Fagopyritol synthase genes and uses thereof
09771608 ยท 2017-09-26
Assignee
Inventors
Cpc classification
Y02P20/52
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12P19/26
CHEMISTRY; METALLURGY
C12N15/8245
CHEMISTRY; METALLURGY
C12P19/46
CHEMISTRY; METALLURGY
International classification
C12P19/46
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The present invention relates to an isolated DNA molecule encoding a fagopyritol synthase. A method for producing a fagopyritol, an insulin mediator, an insulin mediator analog, an insulin mediator homolog, or an insulin mediator inhibitor is also described. The method includes providing a fagopyritol synthase, providing a substrate comprising a galactosyl donor and a galactosyl acceptor, and combining the fagopyritol synthase with the substrate under conditions effective produce a fagopyritol, an insulin mediator, an insulin mediator analog, an insulin mediator homolog, or an insulin mediator inhibitor.
Claims
1. A nucleic acid construct comprising a nucleic acid molecule encoding a fagopyritol synthase, wherein the nucleic acid molecule is at least 80% identical to SEQ ID NO:1 by basic BLAST using default parameters analysis, and wherein the nucleic acid construct comprises at least a portion heterologous to the nucleic acid molecule.
2. The nucleic acid construct according to claim 1, wherein the nucleic acid molecule has the nucleotide sequence of SEQ ID NO:1.
3. The nucleic acid construct according to claim 1, wherein the nucleic acid molecule encodes a protein or polypeptide comprising the amino acid sequence of SEQ ID NO:2.
4. An expression vector comprising the nucleic acid construct according to claim 1, wherein the expression vector comprises transcriptional and translational regulatory nucleotide sequences operably linked to the nucleic acid molecule.
5. A host cell transformed with the nucleic acid construct according to claim 1.
6. The host cell according to claim 5, wherein the cell is selected from the group consisting of a bacterial cell, a virus, a yeast cell, an insect cell, a plant cell, and a mammalian cell.
7. A host cell containing an expression vector according to claim 4.
8. A transgenic plant transformed with the nucleic acid construct according to claim 1.
9. The transgenic plant according to claim 8, wherein the nucleic acid molecule has the nucleotide sequence of SEQ ID NO: 1.
10. The transgenic plant according to claim 8, wherein the nucleic acid molecule encodes a protein or polypeptide comprising the amino acid sequence of SEQ ID NO:2.
11. The transgenic plant according to claim 8, wherein the plant is selected from the group consisting of Gramineae, Liliaceae, Iridaceae, Orchidaceae, Salicaceae, Ranunculaceae, Magnoliaceae, Cruciferae, Rosaceae, Leguminosae, Malvaceae, Umbelliferae, Labiatae, Solanaceae, Cucurbitaceae, Compositae, and Rubiaceae.
12. A transgenic plant seed transformed with the nucleic acid construct according to claim 1.
13. The transgenic plant seed according to claim 12, wherein the nucleic acid molecule has the nucleotide sequence of SEQ ID NO: 1.
14. The transgenic plant seed according to claim 12, wherein the nucleic acid molecule encodes a protein or polypeptide comprising the amino acid sequence of SEQ ID NO:2.
15. The transgenic plant seed according to claim 12, wherein the plant seed is selected from the group consisting of Gramineae, Liliaceae, Iridaceae, Orchidaceae, Salicaceae, Ranunculaceae, Magnoliaceae, Cruciferae, Rosaceae, Leguminosae, Malvaceae, Umbelliferae, Labiatae, Solanaceae, Cucurbitaceae, Compositae, and Rubiaceae.
16. A method for producing a fagopyritol, an insulin mediator, an insulin mediator analogue, an insulin mediator homologue, or an insulin mediator inhibitor comprising: expressing the fagopyritol synthase from an expression system comprising the nucleic acid construct according to claim 1; providing a substrate comprising a galactosyl donor and a galactosyl acceptor; and combining the fagopyritol synthase with the substrate under conditions effective to produce a fagopyritol, an insulin mediator, an insulin mediator analogue, or an insulin mediator homologue.
17. The method according to claim 16, wherein the nucleic acid molecule has the nucleotide sequence of SEQ ID NO: 1.
18. The method according to claim 16, wherein the nucleic acid molecule encodes a protein or polypeptide comprising the amino acid sequence of SEQ ID NO:2.
19. The method according to claim 16, wherein the galactosyl donor is UDP-galactose.
20. The method according to claim 16, wherein the galactosyl donor is UDP-galactosamine.
21. The method according to claim 16, wherein the galactosyl acceptor is selected from the group consisting of D-chiro-inositol, L-chiro-inositol, myo-inositol, bornesitol, and scyllo-inositol.
22. The method according to claim 21, wherein the galactosyl acceptor is D-chiro-inositol.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
DETAILED DESCRIPTION OF THE INVENTION
(30) The present invention relates to nucleic acid molecules encoding fagopyritol synthase enzymes. Fagopyritol is a general term used herein to mean an unspecified -galactosyl D-chiro-inositol or its salt or derivative. More particularly, the present invention relates to an isolated nucleic acid molecule encoding a fagopyritol synthase. In accordance with the present invention, the fagopyritol synthase catalyzes the biosynthesis of a fagopyritol. Suitable fagopyritols include fagopyritol A1, particularly fagopyritol A1s have the following Formula I:
(31) ##STR00001##
fagopyritol A2, particularly fagopyritol A2s having the following Formula II:
(32) ##STR00002##
fagopyritol A3, particularly fagopyritol A3s having the following Formula III:
(33) ##STR00003##
fagopyritol B1, particularly fagopyritol B1 s having the following Formula IV:
(34) ##STR00004##
fagopyritol B2, particularly fagopyritol B2s having the following Formula V:
(35) ##STR00005##
and fagopyritol B3, particularly fagopyritol B3s having the following Formula VI:
(36) ##STR00006##
(37) One suitable source of a nucleic acid molecule encoding a fagopyritol synthase enzyme is Fagopyrum esculentum.
(38) In a first embodiment, the fagopyritol synthase from Fagopyrum esculentum is identified herein as FeGolS-1 and is encoded by a nucleic acid molecule having a nucleotide sequence of SEQ ID NO:1 as follows:
(39) TABLE-US-00001 gagcacccaaagctctgctagcaccatattcaaatcctcaagaatcatcaaatcttccaa 60 ccaatcctcaagttccaaccaaatggcaccagaactcatcacaatcggagccgatcactc 120 gattttgccagcggaatcgttgattccggttgaccgagcttacgtgacgtttctcgccgg 180 gaacggagactatgtcaagggagttgtcggattagcaaagggactgaggaaagtgaaggc 240 tgcttatcctcttgttgtagcggttttaccggacgttccgctagagcatcgccgactcct 300 ggaggcgcagggttgtatcgtaagggaaatcgagccgatatacccgccggaaaacaattg 360 cgagttcgctcacgcatactatgtcatcaactactccaagcttcgcatctgggagtttgt 420 ggagtacagtaagatgatatacttggacggggacatacaggtgtaccagaacattgacca 480 cctgtttgaccagccggacggctacttttacgcggtgatggactgtttttgtgagccatc 540 atggagcaagacgattcagtacaagatcggatactgccaacagtgcccggagaaggtagc 600 gtggccgttggaggctggcccgaagccttctctgtacttcaatgccggattctttgttta 660 cgagccgagccttgagacttacaaggatctcattgacactctcaaagtcacgactcctac 720 ctcctttgccgagcaggacttcttgaacatgtacttcaaggacaagttcaagccactccc 780 catagactacaacttagtcttagccttcctgtggaggcatccggagaaagttgaccttaa 840 ccgagtgaaggtagttcactactgtgcggcggggtctaagccatggaggtacacgggcaa 900 ggaagagaacatggacagagaagacatcaaattgcttgtgaaaaaatggtgggatatcta 960 caacgacgagtcattggacctcaagaaaccggtccatttagtgcagcagcccacggaggt 1020 gctcaaggcggcgctctcggaggctaggcctgttaaatatgtggctgctccttccgcagc 1080 ttaagtatcggcttgtatttggtaatggtttttgtttttgcgaatgtaaagtagaaagaa 1140 ggggcgagagtttgtgatattggggcaatggggaatggtgcgtataaatgtgtgttgtaa 1200 tggcaactgtttttacttggaattatatgtaagaagtaagaatatatgtataaaaaaaaa 1260 aaaaaaaaa 1269
(40) The nucleic acid sequence corresponding to SEQ ID NO:1 encodes an isoform of fagopyritol synthase isolated from Fagopyrum esculentum, identified herein as FeGolS-1, which has a deduced amino acid sequence corresponding to SEQ ID NO:2, as follows:
(41) TABLE-US-00002 MetAlaProGluLeuIleThrIleGlyAlaAspHisSerIleLeuPro 151015 AlaGluSerLeuIleProValAspArgAlaTyrValThrPheLeuAla 202530 GlyAsnGlyAspTyrValLysGlyValValGlyLeuAlaLysGlyLeu 354045 ArgLysValLysAlaAlaTyrProLeuValValAlaValLeuProAsp 505560 ValProLeuGluHisArgArgLeuLeuGluAlaGlnGlyCysIleVal 65707580 ArgGluIleGluProIleTyrProProGluAsnAsnCysGluPheAla 859095 HisAlaTyrTyrValIleAsnTyrSerLysLeuArgIleTrpGluPhe 100105110 ValGluTyrSerLysMetIleTyrLeuAspGlyAspIleGlnValTyr 115120125 GlnAsnIleAspHisLeuPheAspGlnProAspGlyTyrPheTyrAla 130135140 ValMetAspCysPheCysGluProSerTrpSerLysThrIleGlnTyr 145150155160 LysIleGlyTyrCysGlnGlnCysProGluLysValAlaTrpProLeu 165170175 GluAlaGlyProLysProSerLeuTyrPheAsnAlaGlyPhePheVal 180185190 TyrGluProSerLeuGluThrTyrLysAspLeuIleAspThrLeuLys 195200205 ValThrThrProThrSerPheAlaGluGlnAspPheLeuAsnMetTyr 210215220 PheLysAspLysPheLysProLeuProIleAspTyrAsnLeuValLeu 225230235240 AlaPheLeuTrpArgHisProGluLysValAspLeuAsnArgValLys 245250255 ValValHisTyrCysAlaAlaGlySerLysProTrpArgTyrThrGly 260265270 LysGluGluAsnMetAspArgGluAspIleLysLeuLeuValLysLys 275280285 TrpTrpAspIleTyrAsnAspGluSerLeuAspLeuLysLysProVal 290295300 HisLeuValGlnGlnProThrGluValLeuLysAlaAlaLeuSerGlu 305310315320 AlaArgProValLysTyrValAlaAlaProSerAlaAla 325330
The fagopyritol synthase has a molecular mass of from 38 to 41 kDa, and preferably 38.3 kDa. FeGoS-1, isolated from Fagopyrum esculentum (buckwheat), has a single open reading frame (ORF) of 1002 bp, extending between nucleotides 83-1084. The starting codon ATG is identified at 83-85 bp, with the stop codon TAA found between nucleotides 1082-1084, as shown in
(42) In a second embodiment, the fagopyritol synthase from Fagopyrum esculentum is identified herein as FeGolS-2 and is encoded by a nucleic acid molecule having a nucleotide sequence of SEQ ID NO:3 as follows:
(43) TABLE-US-00003 ttggtttcgaacttgatcaaaacctcacaaaaacacgtaagcaaaatgacttccgagatg 60 gcgccacagaacataacgaatgcagaaagaggagccgagcaagtgaagccgtcgagccag 120 ccaagccgagcctacgtgacattcttagccgggaacggtgactacgtgaagggagttata 180 gggctcgccaaaggcctgaggaaaactcagagcggttacccgcttgtggtggcggttctc 240 cctgacgttccgcaggagcaccgccgtatgctggtggcgcaaggctgtataataaaggaa 300 atccagcccgttaacccgcccgataaccagactcagtttgccatggcttattacgtcatc 360 aactactccaagctccgtatatgggagtttatcgagtatagtaagatgatatatcttgat 420 ggagacatccaagtttacgacaacatcgaccacctcttcgacctaccagacgggtacttg 480 tacggtgccatggattgcttttgcgagaagacttggagtcattcgcttccatataagatt 540 gggtattgccaacagtgcccggacagggtccagtggcccgaaaggctcggcccaaaacca 600 acactctacttcaatgcagggatgttcatcttcgagcctagcgtttctacttataatgat 660 ctccttcatacactcgagatcacccctcctacaccttttgctgagcaggactttttgaat 720 atgtacttcaaggatgtgtacagaccaattccgaacgtttacaacttggtattggctttg 780 ttgtggtatcatcctgggttaatgaagcttgatgaggttaaagtcgttcactattgtgcc 840 gatggttcaaaaccatggcggtatacagggaagggggataacatggacagggaagacgtt 900 aggatgctagtgaagaagtggtgggagatttacgatgatcagtctctcgaccctcagcct 960 aagatggtcgagggcaagaagttcgacaaattagaggagtacagcgagtccctcgaccac 1020 ccgcccaaggtggcagaggaagataagctagagaagcccatggcagcgatgacaggcttc 1080 agctacgtacacgccccgtctgctgcctgatttgttgaaacaaggccaaggttccacaaa 1140 tgagggaatcaaaaacctcctatagtattatagatcgtatatttctgttattgctttcca 1200 attaagcaactaagatgttcatatagtagttctggaaaatgaatacgggcatagttgtga 1260 acttgtaatctcattttgtttttcggaatgttcaagtatttcttctaaaaaaaaaaaaaa 1320 aaaaaa 1326
(44) The nucleic acid sequence corresponding to SEQ ID NO:3 encodes an isoform of fagopyritol synthase isolated from Fagopyrum esculentum, identified herein as FeGolS-2, which has a deduced amino acid sequence corresponding to SEQ ID NO:4, as follows:
(45) TABLE-US-00004 MetThrSerGluMetAlaProGlnAsnIleThrAsnAlaGluArgGly 151015 AlaGluGlnValLysProSerSerGlnProSerArgAlaTyrValThr 202530 PheLeuAlaGlyAsnGlyAspTyrValLysGlyValIleGlyLeuAla 354045 LysGlyLeuArgLysThrGlnSerGlyTyrProLeuValValAlaVal 505560 LeuProAspValProGlnGluHisArgArgMetLeuValAlaGlnGly 65707580 CysIleIleLysGluIleGlnProValAsnProProAspAsnGlnThr 859095 GlnPheAlaMetAlaTyrTyrValIleAsnTyrSerLysLeuArgIle 100105110 TrpGluPheIleGluTyrSerLysMetIleTyrLeuAspGlyAspIle 115120125 GlnValTyrAspAsnIleAspHisLeuPheAspLeuProAspGlyTyr 130135140 LeuTyrGlyAlaMetAspCysPheCysGluLysThrTrpSerHisSer 145150155160 LeuProTyrLysIleGlyTyrCysGlnGlnCysProAspArgValGln 165170175 TrpProGluArgLeuGlyProLysProThrLeuTyrPheAsnAlaGly 180185190 MetPheIlePheGluProSerValSerThrTyrAsnAspLeuLeuHis 195200205 ThrLeuGluIleThrProProThrProPheAlaGluGlnAspPheLeu 210215220 AsnMetTyrPheLysAspValTyrArgProIleProAsnValTyrAsn 225230235240 LeuValLeuAlaLeuLeuTrpTyrHisProGlyLeuMetLysLeuAsp 245250255 GluValLysValValHisTyrCysAlaAspGlySerLysProTrpArg 260265270 TyrThrGlyLysGlyAspAsnMetAspArgGluAspValArgMetLeu 275280285 ValLysLysTrpTrpGluIleTyrAspAspGlnSerLeuAspProGln 290295300 ProLysMetValGluGlyLysLysPheAspLysLeuGluGluTyrSer 305310315320 GluSerLeuAspHisProProLysValAlaGluGluAspLysLeuGlu 325330335 LysProMetAlaAlaMetThrGlyPheSerTyrValHisAlaProSer 340345350 AlaAla
The fagopyritol synthase has a molecular mass of from 38 to 41 kDa, and preferably 40.7 kDa. FeGoS-2, isolated from Fagopyrum esculentum, has a single ORF of 1065 bp, extending between nucleotides 46-1110. The starting codon ATG is identified at 46-48 bp, with the stop codon TGA found between nucleotides 1108-1110, as shown in
(46) In a third embodiment, the fagopyritol synthase from Fagopyrum esculentum is identified herein as FeGolS-3 and comprises a nucleic acid molecule having a nucleotide sequence of SEQ ID NO:5 (see
(47) TABLE-US-00005 gctcacgcatactatgtcatcaactactccaagctccgtatatgggagtttatcgagtat 60 agtaagatgatatatcttgatggagacatccaagtttacgacaacatcgaccacctcttc 120 gacctaccagacgggtacttgtacggtgccatggattgcttttgcgagaagacttggagt 180 cattcgcttccatataagattgggtattgccaacagtgcccggacagggtccagtggccc 240 gaaaggctcggcccaaaaccaacactctacttcaatgcagggatgttcatcttcgagcct 300 agcgtttctacttataatgatctccttcatacactcgagatcacccctcctacacctttt 360 gctgagcaggactttttgaatatgtacttcaaggatgtgtacagaccaattccgaacgtg 420 tacaacttggtattggctttgttgtggtatcatcctgggttaatgaatcttgatgaggtt 480 aaagtcgttcactattgtgccgatggttcaaaaccatggcggtatacagggaagggggat 540 aacatggacagggaagacgttaggatgctagtgaagaagtggtgggagatctacgatgat 600 cagtctctcgaccctcagcctaaggtggtcgagggcaagaagttcgacaaattagagtac 660 agcgagtccctcgaccacccgcctaaggtggcagaggaagataagttagagaagcccatg 720 gcggcgatgacagggttcagctacgtacacgccccgtctgctgcctgacttgttgaaaca 780 aggccaaggttccacaaatgagggaatcaaaaacctcctatagtattatagatcgtatat 840 ttctgttattgctttccaattaagcaactaagatgttcatatagtagttctggaaaatga 900 aaacgggcatagttgtgaacttgtaatctcattttgtttttcggaatgtgcaagtatttc 960 ttctaaataaaaaaaaaaaaaaaaaa 986
(48) The nucleic acid sequence corresponding to SEQ ID NO:5 encodes an isoform of fagopyritol synthase isolated from Fagopyrum esculentum, identified herein as FeGolS-3, which comprises a deduced amino acid sequence corresponding to SEQ ID NO:6, as follows:
(49) TABLE-US-00006 AlaHisAlaTyrTyrValIleAsnTyrSerLysLeuArgIleTrpGlu 151015 PheIleGluTyrSerLysMetIleTyrLeuAspGlyAspIleGlnVal 202530 TyrAspAsnIleAspHisLeuPheAspLeuProAspGlyTyrLeuTyr 354045 GlyAlaMetAspCysPheCysGluLysThrTrpSerHisSerLeuPro 505560 TyrLysIleGlyTyrCysGlnGlnCysProAspArgValGlnTrpPro 65707580 GluArgLeuGlyProLysProThrLeuTyrPheAsnAlaGlyMetPhe 859095 IlePheGluProSerValSerThrTyrAsnAspLeuLeuHisThrLeu 100105110 GluIleThrProProThrProPheAlaGluGlnAspPheLeuAsnMet 115120125 TyrPheLysAspValTyrArgProIleProAsnValTyrAsnLeuVal 130135140 LeuAlaLeuLeuTrpTyrHisProGlyLeuMetAsnLeuAspGluVal 145150155160 LysValValHisTyrCysAlaAspGlySerLysProTrpArgTyrThr 165170175 GlyLysGlyAspAsnMetAspArgGluAspValArgMetLeuValLys 180185190 LysTrpTrpGluIleTyrAspAspGlnSerLeuAspProGlnProLys 195200205 ValValGluGlyLysLysPheAspLysLeuGluTyrSerGluSerLeu 210215220 AspHisProProLysValAlaGluGluAspLysLeuGluLysProMet 225230235240 AlaAlaMetThrGlyPheSerTyrValHisAlaProSerAlaAla 245250255
