NICOTINAMIDE ADENINE DINUCLEOTIDE INDICATORS, METHODS OF PREPARATION AND APPLICATION THEREOF
20170219584 ยท 2017-08-03
Inventors
Cpc classification
C07K2319/60
CHEMISTRY; METALLURGY
G01N2500/02
PHYSICS
International classification
Abstract
The invention relates to a genetically encoded fluorescent sensor for nicotinamide adenine dinucleotide, as well as methods of preparation and uses thereof. In one aspect, this invention relates to a sensor for detecting nicotinamide adenine dinucleotide, particularly, a recombinant fluorescent fusion protein sensor for detecting nicotinamide adenine dinucleotide. In one specific aspect, this invention relates to a recombinant fluorescent fusion protein sensor for detecting reduced nicotinamide adenine dinucleotide (NADH); in another specific aspect, this invention relates to a recombinant fluorescent fusion protein sensor for detecting oxidized nicotinamide adenine dinucleotide (NAD.sup.+); in yet another aspect, the invention relates to a recombinant fluorescent fusion protein sensor for detecting the ratio of reduced to oxidized nicotinamide adenine dinucleotide. This invention also relates to the method of preparing the sensors, and uses of the sensors in detecting NADH, NAD.sup.+, NADH/NAD.sup.+ ratio, screening drugs and measuring NADH metabolism.
Claims
1. A genetically encoded fluorescent sensor for NAD.sup.+, comprising a polypeptide sensitive to environmental NAD.sup.+, and a segment that exhibits the environmental NAD.sup.+ by change in its spectral characteristics, wherein the polypeptide sensitive to NAD.sup.+ is: (1) a polypeptide derived from ydiH, a bacterial transcription factor Rex protein, wherein the polypeptide is encoded by a sequence selected from SEQ ID NO: 1-3; (2) a homologous or non-homologous sequence that is 95% identical to the sequence of (1); or (3) a homologous or non-homologous sequence that is 90% identical to the sequence of (1); a NAD.sup.+ binding fragment or NAD.sup.+ binding domain thereof; and wherein the segment that exhibits the environmental NAD.sup.+ by change in the spectral characteristic is a fluorescent protein sequence or a derivative thereof and is inserted between residue 189 and residue 190 of the polypeptide encoded by SEQ ID NO: 1-3.
2. The fluorescent sensor according to claim 1, wherein the fluorescent sensor comprises: (1) an amino acid sequence selected from the group consisting of SEQ ID NO: 127-158; (2) a homologous or non-homologous sequence that is 95% identical to the sequence of (1); or (3) a homologous or non-homologous sequence that is 90% identical to the sequence of (1).
3. The fluorescent sensor according to claim 1, wherein the fluorescent sensor further comprises specific subcellular localization signal, wherein the localization signal allows localization of a target protein into a specified subcellular organelle.
4. A nucleic acid sequence encoding the fluorescent sensor according to claim 1.
5. A method of detecting NAD.sup.+ or NADH/NAD.sup.+, measuring NAD.sup.+ or NADH/NAD.sup.+ metabolism, drug screening or disease diagnosis, comprising contacting a sample with the fluorescent sensor according to claim 1; measuring fluorescence of the fluorescent sensor.
6. The method according to claim 5, wherein the screening involves cells capable of expressing the fluorescent sensor according to claim 19 or 20, and active compounds are those capable of changing the ratio of lactate/pyruvate.
7. The method according to claim 6, wherein the screening takes a compound library of enzyme inhibitors or agonists as a pool of candidate agents.
8. The method according to claim 5, which is carried out in a mammalian system.
9. The method according to claim 8, wherein the system is a tumor bearing mammalian system.
10. A kit comprising the fluorescent sensor according to claim 1.
11. A genetically encoded fluorescent sensor for reduced/oxidized nicotinamide adenine dinucleotide ratio (NADH/NAD.sup.+), comprising a polypeptide sensitive to environmental NADH/NAD.sup.+, and a segment that exhibits the environmental NADH/NAD.sup.+ by change in its spectral characteristics, wherein the polypeptide sensitive to NADH/NAD.sup.+ is: (1) a polypeptide derived from ydiH, a bacterial transcription factor Rex protein, wherein the polypeptide is encoded by a sequence of amino acids 78-211 of SEQ ID NO 1-3; (2) a homologous or non-homologous sequence that is 95% identical to the sequence of (1); or (3) a homologous or non-homologous sequence that is 90% identical to the sequence of (1); a NADH/NAD.sup.+ binding fragment or NADH/NAD.sup.+ binding domain thereof; and wherein the segment that exhibits the environmental NADH/NAD.sup.+ by change in the spectral characteristic is a fluorescent protein sequence or a derivative thereof and is inserted between residue 189 and residue 190 of the polypeptide encoded by 78-211 of SEQ ID NO: 1-3.
12. The fluorescent sensor according to claim 11, wherein the fluorescent sensor comprises: (1) an amino acid sequence selected from the group consisting of SEQ ID NO: 127-158; (2) a homologous or non-homologous sequence that is 95% identical to the sequence of (1); or (3) a homologous or non-homologous sequence that is 90% identical to the sequence of (1).
13. The fluorescent sensor according to claim 11, wherein the fluorescent sensor further comprises specific subcellular localization signal, wherein the localization signal allows localization of a target protein into a specified subcellular organelle.
14. A nucleic acid sequence encoding the fluorescent sensor according to claim 11.
15. A method of detecting NAD.sup.+ or NADH/NAD.sup.+, measuring NAD.sup.+ or NADH/NAD.sup.+ metabolism, drug screening or disease diagnosis, comprising contacting a sample with the fluorescent sensor according to claim 11; measuring fluorescence of the fluorescent sensor.
16. The method according to claim 15, wherein the screening involves cells capable of expressing the fluorescent sensor according to claim 19 or 20, and active compounds are those capable of changing the ratio of lactate/pyruvate.
17. The method according to claim 16, wherein the screening takes a compound library of enzyme inhibitors or agonists as a pool of candidate agents.
18. The method according to claim 15, which is carried out in a mammalian system.
19. The method according to claim 18, wherein the system is a tumor bearing mammalian system.
20. A kit comprising the fluorescent sensor according to claim 11.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0065] The invention is further described with reference to the following figures and examples.
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
DESCRIPTION OF THE EMBODIMENTS
I. Definitions
[0104] When a numerical value or range is indicated, the term about used herein means the value or range is within 20%, 10% and 5% of the indicated value or range.
[0105] Terms such as containing, comprising and its equivalents used herein shall be read as encompasses the meaning of having and consisting of . . . , for example, a composition containing X may consist exclusively of X or may include other substances, like X+Y.
[0106] In the invention, the term YdiH protein refers to protein YdiH (also known as Rex protein), which is a bacterial transcriptional inhibiting protein already known in the art. YdiH has a molecular weight of 23 kDa and regulates the fermentation and anaerobic respiration. It is a type of redox-sensitive regulatory protein which widely exists in Gram-positive bacteria, and is a typical NAD(H)-binding protein that containing Rossmann domain. The key Rossmann domain therein is a super secondary protein structure mainly presents in nucleotide binding proteins, a typical region active in binding cofactor NAD(H), and is represented by various cofactor NAD binding proteins. The structure is essentially comprised of 6 -sheets linked through two pairs of -helixes in the form of ----. Since each Rossmann domain could bind one nucleotide molecule only, there are two Rossmann segments presented pairwise in dinucleotide-binding protein domains such as these for NAD. YdiH (Rex) protein can directly probe changes in cytoplasmic NADH/NAD.sup.+ ratio, but under aerobic conditions, YdiH (Rex) protein can inhibit transcription of its target genes (cydABC, nuoA-D and rexhemACD) when intracellular NADH/NAD.sup.+ ratio is at low level, while dissociates from its operon region at elevated NADH/NAD.sup.+ ratio, and the steric configuration of YdiH (Rex) protein transforms upon the environment changes during this dynamic process. The YdiH protein involved in the invention may contain amino acid sequence encoded by nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3. The flexible region referred to in the invention means specific structure, such as Loop configuration, presents in advanced protein structure. These structures exhibit better mobility and flexibility than other advanced structures of proteins, and are capable of causing dynamic change of domains, while proteins also exhibit significant tendency of undergo spatial conformational change in such regions. The flexible region referred to in the invention mainly means the V113-G119 region and D188-G192 region of T-rex (the Rex protein from Thermus aquaticus).
[0107] The term fluorescent sensor used herein refers to a polypeptide sensitive to environmental NADH and fused with a fluorescent protein, specifically, the polypeptide sensitive to environmental NADH can be a YdiH protein. The sensor utilizes the conformational changes of the fluorescent protein caused by binding of the NADH-specific binding structure Rossman domain in YdiH with NADH, and thus lead to the generation or reduction of fluorescence, or changes in the generated fluorescence; plotting standard curve based on the fluorescence of fluorescent protein measured under different NADH concentrations would, in turn, allow the detection and analy the presence and/or level of NADH.
[0108] The term fusion protein is synonymous with the terms fluorescent fusion protein and recombinant fluorescent fusion protein, refers a polypeptide or protein comprising an amino acid sequence of a first polypeptide or protein, or fragment, analog or derivative thereof, and an amino acid sequence of a heterologous polypeptide or protein (that is, a second polypeptide or protein, or fragment, analog or derivative thereof, which differs from the first polypeptide or protein, or fragment, analog or derivative thereof). In one embodiment, the fusion protein comprises a fluorescent protein fused with the heterologous protein, polypeptide or peptide. According to this embodiment, the heterologous protein, polypeptide or peptide may or may not be a fluorescent protein of different type. In one embodiment, the fusion protein maintains or enhances its activity relative to the activity of the original polypeptide or protein prior to the fusion with heterologous protein, polypeptide or peptide. In a specific embodiment, the fusion protein comprises a fluorescent sensor fused with a heterologous protein, polypeptide or peptide, wherein the heterologous protein, polypeptide or peptide can be a specific subcellular localization signal.
[0109] The term fluorophore used here is synonymous with fluorescent protein, representing a protein exhibits autofluorescence or emits fluorescence under illumination. Fluorescent proteins are often used as detection means, for instance, green fluorescent protein GFP and BFP, CFP, YFP, etc, derived therefrom GFP are routinely used in the biotechnology arts.
