7.5 containing 360 mg potassium-meta-bisulfite, 530 mg L-Cysteine and 1 g EDTA) supplemented with 5 g PVPP and 2 g of activated carbon (see also U.S. Pat. No. 8,759,487). Blending was performed 5 times for 1-minute intervals to keep temperatures below 15 C. Crude extract was filtered through a gauze pad and centrifuged for 30 min, 25000 g, 5 C. The supernatant was collected; CaCl.sub.2) was added to a final concentration of 10 mM. The supernatant was divided into 10 ml samples. The desired enzyme was added to each 10 ml sample, according to the conditions set forth in Table 3 herein below.
(345) TABLE-US-00004 TABLE 3 Procollagen digestion reaction conditions Concen- Incubation tration of Incubation temperature protease time (degrees # Sample Protease: (mg/Liter): (Hours): Celcius): 1 Desired enzyme 1 3 15 2 Desired enzyme 5 3 15 3 Desired enzyme 25 3 15 4 Desired enzyme 1 6 15 5 Desired enzyme 5 6 15 6 Desired enzyme 25 6 15 * Control-no protease 0 3 15 * Control-no protease 0 6 15
(346) Enzyme description: Ficin from Fig tree latex (Sigma, catalog #F4125), Subtilisin from Bacillus licheniformis (Sigma, catalog #P5459-5 gr), Bromelain from pineapple stem (Sigma, catalog #B4882-10 gr), Papain from Carica papaya (Fluka, Catalog #76220-25 gr), Savinase 6.0 t type W from the alkalophilic bacterium Bacillus lentus (Novozymes, catalog #PX92500501), Neutrase 1.5 MG from bacterium Bacillus amyloliquefaciens (Novozymes, catalog #PW201041), Protamex, a commercial Bacillus proteinase complex (Novozymes, catalog #PW2A1021), Alcalase 3.0 T, Bacillus subtilis alkaline proteinase (Novozymes, catalog #PJ90000901), Esperase 6.0 T, alkalophilic bacterium Bacillus lentus (Novozymes, catalog #PE90110401), Alcalase 2.4 L FG, Bacillus subtilis alkaline proteinase (Novozymes, catalog #PLN05330), Esperase 8.0 L, alkalophilic bacterium Bacillus lentus (Novozymes, catalog #PE00077) were all donated by Novozymes. Trypsin, pancreatic trypsin 6.0 S type saltfree, from animal pancreas (Novozymes, catalog #P245-D20). TRYPZEAN, a recombinant trypsin expressed in corn was purchased from Sigma Chemical Co. (catalog #: T3449).
(347) Determination of atelocollagen concentration: The concentration of atelocollagen generated according to Examples 9-10 was assayed by two methods as follows:
(348) SIRCOL assay: SIRCOL collagen assay kit was purchased from Biocolor Ltd. (Cat. No 85000). This assay is based on the interaction of the Sirius Red dye with the collagen triple helix. The analysis was performed according to the supplier's instruction manual, 4th edition, 2002. Bovine collagen standard was used to prepare a calibration curve (0 to 50 g collagen). Three samples of 10-50 l of the collagen solution in 10 mM HCl were placed into a 1.5 ml Eppendorf tube, and the volume was brought to 100 l with 0.5 M acetic acid. 1 ml SIRCOL dye reagent was added to each tube and the tubes were shaken for 30 min at room temperature. Tubes were centrifuged at 12,000 rpm for 10 min at room temperature, the supernatant was aspirated and the tubes were inverted over an absorbing paper to remove the remaining supernatant. Cotton buds were used to remove any access drops from the walls of the tubes. 1 ml of Alkali reagent was added to each tube, mixed well and incubated for 10 min at room temperature. Absorption at 540 nm was measured using a spectrophotometer and the concentration of collagen was calculated against the calibration curve, using 10 mM HCl as a blank sample.
(349) SDS-PAGE Instant Blue assay: Samples were boiled for 5 min in SAB buffer (reducing conditions) and centrifuged at 12,000 rpm for 5 min, prior to loading on a SDS PAGE, 8% acrylamide. The gel was run in a Mini Protean 3 unit (BioRad #165-3301, 165-3302). Instant Blue reagent (Novexin #ISB01L) was applied to the gel until the protein was visualized as blue bands on the gel. The gel was rinsed with water and dried. Concentration of the collagen bands was calculated by densitometry, against a human standard loaded on the same gel.
(350) Coomassie analysis: Samples of collagen (in 10 mM HCl) were titered to pH 7.5 using 1M Tris. Sample Application Buffer containing 10% beta-mercaptoethanol and 8% SDS was added by diluting it fourfold in the 30 l of pH titered samples. The samples were boiled for 7 minutes. 30 l of the supernatant were loaded on to a 10% polyacrylamide gel and separated for 2 hours at 100 volts. The gel was transfer to a Coomassie-based solution for 1 hour with shaking. The Coomassie dye was removed using a standard destain solution.
(351) SDS-PAGE and Western blot analysis of alpha-1 and alpha-2 collagen chains: Samples were boiled for 7 minutes in reducing sample application buffer (2.5% beta-mercaptoethanol and 2% SDS) and then centrifuged for 15 minutes at 13,000 rpm. 30 l of the supernatant were separated on a 10% polyacrylamide gel. Following separation, standard Western blot protocols were employed to blot samples onto nitrocellulose membranes. Following transfer, the membranes were incubated with anti-Collagen I antibody (Chemicon Inc. catalogue #AB745) for immunodetection of alpha-1 and alpha-2 collagen chains. Molecular weight markers were purchased from Fermentas Inc. (catalogue #SM0671).
(352) Controls: A positive control of Human Skin Collagen Type I purchased from Calbiochem (#234138) was employed as a marker for Western blot analyses. The grinding control sample reflects pellets derived from tobacco leaves immediately prior to resuspension in extraction buffer. The D control samples reflect the same pellets following resuspension in extraction buffer. K control samples include ficin-digested procollagen in 10 mM HCl. To monitor background ficin-independent protease activity, ficin-free cleavage samples were always prepared in parallel to all ficin digestion tests.
(353) Purification of collagen from transgenic plants: Digestion of propeptides in the collagen-containing extract was initiated by the addition of 30 mg/L trypsin or 5 mg/L (50 l/L) Subtilisin (Sigma #P5459) or 5 mg/L Ficin (Sigma #F4125). Proteolysis was performed at 15 C. for 4 hours. Elimination of non-soluble contaminants was performed by centrifugation for 30 min, 22,000 g, 15 C. The supernatant was recovered, and the collagen was precipitated by slowly adding crystalline NaCl to a final concentration of 3.13 M with constant stirring for 20 min at R.T. The solution was incubated in a cold room O.N. without stirring. Collection of the collagen was effected by centrifugation at 25,000 g, for 2 hours at 5 C.
(354) The supernatant was carefully poured through four layers of gauze pad. The pellets were resuspended in 200 ml of 250 mM acetic acid and 2M NaCl for 5 minutes using a magnetic stirrer. The suspension was centrifuged at 25,000 g, for 40 min at 5 C. Traces of supernatant were eliminated from the glass vials. The pellets were redissolved in 200 ml of 0.5 M acetic acid at room temperature for 1 hour. Elimination of nonsoluble matter was performed by centrifugation at 16,000 g, 30 min, 15 C. The supernatant was poured through 12 layers of gauze pad. Collagen was precipitated by slowly adding NaCl to a final concentration of 3M with constant stirring for 20 min at R.T. The solution was incubated at 4 C. for 8 hours up to O.N. Collection of collagen was performed by centrifugation at 25,000 g, for 2 hours at 5 C. Following aspiration of the supernatant, the pellet was redissolved in 200 ml of 0.5 M acetic acid using a magnetic stirrer at R.T. for 1 hour. Elimination of nonsoluble matter was performed by centrifugation at 16,000 g, 30 min, 15 C. The supernatant was poured through 12 layers of gauze pad. Collagen was precipitated by slowly adding NaCl to a final concentration of 3M with constant stirring for 20 min at R.T. The solution was incubated at 4 C. for 8 hours. Collagen was collected by centrifugation at 2,000 g, for 2 hours at 5 C. Supernatent was aspirated. The pellet was redissolved in 40 ml of 10 mM HCl by pipetation and vortexing for 5 min at R.T. The solution was transferred to a dialysis bag (MWCO 14,000 Da) and dialyzed for 4 hours against 4 L of 10 mM HCl at 4 C. This dialysis was repeated O.N.