(50) Another suitable source of a nucleic acid molecule encoding a fagopyritol synthase enzyme is Glycine max. A fagopyritol synthase from Glycine max is identified herein as GmGolS and is encoded by a nucleic acid molecule having a nucleotide sequence of SEQ ID NO:7 as follows:
(51) TABLE-US-00007 agccaaaagtttgttttcatagtgtgttttgtttcccaaatcctactcttgtgaccacaa 60 cccttcctcctctttcttttgaaacctctttttttctattccccaaccaaacaagcaaac 120 gctactcactcatcatcactgagatcatggctcctaatatcaccactgtcaaaaccacca 180 tcaccgacgctcaagccaaggtcgccaccgatcatggtcgtgcctacgtcaccttcctcg 240 ccggaaacggtgactatgtgaaaggtgtcgttggcttggcaaaaggtctgagaaaagtga 300 agagcatgtaccctctggtggttgcagtgctacccgatgttccccaagatcaccgcaaca 360 ttctcacctcccaaggttgcattgttagagagattgagcccgtgtaccccccagagaatc 420 aaacccagtttgccatggcatattacgtcatcaactattccaagctacgtatttgggagt 480 ttgtggagtacagcaagatgatatacctagacggtgatatccaagtttttgacaacattg 540 accacttgtttgacttgcctgataactacttctatgcggtgatggactgtttctgtgagc 600 caacttggggccacactaaacaatatcagatcggttactgccagcagtgcccccataagg 660 ttcagtggcccactcactttgggcccaaacctcctctctatttcaatgctggcatgtttg 720 tgtatgagcccaatttggctacttaccgtgacctccttcaaacagtccaagtcacccagc 780 ccacttcctttgctgaacaggattttttgaacatttacttcaaggacaaatataggccaa 840 ttcctaatgtctacaatcttgtgctggccatgctgtggcgtcaccctgagaacgttgagc 900 ttgacaaagttaaagtggttcactactgtgctgctgggtctaagccttggaggtacactg 960 ggaaggaggagaatatggagagagaagatatcaagatgttagtgaaaaagtggtgggata 1020 tatatgaggatgagactttggactacaacaatccactcaatgtggataagttcactgcgg 1080 cacttatggaggttggtgaagtcaagttcgtccgtgccccatctgctgcttaagagtgtc 1140 tttggaaatcaagtgtgatccaagtacatgtacaaagtcatacatcattacattaacttt 1200 tatgtatttctaaaagtcatacatcattacattaagttttatgtatttctaaagtcttaa 1260 gacttaagaggaccttttttatgtgtcccggcttttctttttttctttttccaattctgt 1320 cattgtaaagcaggtgaataccggtatccttaattttataaatggatatgaattttattt 1380 tgcaaaaaaaaaaaaaaaaaaaaaaa 1406
(52) The nucleic acid sequence corresponding to SEQ ID NO:7 encodes an isoform of fagopyritol synthase isolated from Glycine max, identified herein as GmGolS, which has a deduced amino acid sequence corresponding to SEQ ID NO:8, as follows:
(53) TABLE-US-00008 MetAlaProAsnIleThrThrValLysThrThrIleThrAspAlaGln 151015 AlaLysValAlaThrAspHisGlyArgAlaTyrValThrPheLeuAla 202530 GlyAsnGlyAspTyrValLysGlyValValGlyLeuAlaLysGlyLeu 354045 ArgLysValLysSerMetTyrProLeuValValAlaValLeuProAsp 505560 ValProGlnAspHisArgAsnIleLeuThrSerGlnGlyCysIleVal 65707580 ArgGluIleGluProValTyrProProGluAsnGlnThrGlnPheAla 859095 MetAlaTyrTyrValIleAsnTyrSerLysLeuArgIleTrpGluPhe 100105110 ValGluTyrSerLysMetIleTyrLeuAspGlyAspIleGlnValPhe 115120125 AspAsnIleAspHisLeuPheAspLeuProAspAsnTyrPheTyrAla 130135140 ValMetAspCysPheCysGluProThrTrpGlyHisThrLysGlnTyr 145150155160 GlnIleGlyTyrCysGlnGlnCysProHisLysValGlnTrpProThr 165170175 HisPheGlyProLysProProLeuTyrPheAsnAlaGlyMetPheVal 180185190 TyrGluProAsnLeuAlaThrTyrArgAspLeuLeuGlnThrValGln 195200205 ValThrGlnProThrSerPheAlaGluGlnAspPheLeuAsnIleTyr 210215220 PheLysAspLysTyrArgProIleProAsnValTyrAsnLeuValLeu 225230235240 AlaMetLeuTrpArgHisProGluAsnValGluLeuAspLysValLys 245250255 ValValHisTyrCysAlaAlaGlySerLysProTrpArgTyrThrGly 260265270 LysGluGluAsnMetGluArgGluAspIleLysMetLeuValLysLys 275280285 TrpTrpAspIleTyrGluAspGluThrLeuAspTyrAsnAsnProLeu 290295300 AsnValAspLysPheThrAlaAlaLeuMetGluValGlyGluValLys 305310315320 PheValArgAlaProSerAlaAla 325
(see
(54) Other suitable sources of nucleic acid molecules encoding fagopyritol synthases include any plant that expresses galactinol synthase (i.e., any plant that accumulates raffinose series of oligosaccharides), including, but not limited to, sugar beet, vetch, beans, legumes, cereals and grasses, cucurbits, and Brassicas (see, e.g., Kuo et al., J. Agricul. Food Chem. 36:32-36 (1988), which is hereby incorporated by reference in its entirety).
(55) Fragments of the above fagopyritol synthase enzymes are encompassed by the present invention.
(56) Suitable fragments can be produced by several means. In one method, subclones of the genes encoding the fagopyritol synthase enzymes of the present invention are produced by conventional molecular genetic manipulation by subcloning gene fragments. The subclones then are expressed in vitro or in vivo in bacterial cells to yield a smaller protein or peptide.
(57) In another approach, based on knowledge of the primary structure of the protein, fragments of a fagopyritol synthase enzyme encoding gene may be synthesized by using the PCR technique together with specific sets of primers chosen to represent particular portions of the protein. These then would be cloned into an appropriate vector for increased expression of a truncated peptide or protein.
(58) Chemical synthesis can also be used to make suitable fragments. Such a synthesis is carried out using known amino acid sequences for a fagopyritol synthase enzyme being produced. Alternatively, subjecting a full length fagopyritol synthase enzyme to high temperatures and pressures will produce fragments. These fragments can then be separated by conventional procedures (e.g., chromatography, SDS-PAGE).
(59) Another example of suitable fragments of the nucleic acids of the present invention are fragments of the genes which have been identified as conserved (con) regions of the proteins, or alternatively, those portions of nucleotide sequences that have been identified as variable (var) regions. Sequences identified using DNAStar Mega alignment program as either variable or conserved in a gene can be amplified using standard PCR methods using forward and reverse primers designed to amplify the region of choice and which include a restriction enzyme sequence to allow ligation of the PCR product into a vector of choice. Combinations of amplified conserved and variable region sequences can be ligated into a single vector to create a cassette which contains a plurality of DNA molecules in one vector.
(60) Mutations or variants of the above polypeptides or proteins are encompassed by the present invention. Variants may be made by, for example, the deletion or addition of amino acids that have minimal influence on the properties, secondary structure, and hydropathic nature of an enzyme. For example, a polypeptide may be conjugated to a signal (or leader) sequence at the N-terminal end of the protein which co-translationally or post-translationally directs transfer of the protein. The polypeptide may also be conjugated to a linker or other sequence for ease of synthesis, purification, or identification of the polypeptide.
(61) Also suitable as an isolated nucleic acid molecule according to the present invention is a nucleic acid molecule having a nucleotide sequence that is at least 55% similar, preferably at least 80% similar, and most preferably, at least 90% similar, to the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:7 by basic BLAST using default parameters analysis.
(62) Suitable nucleic acid molecules are those that hybridize to a nucleic acid molecule comprising a nucleotide sequence of SEQ ID No: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 under stringent conditions. For the purposes of defining the level of stringency, reference can conveniently be made to Sambrook et al., Molecular Cloning: a Laboratory Manual, 2.sup.nd Edition, Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press, at 11.45 (1989). An example of low stringency conditions is 4-6SSC/0.1-0.5% w/v SDS at 37-45 C. for 2-3 hours. Depending on the source and concentration of the nucleic acid involved in the hybridization, alternative conditions of stringency may be employed such as medium stringent conditions. Examples of medium stringent conditions include 1-4SSC/0.25% w/v SDS at 45 C. for 2-3 hours. An example of high stringency conditions includes 0.1-1SSC/0.1% w/v SDS at 60 C. for 1-3 hours. The skilled artisan is aware of various parameters which may be altered during hybridization and washing and which will either maintain or change the stringency conditions. Other examples of high stringency conditions include: 4-5SSC/0.1% w/v SDS at 54 C. for 1-3 hours and 4SSC at 65 C., followed by a washing in 0.1SSC at 65 C. for about one hour. Alternatively, an exemplary stringent hybridization condition is in 50% formamide, 4SSC, at 42 C. Still another example of stringent conditions include hybridization at 62 C. in 6SSC, 0.05BLOTTO, and washing at 2SSC, 0.1% SDS at 62 C.
(63) The precise conditions for any particular hybridization are left to those skilled in the art because there are variables involved in nucleic acid hybridizations beyond those of the specific nucleic acid molecules to be hybridized that affect the choice of hybridization conditions. These variables include: the substrate used for nucleic acid hybridization (e.g., charged vs. non-charged membrane); the detection method used (e.g., radioactive vs. chemiluminescent); and the source and concentration of the nucleic acid involved in the hybridization. All of these variables are routinely taken into account by those skilled in the art prior to undertaking a nucleic acid hybridization procedure.
(64) A fagopyritol synthase enzyme of the present invention is preferably produced in purified form (e.g., at least about 80%, more preferably 90% pure) by conventional techniques. One example of a suitable technique is set forth in the Examples herein. Alternatively, a fagopyritol synthase enzyme of the present invention is secreted into the growth medium of recombinant host cells. To isolate the fagopyritol synthase enzyme, a protocol involving a host cell such as Escherichia coli may be used, in which protocol the E. coli host cell carrying a recombinant plasmid is propagated, homogenized, and the homogenate is centrifuged to remove bacterial debris. The supernatant is then subjected to sequential ammonium sulfate precipitation. The fraction containing the fagopyritol synthase enzyme of the present invention is subjected to gel filtration in an appropriately sized dextran or polyacrylamide column to separate the proteins or polypeptides. If necessary, the protein fraction may be further purified by high performance liquid chromatography (HPLC).
(65) The nucleic acid molecule encoding the fagopyritol synthase enzyme of the present invention, or a suitable portion thereof, can be incorporated into host cells using conventional recombinant DNA technology. Generally, this involves inserting the nucleic acid molecule into an expression system to which the nucleic acid molecule is heterologous (i.e. not normally present). The expression system contains the necessary elements for the transcription and translation of the inserted protein-coding sequences.
(66) The present invention also relates to an expression vector containing a nucleic acid molecule encoding a fagopyritol synthase enzyme of the present invention. The nucleic acid molecules of the present invention may be inserted into any of the many available expression vectors and cell systems using reagents that are well known in the art. In preparing a DNA vector for expression, the various DNA sequences may normally be inserted or substituted into a bacterial plasmid. Any convenient plasmid may be employed, which will be characterized by having a bacterial replication system, a marker which allows for selection in a bacterium, and generally one or more unique, conveniently located restriction sites. Numerous plasmids, referred to as transformation vectors, are available for transformation. The selection of a vector will depend on the preferred transformation technique and target cells for transfection.
(67) Suitable vectors include, but are not limited to, the following viral vectors such as lambda vector system gt11, gt WES.tB, Charon 4, and plasmid vectors such as pBR322, pBR325, pACYC177, pACYC1084, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKC101, SV 40, pBluescript II SK+/ or KS+/ (see Stratagene Cloning Systems Catalog (1993) from Stratagene, La Jolla, Calif., which is hereby incorporated by reference in its entirety), pQE, pIH821, pGEX, pET series (see F. W. Studier et. al., Use of T7 RNA Polymerase to Direct Expression of Cloned Genes, Gene Expression Technology vol. 185 (1990), which is hereby incorporated by reference in its entirety), and any derivatives thereof. Any appropriate vectors now known or later described for genetic transformation are suitable for use with the present invention. Recombinant molecules can be introduced into cells via transformation, particularly transduction, conjugation, mobilization, or electroporation. The DNA sequences are cloned into the vector using standard cloning procedures in the art, as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, NY (1989), and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., which are hereby incorporated by reference in their entirety.
(68) U.S. Pat. No. 4,237,224 issued to Cohen and Boyer, which is hereby incorporated by reference in its entirety, describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA ligase. These recombinant plasmids are then introduced by means of transformation and replicated in unicellular cultures including prokaryotic organisms and eukaryotic cells grown in tissue culture.
(69) A variety of host-vector systems may be utilized to express the protein-encoding sequence(s). Primarily, the vector system must be compatible with the host cell used. Host-vector systems include but are not limited to the following: bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA; microorganisms such as yeast containing yeast vectors; mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); and plant cells infected by bacteria. The expression elements of these vectors vary in their strength and specificities. Depending upon the host-vector system utilized, any one of a number of suitable transcription and translation elements can be used.
(70) Thus, certain control elements or regulatory sequences are also incorporated into the plasmid-vector constructs of the present invention. These include non-transcribed regions of the vector and 5 and 3 untranslated regions, which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and/or translation elements, including constitutive, inducible, and repressible promoters, as well as minimal 5 promoter elements may be used. A constitutive promoter is a promoter that directs expression of a gene throughout the development and life of an organism. An inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequences or genes will not be transcribed or will only be minimally transcribed.
(71) The DNA sequences of eukaryotic promoters differ from those of prokaryotic promoters. Furthermore, eukaryotic promoters and accompanying genetic signals may not be recognized in or may not function in a prokaryotic system, and, further, prokaryotic promoters are not recognized and do not function in eukaryotic cells.