[0110] The term GFP used herein refers to green fluorescent protein, which is originally isolated from Aequorea victoria. The wild type AvGFP is consisted of 238 amino acids and has a molecular weight of about 26 kD, and amino acid sequence SEQ ID No: 20. Recent study confirms that Ser-Tyr-Gly, the three amino acids 65-67 in native GFP protein, are able to spontaneously form a fluorescent chromophore: p-hydroxybenzylideneimidazolinone, which is the primary emitting site. The wild-type AvGFP exhibits very complex spectral characteristics with its main fluorescence excitation peak at 395 nm and a secondary peak at 475 nm, whose amplitude intensity is about of the main peak. Under standard solution condition, 395 nm excitation can produce 508 nm emission, and 475 nm excitation produces maximum emission at 503 nm wavelength.
[0111] The term YFP used herein refers to yellow fluorescent protein, which is derived from green fluorescent protein GFP, the amino acid sequence of which is up to 90% or more homologous to GFP, and the key change of YFP from GFP is that the substitution of amino acid 203 from threonine to tyrosine (T203Y). Compared to original AvGFP, the main excitation peak of YFP is red-shifted to 514 nm wavelength and emission wavelength shifted to 527 nm. Site-directed mutation of amino acid no. 65 of the YFP (S65T) thereupon will obtain the fluorescence enhanced yellow fluorescent protein EYFP, and typical EYFP amino acid sequence is SEQ ID NO: 21. And sequence rearrangement of the EYFP protein by having the original amino acids 145-238 as the N terminus, and the original amino acid 1-144 as the C terminus of the new protein, with the two fragments linked through a short flexible peptide chain VDGGSGGTG forms cpYFP (circular permutation yellow fluorescent protein) that is sensitive to spacial changes, and typical cpYFP amino acid sequence is SEQ ID NO: 22.
[0112] In this invention, the YdiH protein that fused with fluorophore can be a full length native YdiH protein, or a fragment thereof, isolated from Bacillus subtilis or Thermus aquaticus or Streptomyces coelicolor; amino acids 1-215 of native YdiH protein from Bacillus subtilis or amino acids 1-211 of YdiH protein from Thermus aquaticus, or amino acids 1-259 of YdiH protein from Streptomyces coelicolor are preferable; while amino acids 1-215 of YdiH protein from Bacillus subtilis or amino acids 1-211 of YdiH protein from Thermus aquaticus are more preferable.
[0113] Linker means an amino acid or nucleic acid sequence linking the two segments within a polypeptide, protein or nucleic acid in the invention. When linking for a polypeptide or protein of the invention, the length of the linker is no longer than 6 amino acids, preferably, no longer than four amino acids, more preferably, 3 amino acids. When linking for a nucleic acids of the invention, the length of the linker is no longer than 18 nucleotides, preferably no longer than 12 nucleotides, more preferably 9 nucleotides.
[0114] When referring to a polypeptide or protein, the term variant used herein includes variants of the polypeptide or protein with the same function but differ in sequence. These variants include, but not limited to, sequences obtained by deleting, inserting and/or substituting one or more (typically 1-30, preferably 1-20, more preferably 1-10, and most preferably 1-5) amino acid(s) in the sequence of the polypeptide or protein, and by adding one or more (usually less than 20, preferably less than 10, and more preferably within 5) amino acid(s) to its C-terminus and/or N-terminus. For example, in the art, substitution with amino acids of comparable or similar properties usually does not change the function of the polypeptide or protein. Amino acids with similar properties usually refer to a family of amino acids having similar side chains and have been clearly defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartate, glutamate), amino acids with uncharged polar side chain (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with -branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). As another example, adding one or more amino acids to the C-terminus and/or N-terminus usually does not change the function of the polypeptide or protein either. As known to a person skilled in the art, genetic cloning process often requires design of suitable endonuclease sites, which will eventually introduce one or more irrelevant residues to the terminus of the polypeptide or protein to be expressed, but this does not affect the activity of the target polypeptide or protein. For another example, in order to construct a fusion protein, to promote the expression of a recombinant protein, to obtain a recombinant protein that can secrete itself into the extracellular environment of the host cells, or to facilitate the purification of a recombinant protein, it is often desirable to have the N-terminus, C-terminus, or other suitable regions of the protein added with some amino acids, for example, including, but not limited to, suitable connecting peptides, signal peptides, leader peptides, the terminal extensions, the glutathione S-transferase (GST), maltose E binding protein, Protein A, tags such as 6His or Flag, or factor Xa or thrombin or enterokinase protease cleavage sites. Variants of the polypeptide or protein may include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, polypeptide or protein encoded by a DNA which could hybridize with the DNA for said polypeptide or protein under high or low stringent conditions, as well as the polypeptide or protein derived from antiserum against said polypeptide or protein. These variants may also comprise polypeptide or protein whose sequence is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% sequence identity with said polypeptide or protein.
[0115] In the context of two or more polypeptides or nucleic acid sequences, the term identical or percent identity means, when compared and aligned for maximum correspondence over a comparing window or designated region using available methods such as comparing algorithms known in the art or by manual alignment and visual inspection, two or more sequences or sub-sequences are the same or have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% are the same). For example, preferred algorithms that are suitable for determining the percent sequence identity or similarity are the BLAST and BLAST 2.0 algorithms, which can be found in Altschul (1977) Nucleic Acids Res. 25:3389 and Altschul (1990) J. Mol Biol. 215:403, respectively.
[0116] The term soluble fragment used herein generally refers to fragments having at least about 10 consecutive amino acids of the full-length protein sequence, usually at least about 30 consecutive amino acids, preferably at least about 50 consecutive amino acids, more preferably at least about 80 consecutive amino acids, and optimally at least about 100 consecutive amino acids.
[0117] The terms functional fragment, derivative and analog mean proteins retain substantially the same biological function or activity of the native YdiH protein in the invention. Functional fragments, derivatives or analogs of YdiH in the invention may be (i) proteins with one or more conservative or non-conservative amino acid substitution (preferably conservative), where the substituted amino acid residues may or may not be one encoded by the genetic code, or (ii) proteins containing substitutions of one or more amino acid residues having a substituent group, or (iii) proteins formed having the mature protein fused with another compound (such as compounds that extend half-life of the protein, for example, polyethylene glycol), or (iv) proteins formed by having said protein fused with additional amino acid sequence (such as leader sequence or secretory sequence, or sequence used for purification of the protein or proprotein sequence, or fusion protein formed with fragment of antigen IgG). In accordance with the teachings provided herein, these functional fragments, derivatives and analogs are well known to a person skilled in the art.
[0118] The differences between analogs and the native YdiH protein may be the difference in amino acid sequences, and may also be the difference in the forms of modifications that will not affect the sequence, or both. These proteins include natural or induced genetic variants. Induced variants can be obtained by a variety of techniques, such as generating random mutagenesis by irradiation or exposure to mutagens, and can also be obtained by directed mutagenesis or other known molecular biology techniques.
[0119] Analogs mentioned herein also include analogs with residue(s) different from natural L-amino acid (e.g., D-amino acids), as well as analogs with a non-naturally occurred or synthetic amino acid (such as , -amino acids). It should be understood that the YdiH protein of the invention is not limited to the representative proteins, fragments, derivatives and analogs exemplified above. Forms of modification (usually without change of the primary structure): chemical derivatization of the protein in vivo or in vitro, such as acetylation or carboxylation. The modifications also include glycosylation, such as proteins generated by conducting glycosylation during protein synthesis and processing or further processing steps. This modification can be achieved by exposure of the protein to an enzyme that glycosylates (such as mammalian glycosylase or deglycosylase). The modifications also include sequences with phosphorylated amino acid residues (e.g. phosphotyrosine, phosphoserine, phosphothreonine), and further include protein modified to improve its anti-proteolytic properties, or to optimize the solubility.
[0120] The term nucleic acid used herein be in the form of DNA or RNA. Forms of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be coding strand or non-coding strand. The coding sequence that encodes the mature protein can be identical with the sequence shown in the coding region of SEQ ID NO: 9, 10, 11, 12 or 13, or its degenerate variants. Degenerate variant used in the invention refers to a nucleic acid sequence that encodes the fluorescent fusion protein of the invention, but is different from the coding region sequence shown in SEQ ID NO: 9, 10, 11, 12 or 13.
[0121] In the context of nucleic acid, the term variants used herein may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include degenerate variants, substituted variants, deletion variants, and insertion variants. As known in the art, allelic variant is an alternate form of a nucleic acid, it may be caused by one or more nucleotide substitution, deletion or insertion, but does not substantially alter the function of the encoded protein. The nucleic acid of the invention may include nucleotide sequences with at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% identity with said nucleic acid sequence.
[0122] As used herein, the term hybridizing under stringent conditions is used to describe conditions for hybridization and washing under which nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other. Preferrably, stringent conditions are the conditions that under which sequences at least 65%, more preferably at least 70%, and even more preferably at least 80% or higher homologous to each other typically remain hybridized to each other. The stringent condition is known to a person of ordinary skills in the art. In one preferred, non-limiting example, the stringent conditions are: (1) hybridization and elution under relatively low ionic strength and relatively high temperature, such as 0.2SSC, 1% SDS, 0 C.; or (2) hybridization at the addition of denaturing agent, 50% (v/v) methyl amide, 0.1% fetal calf serum/0.1% Ficoll, 42 C., etc; or (3) hybridization occurred only between two sequences at least 90%, more preferably no less than 95% homologous to each other. Furthermore, the protein encoded by the nucleic acid sequences capable of hybridization has the same biological function and activity as the mature protein shown in SEQ ID NO: 4, 5, 6, 7 or 8.
[0123] The present invention also relates to a nucleic acid fragment hybridizes with the sequence described above. As used here, the length of nucleic acid fragment contains at least 15 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 or more nucleotides. The nucleic acid fragment can be used for nucleic acid amplification techniques (e.g. PCR).