(355) Sterilization of the collagen was performed by filtering the solution first through a 0.45 m filter, then through a 0.2 M filter using a 30 ml syringe. Collagen was further concentrated via ultrafiltration using a Vivaspin PES 20 ml filtration tube (Vivascience, #VS2041, MWCO 100000). Centrifugation was performed for 45 min at 5000 g at 5 C. until the volume was reduced to 0.75 ml.
(356) Optimization of digestion kinetics and conditions of procollagen cleavage by food-grade ficin: Pellets (collected as described in Example 10), up to saturation in 25% ammonium sulfate (AMS)) were resuspended in a buffer (Buffer A: 4.5 mM potassium metadisulfite, 12.5 mM L-cystein, 7.5 mM EDTA dissolved in 0.1 M sodium phosphate buffer, titrated to pH 7.5 with 10 M NaOH or 6 N HCl) at a ratio of 4.36 g pellet:200 mL ice cold buffer. Samples were then stirred for 20 min at 15 C. Aliquots of 10 mL per 15 mL test tube were then prepared, followed by administration of increasing concentrations (5-15 mg/L) of ficin (Fig tree latex, Biochem Europe food grade ficin). Samples were incubated at 15 C. for 1-3 hours and separated by SDS-PAGE and then analyzed by Western blot for presence of collagen migrating at lower molecular weights than procollagen.
(357) Tobacco leaf-derived pellets resuspended in phosphate Buffer A (27.2 g:800 mL buffer) of varying pH values (5.5, 7.5, or 8.5) were treated with 10 mg/L ficin in the presence of 0-3 M NaCl for 1 h at 15 C. The reaction was terminated by centrifuging 1 mL samples from each reaction mixture (10 min, 15000 g, 4 C.). Pellets were resuspended in 1 mL Buffer A (pH 7.5), separated by SDS-PAGE and analyzed by means of Western blot.
(358) Optimization of digestion kinetics and conditions of procollagen cleavage by pharmaceutical-grade ficin: Tobacco leaf pellets were resuspended in a pharmaceutical-grade (Biochem-Europe Pharm grade) ficin-containing extraction buffer (10 mg/L) of varying pH values (7.5, 8.5, 9.5) along with increasing NaCl concentrations (0-3 M) for 5-45 minutes. Further experiments studied the necessity and optimal conditions and concentrations of EDTA and L-cystein as additives to the extraction buffer. Samples were incubated in the digestion mixture in the presence of 0-100 mM EDTA with 0-80 mM L-cystein for 1-3 h at 15 C., at pH 7.5 and without NaCl.
(359) Fibrillogenesis: Fibrillogenesis is regarded as a collagen functionality test. Hence, the ability of purified collagen digested by ficin to form fibrils is an essential property of the obtained product. Test method: The pH of the collagen-containing solution (duplicate samples) was neutralized to pH 6.7 with sodium phosphate, pH 11.2, and then incubated at 27+/2 C for 6 hours. Samples were centrifuged to sediment the hydrogel which was formed. Protein concentration of both pre and post-neutralization (supernatant) samples was determined via the Lowry method. PURECOL (Purchased from NUTACON, Cat No. 5409) was employed as positive control and gelatin as a negative control.
Example 7. Extraction and Purification of Collagen from Transgenic Plants in the Presence of Trypsin and Pepsin
(360) The production of human collagen in plants was initiated in order to avoid the use of collagen from mammalian sources since the use of mammalian proteins in human cosmetics or medical applications may be risky to human health as the evolutionary proximity is relativity close. The known disease Creutzfeldt-Jakob disease (CJD) is an example of one which is caused by consumption of infected mammal proteins by humans.
(361) Initially, the purification of collagen from transgenic plants was performed using bovine pancreatic Trypsin and the digestive protease Pepsin, both of which catalyze the hydrolysis of proteins in the animal digestive system. The following examples illustrate the identification of a protease from a non-animal source suitable for use in the collagen purification process.
(362) Results
(363) Propeptide digestion during the purification of collagen was first performed by the pancreatic enzyme Trypsin. Trypsin, at 300 mg/L digested the collagen propeptides, however collagen yield was very low at the end of the purification process (
(364) In an attempt to overcome this problem, varying incubation temperatures and times were tried; however, the results did not lead to a change in yield (data not shown). The addition of Pepsin enzyme later on in the purification process resolved the partial digestion problem (
Example 8. Collagen Extraction and its Enzymatically-Induced Digestion
(365) However, the trypsin-pepsin solution was not optimal since it required two different enzymes, lengthening the purification process. Furthermore, both enzymes are from animal sources. In order to overcome these issues, a screen of different protease enzymes of non-animal origin, was performed. Varying digestion patterns were obtained by the different enzymes screened. Very little or no observable digestion of the propeptides resulted from the incubation of collagen with the Savinase (
Example 9. Extraction and Purification of Collagen from Transgenic Plants Following Digestion with Subtilisin or Ficin
(366) Collagen purifications from 450 gr leaves of transgenic plants (13-361 or 13-6-52) were performed followed by procollagen digestion with Ficin (
Example 10. Scaled Up Extraction and Purification of Collagen from Transgenic Plants Following Digestion with FICIN
(367) 1 kg of transgenic tobacco leaves were ground with pre-chilled 2 L extraction buffer (100 mM sodium phosphate buffer pH 7.5, 4.5 mM potassium Meta disulfite, 12.23 mM L-cystein and 7.5 mM EDTA) in a 4 L reactor (ESCO model EL-3) for 20 minutes (5 C., 50% scraper speed and 100% homogenizer blade rpm). 6.68 g charcoal and 16.67 g of PVPP were added to the extract and continuously stirred for 20 minutes (5 C. and 50% scraper speed). Extract was centrifuged (11000 rpm, 5 C., 0.5 H) and supernatant was saturated with 15% ammonium sulfate (1 hour stirring, 5 C.). Following a 6880 rpm, 5 C., 30 min, the supernatant was saturated to 25% ammonium sulfate and stirred for 1 hour (5 C.). Following recentrifugation, the pellet (6880 rpm, 5 C., 30 min) was resuspended (in extraction buffer) in 15% of the volume collected after the first centrifugation step. Removal of propeptides was enabled by a 3 hr digestion, 15 C. with 5 mg/L ficin (Biochem Europe). The sample was centrifuged (11,000 rpm, 15 C., 30 min) and the mature collagen was precipitated using 3 M NaCl (NaCl was added slowly while stirring and left O.N. at 4 C.). Following precipitation (13,000 rpm, 5 C., 2 hours), the supernatant was discarded, and the pellet was resuspended in 0.5M acetic acid. Another round of 3M salting out (O.N) and centrifugation was followed by the resuspension of the pellets in 40 ml of 10 mM HCl. The sample was transferred to a dialysis bag (12-14 kDa) and dialyzed against 4 L 10 mM HCl, at 4 C., for 4 hours. The dialysis was repeated with fresh 4 L 10 mM HCl, O.N. The dialyzed solution was filtered through a 0.45 micron filter (previously washed with 10 mM HCl) and then through a 0.25 micron filter. The samples were finally concentrated in a Vivaspin (Vivascience) filtration tube (100 kDa).