(72) Promotors vary in their strength (i.e. their ability to promote transcription). For the purposes of expressing a cloned gene, it is desirable to use strong promotors in order to obtain a high level of transcription and, hence, expression of the gene. Depending upon the host cell system utilized, any one of a number of suitable promotors may be used. For instance, when cloning in E. coli, its bacteriophages, or plasmids, promotors such as the T7 phage promoter, lac promotor, trp promotor, recA promotor, ribosomal RNA promotor, the P.sub.R and P.sub.L promotors of coliphage lambda and others, including but not limited, to lacUV5, ompF, bla, lpp, and the like, may be used to direct high levels of transcription of adjacent DNA segments. Additionally, a hybrid trp-lacUV5 (tac) promotor or other E. coli promotors produced by recombinant DNA or other synthetic DNA techniques may be used to provide for transcription of the inserted gene.
(73) Other examples of some constitutive promoters that are widely used for inducing expression of transgenes include the nopoline synthase (NOS) gene promoter, from Agrobacterium tumefaciens, (U.S. Pat. No. 5,034,322 issued to Rogers et al., which is hereby incorporated by reference in its entirety), the cauliflower mosaic virus (CaMV) 35S and 19S promoters (U.S. Pat. No. 5,352,605 issued to Fraley et al., which is hereby incorporated by reference in its entirety), the enhanced CaMV35S promoter (enh CaMV35S), the figwort mosaic virus full-length transcript promoter (FMV35S), those derived from any of the several actin genes, which are known to be expressed in most cells types (U.S. Pat. No. 6,002,068 issued to Privalle et al., which is hereby incorporated by reference in its entirety), and the ubiquitin promoter, which is a gene product known to accumulate in many cell types. Examples of constitutive promoters for use in mammalian cells include the RSV promoter derived from Rous sarcoma virus, the CMV promoter derived from cytomegalovirus, -actin and other actin promoters, and the EF1 promoter derived from the cellular elongation factor 1 gene.
(74) Bacterial host cell strains and expression vectors may be chosen which inhibit the action of the promoter unless specifically induced. In certain operations, the addition of specific inducers is necessary for efficient transcription of the inserted nucleic acid. For example, the lac operon is induced by the addition of lactose or IPTG (isopropylthio-beta-D-galactoside). A variety of other operons, such as trp, pro, etc., are under different controls.
(75) Other examples of some inducible promoters, induced, for examples by a chemical agent, such as a metabolite, growth regulator, herbicide or phenolic compound, or a physiological stress/physical means, such as cold, heat, salt, toxins, or through the action of a pathogen or disease agent such as a virus or fungus, include a glucocorticoid-inducible promoter (Schena et al., Proc. Natl. Acad. Sci. 88:10421-5 (1991), which is hereby incorporated by reference in its entirety), the heat shock promoter (Hsp), IPTG or tetracycline (Tet on system), the metallothionine promoter, which is activated by heavy metal ions, and hormone-responsive promoters, which are activated by treatment of certain hormones. A host cell containing an inducible promoter may be exposed to an inducer by externally applying the inducer to the cell. In addition, tissue-specific promoters can be used, which are promoters that function in a tissue specific manner to regulate the gene of interest within selected tissues of the host. Examples of such tissue specific promoters include seed, flower, or root specific promoters as are well known in the field (e.g., U.S. Pat. No. 5,750,385 to Shewmaker et al., which is hereby incorporated by reference in its entirety). Promoters of the nucleic acid construct of the present invention may be either homologous (derived from the same species as the host cell) or heterologous (derived from a different species than the host cell.
(76) Specific initiation signals are also required for efficient gene transcription and translation in prokaryotic cells. These transcription and translation initiation signals may vary in strength as measured by the quantity of gene specific messenger RNA and protein synthesized, respectively. The DNA expression vector, which contains a promoter, may also contain any combination of various strong transcription and/or translation initiation signals. For instance, efficient translation in E. coli requires an SD sequence about 7-9 bases 5 to the initiation codon (ATG) to provide a ribosome binding site. Thus, any SD-ATG combination that can be utilized by host cell ribosomes may be employed. Such combinations include but are not limited to the SD-ATG combination from the cro gene or the N gene of coliphage lambda, or from the E. coli tryptophan E, D, C, B or A genes. Additionally, any SD-ATG combination produced by recombinant DNA or other techniques involving incorporation of synthetic nucleotides may be used.
(77) The constructs of the present invention also include an operable 3 regulatory region, selected from among those which are capable of providing correct transcription termination and polyadenylation of mRNA for expression in the host cell of choice, operably linked to a DNA molecule which encodes for a protein of choice. A number of 3 regulatory regions are known in the art. Virtually any 3 regulatory region known to be operable in the host cell of choice would suffice for proper expression of the coding sequence of the nucleic acid of the present invention.
(78) In one aspect of the present invention, the nucleic acid molecule of the present invention is incorporated into an appropriate vector in the sense direction, such that the open reading frame is properly oriented for the expression of the encoded protein under control of a promoter of choice. This involves the inclusion of the appropriate regulatory elements into the DNA-vector construct. These include non-translated regions of the vector, useful promoters, and 5 and 3 untranslated regions which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used.
(79) A nucleic acid molecule of the preset invention, promoter of choice, an appropriate 3 regulatory region, and, if desired, a reporter gene, can be incorporated into a vector-expression system which contains the nucleic acids of the present invention, or suitable fragments thereof, using standard cloning techniques as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, NY (1989), and Ausubel et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., which are hereby incorporated by reference in their entirety. The transcriptional and translational elements are operably linked to the nucleic acid molecule of the present invention or a fragment thereof, meaning that the resulting vector expresses the fagopyritol synthase when placed in a suitable host cell.
(80) Once an isolated DNA molecule encoding a fagopyritol synthase enzyme has been cloned into an expression vector, it is ready to be incorporated into a host cell. Such incorporation can be carried out by the various forms of transformation noted above, depending upon the vector/host cell system. Recombinant molecules can be introduced into cells via transformation, particularly transduction, conjugation, mobilization, or electroporation. The nucleic acid sequences are cloned into the host cell using standard cloning procedures known in the art, as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Springs Laboratory, Cold Springs Harbor, N.Y. (1989), which is hereby incorporated by reference in its entirety. Suitable host cells include, but are not limited to, bacteria, virus, yeast, mammalian cells, insect, plant, and the like.
(81) Thus, the present invention also relates to a host cell incorporating one or more of the isolated nucleic acid molecules of the present invention. In one embodiment, the isolated nucleic acid molecule is heterologous to the host cell. Such incorporation can be carried out by the various forms of transformation noted above, depending upon the vector/host system, and using the various host cells described above.
(82) Methods of transformation may result in transient or stable expression of the DNA under control of the promoter. Preferably, the nucleic acid of the present invention is stably inserted into the genome of the host cell as a result of the transformation, although transient expression can serve an important purpose.
(83) One approach to transforming host cells with a nucleic acid molecule of the present invention is particle bombardment (also known as biolistic transformation) of the host cell. This can be accomplished in one of several ways. The first involves propelling inert or biologically active particles at cells. This technique is disclosed in U.S. Pat. Nos. 4,945,050, 5,036,006, and 5,100,792, all to Sanford et al., which are hereby incorporated by reference in their entirety. Generally, this procedure involves propelling inert or biologically active particles at the cells under conditions effective to penetrate the outer surface of the cell and to be incorporated within the interior thereof When inert particles are utilized, the vector can be introduced into the cell by coating the particles with the vector containing the heterologous DNA. Alternatively, the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle. Biologically active particles (e.g., dried bacterial cells containing the vector and heterologous DNA) can also be propelled into plant cells. Other variations of particle bombardment, now known or hereafter developed, can also be used.
(84) Transient expression in protoplasts allows quantitative studies of gene expression, because the population of cells is very high (on the order of 10.sup.6). To deliver DNA inside protoplasts, several methodologies have been proposed, but the most common are electroporation (Fromm et al., Proc. Natl. Acad. Sci. USA 82:5824-5828 (1985), which is hereby incorporated by reference in its entirety) and polyethylene glycol (PEG) mediated DNA uptake (Krens et al., Nature 296:72-74 (1982), which is hereby incorporated by reference in its entirety). During electroporation, the DNA is introduced into the cell by means of a reversible change in the permeability of the cell membrane due to exposure to an electric field. PEG transformation introduces the DNA by changing the elasticity of the membranes. Unlike electroporation, PEG transformation does not require any special equipment and transformation efficiencies can be equally high. Another appropriate method of introducing the nucleic acid molecule of the present invention into a host cell is fusion of protoplasts with other entities, either minicells, cells, lysosomes, or other fusible lipid-surfaced bodies that contain the chimeric gene (Fraley, et al., Proc. Natl. Acad. Sci. USA 76:3348-52 (1979), which is hereby incorporated by reference in its entirety).
(85) Stable transformants are preferable for the methods of the present invention. An appropriate method of stably introducing the nucleic acid molecule into plant cells is to infect a plant cell with Agrobacterium tumefaciens or Agrobacterium rhizogenes previously transformed with a DNA construct of the present invention. Under appropriate conditions known in the art, the transformed plant cells are grown to form shoots or roots, and develop further into plants.
(86) Plant tissues suitable for transformation include without limitation, floral buds, leaf tissue, root tissue, meristems, zygotic and somatic embryos, megaspores, callus, protoplasts, tassels, pollen, embryos, anthers, and the like. The means of transformation chosen is that most suited to the tissue to be transformed.
(87) Suitable plants include dicots and monocots. Monocots suitable for the present invention include Gramineae (e.g., grass, corn, grains, bamboo, sugar cane), Liliaceae (e.g., onion, garlic, asparagus, tulips, hyacinths, day lily, and aloes), Iridaceae (e.g., iris, gladioli, freesia, crocus, and watsonia), and Orchidacea (e.g., orchid). Examples of dicots suitable for the present invention include Salicaceae (e.g., willow, and poplar), Ranunculaceae (e.g., Delphinium, Paeonia, Ranunculus, Anemone, Clematis, columbine, and marsh marigold), Magnoliaceae (e.g., tulip tree and Magnolia), Cruciferae (e.g., mustards, cabbage, cauliflower, broccoli, brussel sprouts, kale, kohlrabi, turnip, and radish), Rosaceae (e.g., strawberry, blackberry, peach, apple, pear, quince, cherry, almond, plum, apricot, and rose), Leguminosae (e.g., pea, bean, peanut, alfalfa, clover, vetch, redbud, broom, wisteria, lupine, black locust, and acacia), Malvaceae (e.g., cotton, okra, and mallow), Umbelliferae (e.g., carrot, parsley, parsnips, and hemlock), Labiatae (e.g., mint, peppermints, spearmint, thyme, sage, and lavender), Solanaceae (e.g., potato, tomato, pepper, eggplant, and Petunia), Cucurbitaceae (e.g., melon, squash, pumpkin, and cucumber), Compositae (e.g., sunflower, endive, artichoke, lettuce, safflower, aster, marigold, dandelions, sage brush, Dalia, Chrysanthemum, and Zinna), and Rubiaceae (e.g., coffee).
(88) After transformation, the transformed plant cells can be selected and regenerated. Preferably, transformed cells are first identified using a selection marker simultaneously introduced into the host cells along with the DNA construct of the present invention. Suitable selection markers include, without limitation, markers encoding for antibiotic resistance, such as the nptll gene which confers kanamycin resistance (Fraley, et al., Proc. Natl. Acad. Sci. USA 80:4803-4807 (1983), which is hereby incorporated by reference in its entirety), and the genes which confer resistance to gentamycin, G418, hygromycin, streptomycin, spectinomycin, tetracycline, chloramphenicol, and the like. Any known antibiotic-resistance marker can be used to transform and select transformed host cells in accordance with the present invention. Cells or tissues are grown on a selection medium containing the appropriate antibiotic, whereby generally only those transformants expressing the antibiotic resistance marker continue to grow. Other types of markers are also suitable for inclusion in the expression cassette of the present invention. For example, a gene encoding for herbicide tolerance, such as tolerance to sulfonylurea is useful, or the dhfr gene, which confers resistance to methotrexate (Bourouis et al., EMBO J. 2:1099-1104 (1983), which is hereby incorporated by reference in its entirety). Similarly, reporter genes, which encode for enzymes providing for production of a compound identifiable are suitable. The most widely used reporter gene for gene fusion experiments has been uidA, a gene from Escherichia coli that encodes the -glucuronidase protein, also known as GUS (Jefferson et al., EMBO J. 6:3901-3907 (1987), which is hereby incorporated by reference in its entirety). Similarly, enzymes providing for production of a compound identifiable by luminescence, such as luciferase, are useful. The selection marker employed will depend on the target species; for certain target species, different antibiotics, herbicide, or biosynthesis selection markers are preferred.
(89) Once a recombinant plant cell or tissue has been obtained, it is possible to regenerate a full-grown plant therefrom. It is known that practically all plants can be regenerated from cultured cells or tissues, including but not limited to, all major species of sugarcane, sugar beets, cotton, fruit trees, and legumes. Means for regeneration vary from species to species of plants, but generally a suspension of transformed protoplasts or a petri plate containing transformed explants is first provided. Callus tissue is formed and shoots may be induced from callus and subsequently rooted. Alternatively, embryo formation can be induced in the callus tissue. These embryos germinate as natural embryos to form plants. The culture media will generally contain various amino acids and hormones, such as auxin and cytokinins. It is also advantageous to add glutamic acid and proline to the medium, especially for such species as corn and alfalfa. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. If these three variables are controlled, then regeneration is usually reproducible and repeatable.
(90) Plant regeneration from cultured protoplasts is described in Evans, et al., Handbook of Plant Cell Cultures, Vol. 1: (MacMillan Publishing Co., New York, 1983); and Vasil I. R. (ed.), Cell Culture and Somatic Cell Genetics of Plants, Acad. Press, Orlando, Vol. I, 1984, and Vol. III (1986), which are hereby incorporated by reference in their entirety.
(91) After the DNA construct is stably incorporated in transgenic plants, it can be transferred to other plants by sexual crossing or by preparing cultivars. With respect to sexual crossing, any of a number of standard breeding techniques can be used depending upon the species to be crossed. Cultivars can be propagated in accord with common agricultural procedures known to those in the field. Alternatively, transgenic seeds or propagules (e.g., cuttings) are recovered from the transgenic plants. The seeds can then be planted in the soil and cultivated using conventional procedures to produce transgenic plants.
(92) Another aspect of the present invention relates to a method for producing a fagopyritol, an insulin mediator, an insulin mediator analogue, an insulin mediator homologue, or an insulin mediator inhibitor. As used herein, fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, and insulin mediator inhibitors include salts and derivatives thereof.
(93) Studies have been completed that link Type II diabetes and PCOS to deficiencies in insulin mediators composed of galactosamine D-chiro-inositol. Although their functions have yet to be fully characterized, it is known that insulin mediators act as second messengers of insulin action, and they are believed to be inositol phosphoglycans bound to cell membranes (Lamer et al., Diabetes Reviews 7:217-231 (1999), which is hereby incorporated by reference in its entirety). In the presence of insulin, these mediators are released and may activate glycogen synthesis. It has been found that feeding D-chiro-inositol to women with PCOS increased insulin response and ovulatory function (Nestler et al., N. Engl. J. Med. 340:1314-1320 (1999), which is hereby incorporated by reference in its entirety). Another study has also shown that insulin resistance has been associated with abnormal D-chiro-inositol metabolism (Ortmeyer et al., Endocrinology 132:640-645 (1993), which is hereby incorporated by reference in its entirety). Thus, synthesis of insulin mediators containing D-chiro-inositol is of importance in order to determine a treatment for Type II diabetes and PCOS.
(94) This method of the present invention includes providing a fagopyritol synthase, providing a substrate including a galactosyl donor and a galactosyl acceptor, and combining the fagopyritol synthase with the substrate under conditions effective to produce a fagopyritol, an insulin mediator, an insulin mediator analogue, an insulin mediator homologue, or an insulin mediator inhibitor.
(95) Suitable fagopyritols which can be produced by the above method of the present invention are described above.
(96) Suitable insulin mediators, insulin mediator analogues, insulin mediator homologues, and insulin mediator inhibitors which can be produced by the above method of the present invention include, but are not limited to, galactosamine-
(97) Suitable galactosyl donors include, but are not limited to, UDP-galactose, UDP-galactosamine, UDP-glucose, and UDP-glucosamine, which may be used with the enzymes described herein or enzyme mutants.
(98) Suitable galactosyl acceptors include, but are not limited to,
(99) The fagopyritol synthase and substrate are combined to produce a fagopyritol, an insulin mediator, an insulin mediator analogue, or an insulin mediator homologue. Suitable conditions are determined by the fagopyritol synthase and substrate used, and include suitable amounts of Mn.sup.2+(e.g., approximately 1-15 mM MnCl.sub.2, preferably 5 mM MnCl.sub.2) and suitable amounts of reducing agents, such as DTT and mercaptoethanol. One example of suitable conditions is disclosed in the enzyme assays described in the Examples, below.
(100) Separation of the resulting fagopyritol, insulin mediator, insulin mediator analogue, or insulin mediator homologue from any other components may be achieved by methods known to one of ordinary skill in the art, such as with carbon-Celite, BioRad P2 gel, TLC, HPLC, or Dowex columns.
(101) Thus, the method of the present invention can be used to produce an isolated or substantially pure fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, insulin mediator inhibitor, or salts or derivatives thereof. As used herein, an isolated fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, or insulin mediator inhibitor, is one which is substantially free of other components with which it naturally occurs. As referred to herein, substantially pure means substantially free of other compounds or materials, such as galactinol, myo-inositol, digalactosyl myo-inositol, phytin, aromatic materials (e.g. polyphenols and pigments and other colored aromatic materials), cell wall particles, proteins, and acids (e.g. organic acids, nucleic acids, and amino acids) and their salts. Typically, substantially pure fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, or insulin mediator inhibitors are those having greater than about 95% purity, such as greater than about 98% purity or from about 95% to about 99% purity.