[0124] Generally, the full-length sequences or the fragments of the fluorescent sensor or fusion protein in the invention can be obtained by PCR amplification method, recombination method or artificially synthetic method. For PCR amplification, primers can be designed according to the relevant nucleotide sequence disclosed by the invention, and in particular, the sequence of the open reading frame, and commercially available cDNA library, or cDNA library prepared by person skilled in the art using routine methods could be used as template, thereby, obtaining the corresponding sequences by amplification. For longer sequences, two or more individual PCR amplifications are typically desired, which are followed by ligating the separately amplified fragment together in a proper order.
[0125] Once the corresponding sequence is obtained, a large quantities of the sequences can be achieved by recombination. Typically, the sequences is cloned into a vector, which is subsequently transferred into cell, and then the corresponding polypeptide or protein can be obtained from the proliferated host cells by routine isolation and purification methods.
[0126] Furthermore, artificial synthesis can also be used to synthesize the corresponding sequence, especially when the fragment is short. Typically, multiple smaller fragments are synthesized first, and later linked together to produce a fragment with much longer sequence.
[0127] So far, the DNA sequence that encoding the protein herein (or its fragment, derivative, analog or variant) can be obtained solely by chemical synthesis. Said DNA sequence can be introduced subsequently into various available DNA molecules (e.g. vectors) and cells that are already known in the art. Through mutant PCR or chemical synthesis methods, a mutation can be introduced into the sequence of the protein of the invention.
[0128] As used herein, the terms expression vector and recombinant vector may be used interchangeably, and refer to a prokaryotic or eukaryotic expression vector known in the art, such as a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retroviral or other vectors, which can replicate and stabilize in the host organism. One important feature of these recombinant vectors is that they typically comprise expression control sequences. As used herein, the term expression control sequence refers to an element that regulates transcription, translation and expression of a target gene, and may be operably linked with the target gene, said element may be an origin of replication, a promoter, a marker gene or translation control elements, including enhancers, operons, terminators, ribosome binding sites, etc., and the selection of expression control sequence depends on the host cell used. In present invention, suitable recombinant vector includes, but not limited to, bacterial plasmid. In the context of recombinant expression vector, operably linked means the target nucleotide sequence and the regulatory sequence are linked in a way that allows expression of the nucleotide sequence. Suitable methods for constructing expression vector which comprises the coding sequence of the fusion protein and appropriate transcriptional/translational control signals are well known to the person skilled in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, etc. Said DNA sequence may be effectively linked to a proper promoter in the expression vector to direct mRNA synthesis. Representative examples of promoters include E. coli lac or trp promoter; phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, retrovirus LTR, and some other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. Expression vector further comprises a ribosome binding site for the initiation of translation, and a transcription terminator.
[0129] A person of ordinary skills in the art will understand that design of the recombinant expression vector can vary depending on the host cell to be transformed, desired expression level of the protein and other factors. In addition, the recombinant expression vector preferably contains one or more selective marker genes to provide phenotypic traits, such as dihydrofolate reductase, neomycin resistance in eukaryotic cells, or tetracycline or ampicillin resistance in E. coli, for the selection of transformed host cells.
[0130] In one embodiment, the coding sequence of the fluorescent sensor or fusion protein in present invention is double digested with BamHI and HindIII and ligated into the pRSET.sub.b vector digested with BamHI and HindIII to obtain an E. coli recombinant expression vector. The expression vector of the present invention can be transferred into a host cell to produce a protein or peptide comprising the fusion protein. This transfer process may be carried out using routine transformation or transfection techniques well known to a person skilled in the art.
[0131] As used herein, the term host cell, also known as recipient cells, refers to cells capable of receiving and accommodating recombinant DNA molecule(s), which is the place for recombinant gene amplification. An ideal recipient cell should satisfy two criteria: easily available and proliferating. The host cell in present invention may include prokaryotic cells and eukaryotic cells, specifically, include bacterial cells, yeast cells, insect cells and mammalian cells.
[0132] The expression vector in present invention can be used to express the fluorescent sensor or fusion proteins in prokaryotic or eukaryotic cells. Accordingly, the present invention relates to a host cell, preferably E. coli, having the expression vector of the invention incorporated therein. The host cell can be any prokaryotic or eukaryotic cell, representative examples include: bacterial cells including E. coli, Streptomyces, Salmonella typhimurium, fungal cells such as yeast, plant cells, insect cells as Drosophila S2 or Sf9, animal cells as CHO, COS, 293 cells or Bowes melanoma cells, etc., host cells described above are inclusive but not limiting. Said host cells are preferably those advantageous for expression of the gene product or the fermentative production, such cells are well known and routinely used in the art, for example, various E. coli cells and yeast cells. In one embodiment of the present invention, E. coli BL21 is selected to construct a host cell that expresses the fusion protein of present invention. The choice of appropriate carrier, promoter, enhancer and host cells is evident to a person of ordinary skills in the art.
[0133] As used herein, the term transformation and transfection, incorporating and transduction refer to various techniques, already known in the art, to introduce exogenous nucleic acid (e.g., linear DNA or RNA (e.g., linearized vector or individual gene construct without vector)) or nucleic acid in the form of carrier (e.g., plasmids, cosmids, phage, phagemid, phasmid, transposon or other DNA) into a host cell, including calcium phosphate or calcium chloride coprecipitation, DEAE-mannan-mediated transfection, lipid transfection, natural competent cells, chemical-mediated transfer, or electroporation. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after exponential growth phase, and treated with CaCl.sub.2 method, the steps used therein are well known in the art. Another method uses MgCl.sub.2. If necessary, the transformation can also be conducted by electroporation. When the host cell is a eukaryotic cell, DNA transfection methods can be used are as follows: calcium phosphate co-precipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
[0134] Transformed cell obtained thereby may be cultured using routine methods which are suitable for the expression in the host cells in order to express the fusion protein of the present invention. Depending on the host cells, the medium used for culture can be various conventional media. The culture is performed under conditions suitable for the growth of the host cells. When the host cells have grown to an appropriate cell density, the selected promoter is induced by an appropriate method (such as temperature shift or chemical induction), and the cells are further incubated for another period of time.
[0135] In the above method, the recombinant protein can be expressed within the cell, or on the cell membrane or secreted into extracellular environment. If desired, the recombinant protein can be isolated or purified using various separation methods based on its physical, chemical and other characteristics. These methods are well known to a person skilled in the art. Examples of such methods include, but not limited to: conventional refolding treatment, treatment with a protein precipitating agent (salting out), centrifugation, osmotic lysis of bacteria, ultra treatment, ultra centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques, and combinations thereof.
[0136] In one embodiment, the fluorescence sensor or a fusion protein of present invention is produced by fermentation of E. coli comprising the coding sequence of the fusion protein, followed by ammonium sulfate sedimentation, ion exchange chromatography, and purification using gel filtration chromatography to obtain the fluorescent sensor or a fusion protein of the invention in a pure form.
[0137] Uses of the fluorescent sensor or fusion protein of the present invention include, but not limited to, detection of NADH, detection of NADH in physiological state, detection of NADH in subcellular level, in situ detection of NADH, screening of drugs, diagnostics of diseases associated with NADH level.
[0138] Concentrations, contents, percentages, and other numerical values may be presented herein in a range format. It is to be understood that such range format is used merely for convenience and brevity, and it should be interpreted flexibly to include not only the numerical values explicitly recited as the upper and lower limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within said range as if each numerical values or sub range is explicitly recited.
EXAMPLES
[0139] The invention is further illustrated by the specific examples described below. It should be understood that these examples are merely illustrative, and do not limit the scope of the present invention.
[0140] Unless otherwise indicated, experimental protocols in the following examples generally adopt customary conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Guide (New York, USA: Cold Spring Harbor Laboratory Press, 1989); or the conditions according to the manufacturer's recommendations. Unless otherwise indicated herein, all percentages and parts are by weight.
[0141] I. Experimental Materials and Reagents
[0142] Reagents: Unless otherwise indicated, all reagents were purchased from Shanghai Sinopharm Chemical Reagent Co. Ltd. (Shanghai, China).
[0143] Tag enzymes, buffer, dNTP for PCR amplification; protease, buffer, T4 DNA ligase, T4 DNA ligase buffer, T4 polynucleotide kinase (PNK), T4 PNK buffer used in molecular biological experiments were all from Fermentas (Vilnius, Lithuania).
Example 1 Construction and Expression of pRSET.SUB.b.-ydiH-YFP-ydiH (D2)
[0144] 1. Amplification of Nucleic Acid Sequence of cpYFP
[0145] The coding sequence of yellow fluorescent protein (cpYFP) was amplified using pMD19-cpYFP (Nagai, T. et al., Proc Natl Acad Sci U.S.A. 2001, V.98(6), pp. 3197-3202) (obtained from Protein Chemistry Laboratory, East China University of Science and Technology (Shanghai, China)) as the template, and cpYFP F and cpYFP R as primers, where the primer sequences (primers were synthesized by Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China) are as follows:
TABLE-US-00001 P1: SpeI (SEQ ID NO: 23) GAAATCGAAACTAGTTACAACAGCCACAACGTCTATATC P2: KpnI (SEQ ID NO: 24) CCAAGCTTCGGGGTACCGTTGTACTCCAGCTTGTG
[0146] PCR Reaction System
TABLE-US-00002 PCR system Template 1 l Forward primer 0.5 l Reverse primer 0.5 l 10 Taq buffer 5 l Taq enzyme 1 l dNTP (10 mM) 1 l ddH.sub.2O 41 l total 50 l
[0147] PCR Reaction Conditions:
TABLE-US-00003 95 C 5 min 95 C. 40 s 30 cycles {open oversize brace} 55 C. 40 s 72 C. 1 min 72 C. 10 min
[0148] PCR amplification product was electrophoresed on a 1% agarose gel for 30 minutes to obtain cpYFP fragments of about 750 bp. cpYFP fragments were recovered and purified from the gel using Sangon DNA fragment recovery kit (Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China) according to the manufacturer's instructions.
[0149] 2. Extraction of Desired Gene Sequence from Bacillus subtilis 168 Cells
[0150] a. Sample Processing
[0151] (i) Bacillus subtilis 168 was obtained from China General Microbiological Culture Collection Center (Cat. No. 1.1656).
[0152] (ii) According to the conditions as described, 100 l cultured Bacillus subtilis 168 was taken to measure the optical density of the broth at 600 nm, where OD.sub.600=0.1 refers to a density of 110.sup.7510.sup.7 cells/ml, the actual number of cells was calculated thereby. Then 1 ml TRIzol reagent (Invitrogen, California, USA) would be added per 110.sup.7 cells for processing.