Example 11. Solubility of Atelocollagen Produced as Recombinant Human Procollagen in Transgenic Tobacco Plants
(368) The concentration of atelocollagen generated according to Examples 9-10 was assayed by two methods as follows as described in the Methods section. The resulting concentrations obtained for several typical preparations digested with ficin, are listed in Table 4, herein below:
(369) TABLE-US-00005 TABLE 4 Collagen concentrations as determined via the Instant blue or Sircol staining methods mg/ml collagen by mg/ml collagen by Lot No. Instant blue Sircol UPEK1 15.7 9.3 UPEK2 5.8 4.78 PEK052 6.8 5.5 UPEK3 3.4 3.54 UPEK4 NA 3.3 UPEK6-1 5.9 4.7 UPEK6-2 4.3 3.7
Example 12. Ficin-Dependent Proteolysis of Tobacco Leaf-Derived Procollagen
(370) Digestion kinetics of procollagen by food-grade ficin: To calibrate appropriate ficin concentrations and incubation times allowing for highest collagen yields, procollagen-expressing tobacco leaf pellets were incubated with increasing concentrations of food-grade ficin (5-15 mg/L) at 15 C. for 1-3 hours. Samples were then analyzed by immunodetection of alpha-1 and alpha-2 collagen chains on Western blots. Increased ficin concentrations offered improvement in collagen chain yield following a 1-hour incubation period (
(371) Digestion kinetics of procollagen by pharmaceutical-grade ficin: Similar experiments were carried out on procollagen-expressing tobacco leaf pellets to determine the appropriate conditions for procollagen digestion by pharmaceutical-grade ficin. Pellets were resuspended and incubated with increasing concentrations of pharmaceutical-grade ficin (2.5-10 mg/L), at 15 C. for 0.5-3 hrs. Digestion efficiency was determined by immunodetection of collagen chains on Western blots. As is shown in
(372) Optimization of pH values and salt concentrations for ficin-dependent procollagen cleavage: The contribution of both digestion buffer pH and salt concentrations were then evaluated. Similar tobacco leaf post-AMS pellets were resuspended in extraction buffer titrated to pH 5.5, 7.5, 8.5, or 9.5 with salt content ranging from 0.5-3 M NaCl. Samples were then incubated with 10 mg/L pharmaceutical-grade ficin at 15 C. for 1 hour prior to immunoanalysis on Western blots. Acidic assay conditions (pH 5.5) led to insufficient collagen yield (
(373) Determination of vitalness of EDTA and L-cystein in digestion reaction mixture: Both EDTA and L-cystein are additives present in the extraction buffer at early stages of the collagen purification process. Herein, the essentiality of these two components to effective ficin-dependent collagen cleavage was determined. Procollagen post-AMS pellets were resuspended in extraction buffer containing increasing concentrations of EDTA (8-80 mM) and L-cystein (10-100 mM), and incubated with ficin (10 mg/L) at 15 C. for 1 hour, at pH 7.5. A pronounced enhancing effect was observed on digestion efficiency in the presence of 10 mM L-cystein (
(374) Optimization of temperature conditions for ficin-induced procollagen digestion: Procollagen-expressing tobacco leaf pellets were incubated with ficin for 1.5 hours at 15 C. and then transferred to a 30 C. bath for an additional 1.5 hours. Western blot and fibrillogenesis assays did not identify any improvement in collagen yield or sample purity related to increased reaction temperatures.
(375) Fibrillogenesis of collagen extracted from ficin-induced cleavage of procollagen: Following ficin-induced digestion, fibrillogenesis assays were performed to determine the resultant collagen's ability to form fibrils, the ultimate method of determining the collagen's functionality. Table 5, herein below summarizes fibrillogenesis results as determined following ficin cleavage of procollagen using two variant protocols. Both protocols A and B, differing in reaction buffer pH and salt content yielded significant percentage of collagen fibrils. Thus, the proteolysis reaction parameters developed and optimized herein, lead to functional collagen at high yields.
(376) TABLE-US-00006 TABLE 5 Percent fibrillogenesis observed by collagen obtained via digestion under varying conditions Batch # Digestion conditions: % Fibrillogenesis C39 Protocol A: 10 mg/L ficin, 1 94.1 hr, pH 7.5 P100 Protocol B: 10 mg/L ficin, 87.2 pH 8.5, 2M NaCl, 1 hr P101 Protocol A 73.1 YC1 Protocol A 95.4 YC2 Protocol B 98.4 YC3 Protocol A 96 YC4 Protocol A 93.1 YC5 Protocol A 93.2 YC7-8 Protocol B 94.2
Example 13. Determination of TRYPZEAN Protease Efficacy in Procollagen Cleavage
(377) Procollagen-expressing tobacco leaf pellets resuspended in extraction buffer (pH 7.5) enriched with EDTA (7.5 mM) and L-cystein (12.5 mM), were incubated with TRYPZEAN (30-100 mg/L) for 1-3 hours at 15 C. Within 1 hour, doses of 60 and 100 mg/L TRYPZEAN efficiently cleaved procollagen to yield two distinct alpha collagen chains, with no detectable over-digestion (
(378) Discussion
(379) The above Examples 7-13 describe the identification of a non-mammalian protease suitable for use in the process of purification of collagen derived from plants. Proteases from bacterial and plant sources were examined and three enzymes were found suitable for the collagen propeptides digestion, namely, neutrase, subtilisin, TRYPZEAN and ficin.
(380) Neutrase and Subtilisin are both secreted by the bacteria Bacillus sp. Subtilisin is primarily (>90%) used in detergents and household cleaning products. Approximately 10% of subtilisin use is towards technical applications such as protein hydrolysis, leather treatment, and in the textile and cosmetics industries. Standard use of subtilisin in the collagen purification process at higher concentration is problematic due to overdigestion of collagen. Neutrase is mainly used in the beverage alcohol industry and in cheese ripening. In Examples 7-13, described herein above, neutrase was only effective in digesting the propeptides at high concentrations and at least 6 hours were required for desirable digestion results.
(381) Under the presently described experimental conditions, recombinant trypsin and ficin were found to be the most suitable among the four, since there was no overdigestion of collagen at either high enzyme concentrations or after extended incubation periods. Furthermore, these enzymes apparently did not digest the helical region of the collagen, as determined by SDS PAGE analysis. Ficin, being a natural enzyme extracted for Fig latec plant (Ficus carica), is available commercially at several grades including a pharmaceutical grade from several sources at low cost. It is used in the food industries: alcohol and beer industries, hydrolisation of proteins, meat processing, baking industry, and in the preparation of pet food and health food. It is also applied in the pharmaceutical industry in contact lens cleansers, cancer treatment, anti-arthritis treatments, and digestive aids as well as in the cosmetic and textile industries.
Example 14. Further Analysis of rhCollagen Properties
Materials and Methods
(382) Materials
(383) Human recombinant collagen (rhCollagen) type I expressed and isolated from transgenic tobacco plants was produced and supplied by CollPlant Ltd (Israel). Type I Bovine Collagen (PureCol) was purchased from Advanced Biomatrix, USA. Methacrylic anhydride, glycidyl methacrylate, triethylamine, tetrabutylammonium bromide, 2,4,6-Trinitrobenzenesulfonic acid (TNBS), 2-Hydroxy-4-(2-hydroxyethoxy)-2-methylpropiophenone (Irgacure 2959), sodium phosphate monobasic anhydrous, HCl 1N, HCl 37%, sodium bicarbonate and NaOH were purchased from Sigma Aldrich Ltd, Israel. Phosphate buffered saline (PBS), 10 PBS, Foetal Bovine Serum (FBS), DMEM high glucose and penicilin/streptomicin were purchased from Biological Industries Ltd, Israel. Sodium phosphate dibasic anhydrous was purchased from Canton, India. Ethanol absolute and acetone were purchased from Bio-Lab Ltd, Israel. Hyaluronic acid was purchased by Lifecore, USA.
(384) Buffers and Photoinitiator Stock Solution Preparation
(385) Fibrillogenesis buffer (FB): sodium phosphate dibasic was dissolved in double distilled water (DDW) to final concentration of 162 mM. The solution was titrated to pH 11.2 with 10N NaOH.
(386) Medium preparation: 50 ml of foetal bovine serum and 5 ml of penicillin/streptomycin (10,000 units/mL and 10 mg/mL respectively) were added under aseptic conditions to 500 ml of DMEM high glucose medium. The medium was gently mixed and kept in fridge.
(387) Phosphate Buffer Saline preparation: 39 ml of 0.1M Sodium phosphate monobasic solution were mixed with 61 ml of 0.1M sodium phosphate dibasic solution and final volume adjusted to 200 ml with DDW. Final pH was adjusted to 7 with concentrated NaOH or HCl as needed. NaCl was added to final concentration of 150 mM.
(388) Washing buffer: HCl was added to the fibrillogenesis buffer to reach a final concentration of 16.2 mM sodium phosphate dibasic and 10 mM HCl. pH was adjusted to 7.2-7.4 with 10N NaOH.
(389) Photoinitiator 10% (v/v) stock solution: Irgacure 2959 was dissolved in ethanol absolute/PBS 1:1 solution to a final concentration of 100 mg/mL.
(390) Methacrylation of rhCollagen
(391) Fibrillar rhCollagen-methacrylamide and monomeric rhCollagen-methacrylamide were prepared by reaction of lysine and hydroxylysine collagen residues with methacrylic anhydride in aqueous medium as described below and stored at 4 C. light protected until further use.
(392) Fibrillar rhCollagen-methacrylamide
(393) 3 to 10 mg/mL fibrillar rhCollagen-methacrylamide was synthesized either in washing buffer, fibrillogenesis buffer or DDW, at room temperature (R.T.) or at 12 C. For example, in brief, fibrillar collagen-MA was synthesized in DDW as follow: monomeric rhCollagen 3-4 mg/mL solution in 10 Mm HCl, (COLLAGE) was mixed with fibrillogenesis buffer at 9:1 v/v ratio and stirred for 1 hr at R.T, receiving fibrils. The solution was centrifuge at 7500 rpm at 4 C. for 30 minutes, discarding the supernatant. The pellet was re-suspended in equal volume of washing buffer and centrifuged at the same conditions. After that, the sediment fibrils were re-suspended in DDW to 10 mg/mL. Concentration was confirmed by percent solid measurements. Methacrylic anhydride (MA) was added drop-wise under nitrogen flow at room temperature at 10 to 20 molar ratio with respect to collagen lysines, and the reaction solution pH was monitored over time and adjusted to pH 7 with 10N NaOH. After 24 hours reaction, the mixture was dialyzed against washing buffer (pH 7) using 10 kDa cutoff dialysis tubing (Spectrum Laboratories Inc, CA, US) for 3 days at 4 C. with at least 6 changes of the dialysate (washing buffer in this case), to remove reaction by-products and eventually lyophilized for 3-4 days.
