SEQUESTRATION OF CARBON DIOXIDE WITH HYDROGEN TO USEFUL PRODUCTS

20170226542 ยท 2017-08-10

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided herein are genetically engineered microbes that include at least a portion of a carbon fixation pathway, and in one embodiment, use molecular hydrogen to drive carbon dioxide fixation. In one embodiment, the genetically engineered microbe is modified to convert acetyl CoA, molecular hydrogen, and carbon dioxide to 3-hydroxypropionate, 4-hydroxybutyrate, acetyl CoA, or the combination thereof at levels greater than a control microbe. Other products may also be produced. Also provided herein are cell free compositions that convert acetyl CoA, molecular hydrogen, and carbon dioxide to 3-hydroxypropionate, 4-hydroxybutyrate, acetyl CoA, or the combination thereof. Also provided herein are methods of using the genetically engineered microbes and the cell free compositions.

    Claims

    1-2. (canceled)

    3. A genetically engineered microbe modified to convert acetyl CoA, molecular hydrogen and carbon dioxide to 4-hydroxybutyrate, wherein the 4-hydroxybutyrate is produced at increased levels compared to a control microbe, wherein the microbe is a hyperthermophile, and wherein the microbe comprises an exogenous coding region encoding a polypeptide, wherein the polypeptide has an activity selected from 3-hydroxypropionate:CoA ligase activity, 3-hydroxypropionyl-CoA dehydratase activity, acryloyl-CoA reductase activity, methylmalonyl-CoA epimerase activity, methylmalonyl-CoA mutase activity, and succinate semialdehyde reductase activity.

    4-6. (canceled)

    7. The genetically engineered microbe of claim 3 wherein the hyperthermophile is an archeon.

    8. The genetically engineered microbe of claim 7 wherein the archeon is a member of the Order Thermococcales, a member of the Order Sulfolobales, or a member of the Order Thermotogales.

    9. The genetically engineered microbe of claim 8 wherein the archeon is Thermococcus kodakarensis, T. onnurineus, Sulfolobus solfataricus, S. islandicus, S. acidocaldarius, or Pyrococcus furiosus.

    10. (canceled)

    11. The genetically engineered microbe of claim 3 wherein the microbe comprises an exogenous coding region encoding a polypeptide, wherein the polypeptide has an activity selected from acetyl/propionyl-CoA carboxylase activity, malonyl/succinyl-CoA reductase activity, and malonate semialdehyde reductase activity.

    12-14. (canceled)

    15. The genetically engineered microbe of claim 3 wherein the microbe produces 4-hydroxybutyrate, and wherein the microbe comprises an exogenous coding region encoding a polypeptide, wherein the polypeptide has an activity selected from 4-hydroxybutyrate:CoA ligase activity, 4-hydroxybutyrl-CoA dehydratase activity, crotonyl-CoA hydratase/(S)-3-hydroxybutyrl-CoA dehydrogenase activity, and acetoacetyl-CoA -ketothiolase activity.

    16. (canceled)

    17. The genetically engineered microbe of claim 3 wherein an exogenous coding region is operably linked to a temperature sensitive promoter, to a constitutive promoter, or to a non-regulated promoter.

    18. The genetically engineered microbe of claim 3 wherein the microbe further comprises a hydrogenase.

    19. The genetically engineered microbe of claim 18 wherein the hydrogenase is a NADPH-dependent hydrogenase.

    20. The genetically engineered microbe of claim 19 wherein the microbe comprises exogenous coding regions encoding subunits of the NADPH-dependent hydrogenase.

    21. The genetically engineered microbe of claim 20 wherein the subunits of the NADPH-dependent hydrogenase comprise a hydrogenase alpha subunit and a hydrogenase delta subunit.

    22. The genetically engineered microbe of claim 21 wherein the subunits of the NADPH-dependent hydrogenase further comprise a hydrogenase beta subunit and a hydrogenase gamma subunit.

    23-24. (canceled)

    25. A method comprising incubating the genetically engineered microbe of claim 3 under anaerobic conditions suitable for converting acetyl CoA, molecular hydrogen, and carbon dioxide to 4-hydroxybutyrate.

    26. The method of claim 25 further comprising recovering the 4-hydroxybutyrate.

    27-29. (canceled)

    30. The method of claim 25 wherein the incubating comprises an incubation temperature of at least 75 C.

    31-33. (canceled)

    34. A cell free composition that converts acetyl CoA, molecular hydrogen and carbon dioxide to 4-hydroxybutyrate, wherein the composition comprises a polypeptide having 3-hydroxypropionate:CoA ligase activity, a polypeptide having 3-hydroxypropionyl-CoA dehydratase activity, a polypeptide having acryloyl-CoA reductase activity, a polypeptide having methylmalonyl-CoA epimerase activity, a polypeptide having methylmalonyl-CoA mutase activity, and a polypeptide having succinate semialdehyde reductase activity.

    35. A cell free method for fixing CO.sub.2 comprising incubating the cell free composition of claim 34 under anaerobic conditions suitable for the fixation of CO.sub.2 by the conversion of acetyl CoA, molecular hydrogen and carbon dioxide to 4-hydroxybutyrate.

    36. The cell free method of claim 35 further comprising isolating the 4-hydroxybutyrate.

    37-40. (canceled)

    41. The cell free composition of claim 34 wherein the cell free composition further comprises a polypeptide comprising acetyl/propionyl-CoA carboxylase activity, a polypeptide comprising malonyl/succinyl-CoA reductase activity, a polypeptide comprising malonate semialdehyde reductase activity, and a polypeptide comprising NADPH-dependent hydrogenase activity.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0040] FIG. 1. Enzymes and substrates reactions of the 3HP/4HB cycle in M. sedula. E1, , , acetyl/propionyl-CoA carboxylase; E2, malonyl/succinyl-CoA reductase; E3, malonate semialdehyde reductase; E4, 3-hydroxypropionate:CoA ligase; E5, 3-hydroxypropionyl-CoA dehydratase; E6, acryloyl-CoA reductase; E7, methylmalonyl-CoA epimerase; E8, methylmalonyl-CoA mutase; E9, succinate semialdehyde reductase; E10, 4-hydroxybutyrate-CoA ligase; E11, 4-hydroxybutyryl-CoA dehydratase; E12, crotonyl-CoA hydratase/(S)-3hydroxybutyryl-CoA dehydrogenase; E13, acetoacetyl-CoA -ketothiolase.

    [0041] FIG. 2. Bioreactor schematic for gas intensive fermentation of M. sedula. Tandem 2 L bioreactors, started at the same time with the same seed inoculum, were used to grow M. sedula inside of a chemical fume hood. A solenoid valve on the H.sub.2/CO.sub.2 tank provided passive fail-safe operation by cutting off the flow of flammable gas in the event of food failure. Gas compositions for the three different conditions shown bottom right.

    [0042] FIG. 3. 4-Hydroxybutryate-CoA synthetase candidates in M. sedula. Normalized transcription levels for M. sedula genes annotated as small organic acid or fatty-acid ligases and synthetases. High transcription levels are shown in red, low transcription in green, corresponding numbers represent least-squares means of normalized log 2-transformed transcription levels relative to the overall average transcription level of 0 (black). Conditions shown: (2010)Heterotrophic, Autotrophic, Mixotrophic; (2012)Autotrophic Carbon Limited (ACL), Autotrophic Carbon Rich (ACR), Heterotrophic (HTR). Least-squares mean values are shown here for ACL condition for these genes, along with the fold change of genes under ACL relative to HTR and their statistical significance. All other microarray data can be found in the GEO depositGSE39944.

    [0043] FIG. 4A-C. Specific activity of acyl-CoA ligases in the M. sedula carbon fixation pathway on various substrates. Specific activities of the new candidates for 4-hydroxybutyrate-CoA ligase on a variety of substrates compared to reported data for Msed_1456, a 3-hydroxypropionate-CoA ligase: Msed_0394 (A), Msed_0406 (B), and Msed_1456 (C). Msed_1456 showed >1% activity on 3-hydroxybutyrate, but was not tested on 4-hydroxybutyrate. Substrate abbreviations: ACEacetate; PROpropionate; 3HP3-hydroxypropionate; 4HB4-hydroxybutyrate; BUTbutyrate; VALvalerate.

    [0044] FIGS. 5A-B. Specific activity of native Msed_1353 and Msed_1353-W424G mutant on various substrates. Comparison of activity of Msed_1353 FIG. 5A and Msed_1353-G424 FIG. 5B on a variety of short-chain linear organic acids. Substrate abbreviations: ACEacetate; PROpropionate; 3HP3-hydroxypropionate; 4HB4-hydroxybutyrate; BUTbutyrate; VALvalerate; HEXhexanoate; OCToctanoate.

    [0045] FIG. 6. Reaction rate profile for acyl-CoA ligases. Michaelis-Menten reaction rate curves shown with experimental data for Msed_0394 (squares), Msed_0406 (circles), and Msed_1353-G424 (triangles) over a range of substrate concentrations.

    [0046] FIGS. 7A-B. S. enterica acetyl-CoA synthetase (Acs) and Msed_0394 active site comparison. Acs shown in gold (residue W414), Msed_0394 in cyan (residues W233, L307, V331, and P340). Ligand from Acs structure (adenosine-5-propyl phosphate) is labeled Acs. FIG. 7A shows a side view of binding pocket with inter-atomic distances given from phosphorus atom of propyl-phosphate moiety to select atom from amino acid residues. FIG. 7B shows an axial view from bottom of substrate binding pocket.

    [0047] FIG. 8. Sequence alignment of S. enterica acetyl-CoA synthetase (STM4275) and M. sedula acyl-CoA ligases. Amino acid sequence alignment of active site residues in putative acyl-CoA ligases reveals a conserved glycine (shown in red) except for Msed_1353, which has a tryptophan indicative of acetate-propionate CoA ligases. Alignment was generated using Chimera by superposition of I-TASSER 3D structural models. Consensus, SEQ ID NO:400; STM4275, SEQ ID NO:401 (IMB Gene ID number 637214968); Msed_0394, SEQ ID NO:19 (IMB Gene ID number 640506300); Msed_0401, SEQ ID NO:20 (IMB Gene ID number 640506307); Msed_0406, SEQ ID NO:21 (IMB Gene ID number 640506312); Msed_1291, SEQ ID NO:22 (IMB Gene ID number 640507181); Msed_1353, SEQ ID NO:23 (IMB Gene ID number 640507242); and Msed_1422, SEQ ID NO:24 (IMB Gene ID number 640507311).

    [0048] FIG. 9. SDS-PAGE gel images of purified recombinant enzymes. All samples were run on 4-12% NuPAGE Bis-Tris Mini Gels (Life Technologies). BenchMark Protein Ladder (Invitrogen) was used for molecular weight reference.

    [0049] FIG. 10. Progress curve for Msed_0406 on 4HB with controls. Example reaction progress curve showing how data were generated for kinetic characterization. Initial reaction rate was taken as the slope of the linear region on the progress curve for a given substrate concentration (5 mM 4HBcircles). Two negative controls are shown: no 4HB (squares) and no ATP (triangles). A series of reaction rates was graphed over substrate concentration and a non-linear fitting was used to calculate Michaelis-Menten parameters.

    [0050] FIGS. 11A-D. FIG. 11A shows the synthetic operon constructed to express the M. sedula genes encoding E1 (), E2 and E3 in P. furiosus under the control of the promoter for the S-layer protein gene (P.sub.slp). This includes P. furiosus ribosomal binding sites (rbs) from highly-expressed genes encoding pyruvate ferredoxin oxidoreductase subunit (por, PF0971), the S-layer protein (slp, PF1399) and cold-induced protein A (cipA, PF0190). FIG. 11B shows the first three enzymes of the M. sedula 3-HP/4-HB cycle produce the key intermediate 3-hydroxypropionate (3-HP). E1 is acetyl/propionyl-CoA carboxylase (, encoded by Msed_0147, Msed_0148, Msed_1375): E2 is malonyl/succinyl-CoA reductase (Msed_0709) and E3 is malonate semialdehyde reductase (Msed_1993). NADPH is generated by P. furiosus soluble hydrogenase I (SH1), which reduces NADP with hydrogen gas. FIG. 11C shows the first three enzymes (E1E3) in context of the complete 3-HP/4-HP cycle for carbon dioxide fixation by Metallosphaera sedula showing the three subpathways SP1, SP2, and SP3. At FIG. 11D the horizontal scheme shows the amount of energy (ATP), reductant (NADPH), oxidant (NAD) and CoASH required to generate one mole of acetyl-CoA from two moles of carbon dioxide.

    [0051] FIGS. 12A-D. Temperature-dependent production of the SP1 pathway enzymes in P. furiosus strain PF506. FIG. 12A shows the growth of triplicate cultures at 98 C. (circles) and temperature (black line) for the temperature shift from 98 to 75 C. are shown. FIG. 12B shows the sepcific activity (moles NADPH oxidized/min/mg) of the coupled activity of E2+E3 in cell-free extracts from cultures grown at 95 C. to a high cell density of 110.sup.8 cells/ml and then incubated for 18 hrs at the indicated temperature. FIG. 12C shows the activities of E1, E2+E3, and E1+E2+E3 after the temperature shift to 75 C. for the indicated time period (see FIG. S4). The activities of a cell-free extract of autotrophically-grown M. sedula cells is also shown (labeled Msed). The specific activities are: E1+E2+E3 coupled assay with acetyl-CoA and bicarbonate, E2+E3 coupled assay with malonyl-CoA, and E2 with succinyl-CoA as substrates. FIG. 12D shows the temperature dependence of the coupled activity of E2+E3 (circles) in the cell-free extracts after induction at 72 C. for 16 hr. The activity of P. furiosus glutamate dehydrogenase in the same cell-free extracts is also shown (squares).

    [0052] FIGS. 13A-C. 3-HP production by P. furiosus. Cells were grown at 95 C. and then incubated at 72 C. for 16 hr to produce the SP1 enzymes. FIG. 13A shows the in vitro 3-HP production from acetyl-CoA performed in triplicate. The sources of the C1 carbon (CO.sub.2 or HCO.sub.3.sup.) and reducing equivalents (NADPH or NADP/H.sub.2) are indicated. Rates are expressed as moles of 3-HP produced/min/mg. FIG. 13B shows the in vivo 3-HP production by whole cells (static) using maltose as the source of acetyl-CoA in the presence of hydrogen gas and bicarbonate using cells grown in a 100 ml sealed bottles without pH control. The P. furiosus strains are MW56 (circles) and COM1 (squares). FIG. 13C shows the in vivo 3-HP production by whole cells (stirred) of MW56 using maltose as the source of acetyl-CoA (circles) and E2+E3 specific activity of the cell-free extracts (diamonds) using cells grown in a 20 L fermenter with pH control (6.8).

    [0053] FIG. 14. Plasmid map of pALM506-1 used to transform P. furiosus strain pdaD to generate strain PF506.

    [0054] FIG. 15. Plasmid map of pGL007 vector targeting the region between PF0574 and PF0575 in the P. furiosus genome.

    [0055] FIG. 16. Plasmid map of pGL010 used to transform P. furiosus COM1 to generate strain MW56.

    [0056] FIG. 17. Growth of P. furiosus strain PF506 at 98 C. and subsequent temperature shift to 75 C. P. furiosus was grown in four 800 mL cultures at 98 C. until the cell density reached 510.sup.8 cells/mL. The temperature (shown as black line) was then shifted to 75 C. and individual bottles were removed and harvested after 0 (diamond), 16 (square), 32 (triangle) and 48 (circle) hrs. The enzyme activities in each cell type are summarized in FIG. 12B.

    [0057] FIG. 18. Stability of E2 and E3 using an E2+E3 coupled assay at 75 C. after incubation at 90 C. for the indicated amount of time in cell-free extracts of P. furiosus strain PF506 (circles) and of the endogenous P. furiosus glutamate dehydrogenase (squares). The specific activity of E2+E3 in PF506 (grown at 72 C.) is about 2-fold higher than that measured in M. sedula. Activity is expressed as percent of maximum activity.

    [0058] FIG. 19. Growth of P. furiosus COM 1, MW56 and PF506 during the temperature shift from 98 C. to 70 C. Cell densities of COM1 (diamonds), MW0056 (squares), and PF506 (triangles) are indicated. The 400 mL cultures were grown at 95 C. for 9 hr and then allowed to cool at room temperature to 70 C. before being placed in a 70 C. incubator.

    [0059] FIG. 20. Enzyme activities of E1 (left bar of each pair) and coupled E2+E3 (right bar of each pair) in cell-free extracts of the indicated P. furiosus strains after incubation at 70 C. for 16 hr, compared to that measured for the cell-extract of autotrophically-grown M. sedula cells (labeled Msed).

    [0060] FIGS. 21A-B. ESI-MS identification of 3-HP produced from acetyl-CoA, CO.sub.2 and H.sub.2 (or NADPH) by cell-free extracts of P. furiosus strains PdaD FIG. 21A) and PF506 FIG. 21B). The MS peak corresponding to the 3HP derivative (m/z 224, circled) was present above background only in the recombinant PF506 strain.

    [0061] FIG. 22. Maltose and pyruvate metabolism by P. furiosus, and the key roles of pyruvate ferredoxin oxidoreductase (POR) in acetyl-CoA production and of the membrane-bound hydrogenase (MBH) in H.sub.2 production.

    [0062] FIG. 23. In vivo production of 3-HP from maltose by whole cells of P. furiosus strain MW56 (left panel) and PF506 (right panel) after 10 min (blue) and 60 min (red) compared to a 1 mM 3-HP standard (black). A black arrow indicates the position of the 3-HP peaks. A total of 135 M and 199 M of 3-HP was produced by cell suspensions of MW56 (510.sup.10 cells/mL) and of PF506 (510.sup.10 cells/mL), respectively, after 60 min at 75 C.

    [0063] FIG. 24. Design of an artificial operon encoding SP1 (E1E3) for expression in P. furiosus.

    [0064] FIG. 25. SP1 expression cassette for cloning into pSPF300 vector. The sequence of the SP1 expression cassette cloned into pSPF300 to make pALM506-1 is disclosed in Kelly et al. (WO 2013/067326).

    [0065] FIG. 26. Construction of pALM506-1 plasmid for transformation of P. furiosus strain pdaD (Kelly et al., WO 2013/067326)).

    [0066] FIG. 27. Transcriptionally inactive zones for foreign gene insertion.

    [0067] FIG. 28. Target genome regions in NCBI reference sequence versus COM1 sequence.

    [0068] FIG. 29. SOE-PCR products for constructing pGL002 and pGL007 targeting genome regions 2 and 3. The nucleotide sequences of these are disclosed in Kelly et al. (WO 2013/067326)

    [0069] FIG. 30. Construction of pGL002 vector targeting genome region 2.

    [0070] FIG. 31. Construction of pGL007 vector targeting genome region 3.

    [0071] FIG. 32. SP2B expression cassette for cloning into pGL002. The sequence of P.sub.slp-E7-E8-E8-E9 expression cassette cloned into the Small site of pGL002 is disclosed in Kelly et al. (WO 2013/067326).

    [0072] FIG. 33. Construction of pGL005 vector for transformation of P. furiosus COM1.

    [0073] FIG. 34. SP1 expression cassette for cloning into pGL007. The sequence of SP1 expression cassette cloned into pGL007 (genome region 3 insertion vector) to make pGL010) is disclosed in Kelly et al. (WO 2013/067326).

    [0074] FIG. 35. Construction of pGL010 vector for transformation of COM1.

    [0075] FIG. 36. NADPH-dependent assays for the E2, E2+E3 and E1+E2+E3 reactions of SP1.

    [0076] FIG. 37. NADPH-dependent assay for E9 of the SP2B subpathway.

    [0077] FIG. 38. Growth of P. furiosus strain MW43 at 95 C. and temperature shift from 65 C. to 90 C. for 18 hrs.

    [0078] FIGS. 39A-C. E9 temperature profile and stability in cell-free extracts of P. furiosus strain MW43. FIG. 39A shows the E9 specific activity in MW43 versus Msed extract. FIG. 39B shows the E9 specific activity when assayed at increasing temperatures. FIG. 39C shows the stability of E9 over time when incubated at 90 C.

    [0079] FIG. 40. Phosphate-dependent assay for E1.

    [0080] FIG. 41. Scheme for producing acetyl CoA from pyruvate or maltose and for producing ATP and NADPH for the SP1 pathway for 3-HP production by whole cells of P. furiosus strains PF506 and MW56.

    [0081] FIG. 42. Enzymes and substrates in final reactions of 3HP/4HB cycle in M. sedula. Enzymes: 10, 4-hydroxybutyrate-CoA synthetase; 11, 4-hydroxybutyryl-CoA dehydratase; 12, crotonyl-CoA hydratase/(S)-3hydroxybutyryl-CoA dehydrogenase; 13, acetoacetyl-CoA -ketothiolase; 14 acetyl-CoA synthetase (non-native, used for HPLC assay).

    [0082] FIGS. 43A-D. HPLC chromatograms demonstrating in vitro production of acetate from 4-hydroxybutyrate. Samples and standards were derivatized using dibromoacetophenone (DBAP) and run on a reversed-phase column to show production of acetate. Chromatograms shown are: FIG. 43A) 4HB standard, FIG. 43B) 3HP standard, FIG. 43C) control reaction containing buffer, cofactors, and 4HB but no enzymes, and FIG. 43D) SP3 reaction using recombinant enzymes. Retention times: 6.9 min for 4HB and 9.1 min for acetate.

    [0083] FIG. 44. Transcriptional Heatmap for proposed 3HP/4HB cycle and central metabolism in M. sedula. Metabolic diagram shows 3HP/4HB pathway (top center), incomplete tricarboxylic acid cycle (TCA, center), gluconeogenesis (bottom center), and isoprenoid-based lipid biosynthesis pathways (top left). Metabolic network adapted from Estelmann et. al. Enzymes: 1, acetyl-CoA/propionyl-CoA carboxylase; 2, malonyl-CoA reductase (NADPH); 3, malonic semialdehyde reductase (NADPH); 4, 3HP-CoA synthetase (AMP-forming); 5, 3-hydroxypropionyl-CoA dehydratase; 6, acryloyl-CoA reductase (NADPH); 7, acetyl-CoA/propionyl-CoA carboxylase; 8, methylmalonyl-CoA epimerase; 9, methylmalonyl-CoA mutase; 10, succinyl-CoA reductase (NADPH); 11, succinic semialdehyde reductase (NADPH); 12, 4HB-CoA synthetase (AMP-forming); 13, 4-hydroxybutyryl-CoA dehydratase; 14 and 15, crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (NAD.sup.+); 16, acetoacetyl-CoA b-ketothiolase; 17, succinyl-CoA synthetase (ADP-forming); 18, succinic semialdehyde dehydrogenase; 19, succinate dehydrogenase; 20, fumarate hydratase; 21, malate dehydrogenase; 22, (si)-citrate synthase; 23, aconitase; 24, isocitrate dehydrogenase; 25, malic enzyme; 26, pyruvate: water dikinase (ATP); 27, PEP carboxylase; 28, PEP carboxykinase (GTP); 29, enolase; 30, phosphoglycerate mutase; 31, phosphoglycerate kinase; 32, glyceraldehyde-3-phosphate dehydrogenase; 33, triosephosphate isomerase; 34, fructose 1,6-bisphosphate aldolase/phosphatase; 35, malate synthase; 36, acetyl-CoA acetyl-transferase; 37, HMG-CoA synthase; 38, HMG-CoA reductase. Abbreviations: Ac-CoAacetyl-CoA, 3HP3-hydroxypropionate; Suc-CoAsuccinyl-CoA; Suc. semi.succinic semialdehyde; 4HB4-hydroxybutyrate; AcAc-CoAAcetoacetyl-CoA; HMG-CoA3-hydroxy-3-methyl-glutaryl-CoA; PEPphosphoenolpyruvate; F6PFructose-6-phosphate.

    [0084] FIG. 45. Annotated 2-oxoacid oxidoreductases in M. sedula. Normalized transcription levels for M. sedula genes annotated as pyruvate (or 2-oxoglutarate) flavodoxin/ferredoxin oxidoreductases. High transcription levels are shown in red, low transcription in green, corresponding numbers represent least-squares means of normalized log 2-transformed transcription levels relative to the overall average transcription level of 0 (black). Annotations are from the Joint Genome Institute's Integrated Microbial Genome database (img.jgi.doe.gov). Conditions shown: Autotrophic Carbon Limited (ACL), Autotrophic Carbon Rich (ACR), Heterotrophic (HTR). Fold change of gene transcription under ACL relative to HTR and their statistical significance is also shown. All other microarray data can be found in the GEO depositGSE39944.

    [0085] FIGS. 46A-D. Amino acid sequences of polypeptides that are part of the 4-hydroxybutyrate cycle.

    [0086] FIGS. 47A-F shows an amino acid alignment of Msed_0147 (SEQ ID NO:1) and 18 other sequences. 640506050.Msed_0147 (SEQ ID NO:1), 650848362.Ahos_2119 (SEQ ID NO:25), 650472093.SiRe_0254, 643841501.YN1551_2862 (SEQ ID NO:26), 638192839.ST0593 (SEQ ID NO:402), 2508723726.Met . . . 1DRAFT_00020780 (SEQ ID NO:28), 646527065.LD85 0260 (SEQ ID NO:343), 2524413480.SacN8_01265 (SEQ ID NO:29), 643828153.M1425_0254 (SEQ ID NO:30), 638197195.Saci_0260 (SEQ ID NO:31), 643830840.LS215_0285 (SEQ ID NO:32), 643882885.M164_0272 (SEQ ID NO:33), 650822319.Mcup_1926 (SEQ ID NO:34), 643836194.YG5714_0257 (SEQ ID NO:35), 638163678.SS02466 (SEQ ID NO:36), 650474851.SiH_0261 (SEQ ID NO:37), 646942932.Ssol_0270 (SEQ ID NO:38), 643842091.M1627_0254 (SEQ ID NO:39), 650023511.Sso198_010100000595 (SEQ ID NO:40).

    [0087] FIGS. 48A-B. An amino acid alignment of Msed_0148 (SEQ ID NO:2) and 18 other sequences. 640506051.Msed_0148 (SEQ ID NO:2), 638192838.ST0592 (SEQ ID NO:41), 650822318.Mcup_1925 (SEQ ID NO:42), 2508723727.Met . . . 1DRAFT_00020790 (SEQ ID NO:43), 650848361.Ahos_2118 (SEQ ID NO:344), 638163677.SS_02464 (SEQ ID NO:44), 643842090.M1627_0253 (SEQ ID NO:45), 646942931.Ssol_0269 (SEQ ID NO:46), 643828152.M1425_0253 (SEQ ID NO:47), 643882884.M164_0271 (SEQ ID NO:112), 643830839.LS215_0284 (SEQ ID NO:48), 643841500.YN1551_2861 (SEQ ID NO:49), 643836193.YG5714_0256 (SEQ ID NO:50), 650472092.SiRe_0253 (SEQ ID NO:51), 650474850.SiH_0260 (SEQ ID NO:52), 650023512.Sso198_010100000600 (SEQ ID NO:53), 646527064LD85_0259 (SEQ ID NO:54), 638197196.Saci_0261 (SEQ ID NO:55), 2524413481.SacN8_01270 (SEQ ID NO:56).

    [0088] FIGS. 49A-F. An amino acid alignment of Msed_01375 (SEQ ID NO:3) and other sequences. 640507264.Msed_1375 (SEQ ID NO:3), 638192837.ST0591 (SEQ ID NO:57), 2508724172.Met . . . 1DRAFT_00025240 (SEQ ID NO:58), 650821248.Mcup_0858 (SEQ ID NO:59), 646527063.LD85_0258 (SEQ ID NO:60), 643842089.M1627_0252 (SEQ ID NO:61), 643841499.YN1551_2860 (SEQ ID NO:62), 643828151.M1425_0252 (SEQ ID NO:63), 643836192.YG5714_0255 (SEQ ID NO:64), 643830838LS215_0283 (SEQ ID NO:65), 646942930.Ssol_0268 (SEQ ID NO:66), 650023513.Sso198_010100000605 (SEQ ID NO:67), 643882883.M164_0270 (SEQ ID NO:68), 650474849.SiH_0259 (SEQ ID NO:69), 650472091.SiRe_0252 (SEQ ID NO:70), 650848360Ahos_2117 (SEQ ID NO:71), 2524413482.SacN8 01275 (SEQ ID NO:72), 638197197.Saci_0262 (SEQ ID NO:73), 638163676.5502463 (SEQ ID NO:74).

    [0089] FIGS. 50A-D. An amino acid alignment of Msed_0709 (SEQ ID NO:4) and other sequences. 640506613.Msed_0709 (SEQ ID NO:4), 638194641.ST2171 (SEQ ID NO:75), 638199060.Saci_2147 (SEQ ID NO:76), 650848598.Ahos_2348 (SEQ ID NO:77), 643833336.LS215_2961 (SEQ ID NO:78), 646945396.Ssol_2908 (SEQ ID NO:79), 650025873.Sso198_010100012550 (SEQ ID NO:80), 643885393.M164_2777 (SEQ ID NO:81), 643830551M1425_2796 (SEQ ID NO:82), 643844535.M1627_2848 (SEQ ID NO:83), 2524415528.SacN8_11535 (SEQ ID NO:84), 650474573.SiRe_2691 (SEQ ID NO:85), 643841782.YN1551_3167 (SEQ ID NO:86), 2524415315.SacN8_10450 (SEQ ID NO:87), 638199277.Saci_2370 (SEQ ID NO:88), 643838884.YG5714_2976 (SEQ ID NO:89), 650477400.SiH_2755 (SEQ ID NO:90), 646529769.LD85_3126 (SEQ ID NO:91), 638163414.SS02178 (SEQ ID NO:92), 2508722882.Met . . . 1DRAFT_00012340 (SEQ ID NO:93), 650821817Mcup_1427 (SEQ ID NO:94).