[0153] (iii) A proper amount of broth was taken, centrifuged at 4 C., 5000 rpm for 10 minutes, and the supernatant was discarded.
[0154] (iv) Bacterial pellet was washed with 100 lTE buffer (10 mM Tris-HCl, 1 mM EDTA pH8.0, reagents were from Armco corporation (Amresco, Ohio, USA)), and centrifuged at 5000 rpm for 10 minutes, and the supernatant was discarded.
[0155] (v) The bacterial pellet was resuspend in 100 l 1TE buffer (comprising 2 mg/ml lysozyme (from Majorbio Biotech Co. Ltd., Shanghai, China)) and incubated at 37 C. for 30 minutes.
[0156] b. Phase Separation
[0157] (i) One milliliter of TRIzol reagent (Invitrogen) was added thereto and mixed by pipetting, and the mixture was allowed to stand at room temperature for 5 minutes.
[0158] (ii) Two hundred microliter of chloroform was added thereto and vortexed for 15 seconds, and the mixture was allowed to stand at room temperature for 2 to 3 minutes prior to centrifugation at 4 C., 12,000 g for 15 minutes.
[0159] (iii) The solution was segmented into layers upon centrifugation, comprising about 40% of upper aqueous phase containing RNA, and about 60% of lower organic phase containing DNA and protein. The upper aqueous phase was carefully pipetted out and removed.
[0160] c. Removal of Impurities
[0161] Fifty microliter of 10% SDS and 250 l saturated aqueous sodium chloride solution were added into the organic phase, and vortexed to homogenous prior to centrifugation at 4 C., 12,000 g for 5 minutes, and the upper aqueous phase was discarded.
[0162] d. Ethanol Precipitation of DNA
[0163] Seven hundred and fifty microliter of precooled 95% ethanol was added into the organic phase and inverted to mix, and stand at 80 C. for 15 minutes to allow the DNA to precipitate.
[0164] e. DNA Washing
[0165] (i) The upper organic phase was carefully discarded.
[0166] (ii) The precipitate was washed several times with 1 ml of 0.1 M sodium citrate/10% ethanol solution, centrifugation at 4 C., 12,000 g for 5 minutes was conducted after each wash.
[0167] (iii) A final wash was conducted with 75% ethanol and followed by centrifugation at 4 C., 12 000 g for 5 minutes.
[0168] (iv) The ethanol was evaporated through air dry at room temperature.
[0169] f. Dissolving DNA
[0170] DNA pellet was dissolved into 50 l of 8 mM NaOH solution, and stored at 4 C. or 20 C.
[0171] The gene for YdiH protein of Bacillus subtilis 168 (ydiH), in full length or fragment thereof (for amino acids 85-215), was amplified using genomic material extracted above as the template, and primers ydiH-1F and ydiH 1R, ydiH(D2) 2F and ydiH 2R, respectively, wherein amplification with ydiH-1F and ydiH 1R produced ydiH1, the full length YdiH protein gene (ydiH) having BaHI restriction site at 5 end and SpeI restriction site at 3 end; amplification with ydiH (D2) 2F and ydiH 2R produced ydiH(D2) 2, a fragment of YdiH Protein gene (ydiH) (for amino acids 85-215) having KpnI restriction site at 5 end and HindIII restriction site at 3 end. Sequences of the primers ydiH 1F, ydiH 1R, ydiH (D2) 2F and ydiH 2R are as follows:
TABLE-US-00004 ydiH 1F: BamHI (SEQ ID NO: 25) CCGGATCCATGAATAAGGATCAATCAAAAATTC ydiH 1R: SpeI (SEQ ID NO: 26) GCTGTTGTAACTAGTTTCGATTTCCTCTAAAACT ydiH(D2) 2F: KpnI (SEQ ID NO: 27) CGGGGTACCATGACAGACGTCATCTTGATTGGTG ydiH 2R: HindIII (SEQ ID NO: 28) CCCAAGCTTCTATTCGATTTCCTCTAAAAC
[0172] PCR Reaction System:
TABLE-US-00005 PCR system Template 1 l Forward primer 0.5 l Reverse primer 0.5 l 10 Taq buffer 5 l Taq enzyme 1 l dNTP (10 mM) 1 l ddH.sub.2O 41 l total 50 l
[0173] PCR Reaction Conditions:
TABLE-US-00006 95 C. 5 min 95 C. 40 s 30 cycles {open oversize brace} 55 C. 40 s 72 C. 1 min 72 C. 10 min
[0174] PCR amplification product was purified on 1% agarose gel by electrophoresis for 30 minutes to obtain the ydiH 1 of about 700 bp and ydiH (D2) 2 fragment of about 450 bp. The amplified ydiH 1 and ydiH (D2) 2 fragments were recovered and purified from the gel using Sangon DNA fragment recovery and purification kit (Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China) according to the manufacturer's instructions.
[0175] 3. Ligation of the Target Gene Fragment to the Vector
[0176] Overlap extension PCR was conducted using ydiH 1 and cpYFP as templates, and ydiH 1F and cpYFP 1R as primers with the following PCR system:
TABLE-US-00007 PCR system Template 1.sup.(1) 1 l Template 2.sup.(1) 1 l Forward primer.sup.(2) 0.5 l Reverse primer.sup.(2) 0.5 l 10 pfu buffer 5 l pfu enzyme 1 l dNTP (10 mM) 1 l ddH.sub.2O 40 l total 50 l
[0177] PCR Reaction Conditions:
TABLE-US-00008 PCR reaction conditions 95 C. 5 min 95 C. 40 s 10 cycles {open oversize brace} 55 C. 40 s 72 C. 1 min 15 s 95 C. 40 s 20 cycles {open oversize brace} 58 C. 40 s 72 C. 2 min 10 s 72 C. 10 min
[0178] PCR amplification product was subjected to electrophoresis on 1% agarose gel for 40 minutes for the ydiH-cpYFP fragment of about 1400 bp. The recovered and purified PCR fragment ydiH-YFP and vector plasmid pRSET.sub.b were double digested separately with the following digestion systems:
TABLE-US-00009 Double enzyme digestion system DNA fragment ydiH-YFP 15 l BamHI 1 l HindIII 2 l 10 BamHI buffer 5 l ddH.sub.2O 27 l Total 50 l
TABLE-US-00010 Double enzyme digestion system Vector plasmid pRSET.sub.b 10 l BamHI 1 l HindIII 2 l 10 BamHI buffer 5 l ddH.sub.2O 32 l total 50 l
[0179] Reaction conditions: 37 C., 5 hours.
[0180] After the reaction was concluded, 10 l of 6 loading buffer was added to the 50 l reaction system to stop the reaction. Then target fragments were isolated by agarose gel electrophoresis, recovered and purified using Sangon DNA fragment recovery kit (Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China) according to the manufacturer's instructions.
[0181] The double digested fragment of ydiH-cpYFP and the double digested fragment of vector plasmid pRSET.sub.b recovered above were ligated using the following systems:
TABLE-US-00011 Ligation system DNA fragment ydiH-YFP 4 Fragment pRSET.sub.b vector 1 T4 DNA ligase 0.5 10 T4 DNA ligase buffer 1 ddH.sub.2O 3.5 total 10
[0182] Reaction conditions: 16 C., overnight. Ligated product pRSET.sub.b-ydiH-YFP was formed thereby.
[0183] Finally, ydiH (D2) 2 described above and validated pRSET.sub.b-ydiH-YFP were double digested as following:
TABLE-US-00012 Double enzyme digestion system Vector plasmid 10 l pRSET.sub.b-ydiH-YFP KpnI 1 l HindIII 2 l 10 KpnI buffer 5 l ddH.sub.2O 32 l total 50 l
TABLE-US-00013 Double enzyme digestion system DNA fragment ydiH(D2) 2 15 l KpnI 1 l HindIII 3 l 10 KpnI buffer 5 l ddH.sub.2O 26 l Total 50 l
[0184] Reaction conditions: 37 C. for 5 hours.
[0185] When the reaction was concluded, 10 l of 6 loading buffer was added to the 50 l reaction system to terminate the reaction. Target fragments were then isolated by agarose gel electrophoresis, recovered and purified using Sangon DNA fragment recovery kit (Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China) according to the manufacturer's instructions.
[0186] As described above, the double digested product of ydiH (D2) 2 and pRSET.sub.b-ydiH-YFP were recovered and ligated to form the final ligation product pRSET.sub.b-ydiH-YFP-ydiH(D2).
[0187] Positive colonies identified by PCR identification were selected, and sequenced using universal primers at the Shanghai Branch of Beijing Liuhe BGI Technology Co., Ltd. The sequence data was analysed and compared using Vector NTI 8.0. The results showed that the plasmid was actually comprising inserted nucleotide sequence of ydiH-cpYFP-ydiH (D2) (sequence shown as SEQ ID NO: 9 in the sequence listing), which encodes the protein shown as SEQ ID NO: 4 in the sequence listing.
[0188] 4. Transformation
[0189] The recombinant plasmid pRSET.sub.b-ydiH-cpYFP-ydiH (D2) was transformed into competent E. coli BL21 (DE3) pLysS (purchased from Tiangen Biotech Co. Ltd., Beijing, China) to obtain recombinant E. coli BL-Frex, the detailed process is as follows:
[0190] (i) One microliter of plasmid or 10 l of ligation product was added to 100 l competent bacteria under sterile condition, then kept in ice bath for 45 minutes;
[0191] (ii) After ice bathing, the mixture was immediately heat shocked in a 42 C. water bath for 90 to 120 seconds;
[0192] (iii) Subjected to ice bath for another 5 minutes;
[0193] (iv) Recovered by adding 800 l LB liquid medium and incubating at, 150 rpm on a shaker for 1 hour;
[0194] (v) Centrifuged at 4000 rpm for 5 minutes at room temperature, the supernatant was discarded;
[0195] (vi) The pellet was resuspended into a small amount of fresh LB, the entire suspension was then evenly spreaded on LB plates, which were inverted and incubated overnight at 37 C.