(394) Monomeric rhCollagen-methacrylamide
(395) 200 mM MOPS, phosphate, or Tris buffers with the addition of 150 mM NaCl were used. For example, 200 mM MOPS and 150 mM NaCl were added to 3-4 mg/mL COLLAGE and stirred at RT until clear solution was obtained. Thereafter, 10 to 20-fold excess of methacrylic anhydride was added drop-wisely under nitrogen flow at 12 C., and the pH was adjusted over time to pH 7 with 10N NaOH. After 24 hours reaction, the mixture was dialyzed against 10 mM HCl and 20 mM NaCl (pH 2) with 10 kDa cutoff dialysis tubing for 3 days at 4 C. with at least 6 changes of the dialysate, followed by 3-4 days lyophilization.
(396) Methacrylation of Hyaluronic Acid (HA)
(397) 500 mg of HA were functionalized as described by Leach et al. [Leach et. al. 2002, Biotechnology and Bioengineering, vol. 82, no. 5]. Briefly, 1.8 ml of triethylamine, 1.8 ml of glycidyl methacrylate, and 1.8 g of tetrabutyl ammonium bromide were added separately to 50 ml of 10 mg/mL HA solution in DDW and thoroughly mixed before the next component was added. The reaction was mixed overnight at room temperature and the HAMA precipitated in 20-fold volume of acetone and re-dissolved in DDW. The precipitation process was repeated twice to eliminate all the reaction residues. The material was eventually lyophilized.
(398) Solutions Preparation for Viscosity Measurements
(399) PureCol and Collage in PBS: 8 ml of monomeric collagen solutions (3 mg/mL in 10 mM HCl), either rhCollagen (COLLAGE) or bovine collagen (PureColl) were neutralized by adding 1 ml of PBS10. The solution was then brought to pH 7-7.5 by titration with 0.1N NaOH. Eventually double distillated water was added to reach a final volume of 10 ml. Samples were incubated at 37 C. for at least 90 min before measurements were performed (either at 37 C. or 4 C.).
(400) COLLAGE in fibrillogenesis buffer: 9 ml of monomeric rhCollagen (COLLAGE) solution (3.79 mg/mL in 10 mM HCl) was neutralized by adding 1 ml of fibrillogenesis buffer. Samples were incubated at 37 C. for at least 90 min before measurements were performed (either at 37 C. or 4 C.).
(401) Fibrillar rhCollagen-methacrylamide in PBS: Lyophilized fibrillar rhCollagen-MA prepared in DDW and dialyzed vs. washing buffer (according to what described above with 10-fold excess of MA) were dissolved in PBS to a concentration of 10 mg/mL. Samples were incubated at 37 C. for at least 90 min before measurements were performed (either at 37 C. or 4 C.).
(402) rhCollagen-methacrylamide in DMEM: Lyophilized fibrillar rhCollagen-methacrylamide (15-fold excess of MA, prepared and dialyzed in washing buffer, according to the description above) was dissolved in DMEM medium to final concentrations of 20 and 26 mg/mL.
(403) rhCollagen-methacrylamide/Hyaluronic Acid in DMEM: Hyaluronic Acid was added to a solution of fibrillar rhCollagen-MA to obtain final concentrations of 10 mg/mL HA and 20 mg/mL rhCollagen-MA in DMEM medium.
(404) rhCollagen-methacrylamide/Hyaluronic Acid methacrylate (HA-MA) in DMEM: Hyaluronic Acid methacrylate (see above) was added to a solution of fibrillar rhCollagen-MA to obtain final concentrations of 10 mg/mL HA-MA and 20 mg/mL rhCollagen-MA in DMEM medium.
(405) rhCollagen-MA Photocrosslinking for Loss and Storage Moduli Measurements
(406) rhCollagen-MA crosslinked scaffolds were formed in two different preparations, aimed to be examined in two individual experiments. In the first preparation, 1-2 wt % fibrillar rhCollagen-MA synthesized with 10-fold excess of the methacrylic reagent were dissolved in PBS 0.1 M at R.T, then Irgacure 2959 0.1% was added and 1 mL final volume of solutions was injected into a discoid mold. Following that, curing process was performed from a distance of 1.5 cm for 7 and 10 seconds at an averaged intensity of 670 mW/cm2 using mercury light source, ending up in crosslinked scaffolds. The second preparation included 2 different batches of fibrillar rhCollagen-MA, synthesized with 15- and 20-fold excess of the methacrylic reagent. 1-2 wt % were dissolved in PBS 0.1 M, and Irgacure 2959 0.1% was added to achieve a final volume of 1.5 mL. In order to obtain highly crosslinked scaffolds, curing process was performed from a distance of 2 cm for 60 seconds at an averaged intensity of 420 mW/cm.sup.2.
(407) TNBS Assay
(408) The assay protocol was similar to the one reported by Sashidhar et al. [Sashidhar R. B., Capoor, A. K., Ramana, D, Journal of Immunological Methods. 1994, 167, 121-127], and based on Habeeb [Habeeb A. F. S. A, Analytical Biochemistry. 1966, 14, 328-336]. Briefly, freshly prepared 0.4 mL of 0.01% (v/v) TNBS was added to 0.4 mL of 0.1-2 mg/mL fibrillar rhCollagen-MA in sodium bicarbonate 4%. After 2 hours reaction at 40 C., 0.2 mL of 1N HCl and 0.4 mL of 10% (v/v) SDS were added. The absorbance was measured at 335 nm in a spectrophotometer in a 1 mL polystyrene cuvette. A control (blank) was prepared with the same procedure except that sodium bicarbonate buffer was added instead of rhCollagen-MA solution. The absorption of 1-2 mg/mL native fibrillar rhCollagen prepared with the same conditions was recorded for calibration.
(409) Rheological Characterization
(410) Viscosity: Viscosity measurements were performed on a HAAKE RHEOSTRESS600 rheometer (Thermo Electron Corporation) with a temperature-controlled cell chamber, using a C60/1 Ti cone-plate set up. Viscosity was measured on 1 mL sample in a rotational ramp mode, shear rate ranging from 0.0001 to 1000 sec-1 at 4 C., 25 C. and 37 C.
(411) Scaffolds' storage and loss moduli: The rheological behavior of rhCollagen crosslinked discs was investigated using parallel plate system employing PP20 serrated spindle and 20 mm serrate plate set up. In order to characterize the non-crosslinked rhCollagen-MA, C60/1 Ti cone-plate elements were used. In order to evaluate the rheological behavior of rhCollagen-MA, two sets of experiments were performed individually. In the first, 1 mL samples were subjected to oscillation forces at controlled stress mode, recording storage modulus G and loss modulus G values while applying 5 Pa shear stress at 1 Hz frequency and 37 C. for 300 seconds. The gap was adjusted to 90% of the original sample height and G and G values were averaged at the range of 150-300 seconds. In the second experiment, 1.5 mL crosslinked discs were tested in frequency sweep oscillations at 37 C., where G was recorded under 1 Pa shear stress at frequency range of 0.01-100 Hz. To initiate measurement, the spindle was lowered to contact the hydrogel surface, and then further lowered until the axial force of the instrument was equaled to 0.4 N. Prior to all measurements, samples were kept on the plate covered with humidity lid for 1 minute, in order to reach temperature equilibrium.
(412) Results
(413) TNBS Assay
(414) The extent of modification of rhCollagen was quantified using TNBS colorimetric assay. The assay quantifies the molar content of free, non-reacted -amino groups derived from lysine and hydroxyl lysine, and subsequently the degree of functionalization. The degree of functionalization of fibrillar rhCollagen 10, 15 and 20-fold different batches was determined by TNBS assay, as shown in Table 6.
(415) TABLE-US-00007 TABLE 6 The degree of functionalization of fibrillar rhCollagen from different preparations, as determined by TNBS assay. Fibrillar rhCollagen-MA Degree of batch methacrylation [%] 10-fold 98.1 15-fold 95.5 20-fold 92.9
(416) The results indicate on high modification capability of the fibrillary rhCollagen and
(417) imply that adding the methacrylic reagent in molar ratio of 10 may be preferable for receiving maximal functionalization of the fibrillar collagen.