    [0090] FIGS. 51A-D. An amino acid alignment of Msed_1993 (SEQ ID NO:5) and other sequences. 640507881.Msed_1993 (SEQ ID NO:5), 2508724800.Met . . . 1DRAFT_00031520 (SEQ ID NO:95), 650025277. Sso198_010100009521 (SEQ ID NO:96), 638161868.SS00647 (SEQ ID NO:97), 643829267.M1425_1490 (SEQ ID NO:98), 643837420.YG5714_1494 (SEQ ID NO:99), 643832024.LS215_1598 (SEQ ID NO:100), 643840152.YN1551_1342 (SEQ ID NO:101), 643884086.M164_1487 (SEQ ID NO:102), 643843312.M1627_1605 (SEQ ID NO:103), 650476065.SiH_1456 (SEQ ID NO:104), 646944319.Ssol_1706 (SEQ ID NO:105), 650847331.Ahos_1103 (SEQ ID NO:106), 2524414811.SacN8_07880 (SEQ ID NO:107), 650473222.SiRe_1366 (SEQ ID NO:108), 646528384.LD85_1697 (SEQ ID NO:109), 638198535.Saci_1623 (SEQ ID NO:110), 638193893.ST1507 (SEQ ID NO:111), 650820669.Mcup_0293 (SEQ ID NO:113).

    [0091] FIGS. 52A-N. An amino acid alignment of Msed_1456 (SEQ ID NO:6) and other sequences. 640507344.Msed_1456 (SEQ ID NO:6), 650848309.Ahos_2066(SEQ ID NO:114), 650821134.Mcup_0744 (SEQ ID NO:115), 638193050.ST0783 (SEQ ID NO:116), 639783349.Pisl 0270 (SEQ ID NO:117), 2508724181.Met . . . 1DRAFT_00025330 (SEQ ID NO:118), 639773672.Tpen_0893 (SEQ ID NO:119), 650847233.Ahos_1005 (SEQ ID NO:120), 2505689392.Pyrfu_0975 (SEQ ID NO:121), 650025593.S so198_010100011130 (SEQ ID NO:122), 638164412.SS03203 (SEQ ID NO:123), 638198104.Saci_1184 (SEQ ID NO:124), 638171842.PAE2867 (SEQ ID NO:125), 2524414384.SacN8_05775 (SEQ ID NO:126), 650473925.SiRe 2035 (SEQ ID NO:127), 643832752.LS21-5 2320 (SEQ ID NO:128), 650476750.S1H 21-03 (SEQ ID NO:129), 643884788.M164_2161 (SEQ ID NO:130), 643838221.YG5714 2284 (SEQ ID NO:131), 646943552.Ssol 0940(SEQ ID NO:132), 64383945 YN1-551 0632 (SEQ ID NO:133), 643829949.M1425_2-157 (SEQ ID NO:134), 643843952.M1627_2237 (SEQ ID NO:135), 646529117.LD85_2424 (SEQ ID NO:136).

    [0092] FIGS. 53A-C. An amino acid alignment of Msed_2001 (SEQ ID NO:7) and other sequences. 640507889.Msed_2001 (SEQ ID NO:7), 638193901.ST1516 (SEQ ID NO:138), 650847323.Ahos_1095 (SEQ ID NO:139), 638198544.Saci_1633 (SEQ ID NO:140), 252441482.0.SacN807925 (SEQ ID NO:141), 650820662.Mcup_0286 (SEQ ID NO:142), 638161875.SS00654 (SEQ ID NO:143), 650025284.Sso198_010100009556 (SEQ ID NO:144), 2508724790.Met . . . 1DRAFT_00031420 (SEQ ID NO:145), 643843305.M1627_1597 (SEQ ID NO:146), 646528376.LD85_1689 (SEQ ID NO:147), 643840160.YN1551_1350 (SEQ ID NO:148), 643884079.M164_1479 (SEQ ID NO:149), 643832016.LS215_1590 (SEQ ID NO:150), 643837412.YG5714_1486 (SEQ ID NO:151), 646944326.Ssol_1713 (SEQ ID NO:152), 643829260.M1425_1482 (SEQ ID NO:153), 650476056.SiH_1448 (SEQ ID NO:154), 650473215.SiRe_1359 (SEQ ID NO:155).

    [0093] FIGS. 54A-G. An amino acid alignment of Msed_1426 (SEQ ID NO:8) and other sequences. 640507315.Msed_1426 (SEQ ID NO:8), 638192718.ST0480 (SEQ ID NO:156), 650821199.Mcup_0809 (SEQ ID NO:157), 638197838.Saci_0911 (SEQ ID NO:158), 638161989.SS00764 (SEQ ID NO:159), 643831892.LS215_1474 (SEQ ID NO:160), 643843128.M1627_1428 (SEQ ID NO:161), 643828184.M1425_0286 (SEQ ID NO:162), 650473079.SiRe_1239 (SEQ ID NO:163), 646528184.1 . . . D85_1501 (SEQ ID NO:164), 643883965.M164_1370 (SEQ ID NO:165), 643842122.M1627_0286 (SEQ ID NO:166), 646942963.Ssol_0305 (SEQ ID NO:167), 643829150.M1425_1378 (SEQ ID NO:168), 650475916.SiH_1323 (SEQ ID NO:169), 643837294.YG5714_1372 (SEQ ID NO:170), 646944442.Ssol 1823 (SEQ ID NO:171), 643840284.YN1551_1469 (SEQ ID NO:172), 650848532.Ahos_2283 (SEQ ID NO:173), 2524414117.SacN8_04415 (SEQ ID NO:174), 650025399.Sso198_010100010101 (SEQ ID NO:175), 2508722637.Met . . . 1DRAFT00009890 (SEQ ID NO:176).

    [0094] FIGS. 55A-B. An amino acid alignment of Msed_0639 (SEQ ID NO:9) and other sequences. 640506543.Msed_0639 (SEQ ID NO:9), 638192799.ST0554 (SEQ ID NO:177), 638197850.Saci_0923 (SEQ ID NO:178), 646527026.LD85_0221 (SEQ ID NO:179), 2524414129.SacN8_04475 (SEQ ID NO:180), 638163642.SS02426 (SEQ ID NO:181), 650024093.Sso198_010100003518 (SEQ ID NO:182), 2508722799.Met . . . 1DRAFT_00011510 (SEQ ID NO:183), 643882848.M164_0235 (SEQ ID NO:184), 646942892.Ssol_0230 (SEQ ID NO:185), 643828115.M1425_0216 (SEQ ID NO:186), 650474810.SiH_0222 (SEQ ID NO:187), 643842053.M1627 0216 (SEQ ID NO:188), 650821907.Mcup_1517 (SEQ ID NO:189), 643830802.LS215_0247 (SEQ ID NO:190), 643841463.YN1551_2823 (SEQ ID NO:191), 650848464.Ahos_2217 (SEQ ID NO:192), 650472052.SiRe_0215 (SEQ ID NO:193), 643836157.YG57140220 (SEQ ID NO:194).

    [0095] FIGS. 56A-L. An amino acid alignment of Msed_0638 (SEQ ID NO:10) and other sequences. 640506542.Msed_0638 (SEQ ID NO:10), 638192798.ST0552 (SEQ ID NO:195), 638189489.APE1687 (SEQ ID NO:196), 650507277.VMUT_0924 (SEQ ID NO:197), 2524414130.SacN8_04480 (SEQ ID NO:198), 638197851.Saci_0924 (SEQ ID NO:199), 650821906.Mcup_1516 (SEQ ID NO:200), 648200341.Vdis_0037 (SEQ ID NO:201), 2508722798.Met . . . 1DRAFT_00011500 (SEQ ID NO:202), 2510092565.Calag_0472 (SEQ ID NO:203), 638163641.SS02425 (SEQ ID NO:204), 650024094.Sso198_010100003523 (SEQ ID NO:205), 646527025 LD85_0220 (SEQ ID NO:206), 643882847.M164_0234 (SEQ ID NO:207), 650472051.SiRe_0214 (SEQ ID NO:208), 643830801.LS215_0246 (SEQ ID NO:209), 646942891.Ssol 0229 (SEQ ID NO:210), 650848463.Ahos_2216 (SEQ ID NO:211), 643836156.YG5714_0219 (SEQ ID NO:212), 643828114.M1425_0215 (SEQ ID NO:213), 643841462.YN1551_2822 (SEQ ID NO:214), 650474809.SiH_0221 (SEQ ID NO:215), 643842052.M1627_0215 (SEQ ID NO:216), 648118006.ASAC 1077 (SEQ ID NO:217).

    [0096] FIGS. 57A-B. An amino acid alignment of Msed_2055 (SEQ ID NO:11) and other sequences. 640507945.Msed_2055 (SEQ ID NO:11), 638194564ST2096 (SEQ ID NO:218), 638189488 APE1686 (SEQ ID NO:219), 650471903 SiRe_0075 (SEQ ID NO:220), 650474657 SiH_0076 (SEQ ID NO:221), 643827976.M1425_0076 (SEQ ID NO:222), 646942747 Ssol_0081 (SEQ ID NO:223), 643882689.M164_0076 (SEQ ID NO:224), 643841912M1627_0076 (SEQ ID NO:226), 6438306311S215_0076 (SEQ ID NO:227), 646526885LD85_0076 (SEQ ID NO:228), 643838963.YN1551_0076 (SEQ ID NO:229), 643836014.YG5714_0078 (SEQ ID NO:230), 6482.00342.Vdis_0038 (SEQ ID NO:231), 650820610.Mcup_0235 (SEQ ID NO:232), 2510092566.Calag.0473 (SEQ ID NO:233), 250872472814et . . . IDRAFT_00030800 (SEQ ID NO:234), 638197003.Saci_0062 (SEQ ID NO:235), 2524413284.SacN8_00295 (SEQ ID NO:236), 650025504 Sso198_010100010675 (SEQ ID NO:237), 650846706 Abos_0509 (SEQ ID NO:238), 638163495.SS02266 (SEQ ID NO:239), 648118007ASAC_1078 (SEQ ID NO:240), 650507278.VMUT_0925 (SEQ ID NO:241).

    [0097] FIGS. 58A-D. An amino acid alignment of Msed_1424 (SEQ ID NO:12) and other sequences. 640507313.Msed_1424 (SEQ ID NO:12), 638194516.ST2056 (SEQ ID NO:242), 2524415313.SacN8_10440 (SEQ ID NO:243), 638161699.SS00472 (SEQ ID NO:244), 646944079.Ssol_1454 (SEQ ID NO:245), 643829410.M1425_1632 (SEQ ID NO:246), 643839999.YN1551_1180 (SEQ ID NO:247), 643884283.M164_1679 (SEQ ID NO:248), 643837646.YG5714_1723 (SEQ ID NO:249), 643832179.LS215_1759 (SEQ ID NO:250), 643843451.M1627_1747 (SEQ ID NO:251), 650473386.SiRe_1527 (SEQ ID NO:252), 650848525.Ahos_2277 (SEQ ID NO:253), 650476220.SiH_1606 (SEQ ID NO:254), 646528572.LD85_1888 (SEQ ID NO:255), 638199058.Saci_2145 (SEQ ID NO:256), 650821201.Mcup_0811 (SEQ ID NO:257), 650024197.Sso198_010100004040 (SEQ ID NO:258), 2508722628.Met . . . 1DRAFT_00009800 (SEQ ID NO:259).

    [0098] FIGS. 59A-O. An amino acid alignment of Msed_0406 (SEQ ID NO:14) and other sequences. 640506312.Msed_0406 (SEQ ID NO:14), 638193516.ST1190 (SEQ ID NO:345), 638195071.ST2575 (SEQ ID NO:346), 641669006.Tneu_1843 (SEQ ID NO:347), 650847233.Ahos_1005 (SEQ ID NO:348), 650821270.Mcup_0880 (SEQ ID NO:260), 638163277.SS02041 (SEQ ID NO:261), 638163135.SS01903n (SEQ ID NO:262), 638198069.Saci_1149 (SEQ ID NO:263), 650772447.TUZN 2145 (SEQ ID NO:264), 648117514.ASAC_0597 (SEQ ID NO:265), 2508723436.Met . . . IDRAFT_00017880 (SEQ ID NO:266), 643840674.YN1551_1878 (SEQ ID NO:267), 643883328.M164 0732 (SEQ ID NO:268), 650472518.SiRe_0686 (SEQ ID NO:269), 2524414348.SacN8_05595 (SEQ ID NO:270), 646527485.LD85_0753 (SEQ ID NO:271), 646945208.Ssol_2702 (SEQ ID NO:272), 650822064.Mcup_1674 (SEQ ID NO:273), 643828660.M1425_0851 (SEQ ID NO:274), 643831217.LS215 0753 (SEQ ID NO:275), 650024986.Sso198_010100008026 (SEQ ID NO:276), 643831373.LS215_0923 (SEQ ID NO:277), 643828535.M1425_0704 (SEQ ID NO:278), 650475223.SiH_0646 (SEQ ID NO:279), 643842477.M1627_0708 (SEQ ID NO:349), 643836911.YG5714_0994 (SEQ ID NO:350), 650508650.VMUT 2290 (SEQ ID NO:351).

    [0099] FIGS. 60A-K. An amino acid alignment of Msed_1321 (SEQ ID NO:15) and other sequences. 640507210.Msed_1321 (SEQ ID NO:15), 650821278. Mcup_0888 (SEQ ID NO:352), 2511627386.1TX_1102 (SEQ ID NO:353), 650848279.Ahos_2036 (SEQ ID NO:355), 650024685.Sso198_010100006527 (SEQ ID NO:356), 638163940.SS02738 (SEQ ID NO:357), 638171713.PAE2693 (SEQ ID NO:358), 638194068ST1659 (SEQ ID NO:359), 2508721913.Met . . . 1DRAFT_00002650 (SEQ ID NO:360), 2512378777.Pogu_1298 (SEQ ID NO:361), 638199056.Saci_2143 (SEQ ID NO:362), 2524415311.SacN810430 (SEQ ID NO:363), 640125146.Pca1_1396 (SEQ ID NO:364), 641667580.Tneu_0422 (SEQ ID NO:365), 2511694157.P186_0718 (SEQ ID NO:366), 643833127.LS215_2744 (SEQ ID NO:367), 643830347341425_2585 (SEQ ID NO:368), 643844328M1627_2638 (SEQ ID NO:369), 639783328.Pisl_0248 (SEQ ID NO:370), 650477167.S1H_2522 (SEQ ID NO:371), 643839021.YN1551_0139 (SEQ ID NO:372), 640897163.Igni_0595 (SEQ ID NO:373), 643885186.M164_2569 (SEQ ID NO:374), 650474246.SiRe_2362 (SEQ ID NO:375), 643838664.YG5714_2751 (SEQ ID NO:376), 646943192.Ssol_0550 (SEQ ID NO:377), 646529546.LD85 2896 (SEQ ID NO:378).

    [0100] FIGS. 61A-G. An amino acid alignment of Msed_0399 (SEQ ID NO:16) and other sequences. 640506305.Msed_0399 (SEQ ID NO:16), 2508723442.Met . . . 1DRAFT_00017940 (SEQ ID NO:379), 648117957.ASAC_1031 (SEQ ID NO:380), 638170750.PAE1383 (SEQ ID NO:381), 643841549.YN1551_2911 (SEQ ID NO:382), 643882933.M164_0319 (SEQ ID NO:383), 643842139.M1627_0303 (SEQ ID NO:384), 641667694.Tneu_0541 (SEQ ID NO:385), 643828200.M1425_0302 (SEQ ID NO:386), 650472146.SiRe_0307 (SEQ ID NO:387), 650474900.SiH_0309 (SEQ ID NO:388), 646942979.Ssol_0321 (SEQ ID NO:389), 639784518Pisl_1434 (SEQ ID NO:390), 640468018.Pars_0453 (SEQ ID NO:391), 640897631.Igni_1058 (SEQ ID NO:392), 646527111 LD85_0308 (SEQ ID NO:393), 650023499.Sso198_010100000535 (SEQ ID NO:394), 638163722.SS02514 (SEQ ID NO:395), 638196031.Saci_1109 (SEQ ID NO:396), 2524414310.SacN8_05395 (SEQ ID NO:397), 638189274 APE1484 (SEQ ID NO:398), 65082207014cup_1680 (SEQ ID NO:399).

    [0101] FIGS. 62A-I. An amino acid alignment of Msed_0656 (SEQ ID NO:17) and other sequences. 640506560Msed_0656 (SEQ ID NO:17), 638192756.ST0514 (SEQ ID NO:280), 650770713.TUZN_0403 (SEQ ID NO:281), 650821827.Mcup_1437 (SEQ ID NO:282), 646942850Ssol_0188 (SEQ ID NO:283), 643841420.YN1551_2779 (SEQ ID NO:284), 650848421.Ahos_2176 (SEQ ID NO:285), 641667412.Tneu_0249 (SEQ ID NO:286), 638197890.Saci_0963 (SEQ ID NO:287), 650472007.SiRe_0173 (SEQ ID NO:288), 643836114.YG5714_0177 (SEQ ID NO:289), 643842011.M1627_0173 (SEQ ID NO:290), 650474766.SiH_0179 (SEQ ID NO:291), 643830761_LS215_0204 (SEQ ID NO:292), 640124530.Pca1_0781 (SEQ ID NO:293), 640467886.Pars_0309 (SEQ ID NO:294), 643882805.M164_0192 (SEQ ID NO:295), 640897989.Igni_1401 (SEQ ID NO:296), 2512379618.Pogu_2093 (SEQ ID NO:297), 646526983.LD85 0177 (SEQ ID NO:298), 643828073M1425_0173 (SEQ ID NO:299), 2524414169.SacN8_04675 (SEQ ID NO:300), 2508722819.Met . . . 1DRAFT 00011710 (SEQ ID NO:301), 2511627177.TTX_0886 (SEQ ID NO:302), 650024136.Sso198_010100003733 (SEQ ID NO:303), 638163597.SS02377 (SEQ ID NO:304), 648117228.ASAC_0321 (SEQ ID NO:305).

    DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

    [0102] Provided herein are systems for sequestering carbon dioxide from the atmosphere using hydrogen gas as the driving force to convert the carbon to C2, C3, and C4 compounds, including compounds useful in the production of biofuels and plastics. In one embodiment, the system is a complete cycle. This cycle, also referred to herein as the 4-hydroxybutyrate cycle, can be broken down into three sub-pathways, as shown in equations 1-3,


    Acetyl CoA+CO.sub.2+ATP+2H.sub.2.fwdarw.3-HP+ADP+Pi+CoA[1]


    3-HP+CO.sub.2+2ATP+3H2.fwdarw.4-HB+ADP+AMP+Pi+PPi[2]


    4-HB+ATP+NAD++2CoA.fwdarw.2Acetyl CoA+AMP+PPi+NADH[3]

    where 3-HP is 3-hydroxypropionate, and 4-HB is 4-hydroxybutyrate. The reaction described in equation 1 is also referred to herein as the 3-HP subpathway or SP1, and the reaction described in equation 2 is also referred to herein as the 4-HB subpathway or SP2. Thus, the system described herein can be used to produce 3-HP, 4-HB, acetyl CoA, or a combination thereof. In some embodiments other compounds may be produced, as described in greater detail herein.

    [0103] In one embodiment, which is described by equation 1 and shown in FIG. 1 as catalyzed by enzymes E1, , , E2, and E3, the system includes a polypeptide having acetyl/propionyl-CoA carboxylase activity (E1, , ), a polypeptide having malonyl/succinyl-CoA reductase activity (E2), and a polypeptide having malonate semialdehyde reductase activity (E3). In one aspect of this embodiment, the system produces 3-HP. Aspects of the production of 3-HP, including useful carbon donors and electron donors, are discussed herein.

    [0104] A polypeptide having acetyl/propionyl-CoA carboxylase activity means the polypeptide catalyzes the conversion of acetyl CoA to malonyl-CoA or the conversion of propionyl-CoA to (S)-methylmalonyl-CoA. The acetyl/propionyl-CoA carboxylase activity of a polypeptide may be determined by routine methods known in the art.

    [0105] An example of a polypeptide having acetyl/propionyl-CoA carboxylase activity is a heterotrimeric polypeptide that includes one amino acid sequence encoded by coding sequence Msed_0147 of Genbank accession NC_009440 and disclosed at SEQ ID NO:1, one amino acid sequence encoded by coding sequence Msed_0148 of Genbank accession NC_009440 and disclosed at SEQ ID NO:2, and one amino acid sequence encoded by coding sequence Msed_1375 of Genbank accession NC_009440 and disclosed at SEQ ID NO:3.

    [0106] Other examples of polypeptides having acetyl/propionyl-CoA carboxylase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_0147 of Genbank accession NC_009440 and disclosed at SEQ ID NO:1, a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_0148 of Genbank accession NC_009440 and disclosed at SEQ ID NO:2, and/or a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_1375 of Genbank accession NC_009440 and disclosed at SEQ ID NO:3. A candidate polypeptide having structural similarity to one of the polypeptides SEQ ID NO:1, 2, or 3 has acetyl/propionyl-CoA carboxylase activity when expressed in a microbe with the other 2 reference polypeptides. For instance, when determining if a candidate polypeptide having some level of identity to SEQ ID NO:1 has acetyl/propionyl-CoA carboxylase activity, the candidate polypeptide is expressed in a microbe with reference polypeptides SEQ ID NO:2 and 3. When determining if a candidate polypeptide having some level of identity to SEQ ID NO:2 has acetyl/propionyl-CoA carboxylase activity, the candidate polypeptide is expressed in a microbe with reference polypeptides SEQ ID NO:1 and 3. When determining if a candidate polypeptide having some level of identity to SEQ ID NO:3 has acetyl/propionyl-CoA carboxylase activity, the candidate polypeptide is expressed in a microbe with reference polypeptides SEQ ID NO:1 and 2.

    [0107] Additional examples of polypeptides expected to have acetyl/propionyl-CoA carboxylase activity may be obtained from members of the orders Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25) and Chloroflexales (such as Chloroflexus sp. Y-400-fl, C. aurantiacus J-10-fl, and C. aggregans DSM 9485).

    [0108] A polypeptide having malonyl/succinyl-CoA reductase activity means the polypeptide catalyzes the conversion of malonyl-CoA to malonate semialdehyde or succinyl-CoA to succinate semialdehyde. The malonyl/succinyl-CoA reductase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes an amino acid sequence encoded by coding sequence Msed_0709 of Genbank accession NC_009440 and disclosed at SEQ ID NO:4.

    [0109] Other examples of polypeptides having malonyl/succinyl-CoA reductase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_0709 of Genbank accession NC_009440 and disclosed at SEQ ID NO:4.

    [0110] Additional examples of polypeptides expected to have malonyl/succinyl-CoA reductase activity may be obtained from members of the orders Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25) and Desulfurococcales (such as Ignicoccus hospitalis KIN4/I) and Euryarchaeotes (Thermococcales) (such as Pyrococcus sp. NA2), and Chloroflexales (such as Chloroflexus sp. Y-400-fl, C. aurantiacus J-10-fl, and C. aggregans DSM 9485).

    [0111] A polypeptide having malonate semialdehyde reductase activity means the polypeptide catalyzes the conversion of malonate semialdehyde to 3-hydroxypropionate. The malonate semialdehyde reductase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes one amino acid sequence encoded by coding sequence Msed_1993 of Genbank accession NC_009440 and disclosed at SEQ ID NO:5.

    [0112] Other examples of polypeptides having malonate semialdehyde reductase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_1993 of Genbank accession NC_009440 and disclosed at SEQ ID NO:5.

    [0113] Additional examples of polypeptides expected to have malonate semialdehyde reductase activity may be obtained from members of the order Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25).

    [0114] In one embodiment, which is described by equation 2 and shown in FIG. 1 as catalyzed by enzymes E4, E5, E6, E7, and E8 and , the system includes a polypeptide having 3-hydroxypropionate:CoA ligase activity (E4), a polypeptide having 3-hydroxypropionyl-CoA dehydratase activity (E5), a polypeptide having acryloyl-CoA reductase activity (E6), a polypeptide having methylmalonyl-CoA epimerase activity (E7), a polypeptide having methylmalonyl-CoA mutase activity (E8), and a polypeptide having succinate semialdehyde reductase activity (E9). In one aspect of this embodiment, the system produces 4-HB. The system may also include a polypeptide having acetyl/propionyl-CoA carboxylase activity (E1, , ), a polypeptide having malonyl/succinyl-CoA reductase activity (E2), polypeptides which are described above. Aspects of the production of 4-HB, including useful carbon donors and electron donors, are discussed herein.

    [0115] A polypeptide having 3-hydroxypropionate:CoA ligase activity means the polypeptide catalyzes the conversion of 3-hydroxypropionate to 3-hydroxypropionyl CoA. The 3-hydroxypropionate:CoA ligase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes an amino acid sequence encoded by coding sequence Msed_1456 of Genbank accession NC_009440 and disclosed at SEQ ID NO:6.

    [0116] Other examples of polypeptides having 3-hydroxypropionate:CoA ligase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_1456 of Genbank accession NC_009440 and disclosed at SEQ ID NO:6.

    [0117] Additional examples of polypeptides expected to have 3-hydroxypropionate:CoA ligase activity may be obtained from members of the orders Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25), Thermoproteales (such as Vulcanisaeta moutnovskia 768-28 and V. distributa DSM 14429), Acidilobales (such as Acidilobus saccharovorans 345-15), and Euryarchaeotes (Thermococcales) (such as Thermococcus sibiricus MM 739, T. barophilus MP, Pyrococcus furiosus DSM 3638, Pyrococcus sp. NA2, P. horikoshii OT3, Thermococcus gammatolerans EJ3).

    [0118] A polypeptide having 3-hydroxypropionyl-CoA dehydratase activity means the polypeptide catalyzes the conversion of 3-hydroxypropionyl-CoA to acryloyl-CoA. The 3-hydroxypropionyl-CoA dehydratase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes an amino acid sequence encoded by coding sequence Msed_2001 of Genbank accession NC_009440 and disclosed at SEQ ID NO:7.

    [0119] Other examples of polypeptides having 3-hydroxypropionyl-CoA dehydratase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_2001 of Genbank accession NC_009440 and disclosed at SEQ ID NO:7.

    [0120] Additional examples of polypeptides expected to have 3-hydroxypropionyl-CoA dehydratase activity may be obtained from members of the orders Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25), Thermoproteales (such as Vulcanisaeta distributa DSM 14429), Acidilobales (such as Acidilobus saccharovorans 345-15), and Desulfurococcales (such as Aeropyrum pernix K1).

    [0121] A polypeptide having acryloyl-CoA reductase activity means the polypeptide catalyzes the conversion of acryloyl-CoA to propionyl-CoA. The acryloyl-CoA reductase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes an amino acid sequence encoded by coding sequence Msed_1426 of Genbank accession NC_009440 and disclosed at SEQ ID NO:8.

    [0122] Other examples of polypeptides having acryloyl-CoA reductase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_1426 of Genbank accession NC_009440 and disclosed at SEQ ID NO:8.

    [0123] Additional examples of polypeptides expected to have acryloyl-CoA reductase activity may be obtained from members of the orders Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25), and Thermoproteales (such as Vulcanisaeta moutnovskia 768-28 and V. distributa DSM 14429).

    [0124] A polypeptide having methylmalonyl-CoA epimerase activity means the polypeptide catalyzes the conversion of (S)-methylmalonyl-CoA to (R)-methylmalonyl-CoA. The methylmalonyl-CoA epimerase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes an amino acid sequence encoded by coding sequence Msed_0639 of Genbank accession NC_009440 and disclosed at SEQ ID NO:9.

    [0125] Other examples of polypeptides having methylmalonyl-CoA epimerase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_0639 of Genbank accession NC_009440 and disclosed at SEQ ID NO:9.

    [0126] Additional examples of polypeptides expected to have methylmalonyl-CoA epimerase activity may be obtained from members of the orders Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25), Thermoproteales (such as Vulcanisaeta distributa DSM 14429), Euryarchaeotes (Thermococcales) (such as Thermococcus sibiricus MM 739, T. barophilus MP, Pyrococcus furiosus DSM 3638, Pyrococcus sp. NA2, P. horikoshii OT3, T. gammatolerans EJ3, P. abyssi GE5, and Thermococcus onnurineus NA1), and Chloroflexales (such as Chloroflexus sp. Y-400-fl, C. aurantiacus J-10-fl, and C. aggregans DSM 9485).

    [0127] An example of a polypeptide having methylmalonyl-CoA mutase activity is a heterodimeric polypeptide that includes one amino acid sequence encoded by coding sequence Msed_0638 of Genbank accession NC_009440 and disclosed at SEQ ID NO:10, and one amino acid sequence encoded by coding sequence Msed_2055 of Genbank accession NC_009440 and disclosed at SEQ ID NO:11.

    [0128] Other examples of polypeptides having methylmalonyl-CoA mutase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_0638 of Genbank accession NC_009440 and disclosed at SEQ ID NO:10, and/or a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_2055 of Genbank accession NC_009440 and disclosed at SEQ ID NO:11. A candidate polypeptide having structural similarity to one of the polypeptides SEQ ID NO:10 or 11 has methylmalonyl-CoA mutase activity when expressed in a microbe with the other reference polypeptide. For instance, when determining if a candidate polypeptide having some level of identity to SEQ ID NO:10 has methylmalonyl-CoA mutase activity, the candidate polypeptide is expressed in a microbe with reference polypeptide SEQ ID NO:11. When determining if a candidate polypeptide having some level of identity to SEQ ID NO:11 has methylmalonyl-CoA mutase activity, the candidate polypeptide is expressed in a microbe with reference polypeptide SEQ ID NO:10.

    [0129] Additional examples of polypeptides expected to have methylmalonyl-CoA mutase activity may be obtained from members of the orders Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25), Thermoproteales (such as Vulcanisaeta moutnovskia 768-28 and V. distributa DSM 14429), Acidilobales (such as Acidilobus saccharovorans 345-15), Desulfurococcales (such as Aeropyrum pernix K1), Euryarchaeotes (Thermococcales) (such as Thermococcus sibiricus MM 739, T. barophilus MP, Pyrococcus furiosus DSM 3638, Pyrococcus sp. NA2, P. horikoshii OT3, T. gammatolerans EJ3, P. abyssi GE5, and Thermococcus onnurineus NA1), and Chloroflexales (such as Chloroflexus sp. Y-400-fl, C. aurantiacus J-10-fl, and C. aggregans DSM 9485).

    [0130] A polypeptide having succinate semialdehyde reductase activity means the polypeptide catalyzes the conversion of succinate semialdehyde to 4-hydroxybutyrate. The succinate semialdehyde reductase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes an amino acid sequence encoded by coding sequence Msed_1424 of Genbank accession NC_009440 and disclosed at SEQ ID NO:12.

    [0131] Other examples of polypeptides having succinate semialdehyde reductase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_1424 of Genbank accession NC_009440 and disclosed at SEQ ID NO:12.

    [0132] Additional examples of polypeptides expected to have semialdehyde reductase activity may be obtained from members of the order Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25).

    [0133] In one embodiment, which is described by equation 3 and shown in FIG. 1 as catalyzed by enzymes E10, E11, E12, and E13, the system includes a polypeptide having a polypeptide having 4-hydroxybutyrate:CoA ligase activity (E10), a polypeptide having 4-hydroxybutyrl-CoA dehydratase activity (E11), a polypeptide having crotonyl-CoA hydratase/(S)-3-hydroxybutyrl-CoA dehydrogenase activity (E12), and a polypeptide having acetoacetyl-CoA -ketothiolase activity (E13). In one aspect of this embodiment, the system produces acetyl-CoA. Aspects of the production of acetyl-CoA, including useful carbon donors and electron donors, are discussed herein.

    [0134] A polypeptide having 4-hydroxybutyrate:CoA ligase activity means the polypeptide catalyzes the conversion of 4-hydroxybutyrate to 4-hydroxybutyryl-CoA. The 4-hydroxybutyrate:CoA ligase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes an amino acid sequence encoded by coding sequence Msed_0394 of Genbank accession NC_009440 and disclosed at SEQ ID NO:13. Another example of a polypeptide having 4-hydroxybutyrate:CoA ligase activity includes an amino acid sequence encoded by coding sequence Msed_0406 of Genbank accession NC_009440 and disclosed at SEQ ID NO:14.

    [0135] Other examples of polypeptides having 4-hydroxybutyrate:CoA ligase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_0394 of Genbank accession NC_009440 and disclosed at SEQ ID NO:13 and a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_0406 of Genbank accession NC_009440 and disclosed at SEQ ID NO:14.

    [0136] In one embodiment, an example of a polypeptide having 4-hydroxybutyrate:CoA ligase activity is an amino acid sequence encoded by coding sequence Msed_1353 of Genbank accession NC_009440 and disclosed at SEQ ID NO:18, provided that the amino acid at residue 424 is not the tryptophan present in a wild type Msed_1353. In one embodiment, the amino acid at residue 424 is alanine, valine, leucine, isoleucine, or glycine. In one embodiment, the amino acid at residue 424 is alanine, valine, leucine, glycine. In one embodiment, the amino acid at residue 424 is glycine. The amino acid sequence disclosed at SEQ ID NO:18 includes the substitution of glycine for tryptophan. Another example is a polypeptide having structural similarity to the amino acid sequence SEQ ID NO:18, provided the amino acid at residue 424 is not tryptophan.

    [0137] Additional examples of polypeptides expected to have 4-hydroxybutyrate:CoA ligase activity include polypeptides catalyzing a CoA-ligase reaction that uses short (C2-C4) or medium (C5-C8) linear organic acids as a substrate. For instance, examples of polypeptides expected to have 4-hydroxybutyrate:CoA ligase activity include polypeptides catalyzing the reaction described under the IUBMB Enzyme Nomenclature system as EC 6.2.1.1, EC 6.2.1.3, EC 6.2.1.17, or EC 6.2.1.36. Such polypeptides may be obtained from members of the orders Desulfurococcales (such as Ignicoccus hospitalis, or Pyrolobus fumarii), Thermoproteales (such as Thermoproteus neutrophilus), or Sulfolobales (such as Sulfolobus acidocaldarius, S. islandicus, S. solfataricus, S. tokodaii, Metallosphaera cuprina, or M. sedula).

    [0138] A polypeptide having 4-hydroxybutyryl-CoA dehydratase activity means the polypeptide catalyzes the conversion of 4-hydroxybutyryl-CoA to crotonyl-CoA. The 4-hydroxybutyryl-CoA dehydratase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes an amino acid sequence encoded by coding sequence Msed_1321 of Genbank accession NC_009440 and disclosed at SEQ ID NO:15.

    [0139] Other examples of polypeptides having 4-hydroxybutyryl-CoA dehydratase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_1321 of Genbank accession NC_009440 and disclosed at SEQ ID NO:15.

    [0140] Additional examples of polypeptides expected to have 4-hydroxybutyryl-CoA dehydratase activity may be obtained from members of the orders Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25), and Desulfurococcales (such as Ignicoccus hospitalis KIN4/I).

    [0141] A polypeptide having crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase activity means the polypeptide catalyzes the conversion of crotonyl-CoA to acetoacetyl-CoA. The crotonyl-CoA hydratase/(S)-3-hydroxybutyrl-CoA dehydrogenase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes an amino acid sequence encoded by coding sequence Msed_0399 of Genbank accession NC_009440 and disclosed at SEQ ID NO:16.

    [0142] Other examples of polypeptides having crotonyl-CoA hydratase/(S)-3-hydroxybutyrl-CoA dehydrogenase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_0399 of Genbank accession NC_009440 and disclosed at SEQ ID NO:16.

    [0143] Additional examples of polypeptides expected to have crotonyl-CoA hydratase/(S)-3-hydroxybutyrl-CoA dehydrogenase activity may be obtained from members of the orders Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25), Thermoproteales (such as Vulcanisaeta moutnovskia 768-28 and V. distributa DSM 14429), Acidilobales (such as Acidilobus saccharovorans 345-15), and Desulfurococcales (such as Aeropyrum pernix K1, and Ignicoccus hospitalis KIN4/I).

    [0144] A polypeptide having acetoacetyl-CoA -ketothiolase activity means the polypeptide catalyzes the conversion of acetoacetyl-CoA to acetyl-CoA. The acetoacetyl-CoA -ketothiolase activity of a polypeptide may be determined by routine methods known in the art. An example of such a polypeptide includes an amino acid sequence encoded by coding sequence Msed_0656 of Genbank accession NC_009440 and disclosed at SEQ ID NO:17.

    [0145] Other examples of polypeptides having acetoacetyl-CoA -ketothiolase activity include a polypeptide having structural similarity to the amino acid sequence encoded by coding sequence Msed_0656 of Genbank accession NC_009440 and disclosed at SEQ ID NO:17.

    [0146] Additional examples of polypeptides expected to have acetoacetyl-CoA -ketothiolase dehydrogenase activity may be obtained from members of the orders Sulfolobaceae (such as Metallosphaera sedula DSM 5348, M. yellowstonensis, M. prunae, and M. cuprina Ar-4, Acidianus hospitalis W1, Sulfolobus tokodaii str. 7, S. acidocaldarius DSM 639, S. islandicus Y.G.57.14, S. islandicus Y.N.15.51, S. islandicus L.S.2.15, S. islandicus L.D.8.5, S. islandicus M.16.4, S. solfataricus P2, and S. islandicus M.14.25), Thermoproteales (such as Vulcanisaeta moutnovskia 768-28 and V. distributa DSM 14429), Acidilobales (such as Acidilobus saccharovorans 345-15), and Desulfurococcales (such as Aeropyrum pernix K1, and Ignicoccus hospitalis KIN4/I).

    [0147] While this pathway is presented as a cycle, the skilled person will recognize and appreciate that acetyl-CoA used by the heterotrimer E1, acetyl/propionyl-CoA carboxylase, does not need to originate from the enzymatic activity of E13 (acetoacetyl-CoA -ketothiolase). Acetyl-CoA may be produced through, for instance, the metabolism of amino acids, the degradation of fatty acids, or carbohydrate metabolism, and acetyl-CoA from any source may be the substrate of the heterotrimer E1.

    [0148] A candidate polypeptide (e.g., a polypeptide having structural similarity to a polypeptide described herein) may be isolated from a microbe, such as an extremophile. An extremophile is an organism that survives and thrives in challenging conditions impossible for most organisms. Examples of extremophiles include thermophiles, hyperthermophiles, acidophiles, and combinations thereof (e.g., a thermoacidophile). Thermophile refers to prokaryotic microbes that grow in environments at temperatures of between 50 C. and no greater than 75 C. Hyperthermophile refers to prokaryotic microbes that grow in environments at temperatures of at least 75 C. Acidophile refers to prokaryotic microbes that grow in environments at a pH of 3 or less. A prokaryotic microbe may be a member of the domain Archaea or a member of the domain Bacteria. Examples of extremophiles include archaea such as, but not limited to, members of the Order Thermococcales, members of the Order Sulfolobales, and members of the Order Thermotogales. Members of the Order Thermococcales include, but are not limited to, a member of the genus Pyrococcus, for instance P. furiosus, P. abyssi, or P. horikoshii, a member of the genus Thermococcus, for instance, T. kodakaraensis or T. onnurineus. Members of the Order Sulfolobales include, but are not limited to, a member of the genus Metallosphaera, for instance, M. sedula. Members of the Order Thermotogales include, but are not limited to, members of the genus Thermotoga, for instance, T. maritima or T. neapolitana. A candidate polypeptide may be produced using recombinant techniques, or chemically or enzymatically synthesized.

    [0149] The amino acid sequence of a polypeptide having structural similarity to a polypeptide described herein may include conservative substitutions of amino acids present in an amino acid sequence. A conservative substitution is typically the substitution of one amino acid for another that is a member of the same class. For example, it is well known in the art of protein biochemistry that an amino acid belonging to a grouping of amino acids having a particular size or characteristic (such as charge, hydrophobicity, and/or hydrophilicity) may generally be substituted for another amino acid without substantially altering the secondary and/or tertiary structure of a polypeptide. For the purposes of this invention, conservative amino acid substitutions are defined to result from exchange of amino acids residues from within one of the following classes of residues: Class I: Gly, Ala, Val, Leu, and Ile (representing aliphatic side chains); Class II: Gly, Ala, Val, Leu, Ile, Ser, and Thr (representing aliphatic and aliphatic hydroxyl side chains); Class III: Tyr, Ser, and Thr (representing hydroxyl side chains); Class IV: Cys and Met (representing sulfur-containing side chains); Class V: Glu, Asp, Asn and Gln (carboxyl or amide group-containing side chains); Class VI: His, Arg and Lys (representing basic side chains); Class VII: Gly, Ala, Pro, Trp, Tyr, Ile, Val, Leu, Phe and Met (representing hydrophobic side chains); Class VIII: Phe, Trp, and Tyr (representing aromatic side chains); and Class IX: Asn and Gln (representing amide side chains). The classes are not limited to naturally occurring amino acids, but also include artificial amino acids, such as beta or gamma amino acids and those containing non-natural side chains, and/or other similar monomers such as hydroxyacids.

    [0150] Guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et al. (1990, Science, 247:1306-1310), wherein the authors indicate proteins are surprisingly tolerant of amino acid substitutions. For example, Bowie et al. disclose that there are two main approaches for studying the tolerance of a polypeptide sequence to change. The first method relies on the process of evolution, in which mutations are either accepted or rejected by natural selection. The second approach uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene and selects or screens to identify sequences that maintain functionality. As stated by the authors, these studies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which changes are likely to be permissive at a certain position of the protein. For example, most buried amino acid residues require non-polar side chains, whereas few features of surface side chains are generally conserved. Other such phenotypically silent substitutions are described in Bowie et al, and the references cited therein.

    [0151] Guidance on how to modify the amino acid sequences of polypeptides disclosed herein is also provided at FIGS. 47-62. These figures show the amino acid sequences of polypeptides disclosed herein (SEQ ID NOs:1-17) in multiple protein alignments with other related polypeptides. Identical amino acids are marked with an asterisk (*), strongly conserved amino acids are marked with a colon (:), and weakly conserved amino acids are marked with a period (.). By reference to these figures, the skilled person can predict which alterations to an amino acid sequence are likely to modify enzymatic activity, as well as which alterations are unlikely to modify enzymatic activity.

    [0152] A polypeptide described herein may be expressed as a fusion polypeptide that includes a polypeptide described herein and a heterologous amino acid sequence. The heterologous amino acid sequence may be present at the amino terminal end or the carboxy terminal end of a polypeptide, or it may be present within the amino acid sequence of the polypeptide. For instance, the heterologous amino acid sequence may be useful for purification of the fusion polypeptide by affinity chromatography. Various methods are available for the addition of such affinity purification tags to proteins. Examples of tags include a polyhistidine-tag, maltose-binding protein, and Strep-Tag. Representative examples may be found in Hopp et al. (U.S. Pat. No. 4,703,004), Hopp et al. (U.S. Pat. No. 4,782,137), Sgarlato (U.S. Pat. No. 5,935,824), Sharma (U.S. Pat. No. 5,594,115), and Skerra and Schmidt, 1999, Biomol Eng. 16:79-86). The heterologous amino acid sequence, for instance, a tag or a carrier, may also include a cleavable site that permits removal of most or all of the additional amino acid sequence. Examples of cleavable sites are known to the skilled person and routinely used, and include, but are not limited to, a TEV protease recognition site. The number of heterologous amino acids may be, for instance, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, or at least 40.

    [0153] The polypeptides described herein may be produced by using recombinant, synthetic, or chemical techniques. For instance, a polypeptide may be synthesized in vitro, e.g., by solid phase peptide synthetic methods. Solid phase peptide synthetic methods are routine and known in the art. A polypeptide produced using recombinant techniques or by solid phase peptide synthetic methods may be further purified by routine methods, such as fractionation on immunoaffinity or ion-exchange columns, ethanol precipitation, reverse phase HPLC, chromatography on silica or on an anion-exchange resin such as DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation, gel filtration using, for example, Sephadex G-75, or ligand affinity. A preferred method for isolating and optionally purifying a hydrogenase polypeptide described herein includes column chromatography using, for instance, ion exchange chromatography, such as DEAE sepharose, hydrophobic interaction chromatography, such as phenyl sepharose, or the combination thereof.

    [0154] Also provided are isolated polynucleotides encoding the polypeptides described herein. For instance, a polynucleotide may have a nucleotide sequence encoding a polypeptide having the amino acid sequence shown in SEQ ID NOs:1-17, and an example of the class of nucleotide sequences encoding each polypeptide is disclosed herein as a coding region of Genbank accession NC_009440. It should be understood that a polynucleotide encoding a polypeptide represented by one of the sequences disclosed herein, e.g., SEQ ID NOs:1-17, is not limited to the nucleotide sequence disclosed as a coding region of Genbank accession NC_009440, but also includes the class of polynucleotides encoding such polypeptides as a result of the degeneracy of the genetic code. The class of nucleotide sequences encoding a selected polypeptide sequence is large but finite, and the nucleotide sequence of each member of the class may be readily determined by one skilled in the art by reference to the standard genetic code, wherein different nucleotide triplets (codons) are known to encode the same amino acid.

    [0155] A polynucleotide disclosed herein can be present in a vector. A vector is a replicating polynucleotide, such as a plasmid, phage, or cosmid, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide. Construction of vectors containing a polynucleotide of the invention may employ standard ligation techniques known in the art. See, e.g., (Sambrook et al., 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). A vector can provide for further cloning (amplification of the polynucleotide), i.e., a cloning vector, or for expression of the polynucleotide, i.e., an expression vector. The term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, and artificial chromosome vectors. Preferably the vector is a plasmid.

    [0156] Selection of a vector depends upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like. Vectors can be introduced into a host cell using methods that are known and used routinely by the skilled person. The vector may replicate separately from the chromosome present in the microbe, or the polynucleotide may be integrated into a chromosome of the microbe. When more than one vector is to be used in a cell, vectors having compatible origins of replication may be used (Adams et al. (US Patent Application 20110020875).

    [0157] An expression vector may optionally include a promoter that results in expression of an operably linked coding regino during growth in anaerobic conditions. Promoters act as regulatory signals that bind RNA polymerase in a cell to initiate transcription of a downstream (3 direction) coding region. The promoter is operably linked to a coding region, and the coding region may encode an exogenous polypeptide or an endogenous polypeptide. In one embodiment, a promoter is operably linked to more than one coding region, encoding exogenous polypeptides, endogenous polypeptides, or a combination thereof. Such an arrangement of one promoter controlling expression of two or more operably linked coding regions is often referred to as an operon. In one embodiment, a exogenous promoter may be present in the genomic DNA and operably linked to an endogenous coding region.

    [0158] In one embodiment, a suitable promoter causes expression of an operably linked coding region at temperatures of at least 30 C., at least 40 C., at least 50 C., at least 60 C., at least 70 C., at least 80 C., at least 90 C., or up at 100 C. In one embodiment, a suitable promoter causes expression of an operably linked coding region at temperatures between 30 C. and 100 C., between 50 C. and 90 C., or between 60 C. and 80 C.

    [0159] In one embodiment, a promoter is one that functions in an archaeon, e.g., a promoter that is recognized by a highly conserved transcription complex present in archaea cells. Archaeal promoters do not have the same structure as promoters present in members of the domain Bacteria. One transcription factor important in the transcription of archaeal coding regions is TFB, a homologue of the eukaryotic TFIIB. Archaeal promoters often include a TATA box which may be centered 24 to 28 nucleotides upstream of a transcription start site, and the TATA box can be represented as a conserved 8 base pair sequence element TTTAWAta, where W is A or T, and R is A or G. An archaeal promoter may also include a TFB responsive element (cRNaANt), where R is A or G, and N is any nucleotide upstream and adjacent to the TATA box (Gregor and Pfeifer, 2005, Microbiology, 151:25-33; Bell et al., 1999, Mol. Cell., 4:971-982; Bell et al., 1999, PNAS USA, 96:13662-13667).

    [0160] In one embodiment, a promoter is one that functions in a member of the domain Bacteria. The characteristics of bacterial promoters are known to the person skilled in the art, and include, for instance, a 10 element and a 35 element. A consensus sequence for the 10 element is TATAAT, and a consensus sequence for the 35 element is TTGACA; however, these consensus sequences are often not present in a promoter. Instead, a 10 element and a 35 element of a bacterial promoter often has only three or four of the six nucleotides in an element that match the consensus. Some bacterial promoters may also include an UP element, located upstream of the 35 element. Bacterial promoters are recognized by bacterial RNA polymerase, and are not recognized by a native RNA polymerase normally produced by an archaeon. Bacterial RNA polymerase includes 5 subunits, including a sigma subunit. Bacterial promoters having a 10 element and a 35 element as described above are recognized by an RNA polymerase that includes a sigma-70 subunit.

    [0161] In those embodiments where a bacterial promoter is present in a genetically engineered archaeon, the genetically engineered archaeon requires a bacterial RNA polymerase to drive expression of a coding region operably linked to the bacterial promoter. Thus, a genetically engineered archaeon containing a bacterial promoter on an exogenous polynucleotide also includes coding regions encoding the subunits of an RNA polymerase that will recognize and bind to a bacterial promoter and result in expression of a coding region operably linked to the bacterial promoter. A bacterial promoter and the coding regions encoding the RNA polymerase subunits may be on the same exogenous polynucleotide or may be on separate exogenous polynucleotides in a genetically engineered archaeon. Coding regions encoding RNA polymerase subunits present on an exogenous polynucleotide present in a genetically engineered archaeon are operably linked to a promoter described herein, such as a temperature sensitive promoter or a constitutive promoter that functions in an archaeon.

    [0162] The promoter useful in methods described herein may be, but is not limited to, a constitutive promoter, a temperature sensitive promoter, a non-regulated promoter, or an inducible promoter. A constitutive promoter drives expression of an operably linked coding region in a microbe when cultured at the temperatures described herein. The expression of a coding region operably linked to a constitutive promoter occurs at both high and low incubation temperatures, and the level of expression does not change substantially when expression at higher and lower incubation temperatures is compared. An example of a constitutive promoter is P.sub.slp, a P. furiosus promoter of the highly expressed S-layer protein (Chandrayan et al., 2012. J. Biol. Chem., 287:3257-3264). Other examples of constitutive promoters include P.sub.gdh, P.sub.pep and P.sub.por, which are promoters in both P. furiosus and T. kodakarensis of the highly expressed glutamate dehydrogenase, phosphoenolpyruvate synthase and pyruvate ferredoxin oxidoredutase subunit , respectively (for example, see Lipscomb et al. 2011. Appl. Environ. Microbiol. 77:2232-2238; Chandrayan et al., 2012. J. Biol. Chem., 287:3257-3264).

    [0163] The promoter may be a temperature sensitive promoter. In one embodiment, a temperature sensitive promoter drives expression of an operably linked coding region in a microbe at a greater level during incubation at low temperatures when compared to expression during incubation at high temperature. Such a promoter is referred to herein as a cold shock promoter. A cold shock promoter is induced at temperatures lower than the optimum growth temperature (T.sub.opt) of a microbe. In one embodiment, a cold shock promoter is induced when a microbe is cultured at a temperature of no greater than 75 C., no greater than 70 C., no greater than 65 C., no greater than 60 C., no greater than 55 C., no greater than 50 C., no greater than 45 C., no greater than 40 C., or no greater than 35 C. In one embodiment, a cold shock promoter is induced when a microbe is cultured at a temperature between 35 C. and 45 C., between 40 C. and 50 C., between 45 C. and 55 C., between 50 C. and 60 C., between 55 C. and 65 C., between 60 C. and 70 C., or between 65 C. and 75 C. Induction of a cold shock promoter in a genetically engineered microbe may result in an upregulation of expression of an operably linked coding region by at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, or at least 30-fold compared to expression of the same operably linked coding region during growth of the genetically engineered microbe at its T.sub.opt.

    [0164] Examples of cold shock promoters include those operably linked to the coding regions of P. furiosus described by Weinberg et al., (2005, J. Bacteriol., 187:336-348). A promoter is present in the region immediately upstream of the first codon of a coding region. In one embodiment, at least 150 nucleotides upstream to at least 200 nucleotides upstream of the first codon of the operably linked coding region includes the promoter. The size of the region that includes a promoter may be limited by the presence of an upstream coding region such as a start codon (for a coding region on the opposite strand) or a stop codon (for a coding region on the same strand). Identifying promoters in microbes, including hyperthermophilic archaeae and thermophilic archaeae, is routine (see, for example, Lipscomb et al., 2009, Mol. Microbiol., 71:332-349). Other archaea contain homologues of the coding regions described by Weinberg et al., and the promoters of such homologues can be evaluated for induced expression at lower temperatures. Cold sock promoters may be produced using recombinant techniques.

    [0165] In one embodiment, a temperature sensitive promoter drives expression of an operably linked coding region in a microbe at a decreased level during incubation at low temperatures when compared to expression during incubation at high temperature. Such a promoter is referred to herein as a cold repressed promoter. As described herein, a genetically engineered microbe may be used to produce a product; however, the microbe may normally produce an endogenous enzyme that uses the product or an intermediate leading to the product. The use of a cold repressed promoter is advantageous in such an embodiment. The genetically engineered microbe may be modified to decrease the production of the endogenous enzyme. For instance, a microbe may be genetically engineered by removing the promoter driving expression of an endogenous enzyme and replacing it with a cold repressed promoter.

    [0166] A cold repressed promoter is repressed at temperatures lower than the T.sub.opt of a microbe. In one embodiment, a cold repressed promoter is repressed when a microbe is cultured at a temperature of no greater than 75 C., no greater than 70 C., no greater than 65 C., no greater than 60 C., no greater than 55 C., no greater than 50 C., no greater than 45 C., no greater than 40 C., or no greater than 35 C. In one embodiment, a cold repressed promoter is induced when a microbe is cultured at a temperature between 35 C. and 45 C., between 40 C. and 50 C., between 45 C. and 55 C., between 50 C. and 60 C., between 55 C. and 65 C., between 60 C. and 70 C., or between 65 C. and 75 C. The use of a cold repressed promoter in a genetically engineered microbe may result in an down-regulation of expression of an operably linked coding region by at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, or at least 30-fold compared to expression of the same operably linked coding region during growth of the genetically engineered microbe at its T.sub.opt.

    [0167] Cold repressed promoters present in hyperthermophilic archaea and thermophilic archaea can be easily identified using routine methods. For instance, DNA microarray analysis can be used to compare expression of coding regions in an archaeon, such as a hyperthermophile, grown at its T.sub.opt and the arhaeon hyperthermophile grown at a temperature below the T.sub.opt. The temperature below the T.sub.opt may be, for instance, at least 20 C., at least 30 C., at least 40 C. below the T.sub.opt. The decrease in expression may be a change of at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold when comparing expression at the two temperatures. Examples of cold repressed promoters include, but are not limited to, the promoter upstream of the hypothetical polypeptide encoded by coding region PF0882 of P. furiosus, the promoter upstream of the polypeptide encoded by coding region PF0421 of P. furiosus, and the promoter upstream of the polypeptide encoded by coding region PF0198 of P. furiosus (Kelly et al., WO 2013/067326). The promoters of Kelly et al. may be used by attaching a coding region such that the first codon of the coding region is present immediately adjacent to and downstream of the nucleotide located at the 3 end. In one embodiment, a promoter includes at least 200 consecutive nucleotides, at least 250 consecutive nucleotides, at least 300 consecutive nucleotides, at least 350 consecutive nucleotides, or at least 400 consecutive nucleotides.

    [0168] A vector may include a ribosome binding site (RBS) and a start site (e.g., the codon ATG) to initiate translation of the transcribed message to produce the polypeptide. Like other regulatory sequences, a RBS may be heterologous with respect to a host cell. When expressing an exogenous polynucleotide in P. furiosus, it was found that the RBS needed to be carefully considered to ensure expression. A consensus RBS that may be used in P. furiosus is TAGTGGAGGATA (SEQ ID NO:306), where the underlined portion of the consensus RBS is usually at nucleotide position 10 to 5 relative to the start codon of the operably linked coding region. Other examples of useful RBS sequences include, but are not limited to, GGTGATATGCAATG (SEQ ID NO:307), GGAGGTGGAGAAAATG (SEQ ID NO:308), GGAGGTTTGAAGATG (SEQ ID NO:309), GGAGGTGTGGGAAAATG (SEQ ID NO:310), and GGAGGGGGTGAGAGAGATG (SEQ ID NO:311), where the predicted RBS is underlined and the first codon of an operably linked coding region is a double underlined ATG.

    [0169] A vector may also include a termination sequence to end translation. A termination sequence is typically a codon for which there exists no corresponding aminoacetyl-tRNA, thus ending polypeptide synthesis. The polynucleotide used to transform the host cell can optionally further include a transcription termination sequence, and one example is AATCTTTTTTAG (SEQ ID NO:312).

    [0170] A vector introduced into a host cell optionally includes one or more marker sequences, which typically encode a molecule that inactivates or otherwise detects or is detected by a compound in the growth medium. For example, the inclusion of a marker sequence may render the transformed cell resistant to an antibiotic, or it may confer compound-specific metabolism on the transformed cell. Examples of a marker sequence include, but are not limited to, sequences that confer resistance to kanamycin, ampicillin, chloramphenicol, tetracycline, streptomycin, and neomycin. Examples of nutritional markers useful with certain host cells, including extremophiles, are disclosed in Lipscomb et al. (US Published Patent Application 20120135411), and include, but are not limited to, a requirement for uracil, histidine, or agmatine.

    [0171] Polynucleotides of the present invention may be obtained from microbes, or produced in vitro or in vivo. For instance, methods for in vitro synthesis include, but are not limited to, chemical synthesis with a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic polynucleotides and reagents for such synthesis are well known.

    [0172] Also disclosed herein are genetically engineered microbes that have exogenous polynucleotides encoding one or more of the polypeptides disclosed herein. Compared to a control microbe that is not genetically modified in the same way, a genetically engineered microbe exhibits production of 3-HP, 4-HB, acetyl-CoA, or another product, or exhibits increased production of 3-HP, 4-HB, acetyl-CoA, or another product. Accordingly, in one aspect of the invention a genetically engineered microbe may include one or more exogenous polynucleotides that encode one or more of the polypeptides described herein. Exogenous polynucleotides encoding the polypeptides may be present in the microbe as a vector or integrated into a chromosome. In one embodiment, a genetically engineered microbe can exhibit an increase in production of 3-HP, 4-HB, acetyl-CoA, or another product that at least 5%, 10%, 25%, 50%, 75%, 100%, 150%, or 200% greater than the production of 3-HP, 4-HB, acetyl-CoA, or another product by an appropriate control.

    [0173] Examples of useful bacterial host cells include, but are not limited to, Escherichia (such as Escherichia coli), Salmonella (such as Salmonella enterica, Salmonella typhi, Salmonella typhimurium), a Thermotoga spp. (such as T. maritima), an Aquifex spp (such as A. aeolicus), photosynthetic organisms including cyanobacteria (e.g., a Synechococcus spp. such as Synechococcus sp. WH8102 or, e.g., a Synechocystis spp. such as Synechocystis PCC 6803) and photosynthetic bacteria (e.g., a Rhodobacter spp. such as Rhodobacter sphaeroides), a Caldicellulosiruptor spp., such as C. bescii, and the like. Examples of useful archaeal host cells include, but are not limited to members of the Order Thermococcales (including a member of the genus Pyrococcus, for instance P. furiosus, P. abyssi, or P. horikoshii, or a member of the genus Thermococcus, for instance, T. kodakaraensis or T. onnurineus), members of the Order Sulfolobales (including a member of the genus Metallosphaera, for instance, M. sedula), and members of the Order Thermotogales (including members of the genus Thermotoga, for instance, T. maritima or T. neapolitana).

    [0174] A genetically engineered microbe having exogenous polynucleotides encoding one or more of the polypeptides disclosed herein optionally includes a source of electrons that can be used for the reduction of CO.sub.2 and/or other intermediates in the 4-HB cycle. In one embodiment, a source of electrons is hydrogenase, which catalyzes the reversible interconversion of H.sub.2, protons, and electrons. A genetically engineered microbe may naturally include a hydrogenase suitable for supplying reductant, and in one embodiment, such a genetically engineered microbe may express an endogenous hydrogenase polypeptide at an increased level or have altered activity. For instance, a genetically engineered microbe may include an altered regulatory sequence, where the altered regulatory sequence is operably linked to one or more coding regions encoding subunits of a hydrogenase polypeptide. In another example, an endogenous polynucleotide encoding a subunit of a hydrogenase polypeptide may include a mutation, such as a deletion, an insertion, a transition, a transversion, or a combination thereof, that alters a characteristic of the hydrogenase polypeptides, such as the activity. In those aspects where a genetically engineered microbe expresses an endogenous hydrogenase polypeptide at an increased level or having altered activity, the microbe is typically an archaea, such as Pyrococcus spp., such as P. furiosus, P. abyssi, and P. horikoshii, a Thermococcus spp., such as T. kodakaraensis and T. onnurineus, and the like. Methods for modifying genomic DNA sequences of thermophiles and hyperthermophiles are known (Lipscomb et al. (US Published Patent Application 20120135411).

    [0175] In one embodiment, a genetically engineered microbe may include exogenous polypeptides encoding the subunits of a hydrogenase. In one embodiment, the hydrogenase may be an NADPH-dependent hydrogenase. Examples of hydrogenases and their expression in microbes are described in Adams et al. (US Patent Application 20110020875), and Chandrayan et al. (2012, J. Biol. Chem., 287(5):3257-3264). In one embodiment, a hydrogenase includes 4 subunits, alpha, beta, gamma, and delta. In one embodiment, a hydrogenase is 2 subunits, alpha and delta.

    [0176] A genetically engineered microbe may include other modifications in addition to exogenous polynucleotides encoding one or more of the polypeptides disclosed herein, or expressing an endogenous hydrogenase polypeptide at an increased level or having altered activity. Such modifications may provide for increased production of electron donors used by a hydrogenase polypeptide, such as NADH or NADPH.

    [0177] Also provided are methods for using the polypeptides described herein. In one embodiment, the methods include providing the polypeptides for subpathway 1, subpathway 2, subpathway 3, or a combination thereof. In one embodiment, a combination is subpathway 1 and subpathway 2. In one embodiment, a combination is subpathway 1, subpathway 2, and subpathway 3. In one embodiment, a combination is subpathway 2 and subpathway 3. In one embodiment, a combination is subpathway 1 and subpathway 3. The polypeptides are incubated under conditions suitable for producing desirable products such 3-HP, 4-HB, and/or other products. Optionally, the product is collected using methods routine and known in the art.

    [0178] In one embodiment, a source of reductant is also provided. In one embodiment, a source of reductant is provided by use of a hydrogenase.

    [0179] In one aspect, the polypeptides used in the methods are cell-free. For instance, the polypeptides are isolated, or optionally purified. The incubation conditions are typically anaerobic, and the temperature may be at least 60 C., at least 70 C., at least 80 C., or at least 90 C. The methods can be performed in any convenient manner. Thus, the reaction steps may be performed in a single reaction vessel. The process may be performed as a batch process or as a continuous process, with desired product and waste products being removed continuously and new raw materials being introduced.

    [0180] In another embodiment, the polypeptides used in the methods are present in a genetically engineered microbial cell. The methods can include incubating the microbial cell under conditions suitable for the expression of the polypeptides. The microbial cell may be a bacterial cell, such as a gram negative, for instance, E. coli, a photosynthetic organism, for instance, R. sphaeroides, or it can be an archaeal cell, for instance, a member of the genera Pyrococcus, for instance P. furiosus, P. abyssi, or P. horikoshii, or a member of the genera Thermococcus, for instance, T. kodakaraensis or T. onnurineus. The incubation conditions are typically anaerobic, and the temperature may be at least 37 C., at least 60 C., at least 70 C., at least 80 C., or at least 90 C. The use of these conditions results in several advantages. Growth at high temperatures reduces the risk of contamination, as growth of most microbes is reduced, or non-existent. The use of anaerobic conditions reduces the risks inherent in processing compounds that can be used as fuels, such as combustion. Moreover, the hyperthermophiles like Pyrococcus and Thermococcus have genomes of reduced complexity, and encode fewer polypeptides. The reduced complexity results in a more streamlined metabolism with fewer intermediates and decreased metabolic diversity. Hence, there is a decreased likelihood that there will overlap between the metabolites and/or enzymes of the host with those in the engineered metabolic pathway.

    [0181] The conditions used to incubate the microbial cell typically include substrates that can be used by a cell to produce a reductant, such as NADPH. In one embodiment, the conditions used to incubate the microbial cell can include H.sub.2, which can be used by the hydrogenase polypeptide to convert NADP to NADPH. The methods can be performed using any convenient manner. For instance, methods for growing microbial cells to high densities are routine and known in the art, and include batch and continuous fermentation processes.

    [0182] In one embodiment, the method includes initial growth at a higher temperature followed by a shift to a lower temperature. The shift to a lower temperature can result in greater activity of one or more of the polypeptides described herein. In one embodiment, the greater activity may be due to increased expression of a coding region encoding one or more of the polypeptides, as is the case when a coding region is operably linked to a temperature sensitive promoter. In one embodiment, the greater activity may be due to the shift to a temperature that is better tolerated by the one or more polypeptides. Further details on expression of desired polypeptides below a microbe's T.sub.opt, and the production of desired products, are disclosed in Kelly et al. (WO 2013/067326).

    [0183] The methods disclosed herein may be used to make 3-HP, 4-HB, and other products. The 4-HB cycle results in the production of acetyl CoA. Acetyl CoA is an ideal product as it represents an activated reduced C-2 unit that is of fundamental importance in conventional biosynthetic pathways. For example, acetyl CoA is the building block for the biosynthesis of fatty acids, polyisoprenoids and hydroxyacids (such as 3-HB), all of which are potential sources of alkane-based fuels and/or plastics. Thus, the 4-HB cycle can be used to directly generate a range of biofuels, including alkanes, biodiesel (fatty acid esters) and ethanol, as well as butanol. Moreover, when converted to pyruvate, for instance by reductive carboxylation, acetyl CoA can serve as the primary carbon and electron source for all known biofuels (Connor et al., 2009, Curr Opin Biotechnol 20:307-315, Lee et al., 2008, Curr Opin Biotechnol 19:556-63, Peralta-Yahya et al., Biotechnol J 5:147-62). Methods for converting acetyl CoA to pyruvate are known and routine. Likewise, methods for converting any compound produced by the 3-HP/4-HB cycle to other useful products are known and routine. Other products that may be produced using the methods disclosed herein include, but are not limited to, 1,4-butanediol, succinic acid, isopropanol, ethanol, diols, and organic acids such as lactic acid, acetic acid, formic acid, citric acid, oxalic acid, and uric acid. The synthesis of 3-HP, 4-HB, acetyl-CoA, and other products may be a starting material for the synthesis of other compounds.

    [0184] A method for using a genetically engineered microbe may also include recovery of the product produced by the genetically engineered microbe. The method used for recovery depends upon the product, and methods for recovering products resulting from microbial pathways, including carbohydrate metabolism, are known to the skilled person and used routinely. For instance, when the product is ethanol, the ethanol may be distilled using conventional methods. For example, after fermentation the product, e.g., ethanol, may be separated from the fermented slurry. The slurry may be distilled to extract the ethanol, or the ethanol may be extracted from the fermented slurry by micro or membrane filtration techniques.

    [0185] Also provided herein are methods for making a genetically engineered microbe. The method includes introducing into a microbe at least one polynucleotide. In one embodiment, the polynucleotide encodes a polypeptide described herein, so that the microbe produces 3-HP, 4-HB, acetyl-CoA, or another product. In one embodiment, the introduced polynucleotide modifies an endogenous polynucleotide such that expression of an endogenous polypeptide is increased, or the amino acid sequence of an endogenous polypeptide is altered. An example of altering the amino acid sequence of an endogenous polypeptide includes modifying the amino acid sequence encoded by coding sequence Msed_1353 in a M. sedula such that the amino acid at residue 424 is not the tryptophan present in a wild type Msed_1353, and is a different amino acid, such as glycine.

    [0186] The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

    Example 1

    [0187] Metallosphaera sedula is an extremely thermoacidophilic archaeon that grows heterotrophically on peptides, and chemolithoautotrophically on hydrogen, sulfur, or reduced metals as energy sources. During autotrophic growth, CO.sub.2 is incorporated into cellular carbon via the 3-hydroxypropionate/4-hydroxybutyrate cycle (3HP/4HB). To date, all steps in the pathway have been connected to enzymes encoded in specific genes, except for the one responsible for ligation of coenzyme A (CoA) to 4-hydroxybutyrate (4HB). While several candidates for this step have been identified through bioinformatic analysis of the M. sedula genome, none have been shown to catalyze this biotransformation. Here, transcriptomic analysis of cells grown under strict H.sub.2CO.sub.2 autotrophy uncovered two additional candidates, encoded in Msed_0406 and Msed_0394. Recombinant versions of these enzymes catalyzed the ligation of CoA to 4HB, with similar affinities for 4HB (Km values of 1.9 and 1.5 mM for Msed_0406 and Msed_0394, respectively), but with different rates (1.69 and 0.22 molminmg.sup.1 for Msed_0406 and Msed_0394, respectively). Neither Msed_0406 nor Msed_0394 have close homologs in other Sulfolobales, although low sequence similarity is not unusual for acyl-adenylate forming enzymes. The capacity for these two enzymes to use 4HB as a substrate may have arisen from simple modifications to acyl-adenylate forming enzymes. For example, a single-amino acid substitution (Trp424 to Gly) in the active site of the acetate/propionate synthetase (Msed_1353), an enzyme that is highly conserved among the Sulfolobales, changed its substrate specificity to include 4HB. The identification of the 4-HB CoA synthetase now completes the set of enzymes comprising the 3HP/4HB cycle.

    Experimental Procedures

    [0188] Growth of M. sedula in a Gas Intensive Bioreactor

    [0189] M. sedula (DSMZ 5348) was grown aerobically at 70 C. in a shaking oil bath (90 rpm) under autotrophic or heterotrophic conditions on DSMZ medium 88 at pH 2. Heterotrophically-grown cells were supplemented with 0.1% tryptone. Cell growth was scaled up from 300 ml in sealed one liter bottles (Auernik and Kelly, 2010, Appl. Environ. Microbiol. 76, 931-935) to 2 liters in a stirred bench-top glass fermentor (Applikon), also on DSMZ medium 88 (pH 2) at 70 C., and agitated at 250 rpm. Two separately regulated gas feeds were used such that flow rates were held constant for all conditions at 1 ml/min for the hydrogen/CO.sub.2 gas mixes (composition varied) and 100 ml/min for air (composition78% N.sub.2, 21% O.sub.2, 0.03% CO.sub.2). For the autotrophic, carbon-rich (ACR) condition, the gas feed contained H.sub.2 (80%) and CO.sub.2 (20%); for the autotrophic carbon-limited (ACL) condition the feed was changed to H.sub.2 (80%) and N.sub.2 (20%); for the heterotrophic condition (HTR), the medium was supplemented with 0.1% tryptone and the gas feed composition was N.sub.2 (80%) and CO.sub.2 (20%). Tandem fermentors were run simultaneously with the same inoculum to generate biological repeats (FIG. 2). Cells were harvested at mid-exponential phase by rapid cooling with dry ice and ethanol, and then centrifuged at 6,000g for 15 min at 4 C.

    [0190] M. sedula Oligonucleotide Microarray Transcriptional Response Analysis

    [0191] A spotted whole-genome oligonucleotide microarray, based on 2,256 protein-coding open reading frames (ORFs), was used, as described previously (Auernik and Kelly, 2008, Appl. Environ. Microbiol. 74, 7723-7732). Total RNA was extracted and purified (RNeasy; Qiagen), reverse transcribed (Superscript III; Invitrogen), re-purified, labeled with either Cy3 or Cy5 dye (GE Healthcare), and hybridized to the microarray slides (Corning). Slides were scanned on a GenePix 4000B Microarray Scanner (Molecular Devices, Sunnyvale, Calif.), and raw intensities were quantitated using GenePix Pro v6.0. Normalization of data and statistical analysis were performed using JMP Genomics 5 (SAS, Cary, N.C.). In general, significant differential transcription was defined to be relative change at or above 2 (where a log.sub.2 value of 1 equals a two-fold change) with significance values at or above the Bonferroni correction; for these data, this was 5.4 (equivalent to a p-value of 4.010.sup.6). Microarray data are available through the NCBI Gene Expression Omnibus (GEO) under accession number GSE39944.

    [0192] Enzyme Assays for 4-Hydroxybutyrate-CoA Synthetase

    [0193] Two assays were used to measure ligase activity, one spectrophotometric and one using high-performance liquid chromatography (HPLC). A discontinuous assay was used to measure substrate-dependent disappearance of CoA at 75 C. The reaction mixture (600 l) contained 100 mM MOPS-KOH (pH 7.9), 5 mM MgCl.sub.2, 2.5 mM ATP, 0.15 mM CoA, and purified enzyme. At each time point, 80 l of reaction mixture was added to 80 l cold 5,5-dithiobis-(2-nitrobenzoic acid) (DTNB). A time point (0 min) was taken before heating. The reaction mixture was incubated for 2 min at 75 C., followed by addition of substrate. Additional time points were taken at 30, 60, 90, 120, and 180 sec after addition of substrate. Absorbance was measured at 412 nm to determine free CoA concentration, based on the concentration of 2-nitro-5-thiobenzoate dianion (NTB.sup.2) (.sub.412=14,150 M.sup.1 cm.sup.1) (Hawkins et al., 2011, ACS Catal. 1, 1043-1050, Riddles et al., 1983, Methods in Enzymology 91, 49-60). Enzymes were kinetically characterized by varying the concentration of the acyl-CoA substrate from 0.05 mM to 12 mM, while the other substrate concentrations were held constant. Measurements for specific activity were taken under saturating substrate concentrations (10 mM). Formation of the CoA ester was also confirmed using HPLC (Waters). The reaction mixture (0.15 ml) contained 100 mM potassium phosphate (pH 7.9), 10 mM MgCl.sub.2, 2 mM ATP, 0.5 mM CoA, 10 mM substrate, and purified enzyme. The reaction was incubated for 3 min at 75 C., quenched with 15 l 1M HCl, filtered with a 10 kDa spin column (Amicon YM-10) to remove the protein, and loaded onto a reversed-phase C18 silica-based column (Shodex C18-4E, 4.6250 mm). The mobile phase was 50 mM sodium phosphate buffer (pH 6.7) with 2% methanol.

    [0194] Heterologous Expression of M. sedula Genes in E. coli

    [0195] M. sedula genes encoding acyl-CoA synthetases were amplified from genomic DNA using primers synthesized by Integrated DNA Technologies (Coralville, Iowa). Msed_0394 and Msed_0406 were ligated into pET46-Ek/LIC, while Msed_1353 was ligated into pET21b using NdeI and XhoI restrictions sites. All constructs were designed to express with an N-terminal His.sub.6-tag. Plasmids containing gene inserts were cloned into Novablue GigaSingles E. coli competent cells and selected by growth on LB-agar supplemented with ampicillin (100 g/ml). Plasmid DNA was extracted using a QIAprep Spin Miniprep kit. Sequences were confirmed by Eton Biosciences, Inc. (Durham, N.C.). For protein expression, the plasmids were transformed into E. coli Rosetta 2 (DE3) cells and selected by growth on LB-agar, supplemented with ampicillin (100 g/ml) and chloramphenicol (50 g/ml). Cells harboring the recombinant plasmid were induced with IPTG (final concentration 0.1 mM) at OD.sub.600 0.4-0.6 and cultured for three hours before harvest.

    [0196] Purification of Recombinant Proteins

    [0197] Cells were harvested by centrifugation at 6,000g for 15 min at 4 C. Cell yields ranged from 1.6-3.8 g cells per liter LB medium (wet weight). Cell pellets were re-suspended in lysis buffer (50 mM sodium phosphate, 100 mM NaCl, 0.1% NP-40, pH 8.0) containing DNase and lysozyme at final concentrations of 10 and 100 g/ml, respectively. Cells were lysed with a French Press (two passes at 18,000 psi) and the lysate was centrifuged at 22,000g for 15 min at 4 C. to removed insoluble material. Soluble, cell-free extract was heated to 65 C. for 20 min to precipitate mesophilic proteins. Streptomycin sulfate (1% w/v) was added to precipitate nucleic acids, followed by a one hour incubation at 4 C. A final centrifugation was performed at 22,000g for 15 min at 4 C. to collect the soluble, heat-treated cell-free extract, which was sterile filtered (0.22 m) and purified using a 5 ml HisTrap nickel column (GE Healthcare). Proteins were bound to the HisTrap column using binding buffer (50 mM sodium phosphate, 500 mM NaCl, 20 mM imidazole, pH 7.4) and eluted using elution buffer (50 mM sodium phosphate, 500 mM NaCl, 300 mM imidazole, pH 7.4). SDS-PAGE was then performed on the IMAC fractions to qualitatively determine the purity of the protein before further purification. Chromatography fractions containing the protein were concentrated and exchanged into phosphate buffer (50 mM potassium phosphate, 150 mM NaCl, pH 7.0) using an Amicon YM10 (Millipore) centrifugal filter membrane, centrifuged at 4000g and 4 C. To quantify the amount of protein, a Bradford assay was performed on the concentrated IMAC fractions using known serial dilutions of bovine serum albumin (BSA) by taking absorbance readings at 595 nm. Protein was further purified using a Superdex 200 10/300 GL (GE Healthcare) gel filtration column. The proteins were eluted from the gel filtration column using elution buffer (50 mM potassium phosphate, 150 mM NaCl, pH 7.0). Proteins were dialyzed into 100 mM MOPS-KOH (pH 7.9) and either stored at 4 C. or mixed with glycerol to 20% and stored at 20 C.

    [0198] Site-Directed Mutagenesis of Msed_1353

    [0199] Msed_1353 was mutated with the GENEART Site-directed mutagenesis system (Life Technologies), using AccuPrime Pfx polymerase. Mutagenesis primers were designed to change W424 to glycine (Primer 1-5-CCCTTTGGTAGCACTTGGGGAATGACTGAAACTGG (SEQ ID NO:312; Primer 2reverse compliment of Primer 1). Plasmids with Msed_1353-G424 were cloned into Novablue GigaSingles E. coli competent cells and selected by growth on LB-agar supplemented with ampicillin (100 g/ml). Sequences were confirmed by Eton Biosciences Inc (Durham, N.C.).

    [0200] Structural Modeling of Acyl-CoA Synthetases

    [0201] Three-dimensional structural models for M. sedula acyl-CoA synthetases were made using the iterative threading assembly refinement (I-TASSER) online server (Berg 2011, Appl. Environ. Microbiol. 77, 1925-1936, Berg et al., 2010, Nat. Rev. Microbiol. 8, 447-460, Roy et al., 2010, Nat Protoc 5, 725-738). The server first generates three-dimensional atomic models from multiple threading alignments and iterative structural assembly, and then infers function by structural matching to other known proteins. All structures were generated using the Protein Data Base entry for S. enterica Acs (STM4275, 1PG4) as a threading template for additional restraint specification. Amino acid sequence alignments were generated using the UCSF Chimera package by superposition of I-TASSER 3D structural models with the PDB structure for S. enterica Acs.

    [0202] Materials

    [0203] Plasmid vectors and strains were obtained from Novagen (San Diego, Calif.) and Stratagene (La Jolla, Calif.). Chemicals, devices, and reagents were obtained from Fisher Scientific (Pittsburgh, Pa.), ACROS Organics (Geel, Belgium), Sigma Chemical Co. (St. Louis, Mo.), New England Biolabs (Ipswich, Mass.), Qiagen (Valencia, Calif.), Millipore (Billerica, Mass.) and Invitrogen (Grand Island, N.Y.). Gases were purchased from Airgas National Welders (Charlotte, N.C.). Protein purification columns were obtained from GE Healthcare (Piscataway, N.J.). The Bradford Assay reagent was obtained from Bio-Rad (Hercules, Calif.). Site-directed mutagenesis kit was obtained from Invitrogen (Life Technologies).

    Results

    [0204] Metallosphaera sedula Autotrophic Growth is Hydrogen-Limited

    [0205] In order to explore the optimal growth conditions for H.sub.2CO.sub.2 autotrophy in M. sedula, a fermentation system was designed to allow controlled definition of the gas feed. Previous autotrophic work with M. sedula was done in batch cultures in an orbital shaking bath at 70 C. (Berg, 2011, Appl. Environ. Microbiol. 77:1925-1936, Berg et al., 2007, Science, 318:1782-1786, Alber et al., 2008, J. Bacteriol. 190:1383-1389, Hugler et al., 2003, Arch. Microbiol. 179:160-173, Auernik and Kelly, 2010, Appl. Environ. Microbiol., 76:931-935). In that case, gas-fed cultures were grown by replacing the air in a sealed volume with a gaseous mixture of a known composition. Mass transfer of H.sub.2, CO.sub.2, and O.sub.2 into the culture medium was limited to diffusion across the vapor-liquid interface. Gas limitation presumably affected these cultures, and led to sub-optimal growth, as evidenced by the slow doubling time that resulted for M. sedula under these conditions (t.sub.d=11 to 13 h).

    [0206] In order to grow M. sedula autotrophically with more optimal delivery of gaseous substrate to the liquid medium, a semi-continuous fermentation system was developed using a 3 L bioreactor. The system was modified to have two separate gas feeds that sparged directly into the media (sparging stone2 m pore size). Microbubble sparging stones were used to promote dissolution of sparingly soluble gases, in particular H.sub.2. The bioreactor and console were situated inside a modified fume hood, with an airflow monitoring system in place to detect hood failure. Tandem fermentors were seeded with the same inoculum and run simultaneously to provide a biological repeat.

    [0207] Growth of M. sedula in an aerobic, autotrophic fermentation system was expected to be H.sub.2-, and not O.sub.2-limited. Below saturating conditions, growth rates varied according to the amount of H.sub.2 fed to the culture. For high H.sub.2 supply rates (i.e., 30 ml/min), the growth rates were comparable to the fastest growth rates previously observed under heterotrophy (t.sub.d=4.8 h); concomitantly, the culture reached a cell density of 210.sup.9 cells/ml. the highest observed under autotrophic conditions. At a H.sub.2 supply rate of 15 ml/min, the growth rate slowed (t.sub.d=6 h) although the final density was comparable to the 30 ml/min case (1.510.sup.9 cells/ml). A 30-fold reduction in H.sub.2 flow rates (1 ml/min) caused the growth rate to decrease by half (t.sub.d=9.7 h) and the cells to enter stationary phase at 810.sup.8 cells/ml.

    [0208] A similar trend emerged in response to limiting levels of CO.sub.2. When CO.sub.2 was supplemented in the gas feed (referred to here as rich autotrophy), the growth rate was faster that observed for cells grown with air as the only source of CO.sub.2 (t.sub.d=6.8 h vs. 9.4 h, respectively). The growth rate for heterotrophically grown cells (t.sub.d=6.7 h) was comparable to the rich autotrophy condition. This suggests that, under the rich autotrophy condition, the cells were not limited by any one particular gaseous substrate and were doubling at or near their maximal rate. The decrease in growth rate for the carbon-limited autotrophy arises from the limiting amounts of CO.sub.2 available in the medium.

    [0209] Optimized H.sub.2CO.sub.2 Autotrophy Conditions LED to Enhanced Transcriptomic Response

    [0210] The optimized autotrophic growth conditions enhanced the global transcriptional response compared to previous work (Berg et al., 2007, Science, 318:1782-1786, Huber et al., 2008, Proceedings of the National Academy of Sciences, U.S.A, 105:7851-7856, Auernik and Kelly, 2010, Appl. Environ. Microbiol., 76:931-935). Of the 2293 protein coding genes in the 2.2 kb M. sedula genome, nearly half (984 genes) exhibited changes in transcription (either up- or down-regulation) of two-fold or greater, when comparing heterotrophy (HTR) to the autotrophic carbon-limited (ACL) condition (See Table 2). The number of genes that were differentially transcribed was twice as high as previously observed (Berg et al., 2010, Nat. Rev. Microbiol. 8:447-460, Auernik and Kelly, 2010, Appl. Environ. Microbiol., 76:931-935), which could be attributed to the refined conditions for autotrophic growth. Also, in the experiments reported here, it should be mentioned that the improved sensitivity of new equipment used for scanning microarray slides improved the resolution and dynamic response.

    TABLE-US-00002 TABLE 2 Enhanced Transcription Response for M. sedula Autotrophy ACL-ACR ACL-HTR ACR-HTR A-H (1) # of genes UP-regulated 52 467 433 229 (2-fold or more) # of genes DOWN- 124 517 464 252 regulated (2-fold or more) (1) Auernik and Kelly, 2010, Appl. Environ. Microbiol. 76: 931-935

    [0211] Overall, the global transcriptional changes were extensive. Transcripts for the characteristic enzymes of the 3HP/4HB pathway were significantly up-regulated on ACL-HTR. For example, the genes encoding - and -subunits of acetyl-CoA/propionyl-CoA carboxylase (Msed_0147-0148), were up-regulated 18- and 29-fold, respectively, while the 4-hydroxybutyryl-CoA dehydratase gene (Msed_1321), was up-regulated 27-fold. Hydrogenases and hydrogenase assembly and maturation proteins in both the cytosolic hydrogenase operon (Msed_0921-0933) and the membrane-bound hydrogenase operon (Msed_0947-0950) were both highly up-regulated on ACL-HTR, from 3- to 47-fold higher.

    [0212] New Candidates for 4-Hydroxybutyrate-CoA Synthetase Identified from Refined Transcriptomic Data

    [0213] The refined transcriptomic data provided new insights into the putative candidates for 4-hydroxybutyrate-CoA synthetase (FIG. 3). Based on bioinformatic analysis, there are nine candidate genes encoding acyl-CoA synthetases (not including Msed_1456, which was confirmed as a 3HP-CoA synthetase). The high up-regulation of Msed_1422 under autotrophy (13-fold increase) that was observed in this work is consistent with previous transcriptomic studies. On the basis of that initial study, Msed_1422 was chosen for recombinant expression and testing (Berg, 2011, Appl. Environ. Microbiol. 77:1925-1936, Ramos-Vera et al., 2011, J. Bacteriol. 193:1201-1211, Estelmann et al., 2011, J. Bacteriol. 193:1191-1200). In the same study recombinant forms of Msed_1291 and Msed_1353 were also produced, which were chosen based on homology to a confirmed 4HB-CoA synthetase from Thermoproteus neutrophilus (Tneu_0420). None of these enzymes showed activity on 4HB. Msed_1422 and Msed_1291 showed no activity on acetate, propionate, 3HP, 3HB, 4HB, or crotonate, and Msed_1353 had activity only on acetate and propionate, but not 4HB. Thus, it appears that Msed_1353 is a promiscuous acetate/propionate synthetase, while the substrate specificities of Msed_1422 and Msed_1291 remain unknown.

    [0214] Among the other potential candidates that were annotated as acetate-CoA synthetases or medium-chain fatty acid-CoA synthetases (FIG. 3), most showed no transcriptional response, had average or low levels of transcription, or were clearly down-regulated under autotrophy. The new transcriptomic data were consistent with the expression of two previously unexamined candidates, Msed_0406 and Msed_0394, which are annotated as an acetyl-CoA synthetase (ACS) and AMP-dependent synthetase and ligase, respectively. Although Msed_0406 and Msed_0394 were both constitutively transcribed, with less than a two-fold change in transcription levels between the conditions tested, both of them were in the top 25% of the transcriptome. This served as the basis to investigate these two genes by recombinant expression and activity assays, given that no other promising candidates for this step had emerged.

    [0215] Kinetic Analyses of Msed_0394 and Msed_0406

    [0216] Recombinant forms of Msed_0394 and Msed_0406 were produced in E. coli and purified to electrophoretic homogeneity (see FIG. 9 for SDS-PAGE gels). For both enzymes, the production of 4HB-CoA from 4HB and CoA was confirmed using reversed-phase HPLC. Msed_0394 and Msed_0406 were active on a range of small organic acids (see Table 3 for a summary of kinetic data). FIG. 4 shows the relative specific activities on different substrates for Msed_0394, Msed_0406, along with reported data for 3HP-CoA synthetase (Msed_1456) for comparison (Berg et al., 2007, Science, 318:1782-1786, Alber et al., 2008, J. Bacteriol. 190:1383-1389, Estelmann et al., 2011, J. Bacteriol. 193:1191-1200. Note that the calculated molecular weight for these three enzymes varies slightly62 kDa for Msed_0394, 64 kDa for Msed_0406, and 74 kDa for Msed_1456; these specific activities here are meant to highlight substrate preference patterns for each enzyme.

    TABLE-US-00003 TABLE 3 Enzyme kinetic data for CoA synthetases from M. sedula V.sub.max (mol min.sup.1 k.sub.cat k.sub.cat/K.sub.m Enzyme Substrate K.sub.m (M) mg.sup.1) (s.sup.1) (s.sup.1 M.sup.1) Msed_0394 Acetate 680 0.13 0.14 200 Propionate 540 0.2 0.21 390 3- 1880 0.07 0.08 40 Hydroxypropionate 4-Hydroxybutyrate 1540 0.22 0.24 160 Butyrate 60 0.21 0.23 3700 Valerate 120 0.2 0.22 2000 Msed_0406 Acetate 2030 6.0 6.4 3200 Propionate 380 15.1 16.2 43000 3- 810 2.4 2.6 3200 Hydroxypropionate 4-Hydroxybutyrate 2000 1.7 1.8 910 Butyrate 320 7.9 8.4 26000 Valerate 740 5.2 5.6 7500 Msed_1353- 4-Hydroxybutyrate 1130 2.3 2.5 2180 G424

    [0217] The specific activities for Msed_0394 show little difference in the maximum reaction rate under saturating substrate concentrations for the different substrates. The highest reaction rate observed was 0.2 mol min.sup.1 mg.sup.1 for propionate, 4HB, and butyrate. However if the substrate specificities are taken into account a different picture emerges. A comparison of the catalytic specificity constants (k.sub.cat/K.sub.m) for each substrate tested with Msed_0394 (Table 3) shows that the highest value is for butyrate (3700 M.sup.1 s.sup.1), followed by valerate (2000 M.sup.1 s.sup.1), propionate (390 M.sup.1 s.sup.1), acetate (200 M.sup.1 s.sup.1), and finally 4HB (160 M.sup.1 s.sup.1). There is a clear preference for unsubstituted straight chain organic acids with chain length of four or five carbons. No activity was detected with the six carbon hexanoic acid.

    [0218] The specific activities for Msed_0406 under saturating substrate concentrations show the highest reaction rates for propionate (15.1 mol min.sup.1 mg.sup.1). The catalytic specificity constant profile for Msed_0406 shows that this enzyme works best on propionate (43000 M.sup.1 s.sup.1), then butyrate (26000 M.sup.1 s.sup.1), valerate (7500 M.sup.1 s.sup.1), acetate/3HP (3200 M.sup.1 s.sup.1), and then 4HB (910 M.sup.1 s.sup.1). The high V.sub.max for acetate/propionate, combined with the low K.sub.m for propionate, suggest that Msed_0406 is also a promiscuous acetate/propionate ligase, although one that also shows activity on 4HB.

    [0219] Site-Directed Mutagenesis of Msed_1353

    [0220] Msed_1353, a highly conserved gene among the Sulfolobales, was previously reported to have activity only on acetate and propionate (Berg et al., 2007, Science, 318:1782-1786, Alber et al., 2008, J. Bacteriol. 190:1383-1389, Ramos-Vera et al., 2011, J. Bacteriol. 193:1201-1211, Hgler et al., 2003, Eur. J. Biochem. 270:736-744, Alber et al., 2006, J. Bacteriol. 188:8551-8559, Auernik et al., 2008, Appl. Environ. Microbiol. 74:7723-7732). Initial efforts to identify the unknown 4HB-CoA synthetase in M. sedula involved purification of native enzyme activity and analysis of multiple SDS-PAGE gel bands using mass spectrometry. Msed_1353 was detected in these experiments and, based on the very large up-regulation of Msed_1353 under autotrophy, it was recombinantly produced to confirm its activity. Our results confirmed previous reports: under saturating substrate concentrations Msed_1353 had highest activity on acetate (8.9 mol min.sup.1 mg.sup.1-100%) and propionate (99%), but also on 3HP (8%) and butyrate (16%). However, no activity was found on 4HB or longer organic acid substrates (see FIG. 5A).

    [0221] Structural modeling of the binding pocket of Msed_1353 revealed a conserved tryptophan residue, similar to that seen in acetate-CoA synthetase (ACS) from S. enterica (Berg et al., 2007, Science, 318:1782-1786, Riddles et al., 1983, Methods in Enzymology 91:49-60, Gulick et al., 2003, Biochemistry 42:2866-2873). This tryptophan forms the bottom surface of the binding pocket and limits the size of substrate that can be accommodated within the active site. To test the importance of this residue in determining substrate specificity, Trp.sup.424 in Msed_1353 was mutated to a glycine to produce Msed_1353-G424. The single substitution mutant (Trp.sup.424.fwdarw.Gly) was predicted to contain a larger interior binding pocket for the hydrophobic end of the substrate. Accordingly, it showed a dramatic change in specificity (FIG. 5B). Activity for the mutant on acetate and propionate decreased by 60%, from 8.9 to 3.6 and 8.8 to 3.5 mol min.sup.1 mg.sup.1, respectively. However, Msed_1353-G424 also showed activity on C4-C8 substrates, including 4HB (1.8 mol min.sup.1 mg.sup.1).

    [0222] In order to compare the activity of these three enzymes on 4HB the Michaelis-Menten curves are shown in FIG. 6. From this figure it is clear that there is a large difference in catalytic rate for the three enzymes, and this difference holds over the entire range of substrate concentration, including when [S]/K.sub.m<<1. Therefore although it is possible that both Msed_0394 and Msed_0406 are catalytically active on 4HB in vivo, it is likely that Msed_0406 is more physiologically relevant in terms of catalytic performance. Additionally, the single point mutation of Msed_1353 to Msed_1353-G424 produces an enzyme that is active on 4HB at even higher rates for all substrate concentrations.

    DISCUSSION

    [0223] The semi-continuous gas-intensive bioreactor system developed here was successfully used to refine the transcriptional response of autotrophy-related genes in M. sedula. This system provided better delivery of sparingly soluble gases and allowed more precise regulation of gas composition than could be achieved in serum bottles. At 70 C. and 1 atm, the solubility of oxygen and hydrogen are comparable (0.6 mM), while the solubility of carbon dioxide is about 20-fold higher (12 mM) (Auernik and Kelly, 2010, Appl. Environ. Microbiol., 76:931-935, Ramos-Vera et al., 2011, J. Bacteriol., 193:1201-1211, Wilhelm et al., 1977, Chem. Rev., 77:219-262). For these experiments, the low solubility of H.sub.2 was offset by the use of microbubbler sparing stones (2 m pore size) to increase the gas phase surface area and increase delivery of H.sub.2 to the medium.

    [0224] Stoichiometrically, at least four H.sub.2 molecules are required for every carbon atom fixed. Assuming that ATP generation requires the oxidation of two hydrogen molecules, then each turn of the cycle requires 12 molecules of hydrogen for every two molecules of carbon dioxide. As such, the limiting growth factor for M. sedula in a bioreactor is likely acquisition of the electron donor, in contrast to most aerobic microbial fermentation where acquisition of the final electron acceptor, oxygen, limits growth. In its natural environment, the picture may be somewhat different. Hydrogen measurements from the (largely anoxic) acidic hot springs at Yellowstone indicate that gaseous hydrogen may be quite abundantwith concentrations ranging between 10-300 nM (Auernik and Kelly, 2010, Appl. Environ. Microbiol., 76:931-935, Spear et al., 2005, Proc. Natl. Acad. Sci. U.S.A. 102:2555-2560). The source of this hydrogen gas is primarily geochemical; although the mechanism is not well understood, it probably arises from subsurface interaction of water with Fe[II] (Auernik et al., 2008, Appl. Environ. Microbiol. 74:7723-7732, Sleep, 2004, Proc. Natl. Acad. Sci. U.S.A. 101:12818-12823). For most subsurface environments, oxygen is probably limiting (Gold, 1992, Proc. Natl. Acad. Sci. U.S.A. 89:6045-6049). However, M. sedula was isolated from aerobic (surface) samples of a hot water pond at Pisciarelli Solfatara (Huber et al., 1989, Syst. Appl. Microbiol. 12:38-47). Thus both hydrogen and oxygen may be available in abundance for autotrophic growth.

    [0225] The regulation of growth modes in M. sedula involves massive transcriptional changes between heterotrophic and autotrophic growth. Nearly half the genome (984 genes out of 2293) responded with transcriptional changes of 2-fold or greater when comparing heterotrophy to carbon dioxide limited autotrophy. Not much is known about the regulation strategies employed by archaea to control gene transcription, but between different forms of chemolithoautotrophy (reduced metals, H.sub.2, etc.) and heterotrophy, M. sedula can utilize a broad range of metabolic substrates for growth.

    [0226] The missing step in the 3HP/4HB pathway has been the acyl-CoA synthetase that utilizes 4HB. Previous attempts to identify the gene that encodes this enzyme were unsuccessful, and the candidate enzymes had no activity on 4HB (Ramos-Vera et al., 2011, J. Bacteriol. 193:1201-1211). In this work, two previously unexamined synthetases from M. sedula, consistent with the new transcriptomic evidence, were recombinantly produced and characterized. Both Msed_0394 and Msed_0406 showed activity on 4HB as well as other small organic acids. Based on the lack of other synthetase candidates suggested by the transcriptomic analysis and previous biochemical evidence ruling out Msed_1422 and Msed_1291, we conclude that one or both of these enzymes are necessary for autotrophic growth in M. sedula.

    [0227] Acetyl-CoA synthetases belong to the Class I superfamily of adenylate-forming enzymes that includes acyl- and aryl-CoA synthetases, the adenylation domains of non-ribosomal peptide synthetases (NRPSs), and firefly luciferase (Schmelz and Naismith, 2009, Current Opinion in Structural Biology 19:666-671). These enzymes use a two-step mechanism in which first an acyl-AMP intermediate is formed (with release of pyrophosphate) followed by displacement of AMP by CoA (Gulick, 2009, ACS chemical biology 4:811-827). Most acetyl-CoA synthetases have a limited substrate range. Archaeal acyl-CoA synthetases, which form a phylogenetic cluster distinct from other bacterial subgroups (Brasen et al., 2005, Extremophiles 9:355-365), have been reported to exhibit broader substrate preferences. The acetyl-CoA synthetase from Pyrobaculum aerophilum can work on acetate, propionate, butyrate, and isobutyrate (Brsen et al., 2005, FEBS Lett. 579:477-482); another acetyl-CoA synthetase from Archaeoglobus fulgidus was active on acetate, propionate, and butyrate (Ingram-Smith and Smith, 2007, Archaea 2:95-107). Both Msed_0394 and Msed_0406 were found to have activity on a broad range of small organic acid substrates of up to five carbons in length.

    [0228] Activity of both purified Msed_0394 and Msed_0406 on 4HB was well above the reported activity measured in autotrophic cell extract (0.3 mol min.sup.1 mg.sup.1) (Berg et al., 2007, Science, 318:1782-1786). It appears that Msed_0406 is primarily a promiscuous propionate-CoA synthetase. Msed_0394, by contrast, has nearly equal levels of activity on acetate, propionate, and 4-HB. Although the overall activity for Msed_0394 is lower by comparison, when taking into account the different substrate specificities, this enzyme shows a preference for C5-C6 linear unsubstituted organic acids. By comparison, the homologous 4-HB-CoA synthetase from Thermoproteus neutrophilus (Tneu_0420), an anaerobic archaeon that contains the DC/4HB carbon fixation cycle, was recombinantly produced and shown to have maximal activity on 4HB, followed by crotonate, acetate, 3HP, and 3HB (Ramos-Vera et al., 2011, J. Bacteriol. 193:1201-1211). The reported Km for Tneu_0420 is about 3-fold lower than that found for Msed_0406 (700 M vs. 2000 M), with comparable activity (1.6 vs. 1.8 mol min.sup.1 mg.sup.1), which suggests that the catalytic activities on 4HB are also comparable.

    [0229] It is likely that Msed_0406 is more effective at catalyzing the ligation of CoA to 4HB in vivo than Msed_0394. Perhaps these enzymes have evolved from highly specific acetate/propionate synthetases to be sufficient for catalyzing the necessary reaction on 4HB for the 3HP/4HB fixation cycle. It is not clear why two synthetases would be required, or if both of them are necessary for autotrophic growth. However, they are so far the only ligases in M. sedula that have been shown to activate 4HB with CoA.

    [0230] Genes with high homology to Msed_0394 and Msed_0406 exist in the genome of the closely related M. cuprina (67% and 73% amino acid identity, respectively), but it is less clear whether homologs exist in the genomes of other Sulfolobales, such as the Sulfolobus and Acidianus spp. Members of the acyl-adenylate forming enzyme family may share little identity or similarity in amino acid sequence apart from a few highly conserved core motifs (Ingram-Smith and Smith, 2007, Archaea 2:95-107). There are homologs of Msed_0406 in other species of Sulfolobales that have 30-35% identity, and one homolog in S. acidocaldarius with 61% identity. But the effort to find the M. sedula 4HB-CoA synthetase has shown that substrate specificity cannot be inferred from amino acid sequence homology alone. However, the low homology of the M. sedula 4HB-CoA synthetase gene does stand out among all the other genes in the 3HP/4HB cycle, which have distinct homologs in Sulfolobus spp. that range from 50-80% identity.

    [0231] Since 4HB is a metabolite unique to butyrate metabolism (Pryde et al., 2002, FEMS Microbiol. Lett. 217:133-139), including -aminobutyrate fermentation (Gerhardt et al., 2000, Arch. Microbiol. 174:189-199) and polyhydroxyalkanoate production (Valentin et al., 1995, Eur. J. Biochem. 227:43-60), it is unlikely to have any other role in crenarchaeal metabolism outside of carbon fixation. Recent work with metabolic flux analysis has shown there is another exit route for carbon flux from the cycle through succinyl-CoA to succinate (Estelmann et al., 2011, J. Bacteriol. 193:1191-1200). In this study the authors estimate that two-thirds of the cycle carbon flux passes to succinate via succinyl-CoA or succinic semialdehyde, while one-third of the cycle carbon flux passes through the latter part of the cycle (via 4HB) to regenerate acetyl-CoA. Of course, this flux distribution may be highly dependent on growth conditions and could shift more to the 4HB branch depending on substrate availability.

    [0232] It is clear that all members of the Sulfolobales order have a homolog for 4hbd, and therefore should have a complete set of enzymes for carbon fixation. But, previous studies have been mixed as to which Sulfolobus spp. are capable of autotrophic growth. Early reports on Sulfolobus acidocaldarius isolates claimed that they could grow chemolithoautotrophically on elemental sulfur (Brock et al., 1972, Arch. Microbiol. 84:54-68, Shivvers and Brock, 1973, J. Bacteriol. 114:706-710). Subsequent reports claim that neither S. solfataricus nor S. acidocaldarius can grow autotrophically on elemental sulfur alone (Grogan, 1989, J. Bacteriol. 171:6710-6719), although it is unclear whether they simply lost the ability to grow chemolithoautotrophically or were selected from what were originally mixed cultures (Kletzin et al., 2004, J. Bioenergetics and Biomembranes 36:77-91). Recent reports have shown autotrophic growth of S. metallicus on sulfur and S. tokodaii on both sulfur and iron (Bathe et al., 2007, Appl. Environ. Microbiol. 73:2491-2497). The only other member of the Sulfolobales that has been reported to grow on hydrogen is Acidianus ambivalens, a sulfur-reducing acidophile (Laska, 2003, Microbiol. 149:2357-2371). Genes encoding for hydrogenase and maturation enzymes with homology to M. sedula hydrogenase genes are present in one strain of S. islandicus (HVE10/4), but this is predicted to be involved in anaerobic fermentation (Guo et al., 2011, J. Bacteriol. 193:1672-1680). Clearly, some Sulfolobus spp. must have a functional carbon fixation pathway, but others seem to possess an incomplete or non-functional pathway. It may be that the CoA-activating ligase that can operate on 4HB is essential for complete cycle function, and loss of 4HB-CoA synthetase activity renders the carbon fixation cycle inoperable.

    [0233] To investigate the issue of substrate specificity, de novo structural predictions of M. sedula acyl-CoA synthetases with crystal structures were compared with other known synthetases, including acetyl-CoA synthetase from both S. enterica (Gulick et al., 2003, Biochemistry 42:2866-2873) and S. cerevisiae (Jogl and Tong, 2004, Biochemistry 43:1425-1431), and 4-chlorobenzonate-CoA synthetase from Alcaligenes sp. (Gulick et al., 2004, Biochemistry 43:8670-8679). The structure for ACS from S. enterica revealed that there are four residues that form the acetate binding pocketVal.sup.310, Thr.sup.311, Val.sup.386, and Trp.sup.414 (Gulick et al., 2003, Biochemistry 42:2866-2873). The conserved tryptophan residue cuts the binding pocket short and precludes activity on longer substrates (FIG. 7). Extensive mutagenesis of binding pocket residues in yeast ACS showed that mutation of Trp.sup.416.fwdarw.Gly.sup.416 was sufficient to lengthen the binding pocket to accommodate C4-C8 organic acids (Ingram-Smith et al., 2006, Biochemistry 45:11482-11490). Amino acid sequence alignments show that Msed_1353 has a tryptophan in the same position (Trp.sup.424) (FIG. 8) and should, therefore, only work on acetate and propionate, a fact that has been confirmed biochemically (Ramos-Vera et al., 2011, J. Bacteriol. 193:1201-1211). Here, there was some activity with Msed_1353 on 3HP and butyrate, but no activity on 4HB. Msed_0394 and Msed_0406 both have a glycine in this position, G333 and G346, respectively. However, the rest of the genes annotated as acyl-CoA synthetases in M. sedula also have a glycine in this position, so this glycine residue alone is not sufficient to indicate activity on C3-C5 unsubstituted linear organic acids. Both Msed_1422 and Msed_1291 were recombinantly expressed and showed to be inactive on C2-C4 linear organic acids (Ramos-Vera et al., 2011, J. Bacteriol. 193:1201-1211).

    [0234] A mutant of Msed_1353 with a glycine in place of the conserved tryptophan (Trp.sup.424.fwdarw.Gly) was made by site directed mutagenesis and expressed in E. coli (Msed_1353-G424). The native enzyme was active only on acetate and propionate, but the mutant showed activity on 3HP, 4HB, valerate, hexanoate, and even octanoate (FIG. 5). The activity was just as high on C5-C8 substrates as on acetate and propionate, but lower on 3HP and 4HB. This suggests that the polar hydroxyl group destabilizes the interaction between the substrate and the residues of the enlarged binding pocket. A similar trend is evident with Msed_0406 (FIG. 4). However, Msed_0394 has nearly equal levels of activity on propionate, butyrate, and 4HB, suggesting that it can stabilize the hydroxyl group on 4HB better than that of 3HP. Similarly, Msed_1456, which catalyzes the ligation of CoA to 3HP in the 3HP/4HB pathway, has equal activity on propionate and 3HP, and therefore might have residues in the active site that help stabilize the hydroxyl group of 3HP.

    [0235] In Msed_1456, Val.sup.386, which makes contacts with the -carbon of the propyl moiety in the S. enterica ACS structure, is replaced with Asn.sup.390, whose polar amide nitrogen could hydrogen bond with the hydroxyl group of 3HP to stabilize substrate binding. As for Msed_0406, both valine residues in the acetate binding pocket are replaced with alanine (Ala.sup.249 and Ala.sup.321) and Thr.sup.311 is replaced with a lysine (Lys.sup.250). In Msed_0394, all three of these residues are alanine (Ala.sup.240, Ala.sup.241, and Ala.sup.309). Potential candidate residues for stabilizing the hydroxyl group of 4HB in Msed_0394 include His.sup.341 and Tyr.sup.338.

    [0236] This work helps to close the gaps on the missing piece of the 3HP/4HB pathway in M. sedula. It is still unclear why only certain members of the Sulfolobales operate the 3HP-4HB cycle, but this may reflect the environmental history of specific species. Furthermore, along with other recent successes obtaining recombinant versions of difficult to produce enzymes from the pathway (Han et al., 2012, Appl. Environ. Microbiol., 78:6194-202), complete characterization of all cycle enzymes is near at hand. The information obtained for cycle function will be invaluable for the creation of a metabolically engineered platform capable of producing of chemicals and fuels from carbon dioxide (Hawkins et al., 2011, ACS Catal. 1:1043-1050).

    Example 2

    Production of an Industrial Chemical Using Hydrogen and Carbon Dioxide

    [0237] Microorganisms can be engineered to produce useful products, including chemicals and fuels from sugars derived from renewable feedstocks, such as plant biomass. An alternative method is to utilize low potential reducing power from non-biomass sources, such as hydrogen gas or electricity, to reduce carbon dioxide directly into products. This approach circumvents the overall low efficiency of photosynthesis and the production of sugar intermediates. While significant advances have been made in manipulating microorganisms to produce useful products from organic substrates, engineering them to utilize carbon dioxide and hydrogen gas has not been reported. Herein, we describe a novel temperature-dependent approach that confers upon a microorganism, the archaeon Pyrococcus furiosus, that grows optimally on carbohydrates at 100 C., the capacity to utilize carbon dioxide, a reaction that it does not accomplish naturally. This was achieved by the heterologous expression of five genes of the carbon fixation cycle of the archaeon Metallsphaera sedula, which grows autotrophically at 73 C. The engineered P. furiosus strain is able to utilize hydrogen gas and incorporate carbon dioxide into 3-hydroxypropionic acid, one of the top twelve industrial chemicals building blocks. The reaction can be accomplished by cell-free extracts and by whole cells of the recombinant P. furiosus strain. Moreover, it is carried out some 30 C. below the optimal growth temperature of the organism, conditions that support only minimal growth but maintain sufficient metabolic activity to sustain the production of 3-hydroxypropionate. The approach described here can be expanded to produce important organic chemicals, all through biological activation of carbon dioxide.

    Materials and Methods

    [0238] Construction of a synthetic SP1 operon. PCR was performed using P. furiosus or M. sedula genomic DNA to generate the individual PCR products of the P. furiosus S-layer promoter (P.sub.slp) and the five M. sedula SP1 genes, consisting of coupled E1 (Msed_0147-Msed_0148), E1 (Msed_1375), E2 (Msed_0709) and E3 (Msed_1993). P. furiosus ribosomal binding sites, consisting of 11-14 bp of sequence upstream of highly-expressed proteins, were added in front of E1 (5-GGAGGTTTGAAG (SEQ ID NO:313), sequence upstream from por, PF0791), E2 (5-GGGAGGTGGAGCAT (SEQ ID NO:314), sequence upstream from slp, PF1399), and E3 (5-GGTGATATGCA (SEQ ID NO:315), sequence upstream from cipA, PF0190). The primer sequences are given in Table 4. SOE-PCR (splicing by overlap extension and PCR, (Horton et al., 1989, Gene 77(1):61-68) was performed to combine the individual PCR products and generate the expression cassette for SP1 (FIG. 11A).

    TABLE-US-00004 TABLE4 PrimersusedintheconstructionofthesyntheticSP1operon. Primertarget Direction 5 to3 sequence P.sub.s/p Forward GAATCCCCGCGGCCCGGGCTGGCAGAATAGAA(SEQIDNO:316) Reverse GCAACCAAAACTCTACTAAAGGGTGGCATTTTTCTCCACCTCCCAATAATCTG(SEQIDNO:317) Msed_0147- Forward ATGCCACCCTTTAGTAGAGTTTTGG(SEQIDNO:318) 0148 Reverse GTTGCAGTCATCTTCAAACCTCCTTACTTTATCACCACTAGGATATCTCC(SEQIDNO:319) Msed1375 Forward GTGATAAAGTAAGGAGGTTTGAAGATGACTGCAACTTTTGAAAAACCGGAT(SEQIDNO:320) Reverse CGTTCTCCTCATATGCTCCACCTCCCTTAGAGGGGTATATTTCCATGCTTC(SEQIDNO:321) Msed_0709 Forward GGCAATGTCATATGAGGAGAACGCTAAAGGCCGCAATTCSEQIDNO:403) Reverse CCTTTTCAGTCATTGCATATCACCTCATCTCTTGTCTATGTAGCCCTTC(SEQIDNO:322) Msed_1993 Forward TAGACAAGAGATGAGGTGATATGCAATGACTGAAAAGGTATCTGTAGTTGGAG(SEQID NO:323) Reverse CCAATGCATGCTTATTTTTCCCAAACTAGTTTGTATACCTTC(SEQIDNO:324)

    [0239] Construction of vectors for insertion of the SP1 operon into P. furiosus. The SP1 expression cassette (FIG. 11B) was cloned into pSPF300 (Hopkins et al., 2011, PLoS One 6(10):e26569), generating the plasmid pALM506-1, to be used for targeted insertion of the synthetic SP1 operon into the P. furiosus pdaD strain (FIG. 14). SOE-PCR (Horton et al., 1989, Gene 77(1):61-68) was used to combine 0.5 kb flanking regions targeting homologous recombination in the integenic space between convergent genes PF0574-PF0575, with a marker cassette, including restriction sites for cloning. The marker cassette for uracil prototrophic selection consisted of the pyrF gene driven the gdh promoter region (Pgdh, 157 bases upstream of PF1602) and terminated with 12 bases of the 3 UTR of the hpyA1 gene (5-aatcttttttag (SEQ ID NO:326), PF1722). A 65-b sequence of the 3 end of the marker cassette (5-ctaaaaaagattttatcttgagctccattctttcacctcctcgaaaatcttcttagcggcttccc (SEQ ID NO:327)) was repeated at the beginning of the cassette to serve as a homologous recombination region for selection of marker removal (Farkas et al., 2012, Appl Environ Microb 78(13):4669-4676). Vector pGL007 targeting homologous recombination at the PF0574-PF0575 intergenic space was constructed by cloning the SOE-PCR product into pJHWOO6 (Lipscomb et al., 2011, Appl Environ Microb 77(7):2232-2238) (FIG. 15). The SP1 expression cassette was PCR-amplified from pALM506. A terminator sequence was added to the 3 end of the operon (5-aatcttttttag (SEQ ID NO:328), from the 3 UTR of PF1722), and the construct was cloned into the AscI-NotI sites of pGL007 to make pGL010 (FIG. 16), for targeted insertion of the SP1 operon at the PF0574-PF0575 intergenic space. Transformation of P. furiosus pdaD strain was performed as previously described for COM1 (Lipscomb et al., 2011, Appl Environ Microb 77(7):2232-2238) except that the defined medium contained maltose instead of cellobiose as the carbon source and was supplemented with 0.1% w/v casein hydrolysate. Transformation of COM1 was performed as previously described (Lipscomb et al., 2011, Appl Environ Microb 77(7):2232-2238) except that linear plasmid DNA was used for transformation.

    [0240] Growth of P. furiosus. Strains were cultured as previously described in a sea-water based medium containing 5 g/L maltose and 5 g/L yeast extract, 0.5 g/L riboflavin, and 20 M uracil or 4 mM agmatine as needed (Lipscomb et al., 2011, Appl Environ Microb 77(7):2232-2238). Cultures were grown at 95 C. until 110.sup.8 cells/mL and then cooled at 23 C. until the temperature reached 70 to 75 C., which was maintained for up to 48 hours. For growth in a 20 L fermenter, the culture was sparged with 10% CO.sub.2/90% N.sub.2, stirred, and the pH was maintained at 6.8 by addition of 10% NaHCO.sub.3. Cell extracts prepared anaerobically as described previously (Lipscomb et al., 2011, Appl Environ Microb 77(7):2232-2238) in 100 mM MOPS, pH 7.5, re-concentrated three-times with a 3 kDa centrifugation filter and stored at 80 C.

    [0241] Growth of M. sedula for biochemical assays and product analysis. M. sedula (DSM 5348) was grown autotrophically at 70 C. with micro-bubblers feeding 1 mL/min 80/20 H.sub.2/CO.sub.2 and 100 mL/min air in the defined medium, DSMZ 88, at pH 2.0 as previously described (Han et al., 2012, Appl Environ Microbiol 78(17):6194-6202). To obtain cell-free extracts, frozen cell pellets were anaerobically suspended in 50 mM Tris HCl pH 8.0 containing 0.5 g/mL DNase I and stirred for 1 hr in an anaerobic chamber. The cell extract was centrifuged at 100,000g for 1 hr and the supernatant was stored at 80 C.

    [0242] E1, E2 and E3 assays. All reactions were carried out in sealed anaerobic cuvettes at 75 C. containing 100 mM MOPS pH 7.5, 5 mM MgCl.sub.2, 5 mM DTT. After addition of NADPH (to A.sub.3401.0) and the relevant substrate (see below), NADPH oxidation was measured at 340 nm. The substrates for the E2, E2+E3 and E1+E2+E3 assays were succinyl-CoA, malonyl-CoA and acetyl CoA (each 1 mM) respectively. The latter assay also contained 1 mM ATP, and 10 mM NaHCO.sub.3. E1 activity was measured by phosphate release. The assay contained 10 mM NaHCO.sub.3, 1 mM ATP, and 1 mM acetyl-CoA. Samples (20 L) were removed at 2-4 min, diluted with water (180 l), and the BioVision (Mountain View, Calif.) phosphate assay reagent (20 l) was added. The phosphate produced was calculated using a molar extinction coefficient of 90,000 M.sup.1 cm.sup.1 at 650 nm.

    [0243] Measurement of 3-hydroxypropionic acid (3-HP). 3-HP (H0297, 30%, w/v, in water) was obtained from TCI America (http://www.tciamerica.net/). By HPLC and .sup.1H NMR, it was 75% pure with the remaining 25% as 3,3-oxydipropanoic acid. For GC-MS analysis, inositol was the internal standard. Samples were freeze-dried, incubated in 2 M trifluoroacetic acid at 80 C. for 1 hr, dried under nitrogen, and per-O-trimethylsilylated by treatment with Tri-Sil (Pierce) at 80 C. for 30 minutes. GC-MS analysis was performed on an AT 7890n GC interfaced to a 5975C MSD using a Grace EC-1 column (30 m0.25 mm). The exact mass of 3-HP-TMS is 162. Derivatization of 3-HP with 2-nitrophenyl hydrazine was carried out as described previously (Miwa et al., 2000, Journal of Chromatography. A 881(1-2):365-385). The 3HP-hydrazide was extracted by adding 1.0 mL of 1 M KPO.sub.4 buffer pH 7.0 and 1.5 mL of ether to 800 L of the sample, centrifuging for 10 min at 6,000g to separate the phases, removing the top ether layer and evaporating. The dried sample was resuspended in 200 L ethanol and 10-50 L aliquots were analyzed by HPLC. The column and run conditions were as follows: column, Supelco LiChrosorb RP-8 (5 m); solvent system, A 0.05% TFA, B 100% acetonitrile; gradient 0-20 min, 0-100% B, 20-22 min: 100% B; flow rate: 1 mL/min; temperature: 30 C. For ESI-MS analysis, the dried derivative was dissolved in methanol and directly injected on a Perkin-Elmer API 1 plus in negative mode. The mass of the anionic 3-HP-hydrazide derivative is 224.

    [0244] Production of 3-HP in vitro from malonyl-CoA by E2+E3 and from acetyl-CoA by E1+E2+E3. To the P. furiosus extract (1-2 mg/mL) in 100 mM MOPS pH 7.5, 5 mM MgCl.sub.2, and 5 mM DTT, was added 1-2 mM malonyl-CoA (for E2+E3) or 10 mM NaHCO.sub.3 (or 100% CO.sub.2 in the gas phase), 2 mM ATP and 2 mM acetyl-CoA (for E1+E2+E3). The electron source was 2 mM NADPH or 0.5 mM NADP with 20% H.sub.2 in the headspace. Sealed anaerobic vials containing the reaction mixture were incubated at 75 C. for up to 2 hr. Samples were derivatized with 2-nitrophenyl hydrazine and analyzed for 3-HP by HPLC as described above.

    [0245] Product analysis of E1+E2+E3 activities in whole cells. P. furiosus strains PF506 and MW56 were grown in 2 L cultures at 95 C. for 10 hours until cell densities of 110.sup.8 cells/mL and then cooled and incubated at 75 C. for 16 hours. Harvested cells were suspended to 510.sup.10 cells/mL in 100 mM MOPS pH 7.5 and base salts (28 g/L NaCl, 3.5 g/L MgSO.sub.4.7H.sub.2O, 2.7 g/L MgCl.sub.2.6H.sub.2O, 0.33 g/L KCl, 0.25 g/L NH.sub.4Cl, 0.14 g/L CaCl.sub.2.2H.sub.2O). The cell suspension was sealed in a serum vial, degassed with argon, and cysteine HCl (0.5 g/L), NaHCO.sub.3 (10 mM) and either maltose (10 mM) or pyruvate (40 mM) were added. The vials were degassed and flushed with H.sub.2 and incubated at 75 C. for 60 minutes. Samples for 3-HP analysis were derivatized with 2-nitrophenyl hydrazine, using 1 mM p-hydroxyphenyl acetic acid as an internal standard, ether-extracted and analyzed by HPLC as described above.

    [0246] Analysis of the P. furiosus culture medium for 3-HP. P. furiosus strains PF506, MW56 and COM1 were grown at 98 C. in 50 mL cultures with maltose (10 mM) as the carbon source until a cell density of 810.sup.7 cells/mL was reached. The incubation temperature was then shifted to 72 C. for up to 4 days. Sample (1 mL) were periodically removed, centrifuged (10,000g, 10 min) and to a 100 l aliquot of the supernatant (the spent medium) 1 mM p-hydroxyphenyl acetic acid was added as an internal standard. The sample was derivatized with 2-nitrophenyl hydrazine, ether-extracted and analyzed by HPLC as described above.

    Results and Discussion

    [0247] The genes that were incorporated into P. furiosus to enable it to utilize carbon dioxide are the first part of the 3-hydroxypropionate/4-hydroxybutyrate pathway of M. sedula, which consists of 13 enzymes in total (Ramos-Vera et al., 2011, J Bacteriol 193(5): 1201-1211). In one turn of the cycle, two molecules of carbon dioxide are added to one molecule of acetyl-CoA (C.sub.2) to generate a second molecule of acetyl-CoA (FIG. 11C). The cycle can be divided into three sub-pathways (SP1-SP3) where SP1 generates 3-hydroxypropionate (3-HP) from acetyl-CoA and carbon dioxide, SP2 generates 4-hydroxybutyrate (4-HB) from 3-HP and carbon dioxide, and SP3 converts 4-HB to two molecules of acetyl-CoA. The reducing equivalents and energy for the pathway are supplied by NADPH and ATP, respectively (FIG. 11D). Notably, the 3-HP/4-HB pathway is purportedly more energetically efficient than carbon dioxide fixation by the ubiquitous Calvin cycle (Berg et al., 2007, Science 318(5857):1782-1786).

    [0248] The first three enzymes of the Msed 3-HP/4-HB cycle comprise the SP1 pathway and together they produce 3-HP from carbon dioxide and acetyl-CoA (FIG. 11B). The three enzymes are referred to here as: E1 (acetyl/propionyl-CoA carboxylase, encoded by Msed_0147, Msed_0148, Msed_1375), E2 (malonyl/succinyl-CoA reductase, Msed_0709) and E3 (malonate semialdehyde reductase, Msed_1993) (Berg et al., 2007, Science 318(5857):1782-1786; Hgler et al., 2003, Eur J Biochem 270(4):736-744; Alber et al., 2006, J Bacteriol 188(24):8551-8559). E1 carboxylates acetyl-CoA using bicarbonate and requires ATP. E2 breaks the CoA-thioester bond and with E3, reduces the carboxylate to an alcohol with NADPH as the electron donor. E1 and E2 are bi-functional and are also involved in the SP2 part of the cycle (FIG. 11C). To demonstrate the concept, we expressed the M. sedula SP1 pathway in P. furiosus so that the organism could utilize carbon dioxide for the production of 3-HP, using hydrogen as the electron donor. Hydrogen is utilized in P. furiosus by a native cytoplasmic hydrogenase (SHI) that reduces NADP to NADPH (Ma & Adams, 2001, Method Enzymol Volume 331:208-216). SHI is extremely active, even at 70 C., and a P. furiosus strain engineered to over-express the enzyme was previously developed (Chandrayan et al., 2012, J Biol Chem 287(5):3257-3264).

    [0249] The five genes encoding the three enzymes (E1, E2, E3) of M. sedula SP1 were combined into a single synthetic operon with transcription driven by P.sub.slp, a native, constitutive promoter of the highly expressed S-layer protein (PF1399) of P. furiosus (Chandrayan et al., 2012, J Biol Chem 287(5):3257-3264). The M. sedula ribosomal binding sites (RBS) for E1(), E2 and E3 were replaced with RBSs for known highly-expressed P. furiosus proteins (FIG. 1A). The M. sedula RBS for E1 was retained since the two genes, E1 and E1, appear to be translationally-coupled. The SP1 operon was inserted into P. furiosus (strain COM1) at two genome locations. In P. furiosus strain PF506, the SP1 operon was inserted at the site of the pdaD marker (PF1623; FIG. 14). The MW56 strain contained the SP1 operon between convergently-transcribed genes (PF0574 and PF0575: FIGS. S2 and S3) within a 100-bp region having little to no transcriptional activity, according to a previous tiling array study of P. furiosus (Yoon et al., 2011, Genome Res 21(11): 1892-1904). The P. furiosus strains used here are summarized in Table 5.

    TABLE-US-00005 TABLE 5 Strains used and constructed in this study. Strain Parent Genotype/Description Reference COM 1 DSM pyrF 1 3638 pdaD COM 1 pyrF pdaD::P.sub.gdhpyrF 2 PF506 pdaD pyrF pdaD::pdaD P.sub.slp.sup.E1-E2- This work E3 MW56 COM 1 pyrF P.sub.gdhpyrF P.sub.slp.sup.E1-E2-E3 This work 1, Lipscomb et al., 2011, Appl Environ Microbiol 77: 2232-2238; 2, Hopkins et al., 2011, PLoS One 6: e26569.

    [0250] The premise for the temperature-dependent strategy is that P. furiosus (T.sub.opt 100 C.) shows little growth and has very low metabolic activity (Weinberg et al., 2005, J Bacteriol 187:336-348) near the temperature at which the enzymes from M. sedula (T.sub.opt 73 C.) are expected to be optimally active. In the recombinant P. furiosus strains (PF506 and MW56), the SP1 operon was under the control of a temperature-independent, constitutive promoter (P.sub.slp), hence the operon will be transcribed at both 100 C. and 75 C. However, the resulting E1E3 enzymes should be stable and active only near 75 C. P. furiosus strains PF506 and MW56 were, therefore, grown at 98 C. (to 110.sup.8 cells/ml) in closed static cultures and then transferred to 75 C. (FIG. 12A). There was no measurable activity of E1, E2 or E3 in cell-free extracts prior to the temperature change, but all three activities were present in cells after 16 hr at 75 C. Moreover, the specific activities were comparable to those measured in extracts of M. sedula cells grown autotrophically on hydrogen and carbon dioxide and to values reported by others (FIGS. 12C and 20) (Berg et al., 2010, Nat Rev Microbiol 8(6):447-460; Ramos-Vera et al., 2011, J Bacteriol 193(5): 1201-1211). Indeed, when grown in a stirred, pH-controlled culture, the activity of the linked E2+E3 enzymes in strain MW56 continued to increase over a 50 hr period, reaching over 8-fold greater than that measured in M. sedula (FIG. 13C). When strain PF506 was grown at 95 C. and then incubated for 16 hours at temperatures between 55 and 95 C., the maximum specific activity of the linked E2+E3 enzymes was measured in cultures incubated at 70 and 75 C., with dramatically lower values at 65 and 80 C. (FIG. 12B). This clearly indicates that the M. sedula enzymes functioned optimally in P. furiosus at 70-75 C., especially since significant E2+E3 activity could be measured at assay temperatures above 75 C. using cell-free extracts prepared from cultures incubated at 70-75 C. (FIG. 12D). Moreover, the enzymes are very thermostable, with a half-life of approximately 60 min at 90 C. (FIG. 18). This suggests that the lack of enzyme activity of the M. sedula enzymes (and of 3-HP production) in cultures that were incubated at 80 C. or higher is not due to the thermal instability of the M. sedula enzymes per se, but rather to the temperature sensitivity of the protein folding process during the synthesis of these enzymes, which is optimal in the 70-75 C. range.

    [0251] To determine the nature of the products of the SP1 pathway, recombinant P. furious strains PF506 and MW56 were grown at 95 C. (to 110.sup.8 cells/ml) and then transferred to 70 C. for 16 hours (FIG. 19). In extracts of these cells, the specific activities of the E1, E2, and E3 enzymes were comparable to those measured in extracts of autotrophically-grown M. sedula cells (FIG. 20). Two methods were used to detect 3-HP and to confirm its production by the SP1 pathway in the recombinant P. furiosus strains. In the presence of acetyl-CoA, NaHCO.sub.3, and either NADPH or hydrogen gas as the electron donor, the 2-nitrophenylhydrazide-derivative (3-HP/HZ; m/z 224) was identified by electrospray ionization mass spectrometry (ESI-MS) in cell-free extracts of PF506, but was not detected in extracts of the parent P. furiosus strain (FIG. 21). This was confirmed by gas chromatography-mass spectrometry (GC-MS) of the O-trimethylsilylate derivative of 3-HP (3HP/TMS), using malonyl-CoA and either NADPH or hydrogen gas as the electron donor (Table 6). The GC-MS also allowed quantitation of 3-HP/TMS and showed that approximately 150 M 3-HP was produced from malonyl-CoA, after a 2 hr incubation at 72 C. with extracts of PF506 containing NADP under hydrogen gas (Table 6).

    TABLE-US-00006 TABLE 6 3-HP/ Added Inositol Electron Theoretical peak Estimated Vial Donor Substrate 3-HP area 3-HP 1 2 mM 2 mM 1 mM 0.0288 0.2 mM NADPH malonyl-CoA 2 2 mM 2 mM 2 mM 0.0467 0.3 mM NADPH, H.sub.2 malonyl-CoA 3 1 mM 2 mM 2 mM 0.0274 0.2 mM NADP, H.sub.2 malonyl-CoA 4 1 mM None 0 0.0064 0.05 mM NADP, H.sub.2 (control) 5 1 mM None 2 mM 0.2839 2.0 mM NADP, H.sub.2 (control)

    [0252] For routine analysis of 3-HP, a method was developed to extract 3-HP/HZ and to separate and quantitate it by HPLC. As shown in FIG. 3A, this method was used to confirm 3-HP production from acetyl-CoA and carbon dioxide by the combined action of the enzymes E1, E2, and E3 in cell-free extracts. As expected, P. furiosus did not appear to further metabolize 3-HP, as the compound was stable when added to P. furiosus cultures. Moreover, the production of 3-HP from acetyl-CoA was dependent upon either NaHCO.sub.3 or CO.sub.2 as the C-1 carbon source and either NADPH or hydrogen gas (and NADP) as the electron donor (FIG. 13A). The incorporation of electrons from hydrogen gas and the carbon from carbon dioxide into a single desired product is essentially the paradigm for electrofuels (Hawkins et al., 2011, ACS Catalysis 1:1043-1050).

    [0253] P. furiosus grows by fermenting sugars (such as the disaccharide maltose) to acetate, carbon dioxide and hydrogen, and can also utilize pyruvate as a carbon source (Fiala & Stetter, 1986, Arch. Microbiol. 145: 56-61). Acetyl-CoA and carbon dioxide are generated as the product of the pyruvate ferredoxin oxidoreductase (POR) reaction (FIG. 22). The reduced ferredoxin is oxidized by a membrane-bound hydrogenase to generate hydrogen gas (Sapra et al., 2003, Proc Natl Acad Sci USA 100(13):7545-7550). Although growth is limited at 75 C. (Weinberg et al., 2005, J Bacteriol 187:336-348), it was expected that when whole cells were incubated at 75 C. with maltose or pyruvate, sufficient acetyl-CoA would be produced by the low metabolic activity of P. furiosus for the SP1 enzymes to produce 3-HP. This was confirmed by HPLC detection and quantitation of 3-HP as the 2-nitrophenylhydrazide derivative. For example, high cell density suspensions (10.sup.10 cells/ml) of P. furiosus strains PF506 and MW56 produced up to 0.2 mM 3-HP after one hour incubation at 75 C. in the presence of maltose, hydrogen gas, and NaHCO.sub.3 (FIG. 23), and 3-HP production was dependent upon the presence of maltose or pyruvate (Table 7). Moreover, recombinant P. furiosus strains PF506 and MW56, grown in static cultures to late-log phase (110.sup.8 cells/ml) at 98 C. on maltose, produced up to 0.6 mM 3-HP (60 mg/1) when subsequently incubated at 72 C. for up to 40 hours (FIG. 13B). Furthermore, in a stirred, pH-controlled culture, strain MW56 produced 3-HP continuously over a 50 hr period at 72 C. (FIG. 13C). Overall, there appeared to be no significant difference between the two recombinant P. furiosus strains in terms of 3-HP production. This indicated that the genome location of the synthetic operon derived from M. sedula was not a determining factor. This bodes well for the insertion of additional synthetic operons in P. furiosus to extend the results reported here to other industrial chemicals.

    TABLE-US-00007 TABLE 7 3-HP production using maltose or pyruvate as the source of acetyl-CoA by whole cells of P. furiosus strains PF506 and MW56. The amount of 3-HP indicated was present in 1 mL of the cell suspension of P. furiosus. MW56 PF506 Pyruvate Maltose Pyruvate Maltose 155 nmol 100 nmol 70 nmol 145 nmol

    [0254] In summary, this work demonstrates the use of hydrogen as the electron donor for carbon dioxide fixation into a product of great utility in the chemical industry, namely 3-HP. Moreover, it is carried out by an engineered heterotrophic hyperthermophile some 30 C. below the optimal growth temperature of the organism, conditions that support minimal growth, but sufficient metabolic activity is retained to sustain the production of 3-HP (Hawkins et al., 2011, ACS Catalysis 1:1043-1050). The reaction can be accomplished by cell-free extracts, and also by whole cells in culture using sugar (maltose) as the source of the acetyl-CoA and ATP in a hydrogen- and carbon dioxide-dependent manner. The feasibility of using hydrogen gas as the source of reducing power (NADPH) for chemical synthesis, in this case 3-HP, is also of high significance given the availability of relatively inexpensive natural gas as a hydrogen source (Kreysa, 2009, ChemSusChem 2(1):49-55). It is important to note that the low metabolic activity of P. furiosus at 72 C. was sufficient to provide the ATP needed for carbon dioxide fixation. These results are a significant step forward towards the overall goal of incorporating into P. furiosus the complete M. sedula 3-HP/4-HB pathway, in which two molecules of carbon dioxide are reduced to acetyl-CoA that can then be converted into a variety of valuable products including biofuels (Hawkins et al., 2011, ACS Catalysis 1:1043-1050). Clearly, there will be a balance between using a fixed carbon source (sugar) via the low metabolic activity of the host to produce ATP and the high catalytic activity of the heterologous enzymes to generate the desired product. The hydrogen-dependent fixation of carbon dioxide has enormous potential for the production of a variety of chemicals and fuels through strategic use of established biosynthetic pathways and exploiting the hyperthermophilicity of metabolically-engineered microbial hosts (Steen et al., 2010, Nature 463(7280):559-562); Peralta-Yahya & Keasling, 2010, Biotechnol J 5(2): 147-162; Connor & Liao, 2009, Curr Opin Biotechnol 20(3):307-315; Kreysa, 2009, ChemSusChem 2(1):49-55).

    Example 3

    Construction of P. furiosus Strains PF506 and MW56 Containing the SP1 Pathway for 3-Hydroxypropionate Production and the Control Strain MW43 for Optimizing Production of M. sedula Enzymes in P. furiosus

    [0255] The five genes encoding the three enzymes (E1, E2, E3) of the M. sedula 3-HP/4-HB CO.sub.2 fixation sub pathway I (SP1) are scattered across the M. sedula genome (FIG. 24). These genes have been combined into a single artificial operon using overlapping SOE-PCR (splicing by overlap extension and PCR, Horton, et al. 1989. Gene 77, 61), followed by integration of the expression cassette into the P. furiosus genome. Transcription of the artificial SP1 operon in P. furiosus is driven by P.sub.slp, the native, constitutive promoter of the highly expressed S-layer protein (Chandrayan, S. K. et al. 2012. J. Biol. Chem. 287, 3257-3264). To optimize translation of the SP1 genes in P. furiosus, the native M. sedula ribosomal binding sites (RBSs) for E1, E2 and E3 were replaced with optimal P. furiosus RBSs/linker regions for predicted and known highly expressed proteins, while retaining the M. sedula RBS for E1 since the two genes, E1 and E1, appear to be translationally coupled.

    [0256] Strategy for operon expression (SP1 and SP2B) in P. furiosus. The SP1 operon was inserted into the COM1 strain of P. furiosus at two locations on the genome giving rise to two recombinant P. furiosus strains, PF506 and MW56. In addition, a control strain, MW43, was constructed to explore the temperature dependent expression of M. sedula genes in P. furiosus. MW43 contained subpathway 2B (SP2B; E7, E8 and E9) of the 3HP/4HB cycle.

    [0257] PF506: the SP1 operon was inserted at the site of the pdaD marker.

    [0258] MW56: the SP1 operon was inserted into one (GR3) of eleven genome regions previously identified as having little or no transcriptional activity.

    [0259] MW43: the SP2B operon was inserted into GR2.

    [0260] Construction of synthetic operon for expression of SP1 genes. PCR was performed using P. furiosus genomic DNA or M. sedula genomic DNA to generate the individual PCR products of the P. furiosus S-layer promotor and the five M. sedula SP1 genes, consisting of coupled E1 (Msed_0147-Msed_0148), E1 (Msed_1375), E2 (Msed_0709) and E3 (Msed_1993). PCR primers were designed to contain optimized P. furiosus ribosomal binding sites and spacing (Table 4) and to allow splicing of the individual PCR products generated (Table 4 and Table 8). SOE-PCR (Horton, et al. 1989. Gene 77, 61) was performed to combine the individual PCR products and generate the expression cassette for SP-1 (FIG. 25). The expression cassette was digested with SacII and SphI restriction enzymes and cloned into the SacII-SphI sites of the transformation vector, pSPF300 (Hopkins et al., 2011, PLoS One 6(10):e26569), generating the transformation plasmid, pALM506-1, for targeted insertion into the pdaD strain of P. furiosus (FIG. 26).

    TABLE-US-00008 TABLE8 UpstreamandintergenicregionswithoptimizednativePfRBSsequencesandspacing. E1-:Msed_0147 GGGAGGTGGAGAAAATG(SEQIDNO:329) PF1399(s/p,S-layerprotein)RBS E1-3:Msed_0148 GGGTGATGTGGGGATGA(SEQIDNO:330) Msed0148(nativeMsedRBS:coupledE1-3) E1-:Msed_1375 TAAGGAGGTTTGAAGATG(SEQIDNO:331) PF0791(por:Pyruvateferredoxin oxidoreductase)RBS E2:Msed_0709 TAAGGGAGGTGGAGCATATG(SEQIDNO:332) PF1399(s/p,S-layerprotein)RBS E3:Msed_1993 TGAGGTGATATGCAATG(SEQIDNO:333) PF0190(cipA,coldinducedproteinA)RBS)

    [0261] Transformation of P. furiosus pdaD strain to yield P. furiosus strain PF506 containing the SP1 operon. Transformation of P. furiosus pdaD strain was performed as previously described for COM1 (Lipscomb, et al. 2011. Appl Environ Microbiol. 77(7):2232-8) with a few changes, in that sequence-verified plasmid DNA was used for transformation and the defined medium contained maltose instead of cellobiose as the carbon source and was supplemented with 0.1% w/v casein hydrolysate. Briefly, pALM506-1 was mixed (at 5 g plasmid DNA/mL culture) with an aliquot of a fresh overnight culture of pdaD grown in defined maltose (DM) medium containing 0.1% w/v casein hydrolysate and 4 mM agmatine. The transformation mixtures were spread on DM plate medium containing 0.1% w/v casein hydrolysate and 20 M uracil and incubated at 90 C. for 95 h. Transformant colonies were further purified by six serial transfers in DM liquid medium containing 0.1% w/v casein hydrolysate and 20 M uracil. The presence of the insert in the transformed strains was verified by PCR screening of isolated genomic DNA.

    [0262] Determining transcriptionally inactive regions for foreign gene insertion. P. furiosus intergenic genome regions with little to no transcriptional activity were found using tiling array data of gene expression in wild-type P. furiosus from early log to early stationary phase, relative to a mid-log time point ((Yoon, et al. 2011. Genome Res. 21(11):1892-904), FIG. 27). Primary targets consisted of intergenic space between convergent genes, so as to avoid gene promoter regions. Secondary targets consisted of intergenic space between genes in the same orientation, separated by at least 450 bases. Ten total genome regions with little to no transcriptional activity were identified for use as foreign gene insertion sites. Tiling array data was mapped to the NCBI reference genome sequence (P. furiosus DSM3638); however, the genetically tractable strain of P. furiosus, COM1, has some genome rearrangements which affect the positions of the genome regions within the chromosome (Lipscomb G L, et al. 2011. Appl Environ Microbiol. 77(7):2232-8, Bridger S L, et al. 2012. J Bacteriol. 194(15):4097-106) (FIG. 28). Namely, genome region 10 was located within a region of the P. furiosus genome which was inverted in the COM1 strain.

    [0263] Construction of vectors targeting insertion at genome regions 2 and 3. SOE-PCR (splicing by overlap extension and PCR, Horton, et al. 1989) was used to combine 0.5 kb flanking regions targeting homologous recombination at genome region 3 (between convergent genes PF0574-PF0575, see FIG. 28), with a marker cassette, including restriction sites for cloning. The marker cassette for uracil prototrophic selection consisted of the pyrF gene driven by either the pep promoter region (P.sub.pep, 123 bases of DNA sequence immediately upstream from the translation start of the PEP synthase gene, PF0043) or the gdh promoter region (P.sub.gdh, 157 bases of DNA sequence immediately upstream from the translation start of the glutamate dehydrogenase gene, PF1602) and terminated with the terminator sequence consisting of 12 bases of the 3 UTR of the hpyA1 gene (5-aatcttttttag (SEQ ID NO:334), PF1722). A 65-b sequence of the 3 end of the marker cassette (5-ctaaaaaagattttatcttgagctccattctttcacctcctcgaaaatcttcttagcggcttccc (SEQ ID NO:335)) was repeated at the beginning of the cassette to serve as a homologous recombination region for selection of marker removal from the transformed strain which would allow for iterative use of the marker in the same strain (Farkas J, et al. Appl Environ Microbiol. 2012. 78(13):4669-76) (FIG. 29). Vector pGL002, targeting genome region 2, was constructed by cloning the SOE-PCR products into the SmaI site of pJHW006 (FIG. 30), and vector pGL007 targeting genome region 3 was constructed by cloning the SOE-PCR product into the NdeI-NheI sites of pJHW006 (FIG. 31) (Lipscomb, et al., Appl Environ Microb 77:2232-2238 (2011)).

    [0264] Construction of synthetic operons (SP1 and SP2B) for expression of Msed genes in P. furiosus. SOE-PCR was used to construct artificial operons for the co-expression of SP2B genes consisting of the four M. sedula genes E7 (Msed_0639), E8 (Msed_0638), E8 (Msed_2055), E9 (Msed1424), with expression driven by the slp promoter region (P.sub.slp, consisting of 184 bases immediately upstream from the slp gene, PF1399). P. furiosus ribosomal binding sites from either the pep gene (5-ggaggtttgaag (SEQ ID NO:336)) or the slp gene (PF1399, 5-ggaggtggagaaaa (SEQ ID NO: 337)) were inserted in front of each gene downstream from the first in the operon. A terminator sequence of the hpyA1 gene was included at the end of the operon (5-aatcttttttag (SEQ ID NO:338), from the 3 UTR of PF1722) (FIG. 32). The SP2B operon construct was cloned into the SmaI site of pGL002 to make pGL005 for targeted insertion at P. furiosus genome region 2 (FIG. 33).

    [0265] The expression cassette for SP1 consisting of the five M. sedula genes E1 (Msed_0147), E1 (Msed_0148), E1 (Msed_0149), E2 (Msed_0709), E3 (Msed_1993) was PCR-amplified from pALM506 (FIG. 34). This expression cassette contained ribosomal binding sites from the POR gene (PF0791, 5-ggaggtttgaag (SEQ ID NO:339)), the slp gene (PF1399, 5-ggaggtggagaaaa (SEQ ID NO:340)), and the cipA gene (PF0190, 5-ggtgatatgca (SEQ ID NO:341)). A terminator sequence was added to the 3 end of the operon (5-aatcttttttag (SEQ ID NO:342), from the 3 UTR of PF1722), and the construct was cloned into the AscI-NotI sites of pGL007 to make pGL010 (FIG. 35), for targeted insertion at P. furiosus genome region 3 (see FIG. 27).