[0196] Positive colonies were selected using conventional Colony PCR, transferred to 5 ml LB liquid medium containing the appropriate selective pressure, and cultured overnight at 37 C., 220 rpm. The recombinant strain BL-Perex was cultured in LB medium at 37 C., and 0.1 mM IPTG was added when the OD for cell concentration reached 0.8. The expression was induced at 18 C. for 20 hours, and F-rex1 protein was isolated and purified from the bacterial lysate using Ni.sup.2+ affinity chromatography column (General Electric Company, Uppsala, Sweden). The SDS-PAGE identified only one protein band at approximately 66.5 kD, which was the F-rex1 protein (
Example 2 Construction and Expression of pRSET.SUB.b.-ydiH(189)-YFP-ydiH(190)
[0197] 1. Amplification the Nucleic Acid Sequence of cpYFP:
[0198] The coding sequence of yellow fluorescent protein (cpYFP) was amplified using pMD19-cpYFP as the template, and cpYFP F and cpYFP R as primers, where the primer sequences (primers were synthesized by Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China) are as follows:
TABLE-US-00014 P1: PstI (SEQ ID NO: 29) GAATCTGCAGGCTACAACAGCCACAACGTCTATATC P2: KpnI (SEQ ID NO: 30) CCAAGCTTCGGGGTACCGTTGTACTCCAGCTTGTG
[0199] PCR Reaction System
TABLE-US-00015 PCR system Template 1 l Forward primer 0.5 l Reverse primer 0.5 l 10 Pfu buffer 5 l Pfu enzyme 1 l dNTP (10 mM) 1 l ddH.sub.2O 41 l total 50 l
[0200] PCR Reaction Conditions:
TABLE-US-00016 95 C. 5 min 95 C. 30 s 30 cycles {open oversize brace} 55 C. 30 s 72 C. 1 min 15 s 72 C. 10 min
[0201] PCR amplification product was electrophoresed on 1% agarose gel for 20 minutes to obtain cpYFP fragment of approximately 750 bp. cpYFP fragments were recovered and purified from the gel using Sangon DNA fragment recovery kit (Sangon Biotech (Shanghai) Co., Ltd., Shanghai, China) according to the manufacturer's instructions.
[0202] 2. Amplification of Target Gene Sequence for YdiH Protein of Thermus aquaticus
[0203] The gene T-ydiH for YdiH protein of Thermus aquaticus was synthesized by Shanghai Generay Biotech Co. Ltd. (Shanghai, China) (synthesized according to the full-length gene sequence deposited in NCBI GenBank, NCBI Genbank AF061257.1).
[0204] Then the full length T-ydiH sequence for YdiH protein of Thermus aquaticus was amplified using the gene described above as the template, and ydiH IF and ydiH 2R as primers. The amplification using primers ydiH IF and ydiH 2R produced YdiH in full length for T-YdiH protein and having BamHI digestion site at 5 end and HindIII digestion site at 3 end, wherein the sequences of primer ydiH F and ydiH of 2R are as follows:
TABLE-US-00017 P3: BamHI (SEQ ID NO: 31) CCGGATCCGATGAATAAGGATCAATCAAAAATTC P4: HindIII (SEQ ID NO: 32) CCCAAGCTTCTATTCGATTTCCTCTAAAAC
[0205] PCR Reaction System
TABLE-US-00018 PCR system Template 1 l Forward Primer 0.5 l Reverse Primer 0.5 l 10 Pfu buffer 5 l Pfu enzyme 1 l dNTP (10 mM) 1 l ddH.sub.2O 41 l total 50 l
[0206] PCR Reaction Conditions:
TABLE-US-00019 95 C. 5 min 95 C. 40 s 30 cycles {open oversize brace} 55 C. 40 s 72 C. 1 min 72 C. 10 min
[0207] PCR amplification products was purified on 1% agarose gel by electrophoresis for 30 minutes to obtain the T-ydiH1 fragment of about 700 bp. The amplified T-ydiH fragment was recovered and purified using Sangon DNA fragment recovery purification kit (Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China) according to the manufacturer's instructions.
[0208] 3. Ligation of the Target Gene to the Vector
[0209] The recovered and purified PCR fragment T-ydiH and vector plasmid pRSET.sub.b were double digested separately with the following system:
TABLE-US-00020 Double enzyme digestion system DNA fragment T-ydiH 15 l BamHI 1 l HindIII 2 l 10 BamHI buffer 5 l ddH.sub.2O 27 l total 50 l
TABLE-US-00021 Double enzyme digestion system Vector plasmid pRSET.sub.b 10 l BamHI 1 l HindIII 2 l 10 BamHI buffer 5 l ddH.sub.2O 32 l Total 50 l
[0210] Reaction conditions: 37 C. for 5 hours.
[0211] After the reaction was concluded, 10 l of 6 loading buffer was added to the 50 l reaction system to stop the reaction. Then target fragments were isolated by agarose gel electrophoresis, recovered and purified using Sangon DNA fragment recovery kit (Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China) according to the manufacturer's instructions.
[0212] The double digested fragment of T-ydiH and the double digested fragment of vector plasmid pRSET.sub.b as recovered above were ligated using the following system:
TABLE-US-00022 Ligation system DNA fragment T-ydiH-YFP 4 Fragment pRSET.sub.b vector 1 T4 DNA ligase 0.5 10 T4 DNA ligase buffer 1 ddH.sub.2O 3.5 total 10
[0213] Reaction conditions: 16 C. overnight. Ligated product pRSET.sub.b-ydiH was formed thereby.
[0214] The full length pRSETb-ydiH sequence was amplified using the validated PRSETb-ydiH as a template, T-ydiH(L190) F and T-ydiH (F189) R as primers. The amplification using primers T-ydiH(L190) F and T-ydiH (F189) R produced a full length fragment ydiH-pRSETb of the pRSETb-ydiH having PstI digestion site at 5 end and KpnI digestion site at 3 end, wherein the sequences of primers T-ydiH (L190) F and T-ydiH (F189) R are as follows:
TABLE-US-00023 P5: KpnI (SEQ ID NO: 33) ATAGGTACCGGCCTGGCCGGCCTGACCCGGCTG P6: PstI (SEQ ID NO: 34) ATACTGCAGAGAAGTCCACGTTCTCCACGGCCACCTC
[0215] Finally, the yidH-pRSET.sub.b fragment produced thereby, and validated cpYFP fragment were double digested under following conditions:
TABLE-US-00024 Double enzyme digestion system DNA fragment cpYFP 15 l KpnI 1.5 l PstI 1.5 l 10 BamHI buffer 5 l ddH.sub.2O 27 l total 50 l
TABLE-US-00025 Double enzyme digestion system DNA fragment yidH-pRSET.sub.b 10 l KpnI 1.5 l PstI 1.5 l 10BamHI buffer 5 l ddH.sub.2O 32 l total 50 l
[0216] Reaction conditions: 37 C., 5 hours.
[0217] After the reaction was concluded, 10 l of 6 loading buffer was added to the 50 l reaction system to terminate the reaction. Then target fragments were isolated by agarose gel electrophoresis, recovered and purified using Sangon DNA fragment recovery kits (Sangon Biotech (Shanghai) Co. Ltd., Shanghai, China) according to the manufacturer's instructions.
[0218] The double digested fragments of yidH-pRSET.sub.b and cpYFP as recovered above were ligated to form the final product pRSET.sub.b-ydiH (189)-YFP-ydiH (190).
[0219] Positive colonies identified by Colony PCR were selected, sequenced using universal primers at the Shanghai Brance of Beijing Liuhe BGI Technology Co. Ltd. The determined sequence was compared and analysed using Vector NTI 8.0. The result showed that this plasmid was actually comprising inserted nucleotide sequence of ydiH (189)-YFP-ydiH (190) (sequence shown as SEQ ID NO: 13), and which encodes the protein shown as SEQ ID NO: 8 in the sequence listing.
[0220] 4. Transformation
[0221] Recombinant plasmid pRSET.sub.b-ydiH(189)-YFP-ydiH(190) was transformed into competent E. coli BL21 (DE3) pLysS (purchased from TIANGEN Biotech Co. Ltd., Beijing, China) to obtain the recombinant strain BL-Frex, the detailed process is as follows:
[0222] (i) One microliter of plasmid or 10 l of ligation product was added to 100 l of competent bacteria under sterile condition, then kept in ice bath for 45 minutes;
[0223] (ii) After ice bathing, the mixture was immediately heat shocked in a 42 C. water bath for 90 to 120 seconds;
[0224] (iii) Subjected to ice bath for another 5 minutes;
[0225] (iv) Recovered by adding 800 l LB liquid medium, and incubating at 37 C., 220 rpm on a shaker for 1 hour;
[0226] (v) Centrifuged at 4000 rpm for 5 minutes at room temperature, and the supernatant was discarded;
[0227] (vi) The pellet was resuspended into a small amount of fresh LB, and the entire suspension was then evenly spreaded on LB plates, which were inverted and incubated overnight at 37 C.
[0228] Positive colonies were selected using conventional Colony PCR, transferred to 5 ml LB liquid medium containing the appropriate selective pressure, and cultured overnight at 37 C., 220 rpm. The recombinant strain BL-Perex was cultured at 37 C., and 0.1 mM IPTG was added when the OD of cell concentration reached 0.8. The expression was induced at 18 C. for 20 hours, and F-rex2 protein was isolated and purified from the bacterial lysate using Ni.sup.2+ affinity chromatography column (General Electric Company, Uppsala, Sweden). The SDS-PAGE identified only one protein band at approximately 50 kD, which was the F-rex2 protein (
Example 3. Derivatives of YdiH-YFP-ydiH (D2) Sensors
[0229] Principle for Sensor Construction
[0230] Derivative sensors were engineered using intermediate plasmids for the construction of pRSET.sub.b-ydiH-YFP-ydiH and other sensors as templates, and following the principle of site-directed mutagenesis.