(418) Rheology
(419) 1. Viscosity
(420) Temperature Dependence of rhCollagen/Bovine Collagen Viscosity
(421)
(422) Viscosity of rhCollagen-methacrylamide
(423)
(424) The skilled artisan would recognize that rhCollagen-MA is not crosslinked and that in order to achieve crosslinking, one needs to add a photoinitiator and light.
(425) 2. Scaffolds' Loss and Storage Moduli
(426) Rheological analysis of 1 mL discs over time at 37 C. performed in the first experiment are presented in
(427) In the second experiment, 1.5 mL discs illuminated for 60 seconds present higher G values, as shown in
Example 15. Procedure for Obtaining and Processing rhCollagen from Tobacco Plants
(428) Tobacco plants genetically modified as described above are grown, and the leaves are harvested and prepared for initial upstream extraction and purification (
(429) As shown in
(430) As shown in
Example 16. Viscosity and Polymerization of rhCollagen Methacrylate with Additives
(431) The viscosity of 5 mg/ml rhCollagen methacrylate enriched with different additives (polyvinyl alcohol methacrylate (PVAMA) (
(432) The polymerization of rhCollagen methacrylate enriched with different additives is also shown with respect to typical scaffolds of 5 mg/ml collagenMA+ different additives at a ratio of collMA:additive 2:1 (
Example 17. Injectable rhCollagen/Platelet Rich Plasma Scaffold
(433) Injectable rhCollagen/Platelet Rich Plasma (PRP) scaffold was investigated as a scaffold and healing implement for tendonophathy. A slow-degrading rhCollagen matrix combined with a source of growth factors (GFs), such as platelet rich plasma (PRP), was injected at the vicinity of the injured tendon in an effort to provide the required support to enhance the healing of injured tendon. The treatment used a matrix made of plant derived recombinant human Type I collagen (rhCollagen) mixed with PRP, which supports extended release of growth factors at the injured site and promotes healing. The effect of the rhCollagen-PRP matrix was compared to PRP, in vitro and in vivo, in supporting proliferation of fibroblasts, clot degradation, release of GFs and tendon healing in a collagenase-induced Achilles tendon tendinopathy rat model. rhCollagen-PRP demonstrated a superior performance compared to PRP alone in vitro and in vivo. These results are encouraging with respect to the use of the rhCollagen matrix combined with PRP in a clinical trial for a tendinopathy indication.
Materials and Methods
(434) rhCollagen Matrix
(435) Monomeric solution of rhCollagen in 10 mM HCl (CollPlant, Ness Ziona, Israel) was fibrillated by pH neutralization in phosphate solution and cross-linked in 18 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Aldrich, Israel). The cross-linked collagen was then washed by repeated centrifugations in double distilled water and Calcium Chloride (CaCl2) (Merck, Israel) was added, calculated to a final concentration of 20 mM. Syringes filled with rhCollagen slurry were lyophilized and terminally sterilized with Ethylene Oxide.
(436) Platelet Rich Plasma (PRP) Preparation
(437) Granulocyte free PRP was prepared using Tropocell PRP kit (ESTAR, Israel) according to the manufacturer instructions. For the in vitro cell proliferation assay, human blood was collected from healthy human volunteers (Helsinky permission number 2012068). For the in vivo animal studies blood was withdrawn from Hsd:Sprague DawleySD rats (Harlan).
(438) RhCollagen Matrix/PRP and Control Preparation
(439) RhCollagen matrix/PRP: syringes containing lyophilized cross-linked rhCollagen were hydrated with PRP or saline to obtain a final concentration of 20 mg/ml rhCollagen.
(440) Thrombin activated PRP (control): human PRP was mixed with purified Thrombin (Sigma Aldrich, Israel) to obtain final concentration of 100 IU/ml.
(441) CaCl2 activated PRP (control): rat PRP was mixed with CaCl2 (Merck, Israel) to obtain a final concentration of 20 Mm
(442) In Vitro Cell Proliferation Assay
(443) In this study the effect of GFs on normal human dermal fibroblasts (nHDF) viability and proliferation was assessed. Cell viability and proliferation were compared upon GFs diffusion from either a matrix composed of the crosslinked rhCollagen matrix combined with PRP or from a clot composed of thrombin activated PRP. The rhCollagen matrix combined with PRP or thrombin activated PRP (200 l each), were injected into transwells (Thincerts 24 well 8.0 m, Greiner bio-one, Israel) placed on top of a 24 well plate (Thermo scientific, Israel) and incubated at 37 C. for 20 minutes to enable clot formation. Normal human dermal fibroblasts (nHDF) (5,000 cells per 0.5 ml), were seeded on the bottom of each well in serum deprived medium (Dulbecco's Modified Eagle's Medium, DMEM, with 1% Fetal Bovine Serum, FBS, Biological Industries, Israel). The transwells containing the matrices (either the rhCollagen matrix combined with PRP or thrombin activated PRP) were placed on top of the seeded well and additional 0.2 ml of medium were added on top of the samples. nHDF in 0.5 ml DMEM, 1% FBS were seeded as control. Samples were tested in triplicates 7 and 10 days after seeding using cell proliferation kit WST-1 (Roche, Israel) according to the manufacturer instructions.
(444) In Vivo Studies
(445) Animals
(446) Hsd:Sprague Dawley SD rats weighing 230 g20% were chosen for the animal experiments. Animals were given a unique animal identification ear number and randomly assigned to a specific group. Animals were housed in individually ventilated (IVC) cages in dedicated heat, ventilation, air conditioning (HVAC) animal facility. Temperature and humidity were monitored continuously. Animals were provided ad libitum a commercial rodent diet (Harlan Teklad TRM Ra/Mouse Diet) and allowed free access to autoclaved water. The facility had no exposure to outside light and is maintained on automatic alternating cycles of 12 hours light and 12 hours dark. All animals were treated according to the guidelines for laboratory animal treatment and care, and all protocols were approved by the local Institutional Animal Care and Use Committee. No abnormalities were detected in any of the animals throughout the entire study period. No statistically significant differences were found in mean group body weight values and gain. All gains were within the range of normally expected values at termination.
(447) In Vivo Clot Degradation and Growth Factors Release
(448) Degradation time and GFs content over time of rhCollagen matrix combined with PRP, rhCollagen matrix alone or CaCl.sub.2 activated PRP were compared in a subcutaneous (SC) rat model (Science in Action Ltd., Ness Ziona, Israel)
(449) Injection sites on the backs of 34 female Sprague Dawley rats (Harlan Laboratories, Ness Ziona Israel) were shaved and marked. Each rat was injected at four distanced locations with 0.5 ml of the same formulation on the dorsal plane, two sites in the anterior portion and two sites in the posterior portion of the rat's back. Animals were sacrificed at time-points 1, 7, 14, 21, 30, and 45 days post-treatment (10 or 12 animals per group, 2 animals per time point). At each time point, the injection sites were exposed and assessed macroscopically. The skin at the injection sites was gently separated from the muscle using scissors, the sites washed with 0.25 ml DMEM, 1% FBS (Biological Industries, Israel) and the clot extracted and weighed. The washing medium was transferred to an Eppendorf tube (1.5-2 ml) while the extracted clot was transferred to a 6 or 12 wells plate. Once weighed, the clot was combined with the respective washing medium, cut with scissors and minced with a pestle to promote the release of GFs from the clot to the surrounding medium. The Eppendorf tubes were then centrifuged for at least 5 minutes to separate between the clot's pellet and the medium. Supernatants were collected and stored at 80 C. until assayed. A control (TO) containing 0.5 ml of the respective formulation was formed in vitro following the same procedure as described above without injecting into the animal. At the end of the study, PDGF and VEGF contents in the preserved supernatants were assessed by ELISA (Quantikine ELISA Mouse/rat PDGF and Quantikine ELISA Rat VEGF, R&D Systems, Israel).
(450) In Vivo Tendinopathy Induced in Rats
(451) The healing properties of the rhCollagen matrix combined with PRP and of PRP alone were compared in a collagenase induced tendonopathy model in 36 male Sprague Dawley rats (18 rats per group, 6 animals per time point). The experiment was performed at Harlan Laboratories Israel Ltd. (Ness Ziona, Israel).