    [0266] Transformation of P. furiosus COM1 strain to yield P. furiosus strain MW56 containing SP1 and strain MW43 containing SP2B. Transformation of COM1 was performed as previously described (Lipscomb, et al., Appl Environ Microb 77:2232-2238 (2011)), except that linear plasmid DNA was used for transformation. Briefly, pGL010 and pGL005 were linearized by restriction digest and mixed (at a final concentration of 2 g/mL DNA) with an aliquot of a freshly grown culture of COM1, cultured in defined cellobiose medium plus 20 M uracil. Transformation mixtures were spread on defined cellobiose plate medium without uracil and incubated at 95 C. for 60 h. Transformant colonies were further purified on defined cellobiose plate medium without uracil twice. Strains were verified by PCR screening of isolated genomic DNA and sequencing of PCR products amplified from the target regions.

    Example 4

    Temperature-Dependent Production of M. sedula Enzymes in P. furiosus Using Strains PF506 (E1E3) and MW43 (E9)

    [0267] Growth of P. furiosus for biochemical assays and product analysis. P. furiosus strains were cultured in media containing 28 g/L NaCl, 3.5 g/L MgSO.sub.4.7H.sub.2O, 2.7 g/L MgCl.sub.2.6H.sub.2O, 0.33 g/L KCl, 0.25 g/L NH.sub.4Cl, 0.14 g/L CaCl.sub.2.2H.sub.2O, 2.00 mg/L FeCl.sub.3, 0.05 mg/L H.sub.3BO.sub.3, 0.05 mg/L ZnCl.sub.2, 0.03 mg/L CuCl.sub.2.2H.sub.2O, 0.05 mg/L MnCl.sub.2.4H.sub.2O, 0.05 mg/L (NH.sub.4).sub.2MoO.sub.4, 0.05 mg/L AlKSO.sub.4.2H.sub.2O, 0.05 mg/L CoCl.sub.2.6H.sub.2O, 0.05 mg/L NiCl.sub.2.6H.sub.2O, 3.30 mg/L Na.sub.2WO.sub.4.2H.sub.2O, 5 g/L maltose and yeast extract, 0.5 g/L riboflavin, and 20 M uracil or 4 mM agmatine as needed. After these ingredients are dissolved, the media was made anaerobic by the addition of 0.5 g/L cysteine HCl, 0.5 g Na.sub.2S (dissolved in 50 mL water). Following the reductant 1.0 g/L NaHCO.sub.3 was added along with 1 mM potassium phosphate buffer (from a 1 M or 1000 stock at pH 6.8). If needed, the pH of the media was adjusted to 6.8 with HCl before degasing. Cultures were inoculated to 110.sup.7 cells/mL and incubated at 98 C. until cell densities reached 110.sup.8 cells/mL. Cultures were then cooled at room temperature until the temperature reached 70 to 75 C. when they were placed in an incubator set to a temperature in the range of 65 to 75 C. for up to 32 hours. Cell densities were calculated from counting a sample in a Hausser counting chamber.

    [0268] P. furiosus cell paste was anaerobically resuspended in 50 mM Tris pH 8.0+DNase 1 (3 mL buffer/g cell paste). The slurry was stirred for 30 minutes in an anaerobic chamber, lysing the cells by osmotic shock. The crude extract was then centrifuges at 100,000g for 1 hour. The resulting supernatant (S-100) was diluted (with 50 mM Tris pH 8.0) and re-concentrated 3 times with a 3 kDa centrifugation filter. The washed and concentrated S-100 was sealed in a vial to maintain anaerobicity and stored at 80 C.

    [0269] Growth of M. sedula for biochemical assays and product analysis. M. sedula (DSM 5348) was grown autotrophically as described in Example 3.

    [0270] M. sedula cell paste was anaerobically resuspended in 50 mM Tris pH 8.0 and Dnase 1 (2 mL buffer/g cell paste). The slurry was stirred for 1 hour in an anaerobic chamber, lysing the cells by osmotic pressure. The crude extract was then centrifuges at 100,000g for 1 hour. The resulting supernatant (S-100) was sealed in a vial to maintain anaerobic conditions and stored at 80 C.

    [0271] NADPH-dependent assays for the E2, E2+E3 and E1+E2+E3 reactions of SP1 (FIG. 36). All reactions were carried out in sealed anaerobic cuvettes at 75 C. containing 100 mM MOPS pH 7.5 (measured at room temperature), 5 mM MgCl.sub.2, 5 mM DTT and the cell-free extract of P. furiosus (0.25 mg/ml). After addition of NADPH, the relevant CoA derivative and other substrates (see below), NADPH oxidation was determined by the absorbance at 340 nm and rates were calculated based on the difference before and after the addition of the CoA substrate.

    [0272] E2 assay. The added substrates were 1 mM NADPH and 1 mM Succinyl-CoA. Note that E3 does not utilize succinic semialdehyde, the product of the reaction.

    [0273] E2+E3 assay. The added substrates were 1 mM NADPH and 1 mM Malonyl-CoA. In this case E3 does utilize the product, malonate semialdehyde, in a NADPH-dependent reaction.

    [0274] E1+E2+E3 assay. The added substrates were 1 mM NADPH, 1 mM Acetyl-CoA, 1 mM ATP and 10 mM NaHCO.sub.3. The product, malonyl CoA, is then used by E2 and the product of that reaction, malonate semialdehyde, is then used as a substrate for E3, both in NADPH-dependent reactions.

    [0275] The growth of the strain PF505 before and after the temperature shift from 98 C. to 75 C. are shown in FIG. 17. The Specific activities of E1, E2 and E3 in cell-free extracts of PF506 after the temperature shift from 98 C. to 75 C. are shown in Table 9.

    TABLE-US-00009 TABLE 9 Specific activities of E1, E2 and E3 in cell-free extracts of PF506 after the temperature shift from 98 C. to 75 C. Specific activity: mol NADPH oxidized/min/mg Enzymes E1 + E2 + E3 E2 + E3 E2 Substrate Acetyl-CoA Malonyl-CoA Succinyl-CoA PdaD 0 0 0 0 hr 0.03 0.05 0.03 16 hr 0.03 0.54 0.16 32 hr 0.07 0.28 0.11 48 hr 0.07 0.08 0.01 Msed 0.02 0.08 0.08 Msed (literature)* 0.07 0.42 0.20 *Published value assayed aerobically at 65 C.: Berg, I. A. et al. 2007. Science. 318, 1782-1786)

    [0276] The specific activities of E1, E2 and E3 in extracts of PF506 were comparable to those measured in extracts of M. sedula and to literature values reported by others after the P. furiosus cells were grown for approx. 16 hours at 75 C. No activity was measured in cells grown at 98 C.

    [0277] NADPH-dependent assay for E9 of the SP2B subpathway (FIG. 36). Assays were carried out in sealed anaerobic cuvettes at 75 C. containing 100 mM MOPS pH 7.5 (measured at room temperature), 5 mM MgCl.sub.2, 5 mM DTT, 1 mM NADPH and the cell-free extract of P. furiosus (0.25 mg/ml). After addition of 1 mM succinic semialdehyde, NADPH oxidation was determined by the absorbance at 340 nm and rates were calculated based on the difference before and after the addition of the succinic semialdehyde.

    [0278] Growth of P. furiosus strain MW43 at 95 C. and temperature shift from 65 C. to 90 C. for 18 hrs (FIG. 38). Cultures were shifted from 95 C. and were incubated for 18 hr before harvesting. The maximum activity and specific activity for E9 is seen after the cultures are shifted to 70 C. (for 18 hr), with lower values at 65 and 75 C. The production of active E9 decreases dramatically at 80 C. and above.

    [0279] E9 temperature profile and stability in cell-free extracts of P. furiosus strain MW43 (FIG. 39). The specific activity of E9 in P. furiosus strain MW43 (grown at 70 C.) is about 10-fold higher that than measured in M. sedula. The highest E9 specific activity was measured in MW43 cells grown at 70 C. even though in cell extracts the maximum activity was above 80 C. and the enzyme has a half-life of 30 min at 90 C. It was concluded that P. furiosus cells should be temperature shifted from 95-98 C. to 70 C. for 18 hrs to obtain the highest activities of M. sedula enzymes.

    Example 5

    [0280] Determination of E1 and E2 Activities in P. furiosus Strain PF506, its Parent Strain PdaD, in P. furiosus Strain MW56 and its Parent Strain COM1, and in M. sedula

    [0281] Phosphate Assay for E1 (FIG. 40). Pf extract was added to 0.1 mg/mL in buffer containing 100 mM MOPS pH 7.5 (at room temperature), 5 mM MgCl.sub.2, and 5 mM DTT. Added substrates were 10 mM NaHCO.sub.3, 1 mM ATP, and 1 mM Acetyl-CoA. The sealed anaerobic vials were incubated at 75 C. and 20 L samples were taken out at 0, 2, and 4 minutes and added to a 96 well plate. The samples were diluted with 180 L of water before the addition of 30 L of BioVision (Mountain View, Calif.) phosphate assay reagent. Absorbance at 650 nm was measured and rates were calculated based on the difference between theAcetyl-CoA control for each sample.

    [0282] Specific activities of E1 and E2 in cell-free extracts of recombinant and parent P. furiosus strains and in M. sedula (Table 10). The E1 and E2 assays were carried out at 75 C. as described in FIGS. 16 and 23, respectively. Specific activities are expressed as nmol phosphate released and nmol NADPH oxidized/min/mg, respectively.

    TABLE-US-00010 TABLE 10 E1: E2: Acetyl-CoA Malonyl-CoA Cell-extract P.sub.i release NADPH oxidation COM 1 <5 <5 PdaD <5 <5 MW56 93 10 92 (n = 4) (n = 1) PF506 74 19 248 123 (n = 6) (n = 11) Msed 206 49 143 60 (n = 3) (n = 3)

    [0283] The specific activities of E1 and E2 in P. furiosus strains PF506 and MW56 are comparable to those measured in Msed but are not detected in the P. furiosus parent strains.

    Example 6

    [0284] Production of 3HP by Cell-Free Extracts of P. furiosus Strains PF506 and MW56

    [0285] Identification and quantitation of 3-hydroxypropionate produced by the SP1 pathway in cell-free extracts of P. furiosus strain PF506 and strain MW56. Two approaches were used to produce 3HP: 1. Using malonyl CoA with NADPH or H.sub.2/NADP as the electron donor catalyzed by enzymes E2+E3 (and SHI to activate H.sub.2); and 2. Using acetyl CoA plus CO.sub.2 (bicarbonate) with NADPH or H.sub.2/NADP as the electron donor catalyzed by enzymes E1+E2+E3 (and SHI to activate H.sub.2).

    [0286] Detection and quantitation of 3-hydroxypropionate (3HP). 3HP produced in cell-free extracts of P. furiosus was derivatized by two reactions and each derivative was identified and quantitated by different approaches.

    HPLC: 2-Nitrophenylhydrazine derivatization. The 3HP-hydrazide was prepared and extracted from mixtures with ether. The ether-extracted 3HP-hydrazide was identified by ESI-MS analysis. The ether-extracted 3HP-hydrazide was quantitated after separation by HPLC.
    GC-MS: per-O-trimethylsilylate derivatization. The 3HP-TMS derivative was both identified and quantitated using GC-MS analysis.

    [0287] Methods used to identify 3-HP in cell-free extracts of P. furiosus. Production of 3-HP from malonyl CoA by E2+E3 and from acetyl CoA by E1+E2+E3. To the Pf extract (0.25 mg/mL) in buffer containing 100 mM MOPS pH 7.5, 5 mM MgCl.sub.2, and 5 mM DTT, was added 1-2 mM Malonyl-CoA (for E2+E3) or 10 mM NaHCO.sub.3, 2 mM ATP and 1 mM Acetyl-CoA (for E1+E2+E3). The electron source was 2 mM NADPH or 0.5 mM NADP.sup.+ with 100% H.sub.2 in the headspace. Sealed anaerobic vials were incubated at 75 C. for up to 2 hours.

    [0288] GC-MS detection of 3-HP. A sample of the enzyme assay mixture was spiked with 20 g of inositol as an internal standard. For hydrolysis of proteins, the samples were freeze-dried, then incubated in 2 M TFA at 80 C. for 1 hour then dried under nitrogen. The samples were then per-O-trimethylsilylated by treatment with Tri-Sil (Pierce) at 80 C. for 30 minutes. GC-MS analysis of the TMS derivatives was performed on an AT 7890n GC interfaced to a 5975C MSD, using a Grace EC-1 column (30 m0.25 mm). The exact mass of 3-HP-TMS is 162.

    [0289] 2-Nitrophenyl hydrazine derivatization of 3HP. The steps to derivatize 3HP were as follows. 1) Add 100 L sample of cell-free extract to 200 L ethanol. 2) Add 200 L 20 mM 2-nitrophenyl hydrazine in 100 mM HCL/ethanol (1:1). 3) Add 200 L 250 mM 1-Ethyl-3-(3-Dimethylaminopropyl)-N-ethylCarbodiimide hydrochloride (1-EDC.HCL) in 3% pyridine in ethanol (v/v). 4) Heat sample at 60 C. for 20 minutes. 5) Add 100 L of 15% (W/V) KOH. 6) Heat again at 60 C. for 15 minutes. 7) Let sample cool and acidify with 50% HCL to pH between 4-6. 8) Analyze 10-50 L aliquots on the HPLC.

    [0290] Ether extraction of 3HP-Hydrazide. This was accomplished by the following steps. 1) Add 1 mL 1 M KPO.sub.4 Buffer, pH 7.0 to cooled 800 L derivatized sample. 2) Add 1 mL of ether to sample and mix well. 3) Centrifuge 10 min 6,000 g to separate the phases. 4) Remove top ether layer and transfer to a new tube. 5) Repeat steps 2-4. 6) Evaporate the ether. 7) Suspend the dried sample in 200 L methanol or 0.05% TFA. 8) Run 10-50 L aliquots on the HPLC.

    [0291] HPLC detection of 3-HP-Hydrazide. The column and run conditions were as follows: column, Supelco LiChrosorb RP-8 (5 m); solvent system, A 0.05% TFA, B 100% acetonitrile; gradient 0-20 min, 0-100% B, 20-22 min: 100% B; flow rate: 1 ml/min; temperature: 30 C.

    [0292] ESI-MS detection of 3-HP-hydrazide. The derivatized 3HP samples were extracted with ether, dried, and re-constituted in methanol. The resulting samples were analyzed by direct injection on a Perkin-Elmer API 1 plus in negative mode. The exact mass of the anion 3HP-Hydrazide is 224.

    [0293] Summary of methods used to identify 3-HP in cell-free extracts of P. furiosus is shown in Table 13. Summary of amounts of 3-HP produced by cell-free extracts of PF506 and MW56 using malonyl CoA (E2+E3) or acetyl CoA+CO.sub.2 (E1+E2+E3) as the carbon sources with NADPH or H.sub.2 as the electron donor is shown in Table 11 and Table 12

    TABLE-US-00011 TABLE 11 E2 + E3: 1 mM E1 + E2 + E3: 1 mM Malonyl-CoA Acetyl-CoA NADPH NADPH e.sup. donor H.sub.2 e.sup. donor e.sup. donor H.sub.2 e.sup. donor Strain (2 mM) (100% headspace) (2 mM) (100% headspace) MW56 HPLC (not done) HPLC HPLC PF506 HPLC GC-MS HPLC ESI-MS GC-MS ESI-MS ESI-MS

    TABLE-US-00012 TABLE 12 E2 + E3: 1 mM Malonyl-CoA E1-E2 + E3: 1 mM Acetyl-CoA H.sub.2 e.sup. donor H.sub.2 e.sup. donor P. furiosus NADPH e.sup. donor (100% NADPH e.sup. donor (100% strain (2 mM) headspace) (2 mM) headspace) MW0056 100 M/30 min (not done) 40 M/8 min (D) 48 M/8 min (D) (C) PF506 160 M/2 hr (A) 150 M/2 hr 50 M/2 min (D) 23 M/2 min (D) 500 M/2 hr (B) (A) 80 M/30 min (C)

    TABLE-US-00013 TABLE 13 A B C D Method GC-MS HPLC HPLC HPLC [Protein] 0.25 mg/mL 0.25 mg/mL 0.3 mg/mL 3 mg/mL

    Example 7

    [0294] Production of 3HP by Whole Cells of P. furiosus Strains PF506 and MW56
    Product Analysis of E1+E2+E3 Activities in Whole Cells of P. furiosus.

    [0295] In vivo 3-HP production assay. PF506 and MW56 were grown in 2 L cultures at 98 C. for 10 hours until cell densities reached 110.sup.8 cells/mL when they were cooled and incubated at 75 C. for 16 hours. Harvested cells were suspended to 510.sup.10 cells/mL in 100 mM MOPS pH 7.5 and 1Pf base salts (28 g/L NaCl, 3.5 g/L MgSO.sub.4.7H.sub.2O, 2.7 g/L MgCl.sub.2.6H.sub.2O, 0.33 g/L KCl, 0.25 g/L NH.sub.4Cl, 0.14 g/L CaCl.sub.2.2H.sub.2O). The cell suspension was sealed in a serum vial, degasses with Ar, and brought to 0.5 g/L cysteine HCl. Added substrates were 10 mM NaHCO.sub.3 and either 10 mM maltose or 40 mM pyruvate. The vials were then degassed with H.sub.2 and incubated at 75 C. for 60 minutes. Samples for 3-HP analysis by HPLC include a direct sample of the cell suspension, the supernatant of a portion, and the pellet re-suspended and lysed in water. A schematic of how P. furiosus metabolizes maltose and provides acetyl CoA for 3HP production is shown at FIG. 41.

    [0296] A total of 135 M of 3HP was produced by a cell suspension of MW56 (510.sup.10 cells/ml) after 60 min at 75 C. A total of 199 M of 3HP was produced by a cell suspension of PF506 (510.sup.10 cells/ml) after 60 min at 75 C. 3-HP production by whole cells of P. furiosus strains PF506 and MW56 is summarized in Table 14. The majority (70%) of in vivo produced 3-HP was contained within intact cells.

    TABLE-US-00014 TABLE 14 1 mL cell MW56 PF506 suspension Pyruvate Maltose Pyruvate Maltose No Substrate Extracellular 45 nmol 30 nmol <20 nmol 45 nmol <20 nmol Intracellular 110 nmol 80 nmol 50 nmol 100 nmol <20 nmol

    Example 8

    Anapleurosis and Assimilation of Acetyl-CoA Associated with H.SUB.2.CO.SUB.2 .Autotrophy in the Thermoacidophilic Archaeon Metallosphaera Sedula

    [0297] Metallosphaera sedula is an extremely thermoacidophilic archaeon (T.sub.opt=73 C., pH 2.0) that grows heterotrophically on peptides and chemolithoautotrophically on metal sulfides or hydrogen gas (Auernik and Kelly, 2010, Appl. Environ. Microbiol. 76:931-935). For chemolithotrophic growth it uses a unique carbon fixation pathway, known as the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) cycle (Berg et al., 2007. Science 318:1782-1786), so far found only in members of the order Sulfolobales. This cycle is one of two such cycles found exclusively in thermophilic archaea, the other being the dicarboxylate/4-hydroxybutyrate (DC/4HB) cycle present in the order Desulfurococcales (Berg et al., 2010. Nat. Rev. Microbiol. 8:447-460). In the first part of the 3HP/4HB cycle, acetyl-CoA (C2) is converted into succinyl-CoA (C4) by two successive carboxylation steps (Berg et al., 2010. Nat. Rev. Microbiol. 8:447-460). Succinyl-CoA is then converted to 4HB, which is rearranged and cleaved to produce two molecules of acetyl-CoA. Labeling studies using 4-hydroxy[1-.sup.14C]butyrate and [1,4-.sup.13C.sub.1]succinate revealed how the 3HP/4HB pathway relates to M. sedula central metabolism (Estelmann et al., 2011. J. Bacteriol. 193:1191-1200), suggesting that most of the carbon flux (about two-thirds) enters central metabolism via succinate (succinate branch) and not through reductive carboxylation of acetyl-CoA to pyruvate. The remaining third of the carbon flux (acetyl-CoA branch) passes through 4HB, thereby regenerating acetyl-CoA (FIG. 42).

    [0298] Transcriptomic analysis of M. sedula cells grown under strictly autotrophic conditions (H.sub.2, CO.sub.2) presented here supports the premise that most carbon is assimilated via succinate and provides additional insights into the connections between the carbon fixation and central metabolism. This analysis indicates that acetyl-CoA assimilation occurs during formation of citric acid cycle intermediates (e.g., citrate and malate) and also during isoprenoid-based lipid biosynthesis (Koga and Morii, 2007. Microbiol. Mol. Biol. Rev. 71:97-120; Boucher et al., 2004. Molecular Microbiology 52:515-527). Thus, the six enzymes in the acetyl-CoA branch of the 3HP/4HB cycle, which catalyze the rearrangement of succinyl-CoA to acetoacetyl-CoA with subsequent cleavage to acetyl-CoA, are essential not only for CO.sub.2 fixation but also for anaplerosis of acetyl-CoA.

    [0299] Most of the individual enzymes of the 3HP/4HB cycle have now been characterized biochemically, including methylmalonyl-CoA mutase (Msed_0639) and epimerase (Msed_0638, Msed_2055) (Han et al., 2012. Appl. Environ. Microbiol. 78:6194-6202), and acyl-CoA synthetase (Msed_0406) that catalyzes the ligation of 4HB to CoA (Example 1) (Table 1). Here, we report the biochemical characteristics of two more enzymes of the 3HP/4HB pathway4-hydroxybutyryl-CoA dehydratase (4hbd) (Msed_1321) and -ketothiolase (Th1) (Msed_0656). Furthermore, the final part of the 3HP/4HB cycle was re-constituted in vitro to produce acetyl-CoA from 4HB, demonstrating that these enzymes are likely involved in the functioning cycle. Finally, biochemical and transcriptomic information was used to examine the connection of the 3HP/4HB cycle to central metabolism in M. sedula.

    Materials and Methods

    [0300] Growth of M. sedula in a gas-intensive bioreactor. M. sedula (DSMZ 5348) was grown aerobically on DSMZ medium 88 at pH 2.0 in a 70 C. shaking oil bath. For routine small cultures (30 ml), heterotrophically grown cells were supplemented with 0.1% tryptone, while autotrophically grown cells were grown with the addition of 50 ml gas mix to the headspace (80% H.sub.2, 20% CO.sub.2). Cell growth was scaled-up from 300 ml in sealed 1-liter bottles to 2 liters in a stirred bench-top glass fermentor (Applikon), agitated at 250 rpm. Two separately regulated gas feeds were usedone for H.sub.2/CO.sub.2 mixture and one for air. The flow rates were held constant for all conditions at 1 ml/min for the H.sub.2/CO.sub.2 gas mixtures (composition: varied) and 100 ml/min for air (composition: 78% N.sub.2, 21% O.sub.2, 0.03% CO.sub.2). The gas mixture compositions were as follows: autotrophic carbon-rich (ACR)80% H.sub.2 and 20% CO.sub.2; autotrophic carbon limited (ACL)80% H.sub.2 and 20% N.sub.2; and heterotrophic (HTR)80% N.sub.2 and 20% CO.sub.2 (with 0.1% tryptone added to medium). Tandem bioreactors were run simultaneously and started with the same inoculum to generate biological repeats. Cells were harvested at mid-exponential phase by rapid cooling with dry ice and ethanol and then centrifuged at 6000g for 15 min at 4 C.

    [0301] M. sedula oligonucleotide microarray transcriptional response analysis. A spotted whole-genome oligonucleotide microarray was used for transcriptional analysis, as described in Example 1. Total RNA was extracted and purified using an RNeasy kit (Qiagen), reverse-transcribed with Superscript III (Invitrogen), re-purified, and labeled with either Cy3 or Cy5 dye (GE Healthcare). Labeled cDNA was then hybridized to the microarray slide (Corning) at 42 C. Slides were scanned on a GenePix 4000B Microarray Scanner (Molecular Devices, Sunnyvale, Calif.) and raw intensities were quantitated using GenePix Pro version 6.0. Data normalization and statistical analysis were performed using JMP Genomics 5 (SAS, Cary, N.C.). In general, significant differential transcription was defined to be relative changes in expression of 2-fold (where a log 2 value of 1 means a 2-fold change) having p values of 5.4 (Bonferroni correction equivalent to a p value of 4.010.sup.6 for this microarray). Microarray data are available through the NCBI Gene Expression Omnibus (GEO) under accession number GSE39944.

    [0302] Heterologous expression of M. sedula genes in E. coli. Msed_0406, Msed_1321, Msed_0399, and Msed_0656 were amplified from genomic DNA using primers from IDT Technologies (Coralville, Iowa). Msed_0406 was cloned into pET46-Ek/LIC with an N-terminal His.sub.6 tag, as described in Example 1. Msed_1321 was cloned with an N-terminal His.sub.6 tag into a modified pETA vector, into which the anaerobic hya promoter from E. coli had been inserted to allow for anaerobically-regulated expression (Sun et al., 2010. PLoS One 5:e10526). Msed_0399 was cloned into pET21b without a His-tag, and Msed_0656 was cloned into pCDF-Ek/LIC with an N-terminal His.sub.6 tag. All four constructs were individually cloned into NovaBlue GigaSingles E. coli competent cells and selected by growth on LB-agar supplemented with antibiotic. Sequences were confirmed by Eton Biosciences, Inc. (Durham, N.C.). Next, the plasmids were transformed into E. coli Rosetta 2 (DE3) cells for protein expression. Rosetta strains containing pET46-0406, pET21b-0399, and pCDF-0656 were grown and expressed aerobically at 37 C. for 16 h in Studier's auto-inducing medium ZYM-5052 (Studier, 2005. Protein Expression and Purification 41:207-234). Rosetta cells containing pETA-1321 plasmid were grown in a 2 L Applikon bioreactor (37 C., 800 rpm, pH 6.7, 0.5 slpm air) in Studier's non-inducing medium ZYM-505 with 0.5 mM FeCl.sub.3. Cells were grown until dissolved oxygen reached 30% of the initial level, at which point 50 mM glucose was added and the air feed was switched to N.sub.2 to induce anaerobic expression. The cells were grown for another three hours before harvest.

    [0303] Enzyme purification and biochemical assays. Lysis of aerobically expressed proteins began with harvesting cells and centrifuging at 6000g for 15 min at 4 C. Cell pellets were re-suspended in lysis buffer (50 mM sodium phosphate, 100 mM NaCl, 0.1% Nonidet P-40, pH 8.0) and lysed with a French pressure cell (two passes at 18,000 psi). The lysate was centrifuged at 25,000g for 15 min at 4 C. to remove insoluble material. Native E. coli proteins were removed by heat-treating the extract at 65 C. for 20 minutes. Nucleic acids were precipitated by addition of streptomycin sulfate (1% w/v), and then lysate was centrifuged again at 25,000g for 15 min at 4 C. to remove precipitated nucleic acids and heat-labile proteins. The soluble, heat-treated cell-free extract was sterile-filtered (0.22 m) before chromatographic purification. Msed_1321 was lysed and purified in a Coy anaerobic chamber (95% N.sub.2, 5% H.sub.2). The cell pellet was re-suspended in lysis buffer (20 mM Tris, 20 mM NaCl, 3.5 mM DTT, 1 mg/ml lysozyme, pH 8.0) and incubated for 30 min at 37 C., followed by heat-treatment at 65 C. for 30 min. Streptomycin sulfate (1% w/v) was added and the lysate was centrifuged at 25,000g for 15 min at 4 C. The soluble, heat-treated cell-free extract was sterile-filtered (0.22 m) before purification by column chromatography.

    [0304] 4-hydroxybutyrate:CoA ligase (Msed_0406) and acetoacetyl-CoA -ketothiolase Msed_0656 These enzymes were purified using a 1 ml HiTrap nickel column (GE Healthcare). The soluble, heat-treated lysate was loaded onto the column with binding buffer (50 mM sodium phosphate, 300 mM NaCl, 20 mM imidazole, pH 7.4) and the his-tagged enzyme removed with elution buffer (50 mM sodium phosphate, 300 mM NaCl, 500 mM imidazole, pH 7.4). The elution fractions containing enzyme were collected, concentrated, and dialyzed into reaction buffer (100 mM MOPS, pH 7.5), and then either stored at 4 C. for immediate use or mixed with glycerol to 20% and stored at 20 C. For 4-hydroxybutyrate:CoA synthetase (Msed_0406), a discontinuous assay was used to measure substrate-dependent disappearance of CoA at 70 C. using 5,5-dithiobis-(2-nitrobenzoic acid) (DTNB), as described in Example 1. For acetoacetyl-CoA -ketothiolase (Msed_0656), enzyme activity was measured using the discontinuous DTNB assay to measure substrate-dependent disappearance of CoA at 70 C. The reaction buffer contained 20 mM MOPS, pH 7.5, 5 mM MgCl.sub.2, 0.2 mM CoA, 0.3 mM acetoacetyl-CoA, and purified enzyme.

    [0305] Crotonyl-CoA hydratase/(S)-3-Hydroxybutyryl-CoA dehydrogenase (Msed_0399). The enzyme was purified first using a Q-sepharose HiLoad 16/10 anion exchange column (GE Healthcare). The protein was loaded onto the column with 20 mM Tris, pH 8.0, and eluted with 20 mM Tris, 1 M NaCl, pH 8.0 using a linear elution gradient. Fractions containing Msed_0399 were confirmed with SDS-PAGE, collected and dialyzed into buffer for size exclusion chromatography (50 mM potassium phosphate, 150 mM NaCl, pH 7.0). The partially-purified protein was further separated on a HiLoad 26/600 Superdex 200 PG column, and the elution fractions containing Msed_0399 were collected, concentrated, and dialyzed into reaction buffer (100 mM MOPS, pH 7.5), and then either stored at 4 C. for immediate use or mixed with glycerol to 20% and stored at 20 C. Enzyme activity was measured spectrophotometrically at 70 C. by following NAD.sup.+ reduction at 340 nm (extinction coeffienct at 340 nm=3,400 M.sup.1 cm.sup.1) (Berg et al., 2007. Science 318:1782-1786). The assay mixture contained 20 mM MOPS (pH 7.0), 5 mM MgCl.sub.2, 2 mM NAD.sup.+, 0.5 mM crotonyl-CoA or (S)-3-hydroxybutyryl-CoA, and purified enzyme. The reaction mixture was preheated for 2 min at 70 C. and the reaction initiated by addition of substrate.

    [0306] 4-hydroxybutyryl-CoA dehydratase (Msed_1321). The enzyme was purified using a 5 ml Bio-Scale Mini Profinity IMAC cartridge (Bio-Rad). The soluble, heat-treated lysate was loaded onto the column with binding buffer (50 mM Tris, 300 mM NaCl, 3.5 mM DTT, 20 mM imidazole, pH 8.0) and the his-tagged enzyme removed with elution buffer (50 mM Tris, 300 mM NaCl, 3.5 mM DTT, 500 mM imidazole, pH 8.0). The fraction collector was positioned inside the anaerobic chamber, and fractions containing enzyme were collected, concentrated, and dialyzed into reaction buffer (100 mM potassium phosphate, pH 7.5, 1 mM DTT). The enzyme solution was either stored at room temperature inside the anaerobic chamber for immediate use or mixed with glycerol to 20% and stored at 20 C. in a sealed vacuum dessicator. Enzyme activity was measured aerobically in a coupled spectrophotometric assay at 70 C. The assay mixture contained 20 mM sodium phosphate, 5 mM MgCl.sub.2, 2 mM 4HB, 2 mM ATP, 1 mM CoA, 2 mM NAD.sup.+, 1 mM DTT, 1 mg/ml purified Msed_0406, and 42 ng/ml Msed_0399. The reaction mixture was pre-heated for 5 min at 70 C. to allow accumulation of 4HB-CoA, and then initiated by addition of purified Msed_1321. For the oxygen-sensitivity assay, Msed_1321 was washed with 100 mM potassium phosphate, pH 7.5, to remove any DTT from the reaction buffer. An aliquot of Msed_1321 was exposed to air, vortexed well, and tested with the coupled assay at the specified time intervals. During the intervening time, the enzyme and reaction buffer was stored at 4 C. The reaction buffer was made without ATP, CoA, or NAD.sup.+these were kept at 20 C. and added to the reaction at time of use.

    [0307] Analysis of in vitro acetyl-CoA production. Enzymatic production of acetyl-CoA from 4HB was performed in vitro at 70 C. Acetyl-CoA synthase (ACS) from Pyrococcus furiosus (Glasemacher et al., 1997. Eur. J. Biochem. 244:561-567) (Pf-ACS) was used to form acetate from acetyl-CoA, and the resultant mixture was derivatized to form the phenacyl ester using dibromoacetophenone (adapted from (Durst et al., 1975. Anal. Chem. 47:1797-1801)) and assayed using reversed-phase HPLC (Waters). The Adams' Lab at University of Georgia generously provided a recombinant E. coli strain containing Pf-ACS. Heat-treated, cell-free extract from this strain was used in the following assay.

    [0308] The reaction mixture (100 l) consisted of 100 mM sodium phosphate, pH 7.9, 5 mM MgCl.sub.2, 3 mM ATP, 3 mM CoA, 3 mM NAD.sup.+, 3 mM 4HB, 1 mM DTT, 3 mM ADP, purified recombinant Msed_0406 (500 ng/l), Msed_1321 (50 ng/l), Msed_0399 (50 ng/l), and Msed_0656 (50 ng/l). The reaction mixture was incubated at 70 C. for 20 minutes, after which 10 l of Pf-ACS extract was added before incubating an additional 10 minutes at 95 C. The sample was cooled for room temperature, acidified with 50% H.sub.2SO.sub.4 to pH 2, and ether extracted twice with 750 ml diethyl ether. The ether fraction was neutralized with 50 l 20 mM bicarbonate and dried down in a vacuum centrifuge for 2 hours at 30 C. The sample was resuspended in 50 l acetonitrile with 0.5 l of 0.5% phenolphtalein. A solution of 100 mM KOH was added until the sample turned pink (pH9-10), after which 100 l of acetonitrile, 50 l of 1 M 15-crown-5-ether, and 200 l of 20 mM 2,4-dibromoacetophenone were added. The solution was heated to 80 C. for 30 minutes, cooled back to room temperature, and injected (5 l) onto a C18 silica-based column (Shodex C18-4E, 4.6250 mm) at 30 C. The initial mobile phase composition was 60% Buffer A (0.05% trifluoroacetic acid) and 40% Buffer B (acetonitrile). Samples were eluted with a ten minute linear gradient to a final composition of 20% Buffer A and 80% Buffer B.

    Results and Discussion

    [0309] Conversion of 4-hydroxybutyrate to acetyl-CoA in the 3HP/4HB cycle. The final four steps in the acetyl-CoA branch of the 3HP/4HB pathway (which converts 4HB to acetyl-CoA) are putatively catalyzed by 4HB:CoA ligase (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA -ketothiolase (Msed_0656) (FIG. 42). In order to confirm that these enzymes converted 4HB to acetyl-CoA, and to consider possible rate-limiting steps, recombinant versions were produced, purified to homogeneity, and characterized biochemically (FIG. 42, Table 15). For three of the enzymes, recombinant versions were readily produced. However, initial attempts to produce recombinant 4-hydroxybutyryl-CoA dehydratase (Msed_1321) were unsuccessful, possibly because this enzyme is oxygen-sensitive, based on the oxygen sensitivity of a well-studied homolog from an anaerobic bacterium, Clostridium aminobutyricum (Scherf et al., 1993. Eur. J. Biochem. 215:421-429; Mh et al., 1996. Biochemistry 35:11710-11718; Martins et al., 2004. Proc. Natl. Acad. Sci. U.S.A. 101:15645-15649). As such, both expression and purification of Msed_1321 were conducted under anaerobic conditions: an expression system based on the hya promoter from E. coli (Sun et al., 2010. PLoS One 5:e10526) was used, and recombinant cell lysis and protein purification were carried out in an anaerobic chamber (95% N.sub.2, 5% H.sub.2). This approach resulted in production of soluble, active enzyme. However, subsequent testing of Msed_1321 revealed it to be much less oxygen sensitive than its clostridial counterpoint. With a half-life of roughly 4 days, Msed_1321 proved to be surprisingly robust in the presence of oxygen. This increased oxygen tolerance relative to the C. aminobutyricum enzyme could be an adaptive trait associated with the aerobic environments inhabited by M. sedula.

    TABLE-US-00015 TABLE 15 Kinetic Properties of selected M. sedula enzymes from the acetyl-CoA branch of the 3HP/4HB pathway V.sub.max (mol min.sup.1 K.sub.m k.sub.cat k.sub.cal/K.sub.m Enzyme ORF mg.sup.1) (mM) (s.sup.1) (s.sup.1 M.sup.1) 4- Msed_0406 1.7 2.0 1.8 910 Hydroxybutyrate:CoA synthetase 4-Hydroxybutyryl- Msed_1321 2.2 0.15 2.1 1.4 10.sup.4 CoA dehydratase Crotonyl-CoA Msed_0399 20 0.07 19 2.6 10.sup.5 hydratase (C-CoA) (S)-3-Hydroxybutyryl- Msed_0399 (3HB- 16 0.06 15 2.6 10.sup.5 CoA dehydrogenase CoA) Acetoacetyl-CoA Msed_0656 1400 0.18 1000 5.6 10.sup.6 -ketothiolase

    [0310] In a previous study, two separate genes (Msed_0406 and Msed_0394) were found to encode acyl-CoA synthetases with activity on 4HB (8). Both Msed_0406 and Msed_0394 showed activity on a broad range of linear, unsubstituted organic acids (C2-C5). Although Msed_0406 catalyzed CoA ligation at a faster rate than Msed_0394 for the range of substrate concentrations examined (V.sub.max1.7 and 0.22 mol min.sup.1 mg.sup.1, respectively), it is possible that both enzymes contributed to this in vivo activity in M. sedula. The reaction rate for 4-hydroxybutyryl-CoA dehydratase (Msed_1321), the subsequent enzyme in the cycle, is comparable to Msed_0406. Thus, these two steps could be rate-limiting bottlenecks for the acetyl-CoA branch of the 3HP/4HB pathway, since their activities are approximately 10-fold lower than that for the two steps catalyzed by Msed_0399 (20 and 16 mol min.sup.1 mg.sup.1 for the hydration and dehydrogenase reactions, respectively), and Msed_0656 (1400 mol min.sup.1 mg.sup.1). The high K.sub.m value for Msed_0406 (2.0 mM) stands out as being much higher than the K.sub.m values for the rest of the enzymes (Msed_1321-0.15 mM, Msed_0399-0.07 mM, Msed_0656-0.18 mM), and suggests that post-transcriptional mechanisms impact substrate entry into the Acetyl-CoA branch.

    [0311] HPLC was used to confirm production of acetyl-CoA from 4HB using all four enzymes. To detect organic acids using HPLC, samples were dervatized with 2,4-dibromoacetophenone (DBAP) and then run on a reversed-phase C18 column. The reaction mixture containing 4HB and all the necessary cofactors and enzymes was first incubated at 70 C., followed by addition of Pf-ACS and a second incubation at 95 C. to convert all the acetyl-CoA to acetate. The HPLC chromatograms for the reaction mixture, control, and standards (FIG. 43) confirm the in vitro conversion of 4HB to acetate using recombinant versions of these enzymes.

    [0312] Refined autotrophic growth conditions for M. sedula transcriptomic analysis. For initial efforts focusing on M. sedula under autotrophic conditions, cultures were grown in sealed bottles in a shaking orbital bath starting with a known headspace gas composition (Auernik and Kelly, 2010, Appl. Environ. Microbiol. 76:931-935). Mass transfer of H.sub.2, CO.sub.2, and O.sub.2 into the liquid medium was neither controlled nor enhanced and, thus, growth was subject to significant diffusional limitations. To address this issue here, gas-intensive aerobic growth of M. sedula was optimized by controlling gas feed to a 3 L bioreactor. Gas feed rates were controlled using rotameters and a micro-bubble sparging stone (2-m pore size) was used to increase dissolution of sparingly soluble gases, H.sub.2 in particular. The doubling time for M. sedula exponential growth for H.sub.2CO.sub.2 autotrophy decreased from 11-13 h in sealed bottles to 5-6 hours in the gas-intensive bioreactor, indicative of significant gas-liquid mass transfer limitations in the static cultures. These improved doubling times for autotrophic growth were comparable to heterotrophic growth on 0.1% tryptone (5-6 hours), suggesting that metabolic limitations from gas supply were alleviated to a significant extent.

    [0313] Possible limitations of CO.sub.2 gas-liquid mass transfer were investigated for three growth conditions: autotrophic carbon-rich (ACR) (80% H.sub.2 and 20% CO.sub.2), autotrophic carbon-limited (ACL) (80% H.sub.2 and 20% N.sub.2), and heterotrophic (HTR) (80% N.sub.2 and 20% CO.sub.2) with 0.1% tryptone supplemented to the medium. In the ACL condition, all available inorganic carbon came from atmospheric CO.sub.2 in the air feed. The observed growth rate for HTR and ACR cultures was comparable (t.sub.d=6.7 h and 6.8 h, respectively), and faster than for the ACL culture (t.sub.d=9.4 h).

    [0314] Of the 2293 protein-coding genes in the M. sedula genome, 984 responded 2-fold or more when comparing HTR with the ACL condition. While trends were consistent with previous results from less defined growth conditions (Auernik and Kelly, 2010, Appl. Environ. Microbiol. 76:931-935), in many cases, they were more pronounced. Among the most highly up-regulated genes for the HTR vs. ACL contrast were those directly involved in CO.sub.2 fixation in the 3HP/4HB pathway, especially acetyl-CoA/propionyl-CoA carboxylase (Msed_0147, Msed_0148, Msed_1375-7- to 30-fold), 4-hydroxybutyryl-CoA dehydratase (Msed_1321-27-fold), and carbonic anhydrase (Msed_0390-29-fold). The effects of carbon dioxide limitation was especially evident for the -class carbonic anhydrase encoded in Msed_0390; transcript levels were induced 3.7-fold for the carbon-rich (ACR) vs. heterotrophy (HTR) contrast, compared to nearly 30-fold higher for the carbon-limited condition (ACL). This indicates that increasing the rate of bicarbonate formation from CO.sub.2 is essential for rapid growth.

    [0315] Bicarbonate formation actually depends on two separate reversible equilibriafirst, the hydration of aqueous CO.sub.2 to form carbonic acid (H.sub.2CO.sub.3) and second, the first ionization of polyprotic carbonic acid to form bicarbonate (HCO.sub.3.sup.). In aqueous solution at 70 C., the reaction rate of the hydration step will be roughly 75-fold faster than at 25 C. (Wang et al., 2009. The Journal of Physical Chemistry A 114:1734-1740). The equilibrium constant only increases by 2-fold (2.4e-05 M.sup.1 at 25 C. vs 4.0e-05 M.sup.1 at 70 C.), so even at elevated temperatures the concentration of aqueous CO2 is roughly 25,000 times greater than the concentration of carbonic acid (Wang et al., 2009. The Journal of Physical Chemistry A 114:1734-1740). However the apparent pKa of the ionization of carbonic acid to bicarbonate at 65 C is about 6.3, which means that at low pH virtually no bicarbonate exists in solution. M. sedula therefore likely uses carbonic anhydrase to convert CO.sub.2 to carbonic acid in the cytoplasm, where the pH value is closer to neutral. The intracellular pH of Sulfolobus acidocaldarius, an acidophilic archaeon very closely related to M. sedula, has been measured to be around 6.5 (Baker-Austin et al., 2007. Trends Microbiol. 15:165-171). At that pH, the rapid ionization of carbonic acid to bicarbonate would provide the necessary substrate for carbon fixation and cellular growth.

    [0316] The transcriptional response data from growth under gas-intensive conditions provided a clearer picture of the role of genes associated with M. sedula hydrogenases in H.sub.2CO.sub.2 autotrophy. Genes encoded in Msed_0913-0950 were all up-regulated. This locus encodes the two NiFe hydrogenases (Msed_0923-0924, Msed_0944-0945), multiple accessory proteins (HypABCDF), a maturation protease (Msed_0916), and additional hypothetical proteins that were all highly up-regulated under autotrophy. The only potential hydrogenase-related protein not associated with this locus is Msed_2256, which has 48% amino acid identity over the entire open reading frame to SlyD from Pyrococcus furiosus, a chaperone protein that participates in the recruitment of HypB, a nickel-binding GTPase (Chung et al., 2010. FEBS Lett. 585:291-294). Msed_2256 was not up-regulated under H.sub.2CO.sub.2 autotrophy, but is constitutively transcribed at high levels under all growth conditions. Transcripts for both NiFe hydrogenases were up-regulated 5 to 10-fold under autotrophy, although their absolute transcript levels differed significantly; Msed_0944-0945 was transcribed at 30-fold higher levels than Msed_0923-0924 for both heterotrophy and autotrophy. Msed_0943-0950, which encodes a membrane-associated hydrogenase, was strongly up-regulated under autotrophic conditions (Msed_094948-fold increase; Msed_094842-fold increase; Msed_094719-fold increase). This NiFe hydrogenase is likely the primary enzyme responsible for energy conservation via molecular hydrogen oxidation.

    [0317] Assimilation and anapleurosis of acetyl-CoA during H.sub.2CO.sub.2 autotrophy. Taken together, the transcriptomics data acquired through the gas-intensive bioreactor provided a more complete perspective on the assimilation and anapleurosis of acetyl-CoA during growth of M. sedula by H.sub.2CO.sub.2 autotrophy. FIG. 44 summarizes these data for genes implicated in CO.sub.2 fixation and central metabolism (adapted from (Estelmann et al., 2011. J. Bacteriol. 193:1191-1200)). Acetyl-CoA is shown in red boxes to highlight where it is produced or required. The schematic includes the initial steps of the isoprenoid-based lipid biosynthesis pathway (mevalonate pathway) and amino acid biosynthesis groups (shown in black boxes). Note that both PEP carboxylase and PEP carboxykinase are included in FIG. 44 (Enzymes 27 and 28). Assays of M. sedula extract detected activity for PEP carboxykinase (70 nmol min.sup.1 mg.sup.1 in autotrophic extracts), but no activity for PEP carboxylase in either autotrophic or heterotrophic extracts was found (Estelmann et al., 2011. J. Bacteriol. 193:1191-1200).

    [0318] The transcription of most genes directly involved in the 3HP/4HB CO.sub.2 fixation cycle (see upper right in FIG. 44) were triggered under limiting CO.sub.2 concentrations. However, the genes encoding the incomplete tricarboxylic acid cycle (TCA) are not as responsive, suggesting other mechanisms of regulation. These data support previous carbon flux analysis for the 3HP/4HB pathway that showed that carbon from CO.sub.2 enters central metabolism via succinate (Estelmann et al., 2011. J. Bacteriol. 193:1191-1200). Genes encoding succinate dehydrogenase (Msed_0674-0677) were constitutively transcribed at high levels (75% percentile of the transcriptome), along with a gene annotated as fumarate hydratase (Msed_1462) (70% percentile). No strong transcriptional response was observed for potential candidates for succinic semialdehyde dehydrogenase (Msed_0367, Msed_1298, or Msed_1774) or succinyl-CoA synthetase (Msed_1581-1582); transcripts for Msed_1581-1582, were actually down-regulated under autotrophy (6-fold and 5-fold, respectively). This is consistent with the low activity measured for succinyl-CoA synthase in extracts from heterotrophically grown cells (146 nmol min.sup.1 mg.sup.1), which was actually higher than the activity in extracts from autotrophically grown cells (36 nmol min.sup.1 mg.sup.1). Transcript levels for possible succinic semialdehyde dehydrogenase candidates varied: Msed_1774 decreased under autotrophy (down 3.6-fold), while Msed_0367 and Msed_1298 showed no differential response and average transcript levels relative to the transcriptome. Whether these ORFs have been correctly annotated or whether other unidentified genes are responsible for these biotransformations remains to be seen.

    [0319] Metabolic flux analysis of M. sedula metabolism using labeled 4-hydroxy[1-.sup.14C]butyrate and [1,4-.sup.13C.sub.1]succinate showed an unexpected route linking the carbon fixation cycle to central metabolism (Estelmann et al., 2011. J. Bacteriol. 193:1191-1200). Initially, it was suggested that acetyl-CoA was reductively carboxylated directly to pyruvate by pyruvate synthase (Berg et al., 2007. Science 318:1782-1786). However, the labeling patterns of the amino acids did not support this hypothesis, and instead it was argued that the major flux from the carbon fixation pathway happens via succinyl-CoA. Oxidation of succinyl-CoA to malate and oxaloacetate yield pyruvate and phosphoenolpyruvate (PEP), respectively. Therefore, to make one molecule of pyruvate with the 3HP/4HB pathway, it requires 1.5 turns of the cycleone full turn to make acetyl-CoA and another half-turn to make succinyl-CoA. In the anaerobic DC/4HB pathway, pyruvate can be formed directly from acetyl-CoA by reductive carboxylation. This makes the aerobic 3HP/4HB pathway nearly twice as expensive energetically, requiring nine ATP equivalents to make one molecule of pyruvate compared to five for the DC/4HB pathway (Berg et al., 2010. Nat. Rev. Microbiol. 8:447-460; Estelmann et al., 2011. J. Bacteriol. 193:1191-1200).

    [0320] Although the genes encoding for succinic semialdehyde dehydrogenase or succinyl-CoA synthetase were not transcriptionally responsive, the data do not preclude their involvement. In the case of succinic semialdehyde dehydrogenase, it may be that there are as yet unidentified genes responsible for the conversion. Clearly the activity levels are sufficient for the transformations, and the labeling data unambiguously supports the primacy of the succinate branch for carbon flux into central metabolism.

    [0321] Beyond succinyl-CoA, it appears that acetyl-CoA assimilation still has an important role as a biosynthetic precursor based on the total cell carbon measured in the labeling studies (Estelmann et al., 2011. J. Bacteriol. 193:1191-1200). This does not occur through reductive carboxylation of acetyl-CoA to pyruvate, but instead through incorporation into other central carbon intermediates, such as citrate and malate (FIG. 44). Acetyl-CoA is also essential for isoprenoid-based lipid biosynthesis in Archaea (Koga and Morii, 2007. Microbiol. Mol. Biol. Rev. 71:97-120; Boucher et al., 2004. Molecular Microbiology 52:515-527), and indeed, 33% of the 4-hydroxy[1-.sup.14C]butryate label fed to autotrophically growing M. sedula ended up in the lipid and pigment fraction (Estelmann et al., 2011. J. Bacteriol. 193:1191-1200). The initial steps of isoprenoid biosynthesis require the condensation of two molecules of acetyl-CoA to acetoacetyl-CoA (FIG. 42). When growing autotrophically, acetoacetyl-CoA could be recruited directly from the 3HP/4HB pathway, or alternatively formed by acetyl-CoA acetyltransferase (Msed_1647). 3-hydroxy-3-methyl-glutaryl-CoA (HMG-CoA) is formed by HMG-CoA synthase (Msed_1646) and reduced to mevalonic acid (Matsumi et al., 2011. Res. Microbiol. 162:39-52). Interestingly, both Msed_1646 and Msed_1647 are expressed 5-fold higher under HTR compared to ACL. However, HMG-CoA is also produced during the catabolism of leucine, which may account for the increased expression levels of these two genes. The remaining enzyme in the synthesis of mevalonate (Msed_1649) did not show any differential transcription between the tested growth conditions.

    [0322] The assimilation of acetyl-CoA directly into central carbon intermediates occurs both through citrate and malate synthesis. There are two genes in M. sedula annotated as citrate synthase, Msed_0281 and Msed_1522, which under autotrophy were down-regulated 7-fold and up-regulated 3.8-fold, respectively. The role of malate synthase in M. sedula metabolism is still uncertain. There is a gene in the M. sedula genome annotated as malate synthase, Msed_1042, that is constitutively expressed at high levels (80% percentile) and malate synthase activity has been measured in autotrophic cell extracts (58 nmol min.sup.1 mg.sup.1) (Estelmann et al., 2011. J. Bacteriol. 193:1191-1200). However, M. sedula does not have a gene for isocitrate lyase and activity was found neither in autotrophic nor heterotrophic extracts, which suggests that glyoxylate is not being formed from isocitrate to prevent loss of CO.sub.2. Thus it is unclear what role malate synthase has in M. sedula, or how the glyoxylate is being formed. The recent report of malate synthase participation in pentose metabolism in Sulfolobales does not appear to be related, as M. sedula does not grow on sugars (Nunn et al., 2010. J. Biol. Chem. 285:33701-33709).

    [0323] Regulation of flux between the succinate and acetyl-CoA branches. Succinyl-CoA, therefore, represents a branching point where carbon flux either proceeds towards malate or continues through the cycle to 4HB and acetyl-CoA. The enzymes utilized in the acetyl-CoA branch were expressed, biochemically characterized, and the sub-pathway reconstructed in vitro. Based on enzyme kinetic data, flux through the acetyl-CoA branch appears dependent on the activity of 4-HB-CoA synthetase. Previous work has established that activity of acetyl-CoA synthetase is controlled by acetylation of a conserved lysine residue by Sir2 (Starai et al., 2002. Science 298:2390-2392). Regulation on 4HB-CoA synthetase makes sense from an energetic standpoint, since this reaction requires an investment of 2 ATP equivalents to activate 4HB and form the thioester bond. Thermodynamically, this investment is not essential for the transformation of 4HB to acetate, but the formation of the high-energy thioester bond serves to help overcome other, less thermodynamically favorable reactions elsewhere in the carbon fixation pathway, such as carboxylation and carbonyl reduction reactions (Bar-Even et al., 2012. Biochim. Biophys. Acta 1817:1646-1659). The high Michaelis-Menten constant for Msed_0406 (2 mM) indicates that intracellular levels of 4HB must be high to overcome the activity barrier. The reaction rate for the subsequent transformation, the dehydration by 4HBD, is also slow (2.2 mol min.sup.1 mg.sup.1) and, hence, these two reactions form the rate-limiting steps for the acetyl-CoA branch. The final three reactions, catalyzed by the bifunctional crotonyl-CoA hydratase/(S)-3-hydroxybutyrate dehydrogenase and acetoacetyl-CoA -ketothiolase, have much faster reaction rates, 20/16 molmin.sup.1 mg.sup.1 and 1400 molmin.sup.1 mg.sup.1, respectively. Taken together, these indicate that 4HB-CoA synthetase activity serves as the entry point both kinetically and energetically to the acetyl-CoA branch, and as such is the primary determinant of carbon flux distribution.

    [0324] Oxygen tolerance of 4-hydroxybutyryl-CoA dehydratase from M. sedula. Here, we also report the cloning and characterization of 4-hydroxybutyryl-CoA dehydratase (4hbd-Msed_1321), the first recombinant homolog of this unique enzyme cloned from an archaeal host. First discovered in Clostridium aminobutryicum (Gerhardt et al., 2000. Arch. Microbiol. 174:189-199), this enzyme has drawn a lot of interest due to its unusual radical-based catalysis mechanism (Martins et al., 2004. Proc. Natl. Acad. Sci. U.S.A. 101:15645-15649; Buckel et al., 2006. Annu. Rev. Microbiol. 60:27-49). The clostridial verison is active as a homotetramer with one [4Fe-4S].sup.2+ cluster and one flavin adenine dinucleotide (FAD) cofactor per subunit (Martins et al., 2004. Proc. Natl. Acad. Sci. U.S.A. 101:15645-15649). The M. sedula homolog was also found to associate as a homotetramer (222 kDa, subunit mass=56.6 kDa). When exposed to air, the clostridal homolog was slightly activated due to oxidation of the FAD cofactor, followed by oxidation of the FeS cluster leading to irreversible inactivation in 25 min (Scherf et al., 1993. Eur. J. Biochem. 215:421-429). However, the M. sedula homolog was much more robust to oxygen exposure. The same initial activation upon exposure to air was observed but lasted for about 15 hours instead of mere minutes; enzyme activity continued to drop slowly over the course of the next week, with an observed half-life of 4 days. This substantial increase in oxygen tolerance is probably an adaptive trait acquired as a result of the aerobic environment in M. sedula.

    [0325] Transcriptional patterns of 2-oxoacid oxidoreductases in M. sedula. There are several operons in the M. sedula genome containing genes annotated as putative 2-oxoacid oxidoreductases, however the exact nature of their role in metabolism remains uncertain. Previous assays have found very low levels of 2-oxoglutarate and pyruvate oxidoreductase activity in both heterotrophic and autotrophic cell extract (2-3 mol min.sup.1 mg.sup.1) (Estelmann et al., 2011. J. Bacteriol. 193:1191-1200). FIG. 45 shows the transcriptional profile of putative 2-oxoacid oxidoreductases under heterotrophy and autotrophy. Most of these loci either showed no transcriptional change (Msed_0507-0510, Msed_1199-1201) or were down-regulated under autotrophy (Msed_0306-0309, Msed_0524-0525, Msed_1596-1597), however the most striking change was the down-regulation of Msed_1596 and Msed_1597, whose transcription levels decreased 23- and 10-fold, respectively. This strong transcriptional response clearly implicates Msed_1596-1597 in some crucial, but as yet unknown, role under heterotrophic growth.

    [0326] Conclusion. Here, the recombinant expression and characterization of two enzymes in the final steps of the 3HP/4HB pathway are reported and in vitro production of acetate from 4HB is confirmed. The level of biochemical detail of the 3HP/4HB pathway in relationship to central metabolism continues to develop, which will inform future metabolic engineering prospects for microbial biosynthesis of fuels and organic chemicals (Hawkins et al., 2013. Curr. Opin. Biotechnol. 24:376-384).

    [0327] The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. Supplementary materials referenced in publications (such as supplementary tables, supplementary figures, supplementary materials and methods, and/or supplementary experimental data) are likewise incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

    [0328] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term about. Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

    [0329] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

    [0330] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.