[0231] Truncated mutant sequences are shown below:
TABLE-US-00026 SEQ ID Original sequence 206 KHYSVLEEIE 215-TS-YFP-GT-ydiH NO Del T(2) 206 KHYSVLEEIE 215-TS-YFP-G-ydiH 104 Del G 206 KHYSVLEEIE 215-TS-YFP-T-ydiH 103 Del GT 206 KHYSVLEEIE 215-TS-YFP-ydiH 102 Del S 206 KHYSVLEEIE 215-T-YFP-GT-ydiH 126 Del T(1) 206 KHYSVLEEIE 215-S-YFP-GT-ydiH 101 Del TS 206 KHYSVLEEIE 215-YFP-GT-ydiH 159 C9 206 KHYSVLEEI 214-YFP-GT-ydiH 100 C8 206 KHYSVLEE 213-YFP-GT-ydiH 99 C2 206 KH 207-YFP-GT-ydiH 93 C1 206 K-YFP-GT-ydiH 92
[0232] Establishment of the Mutant Library
[0233] 1. Primer Design (Shanghai Sangon)
TABLE-US-00027 SEQ ID No Remark Sequence(5-3) 35 C9 Reverse GATTTCCTCTAAAACTGAATAATGCTTC 36 C8 Reverse TTCCTCTAAAACTGAATAATGCTTC 37 C6 Reverse TAAAACTGAATAATGCTTCAAAAAATAA ACCAG 38 C5 Reverse AACTGAATAATGCTTCAAAAAATAAACCAG 39 C4 Reverse TGAATAATGCTTCAAAAAATAAACCAG 40 C3 Reverse ATAATGCTTCAAAAAATAAACCAGTG 41 C2 Reverse ATGCTTCAAAAAATAAACCAGTGACTG 42 C1 Reverse CTTCAAAAAATAAACCAGTGACTGAAGC 43 C9 Forward TACAACAGCGACAACGTC (general forward primer for C series) 44 C7 Reverse CTCTAAAACTGAATAATGCTTC 45 Del GT Forward ATGACAGACGTCATCTTGATTG 46 Del GT Reverse GTTGTACTCCAGCTTGTGCC 47 Del TS Forward TACAACAGCGACAACGTCTATATCATG 48 Del TS Reverse TTCGATTTCCTCTAAAACTGAATAATGC 49 Del T(1) Forward AGTTACAACAGCGACAACGTCTATATCATG 50 Del S-deletion AGTTTCGATTTCCTCTAAAACTGAATAATGC Reverse 51 Del G-deletion ACCATGACAGACGTCATCTTGATTG Forward 52 Del T(2)- ACCGTTGTACTCCAGCTTGTGCC deletion Reverse 53 D118K Forward TTTTAAGATAAATGAGAGTAAAATAGG 54 118/120 mutation GCCATAGAAATTTTTGTGTTATTG Reverse 55 D118R Forward TTTTCGGATAAATGAGAGTAAAATAGG 56 N120K Forward TTTTGATATAAAGGAGAGTAAAATAGG 57 N120R Forward TTTTGATATACGGGAGAGTAAAATAGG 58 N120E Forward TTTTGATATAGAAGAGAGTAAAATAGG 59 N120D Forward TTTTGATATAGATGAGAGTAAAATAGG 60 D193N Forward TAAATTTAGCAGTTGAGCTTCAG 61 193/194 mutation TATGATGAATTCGAATGTGTTC Reverse 62 D193K Forward TAAAGTTAGCAGTTGAGCTTCAG 63 D193R Forward TACGGTTAGCAGTTGAGCTTCAG 64 L194E Forward TAGATGAAGCAGTTGAGCTTCAG 65 L194D Forward TAGATGATGCAGTTGAGCTTCAG 66 L194K Forward TAGATAAGGCAGTTGAGCTTCAG 67 L194R Forward TAGATCGGGCAGTTGAGCTTCAG
[0234] 2. PCR Amplification
[0235] Truncated mutation and site-directed mutation were conducted using site-directed mutagenesis PCR.
[0236] Amplification system for PCR mutation (primer, enzyme, dNTP and others purchased from Fermentas):
TABLE-US-00028 PCR sampling system Template 0.1 l Forward Primer 0.5 l Reverse Primer 0.5 l 5 PrimeStar Buffer 10 l PrimeStar polymerase 0.5 l dNTP mix (10 mM) 4 l ddH.sub.2O 33.5 l Total 50 l
TABLE-US-00029 PCR reaction conditions 98 C. 5 min 98 C. 10 sec 30 cycles {open oversize brace} 55 C. 5 sec 72 C. 4.5 min 72 C. 10 min
[0237] 3. Separation, Purification of DNA Fragments
[0238] DpnI digestion
[0239] The PCR amplified fragment was first treated with DpnI enzyme (from Fermentas) for 3 hours at 37 C. to remove the potential template plasmid contamination. The reaction system was then denatured and deactivated at 80 C. for 20 minutes. The deactivated mixture could be directly used for subsequent molecular biological experiments.
[0240] Phosphorylation of DNA Fragment
[0241] At the presence of ATP, the DNA fragment was treated with T4 polynucleotide kinase (T4 PNK) (from Fermentas) at 37 C. for 1 h to phosporylate the 5-OH of DNA ribose ring, in order to allow the fragments to cyclize by self-ligation. Then the reaction system was denatured and deactivated at 75 C. for 10 minutes. The deactivated mixture could be directly used for subsequent molecular biological experiments.
[0242] Ligation
[0243] The phosphorylated DNA fragments (mutated DNA fragments: pRSET.sub.b-ydiH-YFP or pRSET.sub.b-YFP-ydiH) were cyclized by self ligation overnight at 16 C. with T4 DNA ligase enzyme (from Fermentas).
[0244] Double-Digestion of Mutant Plasmids
[0245] The extracted mutant plasmids pRSET.sub.b-ydiH-YFP series and pRSET.sub.b-YFP-ydiH series were double digested, respectively. The digestion systems are as follows:
TABLE-US-00030 Double-digest system Mutant plasmid 10 l pRSET.sub.b-ydiH-YFP series BsrGI 1 l HindIII 2 l 10 Tango buffer 5 l ddH.sub.2O 32 l Total 50 l
TABLE-US-00031 Double-digest system Mutant plasmid 10 l pRSET.sub.b-YFP-ydiH series BsrGI 1 l HindIII 2 l 10 Tangobuffer 5 l ddH.sub.2O 32 l Total 50 l
[0246] Reaction conditions: 37 C. for 5 h.
[0247] When the reaction was concluded, 10 l of the 6 loading buffer was added to the 50 l reaction system to terminate the reaction. The fragment was isolated by agarose gel electrophoresis, recovered and purified using adsorption column. Detailed steps are described in Shanghai Sangon Gel Purification Kits/DNA Recovery Kits.
[0248] For truncated mutations, digested fragment of pRSET.sub.b-ydiH-YFP from proper mutant plasmid of pRSET.sub.b-ydiH-YFP series was selected as desired, and then ligated with normal fragment of sequence YFP-ydiH without mutation. For site-directed mutagenesis, digested fragment of pRSET.sub.b-ydiH-YFP from proper mutant plasmid of pRSET.sub.b-ydiH-YFP series was selected as desired, and then ligated with digested fragment YFP-ydiH of pRSET.sub.b-ydiH-YFP series containing site-directed mutation as well.
[0249] Ligation
[0250] Recovered and purified fragments pRSET.sub.b-ydiH-YFP and YFP-ydiH were ligated using the following system:
TABLE-US-00032 Ligation system Fragment YFP-ydiH 4 Fragment pRSET.sub.b-ydiH-YFP 1 T4 DNA Ligase enzyme 0.5 10 T4 DNA Ligase buffer 1 ddH.sub.2O 3.5 Total 10
[0251] Reaction conditions: 16 C., overnight.
[0252] The ligation products were labeled to form pRSET.sub.b-ydiH-YFP-ydiH Truc v2.xx or pRSET.sub.b-ydiH-YFP-ydiH.
[0253] Identification of Plasmid Mutations
[0254] Colonies identified as positive in Colony PCR were selected and sequenced using universal primers at the Shanghai Branch of Beijing Liuhe BGI Technology Co., Ltd. The determined sequences were then compared and analyzed by Vector NTI 8.0.
[0255] Construction of Sensor Series
[0256] Following sensors were produced according to the methods described above.
TABLE-US-00033 Plasmid NO. SEQ ID NO pRSET.sub.b-ydiH-YFP-ydiH(D2)C1 C1 92 pRSET.sub.b-ydiH-YFP-ydiH(D2)C2 C2 93 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 C3 94 pRSET.sub.b-ydiH-YFP-ydiH(D2)C4 C4 95 pRSET.sub.b-ydiH-YFP-ydiH(D2)C5 C5 96 pRSET.sub.b-ydiH-YFP-ydiH(D2)C6 C6 97 pRSET.sub.b-ydiH-YFP-ydiH(D2)C7 C7 98 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 C8 99 pRSET.sub.b-ydiH-YFP-ydiH(D2)C9 C9 100 pRSET.sub.b-ydiH-YFP-ydiH(D2)Del T Del T(1) 101 pRSET.sub.b-ydiH-YFP-ydiH(D2)Del GT Del GT 102 pRSET.sub.b-ydiH-YFP-ydiH(D2)Del G Del G 103 pRSET.sub.b-ydiH-YFP-ydiH(D2)Del T Del T(2) 104 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 D118R C3 D118R 105 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 N120K C3 N120K 106 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 N120R C3 N120R 107 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 N120E C3 N120E 108 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 N120D C3 N120D 109 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 D193N C3 D193N 110 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 D193K C3 D193K 111 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 L194K C3 L194K 112 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 L194R C3 L194R 113 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 L194E C3 L194E 114 pRSET.sub.b-ydiH-YFP-ydiH(D2)C3 L194D C3 L194D 115 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 D118R C8 D118R 116 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 N120K C8 N120K 117 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 N120R C8 N120R 118 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 N120E C8 N120E 119 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 N120D C8 N120D 120 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 D193N C8 D193N 121 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 D193K C8 D193K 122 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 L194K C8 L194K 123 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 L194R C8 L194R 124 pRSET.sub.b-ydiH-YFP-ydiH(D2)C8 L194E C8 L194E 125
Example 4. Derivative Sensors of ydiH(189)-YFP-ydiH(190)
[0257] Principle for Sensor Construction
[0258] Derivative sensors were engineered using intermediate plasmid for constructing sensors such as pRSET.sub.b-ydiH(189)-YFP-ydiH(190) as templates and following the principle of site-directed mutagenesis.