(452) A skin incision was made over the proximal portion of the right posterior leg of the rat over the Common Calcaneal tendon. Under appropriate magnification, the middle branch of the tendon was identified and isolated and tendinopathy was induced by injecting 0.3 mg collagenase (10 mg/ml, Sigma) under the Common Calcaneal tendon sheath using a 0.5 ml insulin syringe. Eventually the skin was closed with interrupted subcutaneous sutures using 4/0 Vicryl. One week following tendinopathy induction, a stab incision was created in the tendon sheath using an ophthalmic corneal/scleral knife. A tunnel was then created under the tendon sheath using a cannula and 50 l of rhCollagen combined with PRP or PRP alone were injected into the pre-created canal. Animals were sacrificed at 3, 7, and 14 days post-treatment. The treated tendons were excised and preserved for histopathological evaluation.
(453) Histology
(454) Tissues were embedded in paraffin and serially cut into 4-5 microns thick samples. The slides were stained with Hematoxilyn & Eosin (H&E) for histopathological examination and blinded evaluated by a pathologist.
(455) Results
(456) In Vitro Cell Proliferation Assay
(457) In this study viability and proliferation of cells seeded in the vicinity of a matrix composed of rhCollagen combined with PRP and a clot composed of thrombin activated PRP were compared. Cells seeded in untreated wells were used as control. The matrices (either composed of rhCollagen combined with PRP or thrombin activated PRP) were placed in transwells on top of the seeded wells in order to allow the diffusion of GFs from the matrices to the well without being in direct contact with the cell layers. The number of live cells on days 7 and 10 are reported (
(458) In Vivo Matrices Degradation Profile and Growth Factors Release
(459) Matrices Degradation Profile
(460) The degradation profile of the injected formulations was determined by weighing the matrices at different time points following subcutaneous injections into rats.
(461) Upon injection of activated PRP, the material disappeared already at day 1 (
(462) Growths Factors Content
(463) GFs content in the injection site as a function of time was assessed by ELISA for PDGF and VEGF (
(464) The GFs increase seen from day 1 to 14 in the PDGF analysis and from day 0 to day 7 in the VEGF analysis testifies the capability of the rhCollagen scaffold to enable GFs accumulation, likely reflecting cells that migrate and proliferate in the scaffold. The integration of the nominal content of PDGF and VEGF over the whole study for each formulation is summarized in
(465) In Vivo Tendinopathy Induced in Rats
(466) The healing properties of the rhcollagen matrix combined with PRP in comparison to PRP alone were assessed in a rat model for tendinopathy and evaluated by histopathological analysis at different time points. Tendon healing and inflammation were quantified by scoring the level of mature fibrosis, the presence of mononuclear inflammatory cells and the presence of immature granulation tissue (score 0-5 as described in Table 7).
(467) TABLE-US-00008 TABLE 7 Histopathological scoring Score Description 0 No change 1 Up to 10% of the area of sectioned tissue is involved by the lesion 2 Up to 25% of the area of sectioned tissue is involved by the lesion 3 Up to 50% of the area of sectioned tissue is involved by the lesion 4 Up to 75% of the area of sectioned tissue is involved by the lesion 5 More than 75% of the area of sectioned tissue is involved by the lesion
(468) The cumulative values of the histopathological scores associated with each treatment are depicted in
(469) Discussion
(470) Damages to soft tissues, including injuries in tendons and ligaments are very common and cause a significant clinical burden. Although several treatments are available, their clinical benefit is still limited. This encouraged the search for new alternatives with the intent of improving healing and reducing recovery time. An injectable matrix composed of human recombinant type I collagen was developed that, once mixed with PRP, forms a collagen-fibrin-PRP composite that degrades slowly, attracts cell migration and proliferation into the collagen scaffold and allows extended release of GFs at the injured site, thus better supporting the healing process. In vitro experiments (
(471) This study demonstrates the biological effects in vitro and in vivo, of an injectable scaffold composed of crosslinked human recombinant type I collagen. Once combined with an autologous source of GFs such as PRP, the formed scaffold accelerates the healing of soft tissue injuries, by controlling the inflammatory response and promoting faster formation of new healthy tissue. The results suggest that the enhanced healing properties reside in the unique combination of rhCollagen and autologous PRP which extends the release of GFs. The data supports the use of the rhCollagen matrix combined with PRP in a clinical trial for tendinopathy.
Example 18. Use of a Plant-Derived Human Recombinant Collagen as a Dermal Filler
(472) In order to reduce immunogenicity, to promote tissue regeneration, and to provide a more uniform and potentially longer lasting dermal filler with improved rheological properties, in comparison with tissue-derived human and bovine collagens, a human transgenic collagen (rhCollagen) is produced and isolated from a plant (e.g., a genetically engineered tobacco plant) and then used as a dermal filler. Typically, the genetically modified plant comprises an expressible sequence of at least one gene sequence of human deoxyribonucleic acid (DNA) selected from the group consisting of: COL1, COL2, P4H-alpha, P4H-beta, and LH3. Typically, the plant-derived human collagen comprises at least modified one human collagen alpha-1 chain as set forth in SEQ ID NO: 3 and as expressed in the genetically modified plant; and at least one modified human collagen alpha-2 chain as set forth in SEQ ID NO: 6 and as expressed in the genetically modified plant; and the genetically modified plant further expresses an exogenous prolyl-4-hydroxylase (P4H) (e.g., a human or other mammalian P4H). Optionally, the genetically modified plant further expresses an exogenous polypeptide selected from the group consisting of lysyl hydroxylase (LH), protease N, and protease C. For example, the human collagen alpha-1 chain is encoded by a sequence as set forth in SEQ ID NO: 1, and/or the human collagen alpha-2 chain is encoded by a sequence as set forth in SEQ ID NO: 2. Optionally, the human collagen alpha-1 chain and/or alpha-2 chain is targeted to a vacuole of the plant or the genetically modified plant and digesting it with ficin, resulting in human atelocollagen.
(473) Optionally, the rhCollagen is modified or is formulated with other substances, including those known in the art for dermal fillers. Examples of modification include, but are not limited to, methacrylation and/or thiolation. Examples of other substances include, but are not limited to, hyaluronic acid (HA) or a modified derivative thereof, poly(vinyl alcohol) (PVA) or a modified derivative thereof, polyethylene glycol (PEG) or a modified derivative thereof, oxidized cellulose (OC) or a modified derivative thereof, or a combination of any of these. Examples of other substance include, but are not limited to, hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), polymethylmethacrylate (PMMA) microspheres, tricalcium phosphate (TCP), calcium hydroxylapatite (CaHA), carboxymethylcellulose, crystalline nanocellulose (CNC) or a combination thereof. Modified derivatives of HA, PVA, PEG, or OC include, but are not limited to, photopolymerizable derivatives. Modifications of HA, PVA, PEG, or OC include, but are not limited to, methacrylation and/or thiolation. Examples of other substances include, but are not limited to, polymerizing agents or initiators, such as a photoinitiator (e.g., sensitive to visible, ultraviolet (uv), or infrared light). Examples of visible light photoinitiators include, but are not limited to, Eosin Y+triethanolamine or riboflavin. Examples of ultraviolet photoinitiators include, but are not limited to, lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP) or 1-[4 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methylpropan-1-one (IRGACURE 2959).
(474) An inherent property of tissue-extracted collagen is gelation at room temperature. At relative low concentrations (e.g., 5-15 mg/ml) in physiological buffer, tissue-extracted collagen forms a gel when transformed from cold (approximately 4 C.) to room temperature.
(475) In contrast, rhCollagen has a relatively low viscosity (in the same concentration and formulation) that allows injection through narrow gauge needles or cannulae (27-gauge to 33-gauge) using a relatively decreased expression force, as well as better penetration into tinier spaces, and greater flexibility in post-injection modulation (sculpting).
(476) The rhCollagen is placed in a syringe having a fine-gauge needle or cannula (27-gauge to 33-gauge) and is injected into a cavity or space below the dermis. The injected rhCollagen is then molded, sculpted, or otherwise manipulated into the desired position (e.g., via manual massage or with a molding or sculpting implement, such as a surgical depressor). Polymerization may be initiated before, during, or after this process by exposure to a light source (e.g., a light-emitting diode (LED), laser, or xenon lamp) located on or above the dermis overlying the injected formulation.
Example 19. Use of a Modified Plant-Derived Human Recombinant Collagen Formulated with a Photoinitiator and Additive
(477) The rhCollagen is modified by methacrylation, as described in Example 18. The modified rhCollagen is prepared as a polymerizable solution formulation with a photoinitiator (e.g., Eosin Y+triethanolamine or riboflavin). Hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), polymethylmethacrylate (PMMA) microspheres, tricalcium phosphate (TCP), calcium hydroxylapatite (CaHA), carboxymethylcellulose, crystalline nanocellulose (CNC) or some combination thereof are included.