(102) Salts of the fagopyritols can be the reaction product of a base having a pKa (i.e., log Ka) greater than the pKa of one or more of the fagopyritols' hydroxyl groups, such as a metal hydroxide or alkoxide, an amonium hydroxide, or an amine (e.g. a tertiary amine, like triethyl amine). Exemplary salts are alkali metal salts, such as lithium salts, sodium salts, and potassium salts, alkali earth metal salts, such as calcium salts and barium salts, ammonium salts, sufonium salts, and phosphonium salts.
(103) Derivatives of the fagopyritols, include, for example, the reaction products of the fagopyritols with compounds bearing a carbon having a positive charge, such as an alkyl halide, in which case the derivative is an ether of the fagopyritol, or a carboxylic acid halide (e.g., acetyl chloride) or anhydride (e.g., acetic anhydride), in which case the derivative is an ester of the fagopyritol (e.g., the acetate).
(104) The fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, and insulin mediator inhibitors produced with the fagopyritol synthase genes of the present invention can be used in a composition which includes one or more of fagopyritol A1, fagopyritol A2, fagopyritol A3, fagopyritol B1, fagopyritol B2, fagopyritol B3
(105) The aforementioned fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, insulin mediator inhibitors, and compositions are useful in treating diabetes in patients, such as mammals, including dogs, cats, rats, mice, and humans, by administering an effective amount of isolated or substantially pure fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, insulin mediator inhibitors, or compositions to such patients. The aforementioned fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, insulin mediator inhibitors, and compositions may also be useful in treating polycystic ovary syndrome (see Nestler et al., New England J. of Med., 340:1314-1320 (1999), which is hereby incorporated by reference in its entirety). For example, the substantially pure fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, and insulin mediator inhibitors, the compositions, or one or more isolated fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, and insulin mediator inhibitors can be administered alone, or in combination with suitable pharmaceutical carriers or diluents. The diluent or carrier ingredients should be selected so that they do not diminish the therapeutic effects of the fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, insulin mediator inhibitors, or compositions. Suitable pharmaceutical compositions include those which include a pharmaceutical carrier and, for example, one or more of an isolated fagopyritol A1, an isolated fagopyritol A2, an isolated fagopyritol A3, an isolated fagopyritol B1, an isolated fagopyritol B2, an isolated fagopyritol B3, an insulin mediator, an insulin mediator analogue, an insulin mediator homologue, or an insulin mediator inhibitor.
(106) The fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, insulin mediator inhibitors, and compositions herein can be made up in any suitable form appropriate for the desired use; e.g., oral, parenteral, or topical administration. Examples of parenteral administration are intraventricular, intracerebral, intramuscular, intravenous, intraperitoneal, rectal, and subcutaneous administration. The preferred route for administration is oral. In cases where the fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, or insulin mediator inhibitors, are administered topically or parenterally, it is preferred that they be pre-hydrolyzed.
(107) Suitable dosage forms for oral use include tablets, dispersible powders, granules, capsules, suspensions, syrups, and elixirs. Inert diluents and carriers for tablets include, for example, calcium carbonate, sodium carbonate, lactose, and talc. Tablets may also contain granulating and disintegrating agents, such as starch and alginic acid; binding agents, such as starch, gelatin, and acacia; and lubricating agents, such as magnesium stearate, stearic acid, and talc. Tablets may be uncoated or may be coated by known techniques to delay disintegration and absorption. Inert diluents and carriers which may be used in capsules include, for example, calcium carbonate, calcium phosphate, and kaolin. Suspensions, syrups, and elixirs may contain conventional excipients, such as methyl cellulose, tragacanth, sodium alginate; wetting agents, such as lecithin and polyoxyethylene stearate; and preservatives, such as ethyl-p-hydroxybenzoate. Dosage forms suitable for parenteral administration include solutions, suspensions, dispersions, emulsions, and the like. They may also be manufactured in the form of sterile solid compositions which can be dissolved or suspended in sterile injectable medium immediately before use. They may contain suspending or dispersing agents known in the art.
(108) For oral administration either solid or fluid unit dosage forms can be prepared. For preparing solid compositions, such as tablets, a suitable fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, insulin mediator inhibitor, or composition, as disclosed above, is mixed with conventional ingredients, such as talc, magnesium stearate, dicalcium phosphate, magnesium aluminum silicate, calcium sulfate, starch, lactose, acacia methylcellulose, and functionally similar materials as pharmaceutical diluents or carriers. Capsules are prepared by mixing the disclosed fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, insulin mediator inhibitors, or compositions with an inert pharmaceutical diluent and filling the fixture into a hard gelatin capsule of appropriate size. Soft gelatin capsules are prepared by machine encapsulation of a slurry of the fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, insulin mediator inhibitor, or composition with an acceptable vegetable oil, light liquid petrolatum, or other inert oil.
(109) Fluid unit dosage forms for oral administration such as syrups, elixirs, and suspensions can be prepared. The water-soluble forms can be dissolved in an aqueous vehicle together with sugar, aromatic flavoring agents, and preservatives to form a syrup. An elixir is prepared by using a hydro-alcoholic (ethanol) vehicle with suitable sweeteners, such as sugar and saccharin, together with an aromatic flavoring agent. Suspensions can be prepared with a syrup vehicle with the aid of a suspending agent, such as acacia, tragacanth, methylcellulose, and the like.
(110) When the fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, insulin mediator inhibitors, or compositions are administered orally, suitable daily dosages can be based on suitable doses of free
(111) Alternatively, the fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, or insulin mediator inhibitors, can be administered orally in foodstuffs. For example, fagopyritols can be incorporated in purified form or in the form of buckwheat bran in bread, bread rolls, or other foodstuffs to form an edible product for consumption of fagopyritols. Fortification of breads, bread rolls, and other foodstuffs with synthesized fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, or insulin mediator inhibitors can provide a way to incorporate larger quantities of fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, or insulin mediator inhibitors into a daily diet. Suitable procedures for bread preparation can be found, for example, in Brown, The Tassajara Bread Book, Boston: Shambhala Publications (1986), which is hereby incorporated by reference.
(112) For parenteral administration, fluid unit dosage forms are prepared utilizing the aforementioned fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, insulin mediator inhibitors, or compositions and a sterile vehicle, water being preferred. The fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, insulin mediator inhibitor, or composition, depending on the vehicle and concentration used, can be either suspended or dissolved in the vehicle. In preparing solutions, the fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, insulin mediator inhibitor, or composition can be dissolved in water for injection and filter sterilized before filling into a suitable vial or ampule and sealing. Advantageously, adjuvants, such as a local anesthetic, preservative, and buffering agents, can be dissolved in the vehicle. To enhance the stability, the fluid unit dosage form can be frozen after filling into the vial, and the water removed under vacuum. The dry lyophilized powder is then sealed in the vial, and an accompanying vial of water for injection is supplied to reconstitute the liquid prior to use. Parenteral suspensions are prepared in substantially the same manner except that the fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, insulin mediator inhibitor, or composition is suspended in the vehicle instead of being dissolved, and sterilization cannot be accomplished by filtration. The fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, insulin mediator inhibitor, or composition can be sterilized by exposure to ethylene oxide before suspending in the sterile vehicle. Advantageously, a surfactant or wetting agent is included in the parenteral suspension to facilitate uniform distribution of the fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, insulin mediator inhibitor, or composition. Parenteral dosages can range from about 5 mg to about 200 mg of fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, insulin mediator inhibitor, or composition per kilogram of the subject's body weight per day. Preferably, the daily parenteral dosage would be considerably less than the dose per kilogram of subject body weight, considering that, in oral administration, the galactose from the fagopyritols would be consumed by microbes in the digestive tract whereas, in parenteral administration the galactose would contribute to blood sugar levels.
(113) Alternatively, the fagopyritol, insulin mediator, insulin mediator analogue, insulin mediator homologue, insulin mediator inhibitor, or composition can be incorporated into a sustained release formulation and surgically implanted using conventional methods. Suitable sustained release matricies include those made of ethylene vinyl acetate and other bicompatible polymers.
(114) For topical administration, carriers, such as phospholipid vesicles, which contain the aforementioned fagopyritols, insulin mediators, insulin mediator analogues, insulin mediator homologues, or insulin mediator inhibitors, may facilitate uptake through the skin.
(115) As indicated above, it is believed that the fagopyritols are digested in the digestive tract by bacteria to release free
(116) The present invention is further illustrated by the following examples.
EXAMPLES
Example 1Fagopyritol synthase, A Novel Multi-Functional Galactinol Synthase Homologue, Catalyzes the Biosynthesis of Fagopyritol A1 and Fagopyritol B1 in Buckwheat Seeds
(117) Nucleotide and Amino Acid Sequence Analyses
(118) The nucleotide sequences of galactinol synthase genes identified to date and their corresponding amino acid sequences were obtained from the nucleotide and protein databases (http://www.ncbi.nlm.nih.gov). Nucleotide and amino acid sequences were compared using a multiple sequence alignment program, CLUSTAL W (http://workbench.sdsc.edu). The identities of buckwheat cDNA fragments amplified from RT-PCR and RACE-PCR assays were examined by BLASTN and BLASTX programs (http://www.ncbi.nlm.nih.gov and http://workbench.sdsc.edu).
(119) Isolation of FeGolS cDNA
(120) The synthesis of PCR-directed cDNA from the poly(A).sup.+ RNA isolated from developing buckwheat seeds (harvested at 20 to 25 days after pollination) was described previously (Lewis et al., Gene 246:81-91 (2000), which is hereby incorporated by reference in its entirety). Briefly, it involved the synthesis of the first strand cDNA using an oligo-dT primer (primer A, 5-GCGGCCGCTTTTTTTTTTTTTTTTT-3 (SEQ ID NO:16),
(121) DNA Sequencing
(122) All PCR-generated cDNA clones were sequenced at the DNA Sequencing Facility, BioResource Center, Cornell University (http://brcweb.biotech.cornell.edu).
(123) Bacterial Expression and Purification of Recombinant GolS Proteins
(124) The entire 1002 bp long protein coding sequence of FeGolS-1 cDNA was amplified from the reconstituted FeGolS-1 cDNA using two oligonucleotide primers, FG1-5 (5-GTTCCAACCATATGGCACCAGAACTC-3) (SEQ ID NO:22) and FG1-3 (5-GGATCCGATACTTAAGCTGCGGAAGGAGC-3) (SEQ ID NO:23) (
(125) Enzyme Assays
(126) Both the crude soluble protein extracts from E. coli and the purified GolS recombinant proteins were used in enzyme assays. Fagopyritol synthase assays included 20 mM UDP-Gal as the galactosyl donor, 20 mM
(127) Results
(128) Cloning of cDNAs Encoding Two Distinct Types of GolS Enzymes in Buckwheat Seeds
(129) Initially, several GolS gene sequences reported from various plant species, either derived from genomic or cDNA clones, were compiled and compared to identify stretches of highly conserved nucleotide sequences corresponding to the conserved amino acid domains of GolS enzymes. By using oligonucleotide primers representing these conserved nucleotide sequences and the first-strand cDNA synthesized from polyA.sup.+ RNA extracted from developing seeds in our PCR assays, a total of three different GolS cDNAs from buckwheat were isolated (
(130) FeGolS-1 cDNA was initially obtained as a partial clone of 469 bp in length, using an internal GolS gene-specific primer (GS1) and primer B corresponding to the dG homopolymer tail present at the 5 end of the cDNA (
(131) Intact FeGolS-1 and FeGolS-2 cDNAs containing the complete protein coding sequences with 5 and 3 UTRs were reconstituted by joining the overlapping 5 and 3 RACE-PCR clones for each gene (
(132) Primary Structures of GolS Polypeptides Deduced from cDNA Sequences
(133) The amino acid sequence deduced from the reconstituted FeGolS-1 cDNA indicated that it is capable of encoding a polypeptide of 333 amino acid residues with a predicted molecular mass of 38.3 kDa (
(134) Both FeGolS-1 and FeGolS-2 polypeptides share a high degree of amino acid sequence similarity with other GolSs identified from a wide variety of plant species (
(135) Recombinant Protein Expression and Purification
(136)
(137) Substrate Specificity of FeGolS-1 and FeGolS-2
(138) Both purified recombinant FeGolS-1 and FeGolS-2 proteins exhibited fagopyritol synthase activities. FeGolS-1 catalyzed the biosynthesis of fagopyritol B1 with UDP-Gal as the galactosyl donor and
(139) Discussion
(140) The FeGolS-1 gene encodes an enzyme that catalyzes fagopyritol B1 biosynthesis using UDP-Gal as galactosyl donor and
(141) Retention of fagopyritol synthase activity by purified recombinant FeGolS-1, FeGolS-2, and GmGolS protein required Mn.sup.+2 (5 mM optimal) as a cofactor, as it has been reported with galactinol synthase from other sources (Saravitz et al., Plant Physiol. 83:185-189 (1987); Castillo et al., J. Agric. Food Chem. 38:351-355 (1990); Smith et al., Plant Physiol. 96:693-698 (1991); Liu et al., Plant Physiol. 109:505-511 (1995); Kuo et al., Plant Sci. 125:1-11 (1997), which are hereby incorporated by reference in their entirety). One to 10 mM Mn.sup.+2 was most commonly used for the retention of galactinol synthase activity. Interestingly, the antihyperglycemic effects of
(142) Pea (Pisum sativum L.) seed galactinol synthase (Frydman et al., Biochem. Biophys. Res. Comm. 12:121-125 (1963), which is hereby incorporated by reference in its entirety) and lentil (Lens culinaris Medik.) stachyose synthase (Hoch et al., Arch. Biochem. Biophys. 366:75-81 (1999), which is hereby incorporated by reference in its entirety) have been reported to form a product with
(143) Among seven GolS genes identified in Arabidopsis thaliana, three were identified as stress responsive (Taji et al., Plant J. 29:417-426 (2002), which is hereby incorporated by reference in its entirety). AtGolS-1 and AtGolS-2 were induced by drought and high-salinity stresses but not by cold stress. In contrast, AtGolS-3 was induced by cold stress by not by drought or high-salinity stress. Buckwheat seeds matured at 18 C. accumulated more fagopyritol A1 and fagopyritol B1 than seeds matured at 25 C. (Horbowicz et al., Planta 205:1-11 (1998), which is hereby incorporated by reference in its entirety), indicating that FeGolS genes may be cold-responsive.
(144) The nucleotide sequence of the soybean EST clone, BE330777, isolated by a public source (Shoemaker et al., Public soybean EST project; GenBank BE33077; Genome Systems Clone ID: Gm-c1041-80 (5), Genome Systems, Inc., 4633 World Parkway Circle, St. Louis, Mo. 63134 (1999), which is hereby incorporated by reference in its entirety) with the full sequence first reported herein, demonstrated a very high homology to the soybean seed galactinol synthase gene (155634), sequence 6 (U.S. Pat. No. 5,648,210 to Kerr et al., which is hereby incorporated by reference in its entirety). The deduced amino acid sequence (328 amino acids) differed by only one amino acid, Ile 223 in GmGolS (AY126715) rather than Met 223 (155634) (U.S. Pat. No. 5,648,210 to Kerr et al., which is hereby incorporated by reference in its entirety). Of the multiple genes for galactinol synthase, some are specifically expressed in seeds. Modification of galactinol biosynthesis is of commercial interest (U.S. Pat. No. 5,648,210 to Kerr et al.; U.S. Pat. No. 5,710,365 to Kerr, which are hereby incorporated by reference in their entirety) for producing soybean seeds with lower stachyose concentrations for the poultry and pig feed industry (Sebastian et al., in Soy in Animal Nutrition, ed. Drackley, Federation of Animal Science Societies, Savoy, Ill., pp 56-73 (2000), which is hereby incorporated by reference in its entirety). A mutant with a single base change in a seed-expressed myo-inositol 1-phosphate synthase (MIPS, EC 5.5.1.4) gene coupled with appropriate modifiers resulted in soybean seeds with both reduced phytic acid and reduced stachyose (Hitz et al., Plant Physiol. 128:650-660 (2002), which is hereby incorporated by reference in its entirety) for use in the feed industry.
(145) Fagopyritol A1 is isosteric with 2-amino-2-deoxy--
Example 2Seed Galactosyl Cyclitols Enhanced by Substrate Feeding
(146) Materials and Methods
(147) Plant Materials
(148) Soybean (Glycine max (L.) Merrill) plants were grown in the greenhouse (Obendorf et al., Crop Sci. 20:483-486 (1980); Obendorf et al., Crop Sci. 38:78-84 (1998), which are hereby incorporated by reference in their entirety) at 27 C. during the day (14 hours) and 22 C. at night (10 hours) under natural sunlight supplemented 14 hours daily with 640 mol m.sup.2 s.sup.1 incandescent light from metal halide lamps (Sylvania 1000 watt BU). Three embryos isolated from immature seeds (25020 mg fresh weight, approximately 35 DPA) by removal of the seed coat and nucellus remnants were incubated in 20 mL screw-capped vials containing 3 mL of substrate (cyclitol and/or sucrose) solutions for 24 hours at 25 C. and 200 mol m.sup.2 s.sup.1 fluorescent light. Embryos were blotted, placed in small plastic Petri dishes, and subjected to slow drying at 22 C. by daily transfer to successive lower relative humidity (RH) controlled by saturated salt solutions (Blackman et al., Plant Physiol. 100:225-230 (1992), which is hereby incorporated by reference in its entirety): day 1, 92% RH; day 2, 87% RH; day 3, 75% RH; day 4, 54% RH; day 5, 45% RH; day 6, 32% RH; day 7, 12% RH; and remained at 12% RH days 8-14.