[0259] Truncated mutant sequences are shown below:
TABLE-US-00034 SEQ Name Structure ID NO Original sequence F189-SAG-YFP-GGC-L190 127 189/190-N1 F189-AG-YFP-GGC-L190 128 189/190-N2 F189-G-YFP-GGC-L190 129 189/190-N3 F189-YFP-GGC-L190 130 189/190-C1 F189-SAG-YFP-GG-L190 131 189/190-C2 F189-SAG-YFP-G-L190 132 189/190-C3 F189-SAG-YFP-L190 133 189/190-C1N1 F189-AG-YFP-GG-L190 134 189/190-C1N2 F189-G-YFP-GG-L190 135 189/190-C1N3 F189-YFP-GG-L190 136 189/190-C2N1 F189-AG-YFP-G-L190 137 189/190-C2N2 F189-G-YFP-G-L190 138 189/190-C2N3 F189-YFP-G-L190 139 189/190-C3N1 F189-AG-YFP-L190 140 189/190-C3N2 F189-G-YFP-L190 141 189/190-C3N3 F189-YFP-L190 142
[0260] Establishment of Mutant Library
[0261] 1. Primer Design (Shanghai Sangon)
TABLE-US-00035 SEQ ID No Remark Sequence(5-3) 68 189/190-N1 (F) GCAGGCTACAACAGCGACAACGTC 69 189/190-N1 (R) GAAGTCCACGTTCTCCACGGCCAC 70 189/190-N2 (F) GGCTACAACAGCGACAACGTCTATATCATG 71 189/190-N3 (F) TACAACAGCGACAACGTCTATATCATGGC 72 189/190-C1 (F) CTGGCCGGCCTGACCCGGCTGAG 73 189/190-C1 (R) GGTACCGTTGTACTCCAGCTTGTGCCCCAGG 74 189/190-C2 (R) ACCGTTGTACTCCAGCTTGTGCCCCAGGATG 75 189/190-C3 (R) GTTGTACTCCAGCTTGTGCCCCAGGATGTTGC 76 Trex(D2) (F) ATGAACCGGAAGTGGGGCCTG 77 Trex(D2) (R) CGGATCCTTATCGTCATCGTCGTAC 78 D112SV113H CATGACCCCGAGAAGGTGGGC (F) 79 D112SV113H CGAGAAGAAGCCCCGCAGCTC (R)
[0262] 2. PCR Amplification
[0263] Truncated mutation and site-directed mutation were conducted using site-directed mutagenesis PCR.
[0264] Amplification system for PCR mutation (Primer, enzyme, dNTP and others purchased from Fermentas):
TABLE-US-00036 PCR amplification system Template 0.1 l Forward Primer 0.5 l Reverse Primer 0.5 l 5 PrimeStar Buffer 10 l PrimeStar polymerase 0.5 l dNTP mix (10 mM) 4 l ddH.sub.2O 33.5 l Total 50 l
TABLE-US-00037 PCR reaction conditions 98 C. 5 min 98 C. 10 sec 30 cycles {open oversize brace} 55 C. 5 sec 72 C. 4.5 min 72 C. 10 min
[0265] 3. Separation, Purification of DNA Fragments
[0266] DpnI Digestion
[0267] The PCR amplified fragment was first treated with DpnI enzyme (from Fermentas) for 3 hours at 37 C. to remove the potential template plasmid contamination. The reaction system was then denatured and deactivated at 80 C. for 20 minutes. The deactivated mixture could be directly used for subsequent molecular biological experiments.
[0268] Phosphorylation of DNA Fragment
[0269] At the presence of ATP, the DNA fragment was treated with T4 polynucleotide kinase (T4 PNK) (from Fermentas) at 37 C. for 1 h to phosphorylate the 5-OH of DNA ribose ring, in order to allow the fragment to cyclize by self-ligation. Then the reaction system was denatured and deactivated at 75 C. for 10 minutes. The deactivated mixture could be directly used for subsequent molecular biological experiments.
[0270] Ligation
[0271] The phosphorylated DNA fragments (mutated DNA fragments: pRSET.sub.b-ydiH-YFP or pRSET.sub.b-YFP-ydiH) were cyclized by self ligation overnight at 16 C. with T4 DNA ligase enzyme (from Fermentas).
[0272] Identification of Plasmid Mutations
[0273] Colonies identified as positive in Colony PCR were selected and sequenced using universal primers at the Shanghai Branch of Beijing Liuhe BGI Technology Co., Ltd. The determined sequence was then compared and analyzed by Vector NTI 8.0.
[0274] Construction of Sensor Series
[0275] Following sensors were produced according to the methods described above, and numbered respectively.
TABLE-US-00038 SEQ ID Plasmid NO. NO pRSET.sub.b-ydiH(189)-YFP-ydiH(190) F-rex2-1.0 127 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-N1 F-rex2-2.0 128 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-N2 F-rex2-2.1 129 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-N3 F-rex2-2.2 130 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C1 F-rex2-2.3 131 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C2 F-rex2-2.4 132 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C3 F-rex2-2.5 133 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C1N1 F-rex2-2.6 134 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C1N2 F-rex2-2.7 135 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C1N3 F-rex2-2.8 136 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C2N1 F-rex2-2.9 137 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C2N2 F-rex2-2.10 138 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C2N3 F-rex2-2.11 139 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C3N1 F-rex2-2.12 140 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C3N2 F-rex2-2.13 141 pRSET.sub.b-ydiH(189)-YFP-ydiH(190)-C3N3 F-rex2-2.14 142 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190) F-rex2-2.15 143 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-N1 F-rex2-2.16 144 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-N2 F-rex2-2.17 145 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-N3 F-rex2-2.18 146 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C1 F-rex2-2.19 147 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C2 F-rex2-2.20 148 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C3 F-rex2-2.21 149 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C1N1 F-rex2-2.22 150 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C1N2 F-rex2-2.23 151 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C1N3 F-rex2-2.24 152 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C2N1 F-rex2-2.25 153 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C2N2 F-rex2-2.26 154 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C2N3 F-rex2-2.27 155 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C3N1 F-rex2-2.28 156 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C3N2 F-rex2-2.29 157 pRSET.sub.b-Trex(D2)-ydiH(189)-YFP-ydiH(190)-C3N3 F-rex2-2.30 158
Example 5. Spectral Characteristics of Fluorescent Sensors for NADH
[0276] The fluorescent sensors that prepared above were dissolved in assay buffer (100 mM KPi, pH7.4) to formulate fluorescent sensor solutions to a final concentration of 10 M. Then their absorption spectra were measured using a Multi-functional Fluorescence Microplate Reader (Synergy2, Biotek) (
[0277] Their excitation and emission spectra were determined using a fluorescence spectrophotometer (Cary Eclipse Fluorescence spectrophotometer, Varian) (
[0278] Experimental results indicated that, F-rex1 had two excitation peaks at 400 nm and 490 nm, respectively, and the latter exhibited an intensity five times of that of the former. However, F-rex1 had only one emission peak at 521 nm. Meanwhile, F-rex2 protein has two excitation peaks at 410 nm and 500 nm, respectively, and the latter exhibited an intensity about half of that of the former. However, F-rex2 had only one emission peak at 518 nm (
Example 6. Characteristics of Fluorescent Sensors for NADH in Responses to Pyridine Nucleotide Analogs Under Physiological Conditions
[0279] The fluorescent sensors prepared above were dissolved in assay buffer (100 mM KPi, pH7.4) to formulate protein solutions to a final concentration of 1 M. Pyridine nucleotide analogs NAD.sup.+, NADH, ATP, ADP, NADP.sup.+ and NADPH (Merck Biosciences GmbH, Darmstadt, Germany) were prepared in assay buffer (100 mM KPi, pH7.4) for stock solutions at a final concentration of 8 mM, which were diluted to 80 M before use.
[0280] Two hundred microliter of the 1 M solution of fluorescent sensors was taken, and first titrated 5 with 4 l of the 80 M NAD.sup.+ or NADH or ATP or ADP or NADP.sup.+ or NADPH, then further titrated 5 with 4 l of the 8 mM NAD.sup.+ or NADH or ATP or ADP or NADP.sup.+ or NADPH. After each titration, the solution was vortexed 5 seconds to allow the reaction to complete, then the fluorescent intensity of 528 nm emission upon 485 nm excitation was measured using a Multi-functional Fluorescence Microplate Reader (Synergy2, Biotek).
[0281] Measurements demonstrated that, NADH fluorescent sensors exhibited robust response to NADH at the physiological concentration (<100 M NADH), but no notable response to other pyridine nucleotide was observed (
Example 7. Localization and Expression of Fluorescent Sensor for NADH in Different Subcellular Organelles
[0282] The NADH fluorescence sensor gene (Frex) was obtained using pRSET.sub.b-ydiH-cpYFP-ydiH(D2) as template, and double-digesting it with BamHI and HindIII. The digested fragment was recovered and ligated to the following vectors: pcDNA3.1-Hygro-Cyto, pcDNA3.1-Hygro-Mito, pcDNA3.1-Hygro-Nuc, pcDNA3.1-Hygro-Mem, pcDNA3.1-Hygro-Golgi, pcDNA3.1-Hygro-ER and pcDNA3.1-Hygro-Peroxi respectively (engineered in Protein Chemistry Laboratory of East China University of Science and Technology, Shanghai, China).
[0283] Preparation: unless otherwise indicated, all primers used herein were synthesized by Shanghai Sangon (Sangon Biotech (Shanghai Co. Ltd., Shanghai, China). First, vector pcDNA3.1-Hygro-Cyto was constructed based on pcDNA3.1-Hygro (+) (Invitrogen, California, U.S.A.). Two primers: Cyto Forward Primer and Cyto Reverse Primer, were designed.
TABLE-US-00039 Cyto Forward Primer: (SEQ ID No 80) CTAGCATGGCGGATCCACTAGTAAGCTTAAGC Cyto Reverse Primer: (SEQ ID No 81) TCGAGCTTAAGCTTACTAGTGGATCCGCCATG
[0284] This primer pair contains restriction sites and the start codon ATG, and the structure was NheI-ATG-GC-BamHI-HindIII-XhoI. Following steps for dual primer annealing with the obtained primers was carried out. [0285] 1. The primer powder was dissolved to 100 M in specific buffer (10 mM Tris, pH7.5-8.0; 50 mM NaCl, 1 mM EDTA). [0286] 2. Equimolar amounts of the primer pair to be annealed were mixed to a total volume of no greater than 500 l. [0287] 3. The mixture was heated to 95 C. and then slowly cooled to room temperature (below 30 C.), then stored at 20 C. before use.