(478) The formulation is placed in a syringe having a fine-gauge needle or a cannula (27-gauge to 33-gauge and is injected into a cavity or space below the dermis. The injected formulation is then molded, sculpted, or otherwise manipulated, either manually or with an appropriate surgical instrument, into the desired position during or after exposure to a light source (e.g., a visible light source), as described in Example 18.
Example 20. Use of a Modified Plant-Derived Human Recombinant Collagen Formulated with a Photoinitiator and Modified Additive
(479) The rhCollagen is modified by methacrylation or thiolation as in Example 19. The modified rhCollagen is prepared as a polymerizable solution formulation with a photoinitiator (e.g., Eosin Y+triethanolamine or riboflavin), as described in Example 18. A modified derivative of hyaluronic acid (HA), poly(vinyl alcohol) (PVA), polyethylene glycol (PEG), oxidized cellulose (OC), or some combination thereof is included and is modified by methacrylation or thiolation.
(480) The formulation is placed in a syringe having a fine-gauge needle or a cannula (27-gauge to 33-gauge and is injected into a cavity or space below the dermis. The injected formulation is then molded, sculpted, or otherwise manipulated, either manually or with an appropriate surgical instrument, into the desired position during or after exposure to a light source (e.g., a visible light source), as described in Example 18.
Example 21. Comparative Injectability and Viscosity of Crosslinked Hyaluronic Acid with Collagens
(481) As shown in
(482) As shown in
(483) As shown in
(484) As shown in
(485) The addition of rhCollagen, either monomeric or fibrillated, crosslinked or not crosslinked, to a crosslinked HA dermal filler did not significantly increase the expression force, allowing similar performance to the physician, but on the other hand it significantly increased the material viscosity, allowing better skin lifting upon injection.
Example 22. Transdermal Polymerization of Recombinant Human Collagen Methacrylate (rhCollagenMA)
(486) As shown in
(487) The rhCollagenMA polymerizes under the skin when illuminated for 6 minutes with a small LED torch in the presence of eosinY/TEA as photoinitiator.
Example 23. Formulation of Double Crosslinked Dermal Fillers: Two-Step Synthesis
(488) Objective: To develop injectable dermal fillers for use improving the appearance of the skin surface for either aesthetic or clinical purposes. The dermal fillers are composed of type I recombinant human Collagen (rhCollagen) or its modified form, methacrylated rhCollagen (MA-rhCol) and crosslinked hyaluronic acid (HA).
(489) The double crosslinked product, wherein crosslinked-HA is further crosslinked to rhCollagen (
(490) Methods:
(491) Double Crosslinking
(492) HA Crosslinking
(493) High Molecular Weight Hyaluronic Acid (range 700 KDa-3 MDa, preferably 1.5M Da) was dissolved under alkaline conditions (pH 12-13, e.g. in 0.3N Na(OH)) at a concentration ranging between 50 to 200 mg/ml (preferably 100 mg/ml). Crosslinker 1, 4-butanediol diglycidyl ether (BDDE) was added to the solvent in a ratio ranging between 1 to 50% of the HA disaccharides amounts (preferably 6, 8, 10%) prior to dissolving the HA. In some embodiments of this formulation, the HA comprises methacrylated-HA (MA-HA).
(494) HA crosslinking was done at room Temp for 24 h.
(495) Addition of Lower MW HA and Neutralization
(496) Lower molecular weight HA (50 KDa to 1000 KDa, preferably 300 to 700 KDa) ranging between 1 to 30% of the total HA amount (preferably 5-10%) was dissolved in water at a concentration ranging between 10 to 100 mg/ml (preferably 30 mg/ml). In some embodiments of this formulation, the HA comprises methacrylated-HA (MA-HA).
(497) Prior to mixing the non-crosslinked HA with the crosslinked HA, HCl is added to the non-crosslinked HA in an amount necessary to neutralize the pH of the crosslinked HA. Phosphate buffer (PB) and NaCl are added to a final concentration of 0.1M PB and 0.2M NaCl.
(498) Neutralization of rhCollagen
(499) Prior to mixing the rhCollagen with HA, rhCollagen is brought to 0.1M in PB+0.2M NaCl.
(500) Mixing HA+rhCollagen
(501) HA (crosslinked+non-crosslinked HA) is mixed with rhCollagen in a ratio HA:rhColalgen ranging between (6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6) and kept at 2-8 C. The final concentration of HA is between about 5-50 mg/ml. The final concentration of rhCollagen or MA-rhCollagen is between about 1-50 mg/ml.
(502) Second Crosslinking
(503) When HA and rhCollagen were well mixed, a second crosslinking was performed with 1-[3-(Dimethylamino)propyl]-3-ethylcarbodiimide methiodide (EDC): an amount of EDC equal to 10 to 100 fold (preferably 50 fold) the amount of free amines in the rhCollagen was dissolved in (0.1 MPB+0.2M NaCl), added to the crosslinked HA-rhCollagen mixture and mixed. The second crosslinking is performed in the dark for 2-3 h at 2-8 C.
(504) Dialysis
(505) The double crosslinked material was then dialyzed vs. either PBS, 1 mM HCl or vs. low phosphate buffer (Low phosphate buffer preparation: (a) Stock solution: 162 mM Sodium phosphate dibasic brought to pH 11.2 with 10 N Na(OH); (b) dilute the stock solution 1:1000 in 0.1 mM HCL.
(506) Rheological and Mechanical Evaluation
(507) Storage and loss moduli were measured, e.g., using a HAAKE-RHEO STRESS 600 instrument (THERMO SCIENTIFIC) using a cone (1-degree) vs. plate configuration (C35/1). Frequency sweep measurements were performed at a constant deformation (e.g., 0.8%) with a range of frequencies (e.g., 0.02-100 Hz). Optionally various ratios or crosslinking ratios of one or both components were tested. First and second crosslinking can be tuned to control the final product storage and loss moduli.
(508) Injectability measurements were taken, e.g., using a MULTITEST 1-/i MECMESIN machine as a function of plunger displacement (mm) to observe expression force.
(509) Injectability
(510) Injectability measurements were taken using a MULTITEST 1-/i MECMES1N machine, as described above. 1 ml LUER-LOK syringes (BECTON-DICKINSON) and 30 G needles were used for Formulations 2, 2A, and 3 (Table 8). Expression force as a function of plunger displacement of representative double crosslinked Formulations 2, 2A, and 3 (Table 8) was compared to a commercially available dermal filler, also using a 30 G needle.
(511) Animal Studies
(512) 200 microlitres of Formulation 2, or 2A, or control were injected subcutaneously into the back of Sprague dawley rats. Histology was performed after 1 week.
(513) Results:
(514) A skilled artisan would appreciate that the two-step double cross linking here uses two-types of crosslinker. The 1st step includes HA and BDDE as crosslinker. In the second step collagen and non-crosslinked HA are added and cross linking is achieved using EDC. It is expected that the difference in cross linking chemistry and sequence of actions, as compared to all other methods of dermal filler preparation, should result in dermal filler compositions having different properties including mechanical properties, tissue interaction, and degradation rate.
(515) Formulations of HA:rhCollagen were made using the above methods, with representative formulations shown in Table 8.
(516) TABLE-US-00009 TABLE 8 Formulations of compositions. HA HA:rhCollagen Formulation crosslinking ratio ratio Comments 1 10% 2:1 Dialyzed vs. phosphate buffer saline 1A 10% 2:1 Dialyzed vs. 1 mM HCl and neutralized 2 6% 2:1 Dialyzed vs. phosphate buffer saline 2A 6% 2:1 Dialyzed vs. 1 mM HCl and neutralized 3 8% 2:1 Dialyzed vs. phosphate buffer saline
Rheological and Mechanical Evaluation
(517) As shown in
(518) The first and second crosslinking can be adjusted to control the final product storage and loss moduli. As shown in
(519) Histology and Animal Studies
(520) Animal studies were conducted as described above. Formulations 2 and 2A (see Tables 8 and 9) were compared with a commercially available dermal filler product following subcutaneous injections. Inflammation is the first step in the regeneration process, as long as it is not too severe.
(521) The average histology scores at day 7 post subcutaneous injections are compared to the commercially available dermal filler in Table 9.
(522) TABLE-US-00010 TABLE 9 Day 7 Histology Scores. Inflammation % % % Necrosis Fibrosis score Lymphocytes Macrophages Neutrophils score Score Formulation 2 50 40 10 0 2 2 Formulation 2.25 42.5 42.5 15 0 2 2A Commercially 1.333333 36.66667 53.33333 10 0 1.333 available material/ control
(523) As shown in Table 9, double crosslinked formulations have a higher fibrosis score and a higher inflammation level than the commercially available dermal filler, indicating a more advanced process of tissue regeneration.