(149) Embryo Feeding ExperimentsSubstrate Concentration Series
(150) Four substrate concentration experiments were conducted. Embryos for each experiment were incubated in each of the substrate solutions for 24 hours, blotted, and slow dried for 14 days. Axis and cotyledon tissues were separated and analyzed for soluble carbohydrates. Four replications of three embryos each (total of 12 embryos/treatment) were incubated in the myo-inositol-sucrose concentration series: A) 0 mM myo-inositol+100 mM sucrose, B) 10 mM myo-inositol+90 mM sucrose, C) 25 mM myo-inositol+75 mM sucrose, D) 50 mM myo-inositol+50 mM sucrose, E) 100 mM myo-inositol+0 mM sucrose, and F) 0 mM myo-inositol+0 mM sucrose. Six replications of three embryos each (total of 18 embryos/treatment) were incubated in the
(151) Embryo Feeding ExperimentsDrying Time Series
(152) Six slow drying time experiments were conducted. In each experiment, three replications of three embryos each (total of 9 embryos per treatment) were incubated in a different sucrose and/or cyclitol substrate solution for 24 hours, blotted, and slow dried for 0, 1, 2, 3, 4, or 14 days. Axis and cotyledon tissues were separated and analyzed for soluble carbohydrates. The substrate solutions for the six experiments were as follows: 30 mM myo-inositol plus 100 mM sucrose; 100 mM
(153) Substrates
(154) Sucrose, myo-inositol, scyllo-inositol, epi-inositol, and UDP-Gal were purchased from Sigma-Aldrich (St. Louis, Mo.).
(155) Carbohydrate Analysis
(156) Soluble carbohydrates were extracted from 2 cotyledons or 1 axis for each embryo. Two cotyledons were extracted with 2.0 mL of ethanol:water (1:1, v/v) containing 300 g of phenyl -
(157) Results
(158) Cyclitols, including myo-inositol,
(159) Both embryonic axis and cotyledon tissues were assayed for experiments reported herein. Embryonic axes mature earlier than cotyledons and accumulate higher concentrations of soluble carbohydrates (up to 25% of dry weight) (Horbowicz et al., Seed Sci. Res. 4:385-405 (1994); Obendorf et al., Crop Sci. 38:78-84 (1998), which are hereby incorporated by reference in their entirety). Accumulation of products in axis tissues generally precedes accumulation of products in cotyledons, reflecting the differential in progression toward maturation. In general, data were more variable for axis tissues than for cotyledon tissues, mainly because of the small mass of axis tissues, about 1 mg dry weight for experiments reported herein.
(160) Concentration series experiments were adjusted to be a constant 100 mM (cyclitol plus sucrose) excluding the sucrose concentration series experiment. Feeding myo-inositol up to 50 mM doubled free myo-inositol concentration in dry axis and cotyledon tissues after precocious maturation with small increases in
(161) Feeding
(162) Feeding
(163) Feeding sucrose at 0 to 200 mM resulted in a small decrease in galactinol (
(164) Feeding a combination of 100 mM
(165) Accumulation of fagopyritol B1 appeared to be independent of accumulation of galactopinitols, raffinose, and stachyose, indicating fagopyritol B1 biosynthesis is independent of galactopinitol biosynthesis. Feeding a combination of
(166) Cyclitols detected in soybean embryos include myo-inositol,
(167) Axis tissues accumulate higher concentrations of soluble carbohydrate products than cotyledons, suggesting that biosynthetic enzymes may be more active in axis tissues. Yellowing of axis and cotyledon tissues is a visual indicator of the cessation of growth and tissue maturation; axis tissues mature earlier than cotyledon tissues in planta (Obendorf et al., Crop Sci. 38:78-84 (1998), which is hereby incorporated by reference in its entirety). This difference in maturation must be considered when assaying gene expression in whole embryos or seeds in contrast to assaying axis and cotyledon tissues separately. Feeding
(168) Feeding both
Example 3Soybean EST Clone Corresponding to Galactinol Synthase (GolS) Gene
(169) Gene or cDNA sequences corresponding to the GolS gene in soybean were searched in the nucleotide and protein databases using the BLAST programs (http://www.ncbi.nlm.nih.gov) and a multiple sequence alignment program, CLUSTAL W (http://workbench.sdsc.edu). A soybean EST clone (GenBank accession number BE330777) sharing a very high level of DNA sequence identity with the GolS genes reported from other plant species was identified, and obtained from INCYTE GENOMICS, Palo Alto, Calif. (cat. no. Gm-c1041). Since only partial DNA sequence data were available for this EST clone in GenBank, the whole EST insert was re-sequenced (nucleotide sequence assigned to GenBank Accession Number AY126715) at the DNA Sequencing Facility at BioResource Center at Cornell University (http://brcweb.biotech.cornell.edu).
(170) The 987 bp long entire protein coding sequence of GmGolS was amplified from the soybean EST clone by PCR. Two primers, 5-CATCACTGAGCATATGGCTGG-3 (SEQ ID NO:29) and 5-GGATCCAAAGACACTCTTAAGCAGCAGATGGGG-3 (SEQ ID NO:30), containing NdeI and BamHI restriction enzyme recognition sites respectively, were used in the PCR assays. After cloning into the pCRII-TOPO vector (Invitrogen, Carlsbad, Calif.) and amplification in Escherichia coli, the NdeI/BamHI fragment containing the entire protein coding sequence was isolated and cloned into the corresponding sites in pET-14b vector (Novagen, Madison, Wis.). This insertion resulted in the placement of the GmGolS protein coding sequence in frame with the preceding poly-histidine codons in the pET-14b vector. The pET14b plasmid containing soybean GmGolS cDNA was mobilized into E. coli strain BL21 (DE3) (Novagen, Madison, Wis.). Expression of the recombinant GmGolS protein was induced in E. coli with 1 mM isopropylthio--
(171) Both crude soluble protein extracts from E. coli containing the recombinant GmGolS protein and purified recombinant GmGolS protein were used in enzyme assays. GolS activity assays included 20 mM UDP-Gal as the galactosyl donor, 20 mM myo-inositol as the galactosyl acceptor, 50 mM HEPES buffer, pH 7.0, 2 mM DTT, 5 mM MnCl.sub.2 and 1 to 5 g of crude protein extract or purified GmGolS protein in 50 L total volume. In fagopyritol synthase assays, myo-inositol was substituted with 20 mM
(172) To confirm that GolS catalyzes the biosynthesis of fagopyritol B1, a soybean galactinol synthase (GmGolS) gene was cloned (GenBank accession number AY126715) and heterologously expressed in Escherichia coli. The purified recombinant protein was assayed for fagopyritol synthase activity. Recombinant GmGolS catalyzed the biosynthesis of galactinol with UDP-Gal as the galactosyl donor and myo-inositol as the galactosyl acceptor (
(173) The recombinant soybean galactinol synthase (GmGolS) is a multi-functional enzyme with both GolS activity and fagopyritol synthase activity, but GmGolS does not exhibit galactopinitol synthase activity. GolS activity in developing and maturing soybean seeds is associated with stachyose accumulation and remained high through seed maturity (Handley et al., J. Amer. Soc. Hort. Sci. 108:600-605 (1983); Saravitz et al., Plant Physiol. 83:185-189 (1987); Lowell et al., Crop Sci. 29:459-465 (1989); Kuo et al., Plant Sci. 125:1-11 (1997), which are hereby incorporated by reference in their entirety). During soybean seed development in planta, Gol S mRNA was first detected in axis tissues at 44 days post anthesis (DPA) and in cotyledons at 46 to 48 DPA (Volk, Ph.D. Dissertation, Cornell University, Ithaca, N.Y., pp 176-187 (1998), which is hereby incorporated by reference in its entirety), coincident with galactinol accumulation and at the onset of stachyose accumulation (Obendorf et al., Crop Sci. 38:78-84 (1998), which is hereby incorporated by reference in its entirety). GolS transcripts remained high during seed desiccation (Volk, Ph.D. Dissertation, Cornell University, Ithaca, N.Y., pp 176-187 (1998), which is hereby incorporated by reference in its entirety). GolS enzyme activity and mRNA increase in response to cold or desiccation (Castillo et al., J. Agric. Food Chem. 38:351-355 (1990); Liu et al., Plant Sci. 134:11-20 (1998), which are hereby incorporated by reference in their entirety). Among seven Arabidopsis thaliana GolS genes, three were stress responsive (Taji et al., Plant J. 29:417-426 (2002), which is hereby incorporated by reference in its entirety). AtGolS1 and AtGolS2 were induced by water-deficit stress and high-salinity stress but not by cold stress. AtGolS3 was induced by cold stress but not by drought or salt stress. Soybean seeds matured at 25 C. had increased
(174) Substrate specificities of soybean GolS and stachyose synthase are different. The lack of soybean GolS activity with
Example 4Biosynthesis of Fagopyritol B1 and Galactopinitols in Soybean Explants Following Feeding With Free Cyclitols
(175) Soybean is a leguminous plant that bears monocarpic fruit only once before death. During maturation, tissues become yellow starting with radical tips, leaf blades, pod walls, hypocotyls, and cotyledons (Benner et al., Biochemie and Physiologie der Pflanzen 179:269-275 (1984), which is incorporated herein by reference in its entirety). Yellowing of the seed coat and embryo indicate cessation of dry matter accumulation in the seed (TeKrony et al., Agronomy Journal 73:553-556 (1981); VerNooy et al., Plant Physiology 82:222-225 (1986), which are hereby incorporated by reference in their entirety). Leaf yellowing, however, is not always a good indicator of when a given soybean seed has stopped growing (Neumann et al., Plant Physiology 72:182-185 (1983), which is incorporated herein by reference in its entirety). Because there is transport from the leaves to the pod, seed weight may continue to increase as long as leaves are still alive. Consequently, pod yellowing is the indicator that is often used to determine the time at which maximum dry weight is reached (Benner et al., Biochemie and Physiologie der Pflanzen 179:269-275 (1984), which is incorporated herein by reference in its entirety). The onset of this yellowing/desiccation is what brings about galactosyl cyclitol accumulation in axis and cotyledon tissue (Obendorf et al., Plant Science 132:1-12 (1998); Obendorf et al., Crop Science 38:78-84 (1998), which are incorporated herein by reference in their entirety).
(176) Soybean seeds accumulate galactosyl cyclitols as opposed to free cyclitols (Horbowicz et al., Seed Science Research 4:385-405 (1994), which is incorporated herein by reference in its entirety). These include galactosyl derivatives of
(177) Upon being fed to soybean, free cyclitols undergo biosynthetic reactions to form galactosyl cyclitols. Several important reactions of myo-inositol,
(178) Knowledge of the translocation patterns of cyclitols is indispensable in understanding their function (Nooden et al., Journal of Plant Growth Regulation 2:265-279 (1984), which is incorporated herein by reference in its entirety). Previous studies used labeled chemicals, hormones, or sugars in order to observe these very translocation patterns within plants of interest. In an experiment done by Nooden and Letham in 1983, for example, .sup.3H (ring-labeled) zeatin riboside was used to trace the production of the hormone cytokinin. The hormone was fed to soybean explants and transported via the transpiration stream. This biological marker allowed for the clear observation of transport from the xylem to the leaf and embryo of the explant. This experiment also resulted in leaves retaining their green color longer, which is important in experimentation with soybean explants (Nooden et al., Journal of Plant Growth Regulation 2:265-279 (1984), which is incorporated herein by reference in its entirety). A previous study by Quebedeaux and Chollet (Quebedeaux et al., Plant Physiology 55:745-748 (1975), which is hereby incorporated by reference in its entirety) used radioactive tracers to demonstrate that the pods (and seeds contained therein) of soybeans are the main sinks for the photosynthetic assimilates from the leaf, indicating that the decrease in the production of photosynthate is therefore due to the decrease in photosynthetic activity of the plant, which accompanies senescence (Benner et al., Biochemie and Physiologic der Pflanzen 179:269-275 (1984), which is incorporated herein by reference in its entirety). In addition to these methods, translocation patterns can also be observed through analysis of products formed following exogenous feeding of large quantities of the compound(s) of interest.
(179) It is known that myo-inositol is biosynthesized in soybean embryos. Johnson and Wang (Johnson et al., J. Biol. Chem. 271:17215-17218 (1996), which is hereby incorporated by reference in its entirety) demonstrated that 1
(180) Several studies provide evidence in support of the hypothesis that
(181) Materials and Methods
(182) Soybean plants [Glycine max (L.) Merrill cv. Chippewa 64] were grown in a greenhouse at 27 C. days (14 hours) and 22 C. nights (10 hours) with natural light supplemented by 640-mol m.sup.2 s.sup.1 artificial light from Sylvania 1000-watt metal halide lamps.
(183) Plants were excised above the third node from the bottom and below the third node from the top before leaf senescence was evident as was done by Neumann et al. Plant Physiology 72:182-185 (1983), which is hereby incorporated by reference in its entirety. Explants were cut mid podfill (about 35 days after flowering), when the pods were still green and approximately 7.2 mm in width, and the seeds weighed about 250 mg fresh weight. Pod number was reduced to one, containing three seeds. Each explant included one node, one leaf, one pod, and one internode. The cut basal end of the internode (stem) of the explants was placed in 50 mM solutions of cyclitols: 50 mM myo-inositol, 50 mM
(184) After the seeds had slow dried, extraction and analysis of soluble carbohydrates was performed. Cotyledon and axis tissues were separated, weighed, pulverized in liquid nitrogen with a mortar and pestle, and homogenized in a ground glass homogenizer with 2.2 ml of ethanol:water (1:1, v/v), containing 300 g (cots) or 100 g (axis) of phenyl -
(185) Results
(186) Overall, none of the feeding experiments resulted in large changes in sucrose, raffinose, or stachyose except for some low values observed in explants fed with
(187) Myo-Inositol
(188) Feeding 50 mM myo-inositol to soybean explants slightly increased free myo-inositol and caused a 50% increase in galactinol in axis and cotyledon tissue (Tables 1 and 2).
(189) TABLE-US-00009 TABLE 1 Concentration of soluble carbohydrates in cotyledons of mature soybean seeds after feeding explants 50 mM myo-inositol, D-chiro-inositol, or D-pinitol. A B C D myo-Inositol D-chiro-Inositol D-Pinitol Control D-Pinitol 7.77 0.92 6.00 0.52 35.77 2.50 8.34 1.12 Galactopinitol 2.01 0.16 1.89 0.14 5.81 0.38 1.59 0.15 A Galactopinitol 1.76 0.21 1.62 0.18 4.88 3.10 1.60 0.22 B Ciceritol 0.63 0.08 0.34 0.11 1.13 0.16 0.85 0.07 D-chiro-Inositol 5.15 0.77 15.59 2.08 1.63 0.11 1.63 0.26 Fagopyritol B1 1.78 0.23 21.11 2.06 1.77 0.11 1.05 0.08 Fagopyritol B2 0.25 0.07 1.52 0.47 0.16 0.02 0.15 0.04 Myo-Inositol 2.35 0.79 0.58 0.05 0.67 0.07 1.69 0.44 Galactinol 0.35 0.06 0.23 0.05 0.05 0.01 0.25 0.04 Sucrose 37.73 4.81 27.88 4.09 32.49 2.05 48.76 7.62 Raffinose 11.22 1.12 7.18 0.58 9.73 0.46 11.00 1.47 Stachyose 23.10 1.94 12.63 1.40 14.60 1.06 24.51 3.73
(190) TABLE-US-00010 TABLE 2 Concentration of soluble carbohydrates in axis of mature soybean seeds after feeding explants 50 mM myo-inositol, D-chiro-inositol, or D-pinitol. A B C D myo-Inositol D-chiro-Inositol D-Pinitol Control D-Pinitol 3.65 0.03 4.07 0.38 21.40 2.41 4.51 0.58 Galactopinitol 4.61 0.41 4.96 0.30 12.14 1.06 3.65 0.35 A Galactopinitol 3.17 0.40 3.61 0.30 9.42 0.88 2.84 0.42 B Ciceritol 0.65 0.12 0.37 0.15 1.58 0.26 0.79 0.23 D-chiro-Inositol 1.08 0.14 12.31 1.44 1.28 0.30 0.61 0.12 Fagopyritol B1 2.81 0.28 30.95 2.46 2.99 0.22 1.79 0.22 Fagopyritol B2 0.24 0.09 1.62 0.50 0.08 0.02 0.14 0.06 Myo-Inositol 1.52 0.15 1.37 0.13 0.98 0.13 1.19 0.20 Galactinol 0.89 0.10 1.00 0.07 0.58 0.08 0.69 0.08 Sucrose 34.02 3.52 32.18 4.31 30.86 4.11 35.59 5.63 Raffinose 8.87 0.77 6.61 0.81 9.81 1.08 1.030 0.76 Stachyose 24.56 2.55 17.95 1.79 23.16 2.50 22.02 2.32
No significant changes in the amount of stachyose, raffinose,
(191) Feeding 50 mM
(192)
(193) Feeding
(194) Discussion
(195) Relative amounts of soluble carbohydrates observed can be attributed to biochemical pathways in soybean and the roles that
(196) In soybean explants, galactinol synthase (GolS or GAS) produces galactinol from myo-inositol and UDP-galactose (
(197) When feeding 50 mM myo-inositol, there were high levels of galactinol, the galactosyl donor for galactopinitol biosynthesis, present. The lack of increase in accumulation of galactopinitols may have been due to limited levels of
(198) Soybean galactinol synthase (GmGolS or GAS) produces fagopyritol B1 from
(199) In this experiment, feeding
(200) myo-Inositol is biosynthesized in embryo tissues of developing legume seeds (Johnson et al., Journal of Biological Chemistry 271, 17215-17218 (1996); Hegeman et al., Plant Physiology 125:1941-1948 (2001); Hitz et al., Plant Physiology 128:650-660 (2002), which are incorporated by reference in their entirety).