[0288] For organelle targeting signal Mito (SEQ ID No 82) and Golgi (SEQ ID No 83), the signal was introduced into vector pcDNA3.1-Hygro(+) through double-digestion utilizing synthesized targeting signal containing NheI restriction site allocated at 5 end and BamHI restriction site allocated at 3 end.
TABLE-US-00040 Double-digestion system DNA fragment 10 l NheI 1 l BamHI 1 l 10 Tangobuffer 5 l ddH.sub.2O 33 l Total 50 l
TABLE-US-00041 Double-digestion system Vector:pcDNA3.1-Hygro(+) 10 l NheI 1 l BamHI 1 l 10 Tangobuffer 5 l ddH.sub.2O 33 l Total 50 l
[0289] Similarly, for organelle targeting signal Nuc, Mem, E R and Peroxi, a pair of restriction sites were allocated to their both ends, respectively. Synthesized primers were utilized in dual primer annealing for the formation of double-stranded DNA, double-stranded DNA fragment with sticky ends obtained directly thereby was subsequently ligated with double-digested vector pcDNA3.1-Hygro(+).
TABLE-US-00042 Nuc Forward Primer: (SEQ ID No 84) AGCTTGATCCAAAAAAGAAGAGAAAGGTAGATCCAAAAAAGAAGAGAA AGGTAGATCCAAAAAAGAAGAGAAAGGTAGC Nuc Reverse Primer: (SEQ ID No 85) TCGAGCTACCTTTCTCTTCTTTTTTGGATCTACCTTTCTCTTCTTTTTTG GATCTACCTTTCTCTTCTTTTTTGGATCA Mem Forward Primer: (SEQ ID No 86) CTAGCATGGCGCTGTGCTGTATGAGAAGAACCAAACAGGTTGAAAAGAA TGATGAGGACCAAAAGATCGCG Mem Reverse Primer: (SEQ ID No 87) GATCCGCGATCTTTTGGTCCTCATCATTCTTTTCAACCTGTTTGGTTCTT CTCATACAGCACAGCGCCATG ER Forward Primer: (SEQ ID No 88) CTAGCATGGCGCTGCTATCCGTGCCGTTGCTGCTCGGCCTCCTCGGCCTG GCCGTCGCCGCG ER Reverse Primer: (SEQ ID No 89) GATCCGCGGCGACGGCCAGGCCGAGGAGGCCGAGCAGCAACGGCAC GGATAGCAGCGCCATG Peroxi Forward Primer: (SEQ ID No 90) AGCTTTCCAAGCTGTAAC Peroxi Reverse Primer: (SEQ ID No 91) TCGAGTTACAGCTTGGAA
[0290] Recombinant plasmids pcDNA3.1-Hygro-Cyto-Frex, pcDNA3.1-Hygro-mito-Frex, pcDNA3.1-Hygro-Frex-Nuc, pcDNA3.1-Hygro-mem-Frex, pcDNA3.1-Hygro-golgi-Frex, pcDNA3.1-Hygro-Frex-ER and pcDNA3.1-Hygro-Frex-peroxi were constructed, and then sequenced. The results demonstrated that the nucleotide sequences of Frex fragment were the same as SEQ ID NO: 9. HEK293 cells, HEK293FT cells and Cos7 cells were transfected with these recombinant plasmids, respectively. The transfected cells were observed under a laser scanning confocal microscope (Nikon, Japan) with two excitation wavelengths at 405 nm and 488 nm, while the emission wavelength was 500-550 nm.
[0291] Experimental results indicated that, in HEK293FT cells, Frex-Cyto was efficiently and accurately located in the cytoplasm (
Example 8 Utilizing the Sensor Series to Indicate Changes of Intracellular Reduced Nicotinamide Adenine Dinucleotide
[0292] (1) Fluorescent sensors for reduced nicotinamide adenine dinucleotide used in real-time measurements of increases of NADH levels in different subcellular compartments as the result of trans-membrane entrance of NADH into the cell.
[0293] As described in Example 7, the fluorescence sensors for reduced nicotinamide adenine dinucleotide were expressed in different subcellular organelles of 293FT cells. Results showed that this series of sensors are capable of detecting, in real time, the changes in intracellular NADH levels upon the addition of external NADH in cell culture medium (
[0294] (2) Fluorescent sensor for nicotinamide adenine dinucleotide used in real-time measurements of NADH levels in different subcellular compartments regulated by glucose, pyruvate and lactate.
[0295] Glycolysis is an important pathway of producing NADH and it plays a vital role in regulating intracellular NADH levels. The nicotinamide adenine dinucleotide fluorescent sensors were used to test how several important metabolites in this pathway, glucose, pyruvate and lactate, would influence the NADH levels in different subcellular compartments.
[0296] (3) Fluorescent sensors for reduced nicotinamide adenine dinucleotide used in real-time detection of NADH levels in mitochondria regulated by oxidative phosphorylation pathway.
[0297] NADH that produced via glycolysis pathway and tricarboxylic acid cycle pathway will be oxidized by the oxidative phosphorylation pathway of mitochondrial respiratory chain, and then generate ATP to provide energy for various life activities. Fluorescent sensors for nicotinamide adenine dinucleotide were used to measure changes of NADH levels in mitochondria when various complexes in the respiratory chain were inhibited.
Example 9 Measurement of Changes in Intracellular NAD.SUP.+ Level by Fluorescent Sensors for Oxidized Nicotinamide Adenine Dinucleotide
[0298] Fluorescent sensor for oxidized nicotinamideadenine dinucleotide has a structure with cpYFP inserted into Trex between two amino acids, F189 and L190. The sequence of said sensor is SEQ ID NO: 129. Said sensor was prepared as described in Example 4. By expressing said sensors in cytoplasm of 293FT cells, we found that real-time monitor of the effects on intracellular NAD.sup.+ levels of adding NAD.sup.+ into cell culture medium could be well achieved using this series of sensors (
Example 10 Measurement of Changes in NADH/NAD.SUP.+ Ratio by Fluorescent Sensors for Reduced/Oxidized Nicotinamide Adenine Dinucleotide Ratio
[0299] Fluorescent sensor for reduced/oxidized nicotinamide adenine dinucleotide ratio has a structure with cpYFP inserted into Trex between two amino acids, F189 and L190. The sequence of said sensor is SEQ ID NO: 148. Said sensor was prepared as described in Example 4. Said sensor exhibited response only to NADH and NAD.sup.+, but no response to NADH analogs. Upon 485 nm excitation, binding with NADH and NAD.sup.+ could both lead increased fluorescence emission at 528 nm. However, upon 420 nm excitation, said sensor could only respond to NADH binding. Since 420 nm and 485 nm excitation could both produce emission fluorescence at 528 nm, different excitation wavelengths could be used to measure the ratio of fluorescence intensity emitted at 528 nm (420 nm/485 nm), it has been found that NADH binding increases the response in said fluorescence ratio, while NAD.sup.+ binding decreases the response in said fluorescence ratio (
[0300] At the presence of 20 uM NADP, NADPH, ADP and ATP, titration of [NADH]/[NAD.sup.+] at indicated ratio was conducted, we could find the responsive value and variation pattern were not affected, indicating that NADP, NADPH, ADP and ATP have no effect on the sensor (
[0301] Therefore, said sensor could be used not only as a sensor for reduced/oxidized nicotinamide adenine dinucleotide ratio but also a sensor for reduced nicotinamide adenine dinucleotide alone.
Example 11 High-Throughput Drug Screening Based on Fluorescence Sensor for Reduced/Oxidized Nicotinamide Adenine Dinucleotide Ratio
[0302] It is generally believed that there is a dynamic balance between the concentration of pyruvate and lactate in cytoplasm and the concentration of free NADH and NAD.sup.+ in cytoplasm. In healthy tissues, pyruvate produced by glycolysis mainly enters mitochondria to participate TCA cycle and eventually generates a large amount of energy through oxidative phosphorylation. But in malignant tissues, pyruvate is mainly reduced to lactate by lactate dehydrogenase, accompanied by oxidizing NADH to NAD.sup.+. We developed a new method of high-throughput drug screening based the metabolic variation using superFrex, a fluorescent sensor for reduced/oxidized nicotinamide adenine dinucleotide ratio.
[0303] Stable cell lines expressing superFrex were mixed with different agents, then loaded into a black 384-well plate, and the fluorescence of superFrex was measured with a Multifunctional Microplate Reader (
Example 12 Measurement of NADH Metabolism in Tumor Cells Using Fluorescent Sensor for Reduced/Oxidized Nicotinamide Adenine Dinucleotide Ratio
[0304] H1299 tumor cells were transfected with pcDNA3.1-cyt-superFrex, and then screened under Hygromycin B for 2 weeks. Single clones of H1299 stable cell lines that exhibiting robuse expression of superFrex were obtained by flow cytometry sorting (H1299-superFrex). Male nude mice of 5-6 weeks old were subcutaneously injected with 200 l of H1299-superFrex cell suspension (1.010.sup.7 cells) into their right armpits and housed for 3-4 weeks at SPF Animal facility, tumors in the nude mice grew to 0.6-1.0 cm. The nude mice were anaesthetized and then injected with 300 l of sodium pyruvate (100 mM) via the tail vein. Effects of the agent on tumor metabolism were observed immediately with Kodak multifunctional vivo imaging system (Carestream, USA). Experimental results showed that, pyruvate resulted a quick decrease in the fluorescence of 420 nm channel of superFrex in tumor tissues, and a quick increase in the fluorescence of 490 nm channel of superFrex, leading to a decrease in ratio 420/490 nm (
Other Embodiments
[0305] A number of embodiments are described herein. However, it should be understood that, in view of this specification, variations and modifications will be apparent to those skilled in the art, without departing from the spirit and scope of the invention. Therefore, these alternative embodiments are also included within the scope of the appended claims.