(524)
(525) Histology scores for the samples shown in
(526) Summary/Conclusion
(527) Double Crosslinked formulations have been developed to have easy injection through 27 to 32 G needles and a wide range of stiffness G-G. Histology results following one-week injection show enhanced initiation of the tissue regeneration process.
Example 24. Photocurable Dermal Filler
(528) Objective: To analyze the properties of a photocurable dermal filler. The photocurable formulation is a semi IPN before curing and ends up being an IPN (interpenetrated network) after curing. Meaning two entangled networks, each one crosslinked to itself and not crosslinked to the other.
(529) Methods:
(530) A mixture of rhCollagen and Methacrylated rhCollagen was added to already crosslinked HA, crosslinked as in Example 23, to a final concentration of 1-10 mg/ml wherein the ratio between the methacrylated to non-methacrylated rhCollagen is 1:0, 1:1, 1:2, 1:3, 1:4, 0:1, 2:1, 3:1, or 4:1. The final concentration range of MA-rhCollagen is 0-12/mg/ml and the final concentration range of non-modified rhCollagen is 0-12 mg/ml. The ratio of the crosslinked HA To MA-rhCollagen is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 1:2, 1:3, 1:4, 1:5, 1:6, or 0:1. The final concentration of HA is 12-25 mg/ml, the final concentratil of rhCollagen (MA+non-modified) is 1-24 mg/ml.
(531) Visible light photoinitiator was added to the mixture (e.g. compositions of Eosin Y, triethanolamine and N-vinylpyrrolidone).
(532) Rheological Studies
(533) 1.6 ml samples of each of representative Formulations 4, 5, and 6 and the Control (see Table 10 below) were poured into cylindrical molds and cylinders of 2 cm diameter and 0.5 mm height and were cured by a constant amount of visible light illumination using a white LED flashlight for 6 minutes.
(534) Formulations of highly crosslinked hyaluronic acid (HA) were mixed with combinations of rhCollagen and/or rH Collagen methacrylate at 3 different representative ratios with a constant amount of visible light photoinitiator, using the above methods, as shown in Table 10. Highly BDDE crosslinked HA (but could be any other crosslinker as well, or even a standard commercial filler made of only crosslinked HA) was mixed with rhCol and rhColMA in different ratios. The result is a crosslinking of the HA and a crosslinking of the entangled rhColMA after curing. This forms an interpenetrated network where the HA is crosslinked to itself and the collagen is crosslinked to itself within the HA network.
(535) TABLE-US-00011 TABLE 10 Formulations tested before and after photocuring. Crosslinked rhCollagen HA MA rhCollagen Control (crosslinked HA) 23 mg/ml Formulation 4 19 mg/ml 2.5 Formulation 5 19 mg/ml 1.25 1.25 Formulation 6 19 mg/ml 0.64 1.83
(536) Storage and loss moduli were measured before and after illumination as described below.
(537) a. Before Curing
(538) Storage and loss moduli were measured using a HAAKE-RHEO STRESS 600 TH instrument (THERMO SCIENTIFIC) using a cone(1) vs. plate configuration (C35/1). Frequency sweep measurements were performed at a constant deformation of 0.8% with a frequency ranging from 0.02 Hz to 100 Hz.
(539) b. After Curing
(540) Storage and loss moduli of photocured cylinders were measured using a HAAKE-RHEO STRESS 600 instrument (THERMO SCIENTIFIC) using a serrated plate vs. plate configuration (PP20). Frequency sweep measurements were performed at a constant shear stress of 3 Pa with a frequency ranging from 0.02 Hz to 100 Hz, under a constant normal load of 0.3 N.
(541) Injectability
(542) Injectability measurements were taken using a MULTITEST 1-i MECMESIN machine, as described above for Formulations 4, 5, and 6 and for highly crosslinked HA as a control. 1 ml LUER-LOK syringes (BECTON-DICKINSON) and 30 G needles were used for all samples (Table 10). Expression force as a function of plunger displacement (12 mm/min) of representative Formulations 4, 5, and 6 (Table 10) was compared to highly crosslinked HA.
(543) Animal Studies
(544) Animal studies were conducted as described above. Formulation 4 (see Tables 10 and 11) was compared with highly crosslinked HA following subcutaneous injections into the back of rats.
(545) Results:
(546) Rheological and Mechanical Evolution
(547)
(548) Injectability
(549) As shown in
(550) Histology and Animal Studies
(551) The average histology score for Formulation 4 at day 7 of subcutaneous injections was compared to highly crosslinked HA in Table 11.
(552) TABLE-US-00012 TABLE 11 Day 7 Histology Scores. Inflammation % % % Necrosis Fibrosis score Lymphocytes Macrophages Neutrophils score Score Formulation 1.5 42.5 50 7.5 0 1.5 4 Commercially 1.333333 36.66667 53.33333 10 0 1.333 available material/ control
(553) As shown in Table 11, Formulation 4 has a higher fibrosis score and a higher inflammation level than the highly crosslinked HA, indicating a more advanced process of tissue regeneration.
(554)
(555) Conclusion/Summary
(556) The photo curable filler was developed to have a relative low stiffness before injection allowing easy injection through 27-32G needles but a significant improve in stiffness (tunable) following photocuring. Stiffness can be tuned by controlling the final ratio between rhCol and rhColMA. This technology allows the physician to sculpture the filler to the desired shape before fixing it with the photocuring illumination. The injected material strongly adheres to the sourroundy tissue. Preliminary in vivo results indicate initiation of regeneration process.
Example 25. In Vivo Animal Studies: Independent Injection of Dermal Filler Components
(557) Objective: To separately inject HA or its methacrylated derivative, and methacrylated rhCollagen into the subcutaneously at a semiliquid phase and crosslink them in situ (crosslinking is rhColMA to rhColMA), post injection, by white light illumination through the skin. This approach allows easier injection and in situ sculpturing of the material shape, just before fixing it by light polymerization. Using a subcutaneous rat model, the cell proliferation, tissue augmentation, and characteristics of matrix degradation overtime will be assessed.
(558) Methods: In this model, sample formulation components (HA or its methacrylated derivative, and methacrylated rhCollagen and photoinitiator) for evaluation will be injected subcutaneously to the back of male Sprague Dawley rats and the injection sites followed for up to 20 days. Injections will be at about the same time (immediately one after the other), at the same location. Component solutions may be massaged in situ prior to or concurrent with or following crosslinking. The subcutaneous rat model is chosen as it is the simplest model to estimate biocompatibility, lifting effect and persistence. Moreover, Hillel at al. published a validation study for this specific model (Dermatol Surg 2012; 38:471-478).
(559) Animals will be sedated with Ketamine/Xylasine prior to each treatment. The animal's back will be shaved, and the injection sites marked on the shaved skin. Each rat will be injected with 0.2 ml of the formulation using 27.5-32G needle at distanced locations on the dorsal plane, over all, 6 injections per rat.
(560) The formulations will be crosslinked post injection by transdermal illumination of the injection site with a white light LED torch for 2 minutes.
(561) All animals will be observed for morbidity and mortality twice daily throughout the entire study period. Every three days (time points 0, 1, 4, 7, 11, 14, 18, and 21 days post injections) the height, width, and length of each bleb will be measured with caliper, and the ellipsoid volume of each bleb [(4/3)()(1/2 height)(1/2 length)(1/2 width)] calculated.
(562) Animals will be sacrificed at time-points for example but not limited to 7, 14, and 21 days post-treatment.
(563) At each scarification point, injections sites will be exposed and assessed macroscopically, and the blebs collected for histological assessment. Injections sites (including the blebs) will be excised with the overlying skin and, fixed in 4% formalin and embedded in paraffin.
(564) Histology
(565) Slides Preparation
(566) Paraffin blocks will be sectioned at approximately 3-5 microns thickness, put on a glass slide, stained with Hematoxylin & Eosin (H&E) and Masson trichrome and covered by an automated machine. The histology evaluation of all the slides will be performed using a light microscope (Olympus BX60, serial NO. 7D04032).
(567) Images will be taken at magnification of 4. Image acquisition will be performed only on pathological changes and of representative animals.
(568) Results:
(569) Similar results to those obtained in Example 24 are expected, wherein the separate, independent injection of components of the photocurable dermal filler may provide increased ease of injection, for example due to decreased viscosity of the components compared with the formulation mix.
(570) Although the dermal fillers, including cellular growth promoting scaffolds, and uses thereof have been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents and patent applications and GenBank Accession numbers mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application or GenBank Accession number was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art.
(571) It is the intent of the applicant(s) that all publications, patents and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.