(201) The results in this Example are consistent with the following interpretations: myo-inositol is formed in maternal tissues and in embryos of seeds,
Example 5Soybean Explant Feeding Experiments
(202) Soybean explants, consisting of a stem segment with attached leaf and pod, were cultured as the soybean explants described in Example 4. In this example, the soybean explant system was used to study the timing of transport of cyclitols, fed through the stem, to the developing soybean seed and the timing of their incorporation into galactosyl cyclitols in axis, cotyledons, and seed coat of developing and maturing soybean seeds. myo-inositol,
(203) TABLE-US-00011 TABLE 3 Accumulation of soluble carbohydrates in soybean axis (g/axis) after 3 days transport of sucrose (1% solution) and myo-inositol (50 mM) into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 axis) Before After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 5.89 5.97 5.05 5.72 2.74 2.86 6.70 5.72 Unknown 0.91 0.67 0.57 0.49 0.52 0.38 1.25 1.46 D-chiro-Inositol 1.98 2.17 3.65 4.69 3.40 1.75 9.39 5.12 myo-Inositol 37.08 37.50 3.34 1.96 1.74 1.69 4.22 3.84 Sucrose 143.88 139.88 38.38 76.58 50.48 82.93 77.01 63.96 Galactopinitol A 4.31 0 5.86 8.20 9.93 11.97 13.99 10.23 Galactopinitol B 0.72 0 1.29 2.20 3.06 4.60 5.50 3.91 Fagopyritol B1 0 0 3.15 5.91 6.25 7.43 11.14 6.13 Galactinol 3.01 3.59 12.80 10.83 7.31 4.07 6.76 4.14 Raffinose Tr 0 5.44 1.83 6.37 7.57 14.51 11.98 Ciceritol Tr 0 0 0 0.39 0.42 0.56 0.29 Fagopyritol B2 0 0 0 0 0 0 0 0 Stachyose 0 0 9.92 6.33 62.18 55.60 89.46 57.18
(204) TABLE-US-00012 TABLE 4 Accumulation of soluble carbohydrates in soybean axis (g/axis) after 3 days transport of sucrose (1% solution) and D-chiro-inositol (50 mM) into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 axis) Before After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 6.94 6.11 6.18 7.87 6.21 3.86 7.68 4.13 Unknown 0.47 0 0.39 0.46 0.65 0.42 0 0.92 D-chiro- 25.26 22.53 20.29 25.33 11.74 7.67 39.99 26.32 Inositol myo-Inositol 18.22 16.89 1.93 2.75 1.27 1.03 0.92 1.01 Sucrose 111.55 149.75 22.44 28.32 35.75 23.35 59.50 30.63 Galactopinitol 0 0 6.35 6.24 13.54 12.18 15.50 10.18 A Galactopinitol 0 0 1.47 1.56 6.35 4.73 9.35 5.03 B Fagopyritol 2.04 0 32.08 25.93 81.94 73.53 78.96 55.76 B1 Galactinol 0 2.71 6.29 10.19 3.46 2.25 4.23 2.27 Raffinose 0.23 0 2.57 3.37 2.61 3.24 6.68 5.73 Ciceritol 0 0 0 0 0 0.27 0 2.69 Fagopyritol 0 0 0 0 0 1.72 2.07 0 B2 Stachyose 0 0 11.56 8.94 49.55 22.07 47.82 39.47
(205) TABLE-US-00013 TABLE 5 Accumulation of soluble carbohydrates in soybean axis (g/axis) after 3 days transport of sucrose (1% solution) and D-pinitol (50 mM) into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 axis) Before After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 16.89 18.34 22.93 20.86 14.00 20.05 26.07 56.18 Unknown 1.30 1.47 0 0 0.69 0.45 0.95 1.53 D-chiro- 1.30 2.20 2.40 1.39 0.59 0.48 1.83 1.32 Inositol myo-Inositol 13.58 15.43 1.58 2.01 1.12 0 2.22 3.62 Sucrose 130.10 160.58 32.16 37.53 66.76 27.38 48.95 56.62 Galactopinitol 0 0 7.62 9.41 25.04 19.32 24.72 32.49 A Galactopinitol 0 0 3.09 3.49 9.62 7.25 10.61 12.71 B Fagopyritol 0 0 4.30 2.75 5.79 4.01 6.41 8.76 B1 Galactinol 2.27 2.97 6.40 10.37 5.46 2.87 3.92 4.18 Raffinose 0 0 6.33 3.86 7.49 3.46 7.60 11.19 Ciceritol 0 0 0 0.80 0.89 0.56 1.42 1.43 Fagopyritol 0 0 0 0 0 0 0 1.26 B2 Stachyose 0 0 11.91 7.69 79.54 28.64 54.54 78.56
(206) TABLE-US-00014 TABLE 6 Accumulation of soluble carbohydrates in soybean axis (g/axis) after 3 days transport of sucrose (1% solution) without cyclitols into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 axis) Before After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 10.61 11.12 7.28 10.54 4.24 4.89 8.64 4.32 Unknown 0.32 0.98 0.85 0.48 0.69 0.41 1.58 1.68 D-chiro- 1.96 2.03 0.89 0.94 0.39 0.30 1.92 0.62 Inositol myo-Inositol 16.11 20.11 2.42 2.14 1.49 1.66 2.62 2.36 Sucrose 230.72 282.09 48.81 84.07 87.13 159.22 115.27 91.58 Galactopinitol 0 0 7.55 9.97 17.42 16.07 16.14 12.28 A Galactopinitol 0 0 1.81 2.60 7.11 7.06 7.78 5.09 B Fagopyritol 1.70 0 3.51 5.52 7.09 6.40 8.41 4.98 B1 Galactinol 1.20 5.49 11.09 13.41 5.60 4.29 4.38 4.27 Raffinose 0.62 2.65 5.83 8.95 8.58 12.44 13.14 8.02 Ciceritol 0 0 0.01 0.07 0.80 0.71 0.94 0.63 Fagopyritol 0 0 5.67 0 0 0 0 0 B2 Stachyose 0 7.83 0 27.73 96.03 118.05 101.39 69.71
(207) TABLE-US-00015 TABLE 7 Accumulation of soluble carbohydrates in soybean cotyledons (g/cotyledon) after 3 days transport of sucrose (1% solution) and myo-inositol (50 mM) into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 cot) Before After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 99.88 127.21 121.52 132.23 101.97 128.68 61.67 95.93 Unknown 4.53 8.94 53.99 63.64 86.25 85.24 62.60 111.06 D-chiro-Inositol 52.20 55.90 133.52 129.44 150.98 192.49 95.36 137.86 myo-Inositol 257.87 275.47 67.54 29.93 21.34 12.69 7.82 11.96 Sucrose 1429.70 1496.60 635.91 995.62 921.47 1952.20 717.30 1228.20 Galactopinitol 9.46 10.00 12.84 10.98 28.27 54.91 34.57 28.69 A Galactopinitol 0 0 6.27 3.19 11.92 28.11 15.29 9.70 B Fagopyritol B1 0 0 7.36 14.06 29.15 86.71 50.31 49.29 Galactinol 0 0 85.06 104.07 57.03 25.34 14.65 14.10 Raffinose 0 0 29.20 89.65 122.10 351.33 165.12 218.44 Ciceritol 0 0 0 0 0 0 2.01 0 Fagopyritol B2 0 0 0 0 0 0 1.29 5.27 Stachyose 0 0 0 50.41 224.95 774.04 399.25 323.00
(208) TABLE-US-00016 TABLE 8 Accumulation of soluble carbohydrates in soybean cotyledon (g/cotyledon) after 3 days transport of sucrose (1% solution) and D-chiro-inositol (50 mM) into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 cot) Before After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 175.37 149.51 140.00 177.82 131.32 171.09 91.50 90.76 Unknown 49.44 36.70 65.35 59.28 74.11 69.17 39.34 56.75 D-chiro-Inositol 518.30 476.04 635.01 719.52 388.25 589.84 335.21 286.00 myo-Inositol 138.61 142.47 21.83 55.39 4.25 10.39 5.77 3.80 Sucrose 1978.90 2102.30 360.00 363.10 395.07 579.04 580.31 736.23 Galactopinitol A 15.98 0 12.41 16.08 47.20 42.69 48.41 47.44 Galactopinitol B 0 0 0 0 22.34 20.06 25.58 23.82 Fagopyritol B1 10.55 0 45.25 25.67 711.00 535.23 612.60 626.65 Galactinol 14.29 0 42.99 42.35 15.89 32.53 11.02 9.34 Raffinose 7.28 10.73 21.08 15.23 122.16 124.39 198.46 211.32 Ciceritol 0 6.06 13.35 0 12.69 0 3.82 2.83 Fagopyritol B2 0 0 0 4.57 12.10 11.12 23.98 22.70 Stachyose 0 0 44.86 0 308.62 277.15 357.02 349.60
(209) TABLE-US-00017 TABLE 9 Accumulation of soluble carbohydrates in soybean cotyledon (g/cotyledon) after 3 days transport of sucrose (1% solution) and D-pinitol (50 mM) into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 cot) Before After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 351.23 497.66 428.40 431.73 472.26 438.53 160.89 303.14 Unknown 62.38 62.50 46.56 38.08 76.63 85.85 24.57 45.01 D-chiro-Inositol 33.59 27.90 46.09 46.18 25.69 68.75 14.91 32.16 myo-Inositol 116.75 167.27 20.25 28.65 2.77 7.67 4.02 6.03 Sucrose 1364.90 2193.00 322.30 431.68 463.59 849.80 369.28 614.41 Galactopinitol A 9.09 9.60 12.29 8.49 94.29 117.43 86.03 104.22 Galactopinitol B 0 0 0 1.48 41.39 50.76 29.37 40.39 Fagopyritol B1 0 3.39 4.99 4.57 51.96 69.76 29.66 51.85 Galactinol 0 0 28.42 40.81 20.87 37.07 11.23 10.39 Raffinose 0 4.09 10.85 15.22 72.18 187.91 77.60 162.90 Ciceritol 0 0 0 2.47 0 3.32 4.88 4.85 Fagopyritol B2 0 0 4.91 0 15.04 11.92 1.77 0 Stachyose 0 0 0 0 211.21 552.89 268.51 427.70
(210) TABLE-US-00018 TABLE 10 Accumulation of soluble carbohydrates in soybean cotyledon (g/cotyledon) after 3 days transport of sucrose (1% solution) without cyclitols into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 cot) Before After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 199.64 176.34 162.30 222.80 187.65 166.14 98.90 153.50 Unknown 11.90 12.07 22.73 20.87 60.13 5840 14.10 8.01 D-chiro-Inositol 45.57 37.40 50.36 57.42 69.00 73.60 54.07 46.46 myo-Inositol 127.35 113.66 23.50 29.70 12.71 15.03 7.16 16.01 Sucrose 2188.80 2395.60 731.21 923.69 1035.10 2211.00 1281.70 1787.10 Galactopinitol A 9.90 9.21 9.17 9.30 114.04 84.24 102.80 68.60 Galactopinitol B 4.55 1.73 1.56 1.54 40.67 36.28 49.91 30.24 Fagopyritol B1 1.89 2.10 4.72 13.12 72.21 62.04 83.93 57.10 Galactinol 1.88 2.16 83.71 166.27 52.22 25.06 28.60 26.57 Raffinose 4.97 2.41 34.55 85.98 200.22 312.69 273.49 444.34 Ciceritol 0 0 1.63 0 1.79 2.22 10.22 4.63 Fagopyritol B2 0 0 2.69 0 11.94 2.08 4.52 4.65 Stachyose 0 0 12.20 18.15 773.51 516.66 1331.00 904.20
(211) TABLE-US-00019 TABLE 11 Accumulation of soluble carbohydrates in soybean seed coats (g/seed coat) after 3 days transport of sucrose (1% solution) and myo-inositol (50 mM) into stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 seed coat) After After 2 days 4 days After 14 days Soluble slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 11.24 9.35 6.81 12.13 15.41 D-chiro-Inositol 15.00 17.15 7.20 13.32 22.63 myo-Inositol 38.71 30.23 4.83 6.94 9.10 Sucrose 21.35 23.43 14.28 78.62 138.83 Galactopinitol A 0 0 4.87 6.98 7.08 Galactopinitol B 0 0 1.07 0 2.22 Fagopyritol B1 3.04 1.97 1.90 5.51 6.47 Galactinol 0 0 0 2.61 2.91 Raffinose 1.58 0 0 7.44 24.24 Ciceritol 0 0 0 0 0 Fagopyritol B2 0 0 0 0 0 Stachyose 0 0 0 20.21 35.12
(212) TABLE-US-00020 TABLE 12 Accumulation of soluble carbohydrates in soybean seed coat (g/seed coat) after 3 days transport of sucrose (1% solution) and D-chiro-inositol (50 mM) into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 seed coat) After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 6.55 5.97 14.69 10.95 12.79 16.30 D-chiro-Inositol 193.33 173.15 169.87 149.60 87.18 134.18 myo-Inositol 12.32 11.96 5.53 5.38 3.76 4.51 Sucrose 16.60 17.20 2.65 2.33 9.81 59.33 Galactopinitol A 0 4.13 4.72 4.29 0 7.33 Galactopinitol B 0 0.79 1.76 0.78 0 3.14 Fagopyritol B1 3.52 4.88 9.14 8.69 14.54 51.81 Galactinol 0 1.30 0 1.19 0 1.60 Raffinose 0 0 0.36 0.18 0 10.08 Ciceritol 0 0 0 0 0 0 Fagopyritol B2 0 0 0 0 0 1.35 Stachyose 0 0 0 0 0 15.45
(213) TABLE-US-00021 TABLE 13 Accumulation of soluble carbohydrates in soybean seed coat (g/seed coat) after 3 days transport of sucrose (1% solution) and D-pinitol (50 mM) into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 seed coat) After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 78.06 73.32 58.50 90.19 50.78 96.60 D-chiro-Inositol 4.66 4.29 4.05 5.81 4.52 8.11 myo-Inositol 10.61 14.11 2.68 2.62 4.13 3.58 Sucrose 15.56 23.40 2.73 4.47 33.23 78.92 Galactopinitol A 0 5.55 4.81 5.72 10.65 19.70 Galactopinitol B 0 3.09 1.44 2.10 3.57 6.98 Fagopyritol B1 0 2.10 1.66 1.66 4.07 10.12 Galactinol 0 0 0 0 0 2.77 Raffinose 0 0 0 0.54 0 18.53 Ciceritol 0 0 0 0 0 0 Fagopyritol B2 0 0 0 0 0 0 Stachyose 0 0 0 0 0 64.19
(214) TABLE-US-00022 TABLE 14 Accumulation of soluble carbohydrates in soybean seed coats (g/seed coat) after 3 days transport of sucrose (1% solution) without cyclitols into the stem of soybean explants and after slow drying of seeds for 2, 4, or 14 days (micrograms/1 seed coat) After 2 days After 4 days After 14 days Soluble slow drying slow drying slow drying Carbohydrate Rep 1 Rep 2 Rep 1 Rep 2 Rep 1 Rep 2 D-Pinitol 16.22 12.15 20.16 19.36 25.66 16.34 D-chiro-Inositol 3.27 3.10 3.77 1.74 3.38 2.68 myo-Inositol 12.27 12.84 5.67 5.65 3.88 4.63 Sucrose 21.74 31.93 8.26 15.33 19.35 82.18 Galactopinitol A 0 4.95 5.54 8.05 5.79 6.14 Galactopinitol B 0 1.22 1.45 0 0 2.18 Fagopyritol B1 3.43 3.27 1.69 5.41 2.54 3.44 Galactinol 0 0 1.50 0 0 1.66 Raffinose 3.50 5.06 1.08 0 0 8.44 Ciceritol 0 0 0 0 0 0 Fagopyritol B2 0 0 0 0 0 0 Stachyose 0 0 0 0 0 16.46
(215) TABLE-US-00023 TABLE 15 Accumulation of soluble carbohydrates (g/cm.sup.2) in soybean leaves (1 cm.sup.2 leaf disks) at 24 hours after feeding 50 mM myo-inositol, D-chiro-inositol, or D-pinitol, each 1% sucrose solution, or 1% sucrose solution alone to stems of soybean explants 24 hours after feeding 50 mM cyclitol in 1% sucrose Soluble solution to explants Carbohydrate myo-Inositol D-chiro-Inositol D-Pinitol Sucrose only g/cm.sup.2 leaf area Fructose 88.82 121.03 62.53 24.85 Glucose 50.75 115.12 69.82 21.14 D-Pinitol 147.24 124.80 757.97 133.76 D-chiro- 18.98 439.69 23.29 12.21 Inositol myo-Inositol 296.44 10.15 5.60 25.31 Sucrose 46.10 29.51 28.89 29.90 Maltose 9.34 9.85 4.11 11.59 Galactopinitol 0 0 0 0 A Galactopinitol 0 0 0 0 B Fagopyritol 0 0 0 0 B1 Galactinol 0 0 0 0 Raffinose 0 0 0 0 Ciceritol 0 0 0 0 Fagopyritol 0 0 0 0 B2 Stachyose 0 0 0 0
(216) Some results and conclusions drawn from this series of experiments are as follows. Feeding myo-inositol,
(217) Feeding myo-inositol,
(218) Feeding myo-inositol,
(219) Feeding myo-inositol,
(220) These results are in general agreement with the those of Examples 2 and 3.
Example 6Buckwheat Plant Temperature Experiments
(221) Common buckwheat (Fagopyrum esculentum Moench) belongs to Polygonoceae family. Originating in northeast Asia, southern Siberia and northern China, there are 18 recognized natural species in Fagopyrum. Among them, common buckwheat is most important from economical, agricultural, and nutritional points of view. In buckwheat, the triangular fruit (achene) forms a single seed. The buckwheat embryo is rich in lipids (Horbowicz et al., J. Agric. Food Chem. 40:745-750 (1992), which is hereby incorporated by reference in its entirety), and high quality proteins (Elpidina et al., J. Exp. Bot. 41:969-977 (1990), which is hereby incorporated by reference in its entirety), and is embedded in a starchy endosperm (Marshall et al., Adv. Cereal Sci. Tech. 5:157-210 (1982); Steadman et al., J. Cereal Sci. 33:271-278 (2001), which are hereby incorporated by reference in their entirety).
(222) Common buckwheat plants are dimorphic and heterostylous. One-half of the plants have pin-type flowers with long styles and short stamens, and one-half of the plants have thrum-type flowers with short styles and long stamens (Marshall et al., Adv. Cereal Sci. Tech. 5:157-210 (1982), which is hereby incorporated by reference in its entirety). Each type is self-incompatible and cross-incompatible among plants with the same flower type. Seed set requires legitimate cross pollination, pin by thrum and thrum by pin, by insects under field conditions or by hand pollination in the greenhouse as in the present study (Horbowicz et al., J. Agric. Food Chem. 40:745-750 (1992), which is hereby incorporated by reference in its entirety).
(223) Buckwheat plants grow best in cool, moist climates. Daytime air temperatures of 17 C. to 19 C. are optimal during flowering and seed maturation of this plant (Marshall et al., Adv. Cereal Sci. Tech. 5:157-210 (1982), which is hereby incorporated by reference in its entirety). Because the crop matures in 10 to 12 weeks, it can be grown in temperate regions and higher altitude areas. The crop is sensitive to high temperatures and dry weather, especially when the plants are flowering (Slawinska et al., Seed Sci. Res. 11:223-233 (2001); Taylor et al., Crop Sci. 41:1792-1799 (2001), which are hereby incorporated by reference in their entirety).
(224) Recent evidence points to the importance of special types of carbohydrates in development of seed desiccation tolerance and storability (Koster et al., Plant Physiol. 88:829-832 (1998); Blackman et al., Plant Physiol. 100:225-230 (1992); Horbowicz et al., Seed Sci. Res. 4:385-405 (1994); Obendorf et al., Seed Sci. Res. 7:63-74 (1997); Obendorf et al., Crop Sci. 38:78-84 (1998), which are hereby incorporated by reference in their entirety). During development of legume seeds mainly sucrose and -galactosides of sucrose are accumulated (Horbowicz et al., Seed Sci. Res. 4:385-405 (1994); Obendorf et al., Seed Sci. Res. 7:63-74 (1997); Brenac et al., J. Plant Physiol. 150:481-488 (1997), which are hereby incorporated by reference in their entirety). Instead, buckwheat seeds contains sucrose and -galactosides of
(225) Six fagopyritols (galactosyl cyclitols), representing two distinct series differing in bonding positions, were found in buckwheat seeds (Horbowicz et al., Planta 205:1-11 (1998); Steadman et al., J. Cereal Sci. 33:271-278 (2001); Steadman et al., Carbohydr. Res. 331:19-25 (2001); Szczecinski et al., Bull. Pol. Acad. Sci. 46:9-13 (1998), which are hereby incorporated by reference in their entirety). Fagopyritol B1 and fagopyritol A1 are the major galactosides accumulated, and correlated to desiccation tolerance in buckwheat seeds (Horbowicz et al., Planta 205:1-11 (1998); Obendorf et al., Carbohydr. Res. 328:623-627 (2000), which are hereby incorporated by reference in their entirety). Structures of di- and trigalactosides of
(226) chiro-inositol plays a role in the biosynthesis of galactosamine-
(227) Temperature during development of legume seeds had only minor effects on soluble carbohydrate biosynthesis and accumulation (Gorecki et al., Crop Sci. 36:1277-1282 (1996); Obendorf et al., Crop Sci. 38:78-84 (1998), which are hereby incorporated by reference in their entirety). However during our preliminary studies, temperature during seed maturation affected soluble carbohydrate content and composition of buckwheat embryos (Horbowicz et al., Planta 205:1-11 (1998), which is hereby incorporated by reference in its entirety). Warm temperature (25 C.) favored biosynthesis of sucrose, and embryos matured at cool temperature (18 C.) accumulated higher quantities of fagopyritol A1 and fagopyritol B1. During maturation of soybean embryos, warm temperature (25 C.) favors biosynthesis of fagopyritol B1, as well as sucrose, raffinose,
(228) Materials and Methods
(229) Buckwheat plants (cv. Mancan) were grown in the greenhouse at 24 C. day (14 hours) and 18 C. night (10 hours). Natural sunlight was supplemented 14 hours daily with 740 mol m.sup.2 s.sup.1 light from 1000 W Sylvania metal halide lamps. After opening first flowers, plants were separated into pin and thrum types and placed in separate growth chambers at 18 C. All plants received 14 hours of fluorescent light daily at about 300 mol m.sup.2 s.sup.1. After 7 to 10 days, plants were hand pollinated by legitimate cross-pollination, pinthrum and thrumpin. Eight days after pollination the temperature in three growth chambers was changed from 18 C. to 15 C., 22 C., and 30 C., respectively. Seeds were harvested at 8, 12, 16, 20, and 28 days after pollination (DAP) and analyzed for soluble carbohydrates. After the last harvest (28 DAP) seeds were placed in a desiccator over saturated LiCl solution (RH=12%), and dried for 14 days before analysis. Weight of each groat was measured. After drying over LiCl, seeds (four replications of 10 groats each) were germinated on wet germination papers at 25 C. in darkness. After 2, 4, and 6 days the germination rate (in %) was measured, as well as hypocotyl length.
(230) Carbohydrates in buckwheat embryo were analyzed by high resolution gas chromatography as previously described (Horbowicz et al., Seed Sci. Res. 4:385-405 (1994); Horbowicz et al., Planta 205:1-11 (1998), which are incorporated herein by reference in their entirety). Carbohydrate standards (sucrose, myo-inositol, fructose, glucose, raffinose and stachyose), internal standard (phenyl -
(231) Results
(232) Buckwheat embryos accumulated maximum fresh weight by 20 days after pollination (DAP) when matured at 15 C., by 16 DAP when matured at 22 C., and by 12 DAP when matured at 30 C. (Table 16).
(233) TABLE-US-00024 TABLE 16 Dry weight (DW) and fresh weight (FW) of buckwheat embryos (mg/embryo) from seeds matured at 15, 22, or 30 C. as a function of days after pollination (DAP). Maturation at 15 C. Maturation at 22 C. Maturation at 30 C. DAP FW (mg) DW (mg) FW (mg) DW (mg) FW (mg) DW (mg) 8 0.99 0.08 0.24 0.12 0.99 0.08 0.24 0.07 0.99 0.08 0.24 0.07 12 3.00 0.71 0.70 0.27 6.77 1.41 1.47 0.14 11.17 0.95 4.43 0.43 16 11.50 1.25 4.23 1.07 14.13 3.06 5.77 1.62 10.57 0.20 5.17 0.23 20 17.37 0.64 8.67 0.32 13.43 0.67 6.97 0.61 9.90 0.52 7.63 0.26 28 14.43 1.07 8.03 0.26 8.60 0.38 6.37 0.13 6.67 0.87 6.83 0.65 28 DAP + 7.80 0.72 7.07 0.64 7.40 0.98 6.50 0.86 9.73 0.59 6.93 0.54 2 wk 12% RH Values are mean SE for three replicate samples.
Highest daily increase in fresh weight occurred between 12 and 16 DAP when matured at 15 and 22 C. and between 8 and 12 DAP when matured at 30 C.
(234) Independently of maturation temperature, the dry weight of embryos reached maximal values after 20 DAP, but fastest daily increase of DW occurred between 8 and 12 DAP at 30 C., between 12 and 16 DAP at 22 C., and at 15 C. between 16 and 20 DAP (Table 16). Although differences in the rates of dry matter accumulation occurred between all temperatures, the final dry weight of embryos matured at 15, 22 and 30 C. was similar. The slight decrease of dry weight in embryos matured at 15 C. noted after 2 weeks of drying over LiCl solution probably was the effect of difficulty in removing all remnants of cotyledons surrounded by endosperm tissue. Equal accumulation of embryo dry weight was also noted in our previous experiments, where seeds were matured in 18 and 25 C. (Horbowicz et al., Planta 205:1-11 (1998), which is hereby incorporated by reference).
(235) Mean dry weight of groats gradually declined when maturation temperature increased. Mean dry weight of buckwheat groats matured at 15 C. was 48.171.75 mg, at 22 C.-41.271.48 mg, and at 30 C.-35.201.31 mg. Data presented here are the groat mean (SE) dry weights from 50 seeds. Calculated average decline of buckwheat groat weight with increasing temperature was 0.86 mg/1 C.
(236) Maturation temperature had no effect on the total amount of soluble carbohydrates in buckwheat embryos (Table 17).
(237) TABLE-US-00025 TABLE 17 Soluble carbohydrates (g/embryo) in buckwheat embryos from seeds matured at 15, 22, or 30 C. All seed harvested at 28 days after pollination (DAP) and dried 2 weeks at 12% RH. Values are mean SE for three replicate samples. Sol. Maturation at Maturation at Maturation at carbohydrate 15 C. 22 C. 30 C. D-chiro-Inositol 9.76 2.86 6.81 1.07 3.49 0.66 Fagopyritol A1 45.59 5.24 34.15 10.02 21.78 1.55 Fagopyritol B1 256.00 38.30 219.15 24.20 159.60 7.70 Fagopyritol A2 3.66 0.84 11.12 3.04 15.52 0.68 Fagopyritol B2 2.47 0.74 12.98 3.59 19.70 1.74 Sub total 317.50 48.00 284.60 42.00 220.10 12.30 myo-Inositol 2.91 0.54 5.03 0.74 3.25 0.64 Galactinol 0 1.57 0.79 1.60 0.04 Digalactosyl 0.25 0.25 0.55 0.55 1.69 0.73 myo-inositol Sub total 3.16 0.79 7.15 2.08 6.54 1.41 Sucrose 225.00 14.90 250.20 22.70 376.40 59.20 Total soluble 545.70 63.70 542.00 66.80 603.00 72.90 carbohydrates
(238) Reducing sugars, fructose and glucose were present only in early stages of embryo development (8 and 12 DAP). Sucrose slightly decreased between 8 and 12 DAP, probably due to temperature and pollination shocks, and then during next 4 days increased dramatically reached maximal values 16 DAP (
(239) Monogalactosides of
(240) An opposite situation occurred in the case of
(241) TABLE-US-00026 TABLE 18 Minor soluble carbohydrates (g/embryo) in buckwheat embryos from seeds matured at 15, 22, or 30 C. as a function of days after pollination (DAP). Values are mean SE for three replicate samples. Soluble Maturation 28 DAP + 2 wk Carbohydrate temperature 16 DAP 20 DAP 28 DAP 12% RH Digalactosyl 15 C. 0 0 0 0.25 0.25 myo-inositol 22 C. 0 1.38 0.84 1.12 0.18 0.55 0.55 30 C. 1.02 1.02 3.54 2.51 2.21 0.32 1.69 0.73 Fagopyritol A3 15 C. 0 0 0 0 22 C. 0 0 30 C. 9.80 5.47 4.41 4.41 Raffinose 15 C. 0 0 0 0 22 C. 0 0.78 0.45 30 C. 0.70 0.12 1.21 0.95 Stachyose 15 C. 0 0 0 0 22 C. 0 3.04 3.04 30 C. 2.71 2.71 5.07 2.53
(242) During later stages of buckwheat embryo development (after 20 DAP and 28 DAP) at 22 and 30 C., small amounts of raffinose and stachyose were found (Table 18). In embryos matured in 30 C., fagopyritol A3 (a trigalactoside of
(243) The germination rate of seeds matured in low temperatures (15 or 22 C.) was lower than for seeds matured at 30 C. (
(244) Growth of hypocotyls in germinating buckwheat seeds was faster in seeds matured at 15 and 22 C., than for seeds matured at 30 C. (
(245) Discussion
(246) The response of plants to stress involves complex physiological and biochemical responses. Conditions during seed development and maturation can have an impact on subsequent seed quality. Soil moisture and temperature stress in that time has been suggested to have an influence on seed and seedling vigor. Factors during seed maturation such as environmental conditions also have an impact on seed viability (Baskin et al., Seeds: Ecology, Biogeography, and Evolution of Dormancy and Germination, Academic Press, New York, pp. 41-43 (1998), which is hereby incorporated by reference in its entirety). High temperatures during growth can increase biochemical reactions in plants, but it might not always be transferred to higher productivity because of heat stress constraints such as limited water supply, increase in leaf temperature, increased respiration, decline of the synthesis and/or activity of photosynthetic enzymes. In buckwheat groats matured in high temperatures (22 or 30 C.), reduced mean weight was noted, than when produced in low temperature (15 C.). Although high temperature maturation (30 C.) can change physiological reactions the buckwheat embryos obtained in such conditions have similar dry weight to those from matured in lower temperatures (15 or 22 C.). Dry weight of whole seed was lower, mainly due to decrease of endosperm deposition (Horbowicz et al., Planta 205:1-11 (1998), which is hereby incorporated by reference in its entirety). Additionally, plants growing at 25 C. produced only half as many seeds as plants at 18 C. (Slawinska et al., Seed Sci. Res. 11:223-233 (2001), which is hereby incorporated by reference in its entirety). All mentioned facts can have huge impact on buckwheat seed yield. Probably, the difference in temperature during buckwheat flowering and seed filling is the main factor influencing the large variability in seed set and seed yield among years (Slawinska et al., Seed Sci. Res. 11:223-233 (2001); Taylor et al., Crop Sci. 41:1792-1799 (2001), which is hereby incorporated by reference in its entirety).
(247) During high temperature stressed plants make a special proteins called heat shock proteins (HSPs). Among the different HSPs produced by plants, the small (sm) HSPs appear to be particularly important because of their abundance. In addition, smHSPs are expressed during specific stages of plant development including seed maturation, indicating they also function in the absence of stress to protect components essential for seed development (Schoffl et al., Plant Physiol. 117:1135-1141 (1998), which is hereby incorporated by reference in its entirety). HSPs showing a reversible interaction with other proteins and preventing either complete denaturation or supporting proper folding of enzymes under or after protein denaturing conditions. Some HSP-like proteins are involved in the processes of targeting other proteins to organelles or to their suborganellar localization and a number of HSPs are expressed in the absence of external stressors, during embryogenesis and seed maturation in many plant species (Schoffl et al., Acta Physiol. Plantarum 19:549-556 (1997), which is hereby incorporated by reference in its entirety).
(248) It is possible that HSPs might have an influence on biosynthesis of carbohydrates during maturation of buckwheat embryos. In buckwheat embryos matured in higher temperatures biosynthesis of fagopyritols B1 and its positional isomer fagopyritol A1 was partly inhibited (Horbowicz et al., Planta 205:1-11 (1998), which is hereby incorporated by reference in its entirety). In present studies total amounts of both fagopyritols in embryos matured at 15 C. is about twice as high as those matured at 30 C. However, sucrose level is much higher in buckwheat embryos matured at high temperatures. This observation differs from soybean embryos, where maturation at 25 C. enhanced the amount of fagopyritol B1 when compared to embryos matured at 18 C. (Obendorf et al., Crop Sci. 38:78-84 (1998), which is hereby incorporated by reference in its entirety).
(249)
(250) High temperature during buckwheat seed maturation enhanced the biosynthesis of di--galactosides of
(251) Surprisingly, germination was higher in case of buckwheat seeds matured at 30 C. than for those matured at 15 or 22 C. Lowest germination rate was found in seeds matured at 22 C. Possibly during maturation of buckwheat seeds at 22 C. germination inhibitors are biosynthesized in higher concentration and they affect the proteolytic enzymes during germination (Belozersky et al., J. Plant Physiol. 46(3):330-339 (1999), which is hereby incorporated by reference in its entirety). Seeds matured at 15 C. have delayed maturation, and therefore inhibitors are probably absent or in low, insufficient quantities. At 30 C. seeds mature very fast and it is quite possible that these seeds have lower levels of germination inhibitors, due to the shorter time of maturation.
Example 7Buckwheat Explant Feeding Experiments
(252) Buckwheat explants, consisting of a stem segment with attached leaf and terminal floral cluster, were patterned after the soybean explants described in Example 4. This example uses the buckwheat explant system to study the transport of cyclitols, fed through the stem, to the developing buckwheat seed and their incorporation into fagopyritols.
(253) TABLE-US-00027 TABLE 19 Soluble carbohydrates (g/embryo) in embryos of seeds from buckwheat explants fed 100 mM D-chiro-inositol in 1% sucrose solution - feeding 5 days before slow drying (micrograms/embryo) After After 2 days 4 days 7 days Soluble 1 day 5 days slow slow slow Carbohydrate feeding feeding drying drying drying D-Pinitol 0 0 0 0 0 0 0 0 0 0 D-chiro-Inositol 2.28 93.10 1.32 2.20 56.97 14.89 87.78 25.03 44.55 41.29 122.37 138.86 55.10 myo-Inositol 1.63 2.03 1.84 3.29 2.20 1.71 4.59 1.88 2.64 1.20 2.74 2.19 1.10 Sucrose 66.64 268.14 124.83 202.99 162.68 232.10 90.04 185.14 147.00 121.44 202.20 118.11 121.99 Galactopinitol A 0 0 0 0 0 0 0 0 0 0 0 0 0 Galactopinitol B 0 0 0 0 0 0 0 0 0 0 0 0 0 Fagopyritol A1 0 10.71 25.53 27.38 41.11 0 133.47 117.32 42.86 21.71 69.49 52.16 27.96 Fagopyritol B1 0 33.64 127.23 125.16 298.43 0 623.00 635.89 388.66 190.64 322.50 270.67 208.33 Galactinol 0 3.15 9.84 6.82 7.21 0 3.75 3.63 3.90 1.71 2.62 2.70 0 Fagopyritol A2 0 0 6.43 4.19 2.57 0 10.11 4.91 2.04 1.19 1.93 4.42 1.33 Fagopyritol B2 0 0 5.51 3.95 2.28 0 5.48 3.45 2.83 0.91 1.72 1.57 1.99 Digalactosyl 0 0 0 0 0 myo-inositol 0 0 0 0 0 0 0 0
(254) TABLE-US-00028 TABLE 20 Soluble carbohydrates (g/embryo) in embryos of seeds from buckwheat explants fed 100 mM D-pinitol in 1% sucrose solution - feeding 5 days before slow drying (micrograms/embryo) After After 2 days 4 days 7 days Soluble 1 day 5 days slow slow slow Carbohydrate feeding feeding drying drying drying D-Pinitol 35.53 204.10 230.83 134.07 148.04 263.02 163.47 162.97 85.34 328.27 56.90 173.51 129.52 D-chiro-Inositol 4.50 1.32 1.51 2.19 1.97 28.25 0.70 4.78 1.01 9.41 0.94 1.11 7.71 myo-Inositol 1.00 1.38 6.63 5.34 2.78 4.60 3.07 4.92 3.38 3.43 1.37 4.81 3.33 Sucrose 212.67 89.73 106.43 87.98 84.50 86.41 167.61 229.72 122.05 147.85 84.96 104.05 177.42 Galactopinitol A 0 0 0 3.39 6.41 6.18 12.91 0 9.09 5.84 6.68 0 0 Galactopinitol B 0 1.61 4.39 5.88 0 1.10 0 0 1.81 1.90 0 0 0 Fagopyritol A1 0 0 2.38 16.78 10.82 21.43 29.81 39.10 12.44 22.91 23.96 15.80 20.01 Fagopyritol B1 1.44 0.98 7.29 116.5 64.64 90.76 165.96 165.56 77.20 75.14 111.41 77.90 119.44 Galactinol 2.51 0 10.69 2.68 0 3.26 7.75 4.14 1.24 3.40 2.79 3.31 0 Fagopyritol A2 0 0 0 6.18 1.30 0 9.52 6.64 0.71 4.65 6.89 4.73 2.21 Fagopyritol B2 0 0 0 5.70 1.60 0 6.69 4.29 0.48 4.98 4.46 2.47 Digalactosyl 0 0 0 0 0 myo-inositol 0 0 1.05 0 0 0 0 0
(255) TABLE-US-00029 TABLE 21 Soluble carbohydrates (g/embryo) in embryos of seeds from buckwheat explants fed 100 mM myo-inositol in 1% sucrose solution - feeding 5 days before slow drying (micrograms/embryo) After After 2 days 4 days 7 days Soluble 1 day 5 days slow slow slow Carbohydrate feeding feeding drying drying drying D-Pinitol 0 0 0 tr tr tr 0 tr tr D-chiro-inositol 6.45 15.19 6.42 3.54 14.01 126.48 1.07 6.67 9.90 myo-Inositol 4.56 4.93 1.67 3.66 2.37 4.72 0 2.27 2.11 Sucrose 306.16 225.64 313.35 180.43 163.04 74.48 66.92 161.20 121.70 Galactopinitol A 0 0 0 0 0 0 0 0 0 Galactopinitol B 0 0 0 0 0 0 0 0 0 Fagopyritol A1 0 18.90 62.19 19.72 14.49 10.94 29.81 41.42 34.61 Fagopyritol B1 0 95.33 300.84 111.78 79.17 44.47 129.87 183.36 188.73 Galactinol 0 19.19 10.36 8.41 2.09 3.71 3.46 4.79 0 Fagopyritol A2 0 2.60 38.72 11.49 2.54 0 10.89 4.52 2.64 Fagopyritol B2 0 1.62 35.81 13.37 3.53 0 3.22 3.31 2.57 Digalactosyl 0 0.85 6.63 2.13 0.35 myo-inositol 0 8.61 0 0
(256) TABLE-US-00030 TABLE 22 Soluble carbohydrates (g/embryo) in embryos of seeds from buckwheat explants fed 1% sucrose (without cyclitols) solution - feeding 5 days before slow drying (micrograms/embryo) After After 2 days 4 days 7 days Soluble 1 day 5 days slow slow slow Carbohydrate feeding feeding drying drying drying D-Pinitol 0 0 0 0 tr tr 0 tr tr D-chiro-Inositol 3.22 5.57 1.94 14.09 24.47 8.02 2.09 5.09 26.74 myo-Inositol 1.50 3.63 6.44 2.46 17.80 2.71 2.94 4.07 2.30 Sucrose 211.90 111.20 189.33 177.61 524.20 141.36 105.55 246.49 151.69 Galactopinitol A 0 0 0 0 tr 0 0 0 tr Galactopinitol B 0 0 0 0 tr 0 0 0 0 Fagopyritol Al 0.70 12.27 16.02 23.01 27.67 51.20 14.64 15.97 76.65 Fagopyritol B1 0.87 55.08 89.92 138.32 151.69 237.27 72.98 111.37 476.65 Galactinol 1.47 15.87 26.38 0 19.03 10.02 8.45 5.93 5.03 Fagopyritol A2 0 0.58 10.60 7.35 8.12 12.29 6.87 6.34 8.09 Fagopyritol B2 0 0.66 11.05 7.65 6.72 10.83 5.72 6.34 4.39 Digalactosyl 0 0. 2.98 0.82 myo-inositol 3.02 0.60 0.74 1.48 0
(257) TABLE-US-00031 TABLE 23 Soluble carbohydrates (g/10 mg leaf disk) in leaves from buckwheat explants fed 100 mM D-chiro-inositol in 1% sucrose solution - leaf composition, micrograms in 10 mg disc Soluble After 1 hour After 24 hours After 72 hours Carbohydrate feeding feeding feeding Fructose 2.05 19.96 115.25 Glucose 3.90 16.53 77.78 D-Pinitol 0 0 0 D-chiro-inositol 2.06 21.16 72.91 myo-Inositol 3.76 1.88 3.91 Sucrose 16.50 15.13 16.15
(258) TABLE-US-00032 TABLE 24 Soluble carbohydrates (g/10 mg leaf disk) in leaves from buckwheat explants fed 100 mM D-pinitol in 1% sucrose solution - leaf composition, micrograms in 10 mg disc Soluble After 1 hour After 24 hours After 72 hours Carbohydrate feeding feeding feeding Fructose 53.82 60.78 42.84 Glucose 35.78 48.92 35.53 D-Pinitol 2.45 121.45 64.73 D-chiro-Inositol 3.42 4.82 3.71 myo-Inositol 4.46 3.05 4.23 Sucrose 84.83 2.18 9.04
(259) TABLE-US-00033 TABLE 25 Soluble carbohydrates (g/10 mg leaf disk) in leaves from buckwheat explants fed 1% sucrose (without cyclitols) solution - leaf composition, micrograms in 10 mg disc Soluble After 1 hour After 24 hours After 72 hours Carbohydrate feeding feeding feeding Fructose 4.05 20.25 23.35 Glucose 4.63 10.35 8.01 D-Pinitol 0 0 0 D-chiro-Inositol 3.51 3.81 6.26 myo-Inositol 4.21 5.58 8.45 Sucrose 39.23 14.29 17.40
(260) Based on the above data it was determined that feeding
Example 8Biosynthesis of an Insulin Mediator
(261) Growth of Recombinant E. coli and Isolation of Recombinant Proteins
(262) cDNAs corresponding to the FeGolS-1, FeGolS-2, and GmGolS genes were inserted into pET-14B expression vectors. The vector also contained a gene for ampicillin resistance and a sequence that codes for six histidines on the N-terminal end of the expressed protein. The vectors containing the gene inserts were used to transform E. coli strain BL21, containing the bacteriophage lysogen DE3. The bacteria were then streaked on ampicillin-containing plates and incubated overnight (8-12 hours) at 37 C. One colony from each plate was then transferred to 2 mL of Luria Broth (LB) containing 0.05 mM ampicillin in 10 mL screw-capped Pyrex tubes. The tubes were then placed in an incubator at 37 C. with shaking at 175 rpm overnight (8-12 hours). One mL of the starter cultures was then transferred to 250 mL of the LB-Amp solution and grown under the same conditions for three hours. After three hours, IPTG was added to induce expression of the genes in the pET-14B vector. The bacteria were then grown for another three hours and harvested via centrifugation at 6,000 rpm. Bacteria from 500 mL of LB-Amp were lysed using 5 mL of BugBuster solution. Nucleic acids and non-soluble cellular matter were removed from the crude extract by centrifugation and filtration and the soluble extract was then loaded onto a Ni.sup.2+-NTA column. The target proteins with the N-terminal histidine tag bound to the column while all other soluble proteins were washed away. These enzymes were eluted from the column by the addition of imidazole containing extraction buffer. The protein solution was dialyzed against 5 mM Mn.sup.2+ solution and then used for enzyme assays.
(263) Enzyme Assays
(264) Assays were completed under varying conditions to begin to characterize the purified galactinol synthase enzymes. Assays were first designed to determine if the enzymes could synthesize galactinol and fagopyritols (A). The optimal concentration of Mn.sup.2+ for enzyme action was then determined (B). The enzymes were next used in assays to determine their substrate specificity (C). Finally, assays were completed to determine the reaction kinetics of the enzymes (D). (A) Initial Assays of purified recombinant FeGolS-1, FeGolS-2, and GmGolS enzymes:
(265) It was first determined that the purified recombinant FeGolS-1, FeGolS-2, and GmGolS enzymes could synthesize fagopyritols and galactinol. To determine galactinol synthase activity, assays were completed using myo-inositol as the galactosyl acceptor and UDP-galactose as the galactosyl donor. Approximately 1-2 g of each enzyme was added to a 50 L solution containing 20 mM myo-inositol, 20 mM UDP-galactose, 50 mM HEPES, pH 7.0, 2 mM DTT, and 3 mM Mn.sup.2+ (MnCl.sub.2) at 30 C. The reactions were stopped after 3 hours with the addition of 50 L of 100% EtOH. To determine fagopyritol synthase activity, the same reaction conditions were used, except
(266) (B) Optimal Concentration of Mn.sup.2+:
(267) To determine the concentration of Mn.sup.2+ in which the enzymes had the greatest activity, multiple assays were completed varying the amount of Mn.sup.2+. Earlier studies of galactinol synthase enzymes from other plants reported optimal Mn.sup.2+ concentrations ranging from 1 mM to 15 mM. Two different sets of assays were completed, one using myo-inositol as the galactosyl acceptor, and the other using
(268) (C) Substrate Specificity Assays:
(269) The substrate specificity of the three galactinol synthase enzymes was characterized through assays varying the galactosyl acceptor. myo-inositol,
(270) (D) Reaction Kinetics:
(271) The assays to determine the K.sub.m and V.sub.max of the enzymes in the synthesis of galactinol from myo-inositol and UDP-galactose were set up as follows:
(272) Reaction A: 5 mM myo-inositol 20 mM UDP-Galactose 1 mM DTT 50 mM Hepes, pH 7.0 5 mM MnCl.sub.2
(273) Reaction B: 10 mM myo-inositol 20 mM UDP-Galactose 1 mM DTT 50 mM Hepes, pH 7.0 5 mM MnCl.sub.2
(274) Reaction C: 15 mM myo-inositol 20 mM UDP-Galactose 1 mM DTT 50 mM Hepes, pH 7.0 5 mM MnCl.sub.2
(275) Reaction D: 20 mM myo-inositol 20 mM UDP-Galactose 1 mM DTT 50 mM Hepes, pH 7.0 5 mM MnCl.sub.2
(276) Reaction E: 25 mM myo-inositol 20 mM UDP-Galactose 1 mM DTT 50 mM Hepes, pH 7.0 5 mM MnCl.sub.2
(277) The assays to determine the K.sub.m and V.sub.max of the enzymes in the synthesis of fagopyritol A1 and fagopyritol B1 from
(278) Reaction A: 5 mM
(279) Reaction B: 10 mM
(280) Reaction C: 15 mM
(281) Reaction D: 20 mM
(282) Reaction E: 25 mM
(283) To each reaction, 4-5 g of enzyme were added. Each reaction was run for 0, 3, 6, 9, and 12 minutes at 30 C. The reactions were stopped with the addition of 50 L of 100% EtOH and 25 L of internal standard. The reactions were then filtered through Nanosep tubes and 100 L of each reaction added to silyation vials. Samples were dried under nitrogen and stored over P.sub.2O.sub.5 overnight. Dry residues were derivatized with 100 IL of trimethylsilylsylimadazole:pyridine (1:1, v/v) at 80 C. for 45 minutes, and 1 L was injected for GC analysis of products as previously described (Horbowicz et al., Planta 205:1-11 (1998), which is hereby incorporated by reference in its entirety) using an HP1-MS capillary column.
(284) All five reactions were plotted on a product concentration vs. time plot. The concentration of the enzyme had to be small enough so that the reaction was still linear after six minutes. The V.sub.o for each reaction was determined by finding the slope of this linear portion of the curve (i.e. if its linear, use the zero point and the concentration of product after three minutes to calculate the slope of that portion of the reaction). Once this was completed, V.sub.o (Rate) versus myo-inositol concentration was plotted. Finally, a Lineweaver-Burke Plot was made by plotting 1/V.sub.o vs. 1/[substrate]. If the line was linear, then its slope was the K.sub.m/V.sub.max. The y-intercept was 1/V.sub.max, the x-intercept was 1/K.sub.m.
(285) All samples from the assays were analyzed by gas chromatography. All were prepared for analysis in the same way. After addition of 50 L of 100% EtOH, 25 of Internal Standard (25 g of phenyl -
(286) Synthesis of the Putative Insulin Mediator
(287) In order to synthesize the putative insulin mediator, it is necessary to first synthesize UDP-galactosamine. Work was completed developing a protocol for the synthesis of the compound and its purification for use in further assays. UDP-galactosamine was synthesized from galactosamine-1-phosphate (from Sigma). The synthesis was done using the procedure outlined in Heidlas et al., J. Org. Chem. 57:152-157 (1992), which is hereby incorporated by reference in its entirety. The procedure uses an uridyltransferase (EC 2.7.7.9) to transfer a UDP moiety from UDP-glucose to galactosamine-1-phosphate to make UDP-galactosamine on a gram scale (
(288)
(289) Discussion
(290) A protocol has been developed that resulted in purification of the target enzymes from the bacterial preparation without loss of activity. Dialysis was used to remove the enzymes from the extraction buffer and into a solution of Mn.sup.2+ ions. This change retained enzyme activity throughout the purification procedure. Also, adjusting bacterial growth times and preparation methods further maximized the expression system.
(291) Manganese concentration assays were used to determine that optimal enzyme action occurred in 5 mM Mn.sup.2+ solution. Results from the substrate specificity assays helped to identify the inositols the enzymes could use as galactosyl acceptors. myo-inositol,
(292) Reactions to synthesize UDP-galactosamine and purification of the compound have been completed (
(293) Although the invention has been described in detail for the purpose of illustration, it is understood that such detail is solely for that purpose, and variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims.