Fc-binding protein exhibiting improved alkaline resistance, method for producing said protein, antibody adsorbent using said protein, and method for separating antibody using said antibody adsorbent
11603548 · 2023-03-14
Assignee
Inventors
- Ryoko Watanabe (Kanagawa, JP)
- Satoshi Endo (Kanagawa, JP)
- Yosuke Terao (Kanagawa, JP)
- Seigo Oe (Kanagawa, JP)
Cpc classification
C07K1/22
CHEMISTRY; METALLURGY
C07K16/283
CHEMISTRY; METALLURGY
C07K14/70535
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C07K17/00
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
International classification
C07K1/22
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
C07K16/28
CHEMISTRY; METALLURGY
Abstract
An Fc-binding protein exhibiting improved alkaline resistance, a method for producing the protein, an antibody adsorbent obtained by immobilizing the protein on a carrier, and a method for separating an antibody using the adsorbent.
Claims
1. An Fc-binding protein comprising at least the amino acid residues from glycine at position 33 to glutamine at position 208 of the amino acid sequence listed as SEQ ID NO: 7, 9 or 11.
2. A polynucleotide encoding an Fc-binding protein comprising at least the amino acid residues from glycine at position 33 to glutamine at position 208 of the amino acid sequence listed as SEQ ID NO: 7, 9 or 11.
3. An expression vector comprising the polynucleotide according to claim 2.
4. A transformant capable of producing Fc-binding protein, obtained by transforming a host with the expression vector according to claim 3.
5. The transformant according to claim 4, wherein the host is E. coli.
6. A method for producing Fc-binding protein, comprising producing Fc-binding protein by culturing the transformant according to claim 4, and recovering the produced Fc-binding protein from the cultured product.
7. Antibody adsorbent obtained by immobilizing the Fc-binding protein according to claim 1 on an insoluble support.
8. An antibody separating method comprising adding an antibody-containing solution to a column packed with the adsorbent according to claim 7, and adsorbing the antibody onto the adsorbent, and using an eluent to elute the antibody adsorbed on the adsorbent.
9. The separating method according to claim 8, wherein antibodies with different sugar chain structures are separated based on differences in their affinity for Fc-binding protein.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
EXAMPLES
(8) The present invention will now be described in greater detail by examples, with the understanding that the invention is not limited to the examples.
Example 1 Mutagenesis in Fc-Binding Protein and Construction of Library
(9) Random mutagenesis by error-prone PCR was carried out on a polynucleotide encoding FcR35c-containing Fc-binding protein (SEQ ID NO: 5), prepared by the method described in Japanese Unexamined Patent Publication No. 2017-118871. Incidentally, FcR35c (the amino acid residues from position 33 to position 208 of the amino acid sequence listed as SEQ ID NO: 5) is a polypeptide having the amino acid residues from glycine at position 33 to glutamine at position 208 of SEQ ID NO: 4 (from glycine at position 17 to glutamine at position 192 in SEQ ID NO: 1), corresponding to the extracellular domain of the wild-type human FcγRIIIa (the EC domain in
(10) (1) Error-prone PCR was carried out using expression vector pET-FcR35c prepared by the method described in Japanese Unexamined Patent Publication No. 2017-118871 as the template (the sequence of the polynucleotide encoding Fc-binding protein listed as SEQ ID NO: 5 in this expression vector is shown as SEQ ID NO: 6). The error-prone PCR was carried out by preparing a reaction mixture with the composition shown in Table 1, and then heat treating the reaction mixture at 95° C. for 2 minutes, carrying out 35 cycles of reaction where one cycle consisted of a first step at 95° C. for 30 seconds, a second step at 60° C. for 30 seconds and a third step at 72° C. for 90 seconds, and finally conducting heat treatment at 72° C. for 7 minutes. As a result of the reaction, mutations were satisfactorily introduced into the polynucleotide encoding Fc-binding protein.
(11) TABLE-US-00001 TABLE 1 Composition Volume Template DNA (pET-FcR35c, l μL concentration: 12 ng/μL) 10 μM PCR primer (SEQ ID NO: 2) 4 μL 10 μM PCR primer (SEQ ID NO: 3) 4 μL 2.5 mM MgCl.sub.2 12 μL l0 mM dATP 2 μL l0 mM dGTP 2 μL l0 mM dCTP 10 μL l0 mM dTTP 10 μL 10 mM MnCl.sub.2 4 μL 10 × Ex Taq Buffer (Takara Bio, Inc.) 10 μL GoTaq polymerase (Promega) 1 μL H.sub.2O up to 100 μL
(12) (2) After purifying the PCR product obtained in (1), it was digested with restriction enzymes NcoI and HindIII, and ligated with expression vector pETMalE previously digested with the same restriction enzymes (Japanese Unexamined Patent Publication No. 2011-206046).
(13) (3) Upon completion of the ligation reaction, the reaction mixture was introduced into E. coli BL21(DE3) by electroporation, and culturing was conducted on LB plate culture medium containing 50 μg/mL kanamycin, after which the colonies formed on the plate were used as a random mutation library.
Example 2: Screening of Fc-Binding Protein with Alkali Resistance
(14) (1) The random mutation library (of transformants) prepared in Example 1 was inoculated into 200 μL of 2YT liquid medium (16 g/L peptone, 10 g/L yeast extract, 5 g/L sodium chloride) containing 50 μg/mL kanamycin, and a 96-well deep well plate was used for shake culturing overnight at 30° C.
(15) (2) After culturing, 5 μL of culture solution was subcultured on 2YT liquid medium containing 500 μL of 0.05 mM IPTG (isopropyl-β-D-thiogalactopyranoside), 0.3% (w/v) glycine and 50 μg/mL kanamycin, and a 96-well deep well plate was used for shake culturing overnight at 20° C.
(16) (3) After culturing, the culture supernatant containing the Fc-binding protein obtained by centrifugation was diluted 25-fold with purified water and mixed with an equivalent amount of 500 mM sodium hydroxide, and then allowed to stand at 30° C. for 3 hours for alkali treatment. After alkali treatment, the pH was adjusted to near neutral with a 4-fold amount of 1 M Tris buffer (pH 7.0).
(17) (4) The antibody-binding activity of the Fc-binding protein after the alkali treatment of (3) and the antibody-binding activity of the Fc-binding protein without the alkali treatment of (3) were each measured by the ELISA method described below, and the antibody-binding activity of the Fc-binding protein after alkali treatment was divided by the antibody-binding activity of the Fc-binding protein without alkali treatment to calculate the residual activity.
(18) (4-1) A gammaglobulin preparation (by Kaketsuken) as the human antibody, was immobilized in the wells of a 96-well microplate at 1 μg/well (at 4° C. for 18 hours), and after complete immobilization, blocking was performed with 20 mM Tris-HCl buffering solution (pH 7.4) containing 2% (w/v) SKIM MILK (product of BD Co.) and 150 mM sodium chloride.
(19) (4-2) After rinsing with wash buffer (20 mM Tris-HCl buffer (pH 7.4) containing 0.05% [w/v] Tween 20 and 150 mM NaCl), a solution containing Fc-binding protein for evaluation of the antibody-binding activity was added, and reaction was conducted between the Fc-binding protein and the immobilized gammaglobulin (at 30° C. for 1 hour).
(20) (4-3) Upon completion of the reaction, it was rinsed with wash buffer and Anti-6His antibody (product of Bethyl Laboratories) diluted to 100 ng/mL was added at 100 μL/well.
(21) (4-4) Reaction was conducted at 30° C. for 1 hour, and after rinsing with wash buffer, TMB Peroxidase Substrate (product of KPL) was added at 50 μL/well. Coloration was stopped by adding 1 M phosphoric acid at 50 μL/well, and the absorbance at 450 nm was measured with a microplate reader (product of Tecan).
(22) (5) Approximately 2700 transformants were evaluated by the method of (4), and among these there were selected transformants expressing Fc-binding protein with increased stability compared to FcR35c. The selected transformants were cultured with 2YT liquid medium containing 50 μg/mL kanamycin, and an expression vector was prepared using a QIAprep Spin Miniprep kit (product of Qiagen Inc.).
(23) (6) The sequence of the polynucleotide region encoding Fc-binding protein that had been inserted into the obtained expression vector was supplied to a cycle sequencing reaction using a BigDye Terminator Cycle Sequencing FS Read Reaction Kit (product of Thermo Fisher Scientific) based on the chain terminator method, and the nucleotide sequence was analyzed with a fully automatic DNA sequencer: ABI Prism 3700 DNA analyzer (product of Thermo Fisher Scientific). For the analysis, oligonucleotides comprising the sequences listed as SEQ ID NO: 2 (5′-TAATACGACTCACTATAGGG-3′) and SEQ ID NO: 3 (5′-TATGCTAGTTATTGCTCAG-3′) were used as the sequencing primers.
(24) The transformants were evaluated by the method of (4) above and compared with FcR35c, giving the results shown in Table 2. The polypeptides with increased alkali stability compared to FcR35c were designated as FcR35d, FcR36i and FcR36a. The polypeptides with decreased alkali stability compared to FcR35c are listed as A, B, C and D in Table 2 (unconfirmed sequences).
(25) TABLE-US-00002 TABLE 2 Fc-binding protein Residual Name SEQ ID NO: activity [%] FcR35d 7 45.1 FcR36i 9 43.5 FcR36a 11 43.0 A — 40.0 B — 39.0 C — 35.5 D — 17.6 FcR35c 5 42.2
(26) The amino acid sequence of the Fc-binding protein containing FcR35d is listed as SEQ ID NO: 7, and the polynucleotide encoding that protein is listed as SEQ ID NO: 8. The amino acid sequence of the Fc-binding protein containing FcR36i is listed as SEQ ID NO: 9, and the polynucleotide encoding that protein is listed as SEQ ID NO: 10. The amino acid sequence of the Fc-binding protein containing FcR36a is listed as SEQ ID NO: 11, and the polynucleotide encoding that protein is listed as SEQ ID NO: 12. In SEQ ID NO: 7, 9 and 11, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position 27 to methionine (Met) at position 32 is a linker sequence, the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is the amino acid sequence of FcR35d (SEQ ID NO: 7), FcR36i (SEQ ID NO: 9) or FcR36a (SEQ ID NO: 11), the region of glycine (Gly) from position 209 to position 210 is a linker sequence, and the region of histidine (His) from position 211 to position 216 is the tag sequence.
(27) As a result of analyzing the sequences of the polynucleotides encoding FcR35d, FcR36i and FcR36a by the method of (6) above, it was found that FcR35d (SEQ ID NO: 7) had produced the new amino acid substitutions of Ser81Arg, Asn196 Lys, Glu200Gly and Glu203Asp in FcR35c, while the amino acid residues at position 98, position 114, position 117 and position 208 had been restored to the amino acid residues of the wild-type (SEQ ID NO: 4). Also, FcR36i (SEQ ID NO: 9) had produced the new amino acid substitutions of Ser81Arg, Val192Ile, Asn196 Lys, Glu200Gly and Glu203Asp in FcR35c, while the amino acid residues at position 98, position 114, position 117 and position 208 had been restored to the amino acid residues of the wild-type (SEQ ID NO: 4), similar to FcR35d. FcR36a (SEQ ID NO: 11) had produced the new amino acid substitutions of Ser81Arg, Val192Ala, Asn196 Lys, Glu200Gly and Glu203Asp in FcR35c, while the amino acid residues at position 98, position 114, position 117 and position 208 had been restored to the amino acid residues of the wild-type (SEQ ID NO: 4), similar to FcR35d and FcR36i.
Example 3 Evaluation of Alkali Stability of Fc-Binding Proteins
(28) (1) Transformants expressing FcR35ε-containing Fc-binding protein (SEQ ID NO: 5), as well as the FcR35d-containing Fc-binding protein (SEQ ID NO: 7), FcR36i-containing Fc-binding protein (SEQ ID NO: 9) and FcR36α-containing Fc-binding protein (SEQ ID NO: 11), obtained in Example 2, were each inoculated onto 100 mL of 2YT liquid medium containing 50 μg/mL kanamycin, and aerobically shake cultured overnight at 37° C. as preculturing.
(29) (2) This preculturing solution was inoculated at 10 mL into 1000 mL of 2YT liquid medium (16 g/L peptone, 10 g/L yeast extract and 5 g/L sodium chloride) containing 50 μg/mL added kanamycin, and aerobically shake cultured at 37° C.
(30) (3) At 1.5 hours after the start of culturing, the culturing temperature was lowered to 20° C. and shake culturing was continued for 30 minutes. Next, IPTG was added to a final concentration of 0.01 mM, and aerobic shake culturing was continued overnight at 20° C.
(31) (4) Upon completion of culturing, the cells were collected by centrifugal separation and suspended in buffer (20 mM Tris-HCl buffer containing 150 mM NaCl (pH 7.4)) and subjected to ultrasonic disruption. The supernatant was then collected by centrifugal separation.
(32) (5) The collected supernatant was passed through a column packed with Ni Sepharose6 Fast Flow (GE Healthcare) and thoroughly washed with wash buffer (20 mM Tris-HCl buffer containing 150 mM NaCl (pH 7.4)), after which it was eluted with elution buffer (20 mM Tris-HCl buffer containing 150 mM NaCl and 500 mM imidazole (pH 7.4)) and the elution fraction was recovered.
(33) (6) The elution fraction recovered in (5) was passed through a column packed with IgG Sepharose6 Fast Flow (GE Healthcare) and thoroughly washed with wash buffer (20 mM Tris-HCl buffer containing 150 mM NaCl (pH 7.4)), after which it was eluted with elution buffer (100 mM glycine buffer containing (pH 3.0)) and the elution fraction was recovered, and then a ¼-fold amount of 1 M Tris-HCl buffer (pH 8.0) was added for neutralization, to prepare each purified Fc-binding protein.
(34) (7) After dilution with purified water to a 10 μg/mL concentration of each Fc-binding protein, 50 μL of the diluted solution and 50 μL of a 200 mM sodium hydroxide solution were mixed and the mixture was allowed to stand at 25° C. for 96 hours for alkali treatment. It was then neutralized by adding a 4-fold volume of 1 M Tris-HCl buffer (pH 7.0).
(35) (8) The antibody-binding activity of the Fc-binding protein after the alkali treatment of (7) above and the antibody-binding activity of the Fc-binding protein without the alkali treatment of (7) were each measured by the ELISA method described in Example 2(4). The antibody-binding activity of the Fc-binding protein after the alkali treatment was then divided by the antibody-binding activity of the Fc-binding protein without alkali treatment to calculate the residual activity.
(36) The results are shown in Table 3. The FcR35d-containing Fc-binding protein (SEQ ID NO: 7), FcR36i-containing Fc-binding protein (SEQ ID NO: 9) and FcR36α-containing Fc-binding protein (SEQ ID NO: 11) had high residual activity compared to the FcR35c-containing Fc-binding protein (SEQ ID NO: 5), and therefore FcR35d, FcR36i and FcR36a obtained in Example 2 were confirmed to have increased alkali stability (alkali resistance) compared to FcR35c.
(37) TABLE-US-00003 TABLE 3 Fc-binding protein Residual Name SEQ ID NO: activity [%] FcR35d 7 95.0 FcR36i 9 91.7 FcR36a 11 84.3 FcR35c 5 75.0
Example 4: Measurement of Binding Activity of Fc-Binding Protein for IgG
(38) The transformants used were transformants expressing FcR35d-containing Fc-binding protein (SEQ ID NO: 7), FcR36i-containing Fc-binding protein (SEQ ID NO: 9), FcR36α-containing Fc-binding protein (SEQ ID NO: 11) or FcR35c-containing Fc-binding protein (SEQ ID NO: 5), and measurement was performed by the following method.
(39) (1) Transformants expressing the FcR35d-containing Fc-binding protein (SEQ ID NO: 7) or FcR36i-containing Fc-binding protein (SEQ ID NO: 9) were each inoculated onto 2 mL of 2YT liquid medium containing 50 μg/mL kanamycin, and aerobically shake cultured overnight at 37° C. as preculturing.
(40) (2) This preculturing solution was inoculated at 0.2 mL into 20 mL of 2YT liquid medium (16 g/L peptone, 10 g/L yeast extract and 5 g/L sodium chloride) containing 50 μg/mL added kanamycin, and aerobically shake cultured at 37° C.
(41) (3) At 1.5 hours after the start of culturing, the culturing temperature was lowered to 20° C. and shake culturing was continued for 30 minutes. Next, IPTG ((isopropyl-β-thiogalactopyranoside) was added to a final concentration of 0.01 mM, and aerobic shake culturing was continued overnight at 20° C.
(42) (4) Upon completion of culturing, the cells were collected by centrifugal separation and a BugBuster Protein extraction kit (product of Merck Millipore) was used to prepare a protein extract.
(43) (5) The antibody-binding activity of the Fc-binding protein was measured by the ELISA method described in Example 2(4). The expression level of the Fc-binding protein was calculated based on the binding activity of the obtained Fc-binding protein for IgG.
(44) The results are shown in Table 4. The expression levels of the Fc-binding proteins FcR35d and FcR36i per 1 L of culture solution were 443.5 mg and 495.6 mg, respectively.
(45) TABLE-US-00004 TABLE 4 Fc-binding protein Expression level [mg/L Name SEQ ID NO: (culture solution)] FcR35d 7 443.5 FcR36i 9 495.6
(46) (6) Transformants expressing FcR35d-containing Fc-binding protein (SEQ ID NO: 7), FcR36i-containing Fc-binding protein (SEQ ID NO: 9), FcR36α-containing Fc-binding protein (SEQ ID NO: 11) or FcR35ε-containing Fc-binding protein (SEQ ID NO: 5) were each inoculated onto 2 mL of 2YT liquid medium containing 50 μg/mL kanamycin, and aerobically shake cultured overnight at 37° C. as preculturing.
(47) (7) Shake culture was carried out in the same manner as (2) above.
(48) (8) Shake culture was carried out by the same method described in (3) above, except that the culturing time was 12 hours.
(49) (9) A protein extract was prepared in the same manner as (4) above.
(50) (10) The expression level was calculated in the same manner as (5) above.
(51) The results are shown in Table 5. The expression levels of the Fc-binding proteins FcR35d, FcR36i, FcR36a and FcR35c per 1 L of culture solution were 226 mg, 248 mg, 307 mg and 211 mg, respectively.
(52) TABLE-US-00005 TABLE 5 Fc-binding protein Expression level [mg/L Name SEQ ID NO: (culture solution)] FcR35d 7 226 FcR36i 9 248 FcR36a 11 307 FcR35c 5 211
Example 5: Evaluation of Binding Affinity Between Fc-Binding Proteins and IgG1
(53) (1) Culturing and purification were carried out by the same methods as Example 3(1) and (6) to prepare Fc-binding proteins.
(54) (2) The binding affinity between IgG1 and each Fc-binding protein recovered as the elution fraction in (1) was evaluated by the surface plasmon resonance method. For measurement of the binding affinity using the surface plasmon resonance method, a Biacore T100 (GE Healthcare) was used as the measuring apparatus, a Sensor Chip CM5 (GE Healthcare) was used as the sensor chip and Biacore T100 Evaluation Software (GE Healthcare) was used as the analysis software.
(55) (3) An Amine Coupling Kit (GE Healthcare) was used for flow of a solution comprising IgG1 (product of Sigma-Aldrich) diluted with HBS-EP (GE Healthcare) on a sensor chip immobilizing the Fc-binding protein, to obtain a sensorgram. Curve fitting was carried out based on the sensorgram to calculate the binding affinity for IgG1.
(56) The results of calculating the binding affinity for IgG1 are shown in Table 6. In Table 6, a lower K.sub.D value (dissociation constant) indicates higher affinity (binding affinity). The K.sub.D values for the FcR35d-containing Fc-binding protein (SEQ ID NO: 7), FcR36i-containing Fc-binding protein (SEQ ID NO: 9) and FcR36a-containing Fc-binding protein (SEQ ID NO: 11) were 3.9×10.sup.−8 M, 4.3×10.sup.−8 M and 9.5×10.sup.−8 M, respectively, which were approximately equivalent to the K.sub.D value for the FcR35c-containing Fc-binding protein (SEQ ID NO: 5) (4.0×10.sup.−8 M).
(57) TABLE-US-00006 TABLE 6 Binding rate Dissociation rate Dissociation Fc-binding protein constant ka constant kd constant Kd Name SEQ ID NO: [1/Ms] [1/s] [M] FcR35d 7 8.1 × 10.sup.5 3.1 × 10.sup.−2 3.9 × 10.sup.−8 FcR36i 9 9.0 × 10.sup.5 3.8 × 10.sup.−2 4.3 × 10.sup.−8 FcR36a 11 1.4 × 10.sup.6 1.3 × 10.sup.−1 9.5 × 10.sup.−8 FcR35c 5 5.4 × 10.sup.5 2.2 × 10.sup.−2 4.0 × 10.sup.−8
(58) These results demonstrated that the FcR35d, FcR36i and FcR36a obtained in Example 2 have antibody-binding affinity similar to a known polypeptide that can bind to the antibody Fc region (FcR35c, Japanese Unexamined Patent Publication No. 2017-11887), while have increased alkali resistance.
Example 6: Construction of Cysteine Tag-Added FcR36i
(59) (1) PCR was conducted using a polynucleotide encoding the FcR36i constructed in Example 2 (SEQ ID NO: 10) as template. The primers used for PCR were oligonucleotides comprising the sequences listed as SEQ ID NO: 13 (5′-CATATGAAAATAAAAACAGGTGCACGCATCCTCGCATTATCCGCATTAACGAC-3′) and SEQ ID NO: 14 (5′-CCCAAGCTTATCCGCAGGTATCGTTGCGGCACCCTTGGGTAACGGTAATGTCCACGG CCCCGCTG-3′). The PCR was conducted by preparing a reaction mixture with the composition shown in Table 7, and then heat treating the reaction mixture at 98° C. for 5 minutes, and repeating 30 cycles of a reaction where one cycle consisted of a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds and a third step at 72° C. for 1 minute.
(60) TABLE-US-00007 TABLE 7 Composition Volume Template DNA (concentration: 1 ng/μL) 1 μL 10 μM PCR primer (SEQ ID NO: 13) 1.5 μL 10 μM PCR primer (SEQ ID NO: 14) 1.5 μL 5 × PrimeSTAR buffer (Takara Bio, Inc.) 10 μL 2.5 mM dNTPs 4 μL 2.5 U/μL PrimeSTAR HS (Takara Bio, 0.5 μL Inc.) H.sub.2O up to 50 μL
(61) (2) The polynucleotide obtained in (1) was purified and digested with restriction enzymes NcoI and HindIII, and then ligated with expression vector pTrc-PelB constructed by the method described in WO2015/199154, which had been previously digested with restriction enzymes NcoI and HindIII, and the ligation product was used to transform E. coli W3110.
(62) (3) The obtained transformants were cultured in LB medium containing 100 μg/mL carbenicillin, and then a QIAprep Spin Miniprep kit (product of Qiagen Inc.) was used to extract expression vector pTrc-FcR36i_Cys.
(63) (4) The nucleotide sequence of pTrc-FcR36i_Cys was analyzed using oligonucleotides comprising the sequences listed as SEQ ID NO: 15 (5′-TGTGGTATGGCTGTGCAGG-3′) and SEQ ID NO: 16 (5′-TCGGCATGGGGTCAGGTG-3′).
(64) The amino acid sequence of the polypeptide expressed by expression vector pTrc-FcR36i_Cys is listed as SEQ ID NO: 17, and the sequence of the polynucleotide encoding the polypeptide is listed as SEQ ID NO: 18.
(65) In SEQ ID NO: 17, the sequence from methionine (Met) at position 1 to alanine (Ala) at position 22 is a modified PelB signal peptide (an oligopeptide comprising the amino acid residues from position 1 to position 22 of UniProt No. P0C1C1, with the stipulation that the oligopeptide includes one amino acid substitution), and the sequence from glycine (Gly) at position 24 to glutamine (Gln) at position 199 is the amino acid sequence of Fc-binding protein FcR36i (the region from position 33 to position 208 of SEQ ID NO: 9), while the sequence from glycine (Gly) at position 200 to glycine (Gly) at position 207 is the cysteine tag sequence.
Example 7: Preparation of FcR36i_Cys
(66) (1) Transformants expressing the FcR36i_Cys constructed in Example 6 were inoculated into 400 mL of 2YT liquid medium (16 g/L peptone, 10 g/L yeast extract and 5 g/L sodium chloride) containing 100 μg/mL carbenicillin in a 2 L baffle flask, and aerobically shake cultured overnight at 37° C., as preculturing.
(67) (2) After inoculating 180 mL of the culture solution of (1) into 1.8 L of liquid medium containing 10 g/L glucose, 20 g/L yeast extract, 3 g/L trisodium phosphate dodecahydrate, 9 g/L disodium hydrogen phosphate dodecahydrate, 1 g/L ammonium chloride and 100 mg/L carbenicillin, a 3 L fermenter (product of Biott) was used for main culturing. The conditions were set to a temperature of 30° C., a pH of 6.9 to 7.1, an aeration rate of 1 VVM and a dissolved oxygen concentration at 30% saturated concentration, and main culturing was commenced. For pH regulation, 50% phosphoric acid was used as the acid and 14% ammonia water was used as the alkali, the dissolved oxygen was controlled by varying the stirring speed, and the stirring rotational speed was set with a lower limit of 500 rpm and an upper limit of 1000 rpm. When the glucose concentration was no longer measurable after the start of culturing, feeding culture medium (248.9 g/L glucose, 83.3 g/L yeast extract, 7.2 g/L magnesium sulfate heptahydrate) was added while controlling the dissolved oxygen (DO).
(68) (3) When the absorbance at 600 nm (OD600 nm) reached about 150 as a measure of the cell mass, the culturing temperature was lowered to 25° C., and upon confirming that the preset temperature had been reached, IPTG (isopropyl β-D-1-thiogalactopyranoside) was added to a final concentration of 0.5 mM and culturing was continued at 25° C.
(69) (4) Culturing was terminated at about 48 hours after the start of culturing, and the cells were recovered by centrifugation of the culture solution at 8000 rpm for 20 minutes at 4° C.
(70) (5) The collected cells were suspended in 20 mM phosphate buffer (pH 7.0) to 5 mL/1 g (cells), and an ultrasonic generator (INSONATOR 201M, trade name of Kubota Corp.) was used to disrupt the cells at 4° C. for about 10 minutes, with an output of about 150 W. The cell disruptate was centrifuged twice at 4° C. for 20 minutes, 8000 rpm, and the supernatant was collected.
(71) (6) The supernatant obtained in (5) was applied to a VL32×250 column (Merck Millipore) packed with 140 mL of TOYOPEARL CM-650 M (Tosoh Corp.) previously equilibrated with 20 mM phosphate buffer (pH 7.0), at a flow rate of 10 mL/min. After rinsing with the buffer used for equilibration, it was eluted with 20 mM phosphate buffer (pH 7.0) containing 0.8 M sodium chloride.
(72) The purification described above yielded FcR36i_Cys.
Example 8: Preparation of FcR36i-Immobilized Gel and Antibody Isolation by Linear Gradient Elution
(73) (1) After activating the hydroxyl groups on the surface of a hydrophilic vinyl polymer for separation (Tosoh Corp.) using iodoacetyl groups, it was reacted with the FcR36i_Cys prepared in Example 7 to obtain an FcR36i-immobilized gel.
(74) (2) A 1.0 mL portion of the FcR36i-immobilized gel prepared in (1) was packed into a Tricorn column (product of GE Healthcare, inner diameter: 5 mm).
(75) (3) The column packed with the FcR36i-immobilized gel was connected to an AKTA Avant (GE Healthcare) and equilibrated with 20 mM acetate buffer at pH 4.8 (buffer A).
(76) (4) A 0.5 mL portion of 10 mg/mL of monoclonal antibody (Rituxan, product of Zenyaku Kogyo) was applied with 20 mM acetate buffer at pH 4.8 (buffer A), at a flow rate of 0.2 mL/min.
(77) (5) After rinsing for 66 minutes with equilibrating buffer while maintaining a flow rate of 0.2 mL/min, the monoclonal antibody adsorbed with a linear gradient produced with 10 mM glycine hydrochloride buffer at pH 3.0 (buffer B) (a linear gradient for 100% of the 10 mM glycine hydrochloride buffer at pH 3.0 (buffer B) in 75 minutes) was eluted.
(78) The result (elution pattern chromatogram) is shown in
Example 9: ADCC (Antibody-Dependent Cell-Mediated Cytotoxicity) Activity Measurement of Antibody Separated by Linear Gradient Elution Using FcR36i-Immobilized Gel
(79) (1) A monoclonal antibody was isolated under the elution conditions described in Example 8 and fractionated into fraction A (FrA) and fraction B (FrB) in the elution pattern chromatogram shown in
(80) (2) The concentrations of the antibodies included in FrA and FrB and of the monoclonal antibodies before isolation were measured at an absorbance of 280 nm.
(81) (3) The ADCC activities of the antibodies included in FrA and FrB and the monoclonal antibodies before isolation were measured by the following method.
(82) (3-1) Using ADCC Assay Buffer prepared by mixing 1.4 mL of Low IgG Serum and 33.6 mL of RPMI 1640 medium, a 9-step dilution series from 1 ng/mL to 1/3 dilution was prepared from the antibodies included in FrA and FrB and the monoclonal antibodies before isolation.
(83) (3-2) Raji cells were prepared to approximately 5×10.sup.5 cells/mL with ADCC Assay Buffer, and added to a 96-well plate (3917: Corning, Inc.) at 25 μL/well.
(84) (3-3) The monoclonal antibodies of FrA, FrB and before isolation, prepared in (3-1), and a blank (ADCC Assay Buffer alone), were added to the Raji cell-added wells at 25 μL/well.
(85) (3-4) Effector cells (Promega) were prepared to approximately 3.0×10.sup.5 cells/mL with ADCC Assay Buffer, and added to the wells containing the Raji cells and antibodies at 25 μL/well. The mixture was then allowed to stand for 6 hours in a CO.sub.2 incubator (5% CO.sub.2, 37° C.).
(86) (3-5) After allowing the 96-well plate to stand for 5 minutes to 30 minutes at room temperature, Luciferase Assay Reagent (Promega) was added at 75 μL/well. Following reaction for 30 minutes at room temperature, the luminescence was measured with a GloMax Multi Detection System (Promega).
(87)
(88) The antibody in FrA with a rapid elution time, which was separated by the FcR36i-immobilized gel, had about the same luminous intensity as the monoclonal antibody before separation, and therefore their ADCC activities may be considered to be approximately equal.
(89) The antibody in FrB with a slow elution time had ADCC activity increased by about 1.4 times compared to the monoclonal antibody before separation, and by about 1.5 times compared to the antibody in FrA as well. In other words, the antibody in FrB had higher ADCC activity than the monoclonal antibody before separation and the antibody in FrA.
Example 10: Sugar Chain Structure Analysis of Antibodies Separated by Linear Gradient Elution Using FcR36i-Immobilized Gel
(90) (1) After denaturing the respective antibodies in FrA and FrB that had been fractionated in Example 9(1), by heat treatment at 100° C. for 10 minutes, they were treated with glycoamidase A/pepsin and pronase in that order, and subjected to a purification procedure by gel filtration to obtain the sugar chain fraction.
(91) (2) The sugar chains obtained in (1) were concentrated and dried with an evaporator, and then reacted with 2-aminopyridine and dimethylamineborane in that order in an acetic acid solvent to obtain fluorescent-labeled sugar chains, which were purified by gel filtration.
(92) (3) The fluorescent-labeled sugar chains obtained in (2) were separated into a neutral sugar chain fraction and a monosialylated sugar chain fraction, using an anion exchange column (TSKgel DEAE-SPW, φ7.5 mm×7.5 cm, product of Tosoh Corp.).
(93) (4) The neutral sugar chain fraction and monosialylated sugar chain fraction obtained in (3) were isolated into individual sugar chains using an ODS column. After obtaining molecular weight information for the isolated sugar chains by MALDI-TOF-MS analysis, the sugar chain structures were assigned, taking into account the retention time of the ODS column chromatograph.
(94) The results of the assigned sugar chain structures are shown in
(95) TABLE-US-00008 TABLE 8 Percentage of sugar Name of sugar chain structure (%) chain structure FrA FrB Man5 2.8 0.2 G0 0.7 3.0 G1a — 1.2 G0F 49.2 20.8 G1Fa 22.1 44.6 G1Fb 3.0 4.0 G2F 4.1 14.3 G1F + SA — 0.2 G2F + SA — 2.4 G2F + SA2 — 1.8 Unknown structure 15.9 6.3 Other 2.2 1.2
(96) TABLE-US-00009 TABLE 9 Name of sugar chain structure Name of sugar chain structure Man5
Example 11: Preparation of FcR36i-Immobilized Gel and Antibody Isolation by Step Gradient Elution
(97) (1) An FcR36i-immobilized gel was obtained by the same method as Example 8(1).
(98) (2) The FcR36i-immobilized gel was packed into a column by the same method as Example 8(2).
(99) (3) The column packed with the FcR36i-immobilized gel was connected to an AKTA Avant (GE Healthcare) and equilibrated with 20 mM acetate buffer (pH 5.2).
(100) (4) A 1.5 mL portion of 10 mg/mL of monoclonal antibody (Rituxan, product of Zenyaku Kogyo) was applied with 20 mM acetate buffer (pH 5.2), at a flow rate of 0.2 mL/min.
(101) (5) After conveying 20 mM acetate buffer (pH 5.2) for 120 minutes while maintaining a flow rate 0.2 mL/min, 20 mM acetate buffer (pH 4.8) was conveyed for 100 minutes at a flow rate of 0.2 mL/min to elute a monoclonal antibody.
(102) (6) Next, 10 mM glycine hydrochloride buffer (pH 3.0) was conveyed for 50 minutes while maintaining a flow rate of 0.2 mL/min, to elute an adsorbed monoclonal antibody.
(103) The result (elution pattern chromatogram) is shown in
Example 12: Sugar Chain Analysis of Antibodies Separated by FcR36i-Immobilized Gel
(104) (1) Monoclonal antibodies were isolated under the elution conditions described in Example 11 and fractionated into fraction C (FrC), fraction D (FrD) and fraction E (FrE) in the elution pattern chromatogram shown in
(105) (2) The sugar chain structures were assigned by the same method as Example 10, except for using the respective antibodies in FrC, FrD and FrE fractionated as described above.
(106) The results of the assigned sugar chain structures are shown in
(107) Upon comparing the sugar chain structures of each of the antibodies in FrC (eluted with 20 mM acetate buffer (pH 5.2)), FrD (eluted with 20 mM acetate buffer (pH 4.8)) and FrE (eluted with 10 mM glycine hydrochloride buffer (pH 3.0)), the proportion of antibodies with a galactose-free sugar chain structure (G0F) at the ends was higher with the antibodies contained in the fraction eluted at high pH, while the proportion of antibodies with galactose-containing sugar chain structures (G1Fa and G2F) at the ends was higher with the antibodies contained in the fraction eluted at low pH. This indicates that an antibody having a sugar chain structure with galactose at the end binds strongly to FcR36i, and elutes at a low pH when separated with Fc36i-immobilized gel, while an antibody having a sugar chain structure without galactose at the end has weak binding strength with FcR36i, and elutes at a high pH during separation with Fc36i-immobilized gel.
(108) TABLE-US-00010 TABLE 10 Percentage of sugar Name of sugar chain structure (%) chain structure FrC FrD FrE Man5 5.5 — — G0 1.2 2.0 3.1 G1a — — 1.6 G0F 43.9 33.0 14.3 G1Fa 22.2 35.5 41.8 G1Fb 5.7 5.2 2.5 G2F 4.6 9.4 16.4 G2F + SA — 1.4 4.9 G2F + SA2 — — 4.6 Unknown structure 13.0 13.3 10.7 Other 3.6 — —
Example 13: Antibody Isolation by Step Gradient Elution Using FcR36i-Immobilized Gel (2)
(109) (1) An FcR36i-immobilized gel was obtained by the same method as Example 8(1).
(110) (2) The FcR36i-immobilized gel was packed into a column by the same method as Example 8(2), except that the amount of gel was 0.2 mL
(111) (3) The column packed with the FcR36i-immobilized gel was connected to an AKTA Avant (GE Healthcare) and equilibrated with 20 mM acetate buffer (pH 5.2).
(112) (4) A 0.3 mL portion of 10 mg/mL of monoclonal antibody (Avastin, product of Roche) was applied with 20 mM acetate buffer (pH 5.2), at a flow rate of 0.04 mL/min.
(113) (5) After conveying 20 mM acetate buffer (pH 5.2) for 180 minutes while maintaining a flow rate 0.04 mL/min, 20 mM acetate buffer (pH 4.8) was conveyed for 150 minutes at a flow rate of 0.04 mL/min to elute a monoclonal antibody.
(114) (6) Next, 10 mM glycine hydrochloride buffer (pH 3.0) was conveyed for 100 minutes while maintaining a flow rate of 0.04 mL/min, to elute the adsorbed monoclonal antibody.
(115) The resulting (elution pattern chromatogram) is shown in
Reference Example 1: Construction of Amino Acid-Substituted FcR9
(116) The following amino acid substitution was carried out in Fc-binding protein FcR9 (SEQ ID NO: 20) prepared by the method described in Japanese Unexamined Patent Publication No. 2016-169197 (PTL 3), in order to confirm the efficacy of substituting the amino acid residue at position 192 (corresponding to position 176 in SEQ ID NO: 1) with other amino acids. Specifically, amino acid substitution was carried out with plasmid pET-FcR9 containing a polynucleotide encoding FcR9 (SEQ ID NO: 21) (Japanese Unexamined Patent Publication No. 2016-169197) using PCR, to prepare Fc-binding protein having valine at position 192 of FcR9 (SEQ ID NO: 20) substituted with other amino acids. Incidentally, FcR9 (SEQ ID NO: 20) is an Fc-binding protein having the amino acid substitutions of glutamic acid for valine at position 43 (corresponding to position 27 in SEQ ID NO: 1), isoleucine for phenylalanine at position 45 (corresponding to position 29 in SEQ ID NO: 1), asparagine for tyrosine at position 51 (corresponding to position 35 in SEQ ID NO: 1), arginine for glutamine at 64th (corresponding to position 48 in SEQ ID NO: 1), leucine for phenylalanine at position 91 (corresponding to position 75 in SEQ ID NO: 1), serine for asparagine at position 108 (corresponding to position 92 in SEQ ID NO: 1), glutamic acid for valine at position 133 (corresponding to position 117 in SEQ ID NO: 1), glycine for glutamic acid at position 137 (corresponding to position 121 in SEQ ID NO: 1) and serine for phenylalanine at position 187 (corresponding to position 171 in SEQ ID NO: 1), in the Fc-binding protein comprising the human FcγRIII extracellular domain listed as SEQ ID NO: 4.
(117) (1) A reaction mixture was prepared comprising the composition listed in Table 11, using plasmid pET-FcR9 (Japanese Unexamined Patent Publication No. 2016-169197) containing a polynucleotide (SEQ ID NO: 21) encoding FcR9 (SEQ ID NO: 20) constructed by the method described in Japanese Unexamined Patent Publication No. 2016-169197, as template DNA, an oligonucleotide comprising the sequence listed as SEQ ID NO: 2 (5′-TAATACGACTCACTATAGGG-3′) as the forward primer and an oligonucleotide comprising the sequence listed as SEQ ID NO: 22 (5′-CATTTTTGCTGCCMNNCAGCCCACGGCAGG-3′) as the reverse primer, and then PCR was conducted, by heat treatment of the reaction mixture at 95° C. for 2 minutes, 30 cycles of reaction where 1 cycle consisted of a first step at 95° C. for 30 seconds, a second step at 50° C. for 30 seconds and a third step at 72° C. for 90 seconds, and finally heat treatment at 72° C. for 7 minutes. The obtained PCR product was designated as V192p1.
(118) TABLE-US-00011 TABLE 11 Composition Volume Template DNA 2 μL 10 μM Forward primer 1 μL 10 μM Reverse primer 1 μL 5 × PrimeSTAR buffer 4 μL (Takara Bio, Inc.) 2.5 mM dNTPs 2 μL 2.5 U/μL PrimeSTAR HS 0.5 μL (Takara Bio, Inc.) H.sub.2O up to 20 μL
(119) (2) PCR was conducted by the same method as (1) above, except for using an oligonucleotide comprising the sequence listed as SEQ ID NO: 23 (5′-CCTGCCGTGGGCTGNNKGGCAGCAAAAATG-3′) as the forward primer and an oligonucleotide comprising the sequence listed as SEQ ID NO: 3 (5′-TATGCTAGTTATTGCTCAG-3′) as the reverse primer, and the obtained PCR product was designated as V192p2.
(120) (3) A mixture of the V192p1 obtained in (1) and the V192p2 obtained in (2) as PCR products, was used to prepare a reaction mixture having the composition shown in Table 12, and the reaction mixture was then heat treated at 98° C. for 5 minutes, after which PCR was conducted by 5 cycles of reaction, where one cycle consisted of a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds and a third step at 72° C. for 1 minute, to obtain a PCR product V192p in which V192p1 and V192p2 were linked.
(121) TABLE-US-00012 TABLE 12 Composition Volume PCR product 1 μL each 2.5 U/μL PrimeSTAR HS 0.5 μL (Takara Bio, Inc.) 5 × PrimeSTAR buffer 4 μL (Takara Bio, Inc.) 2.5 mM dNTPs 2 μL H.sub.2O up to 20 μL
(122) (4) After preparing a reaction mixture with the composition shown in Table 13 using the V192p obtained in (3) as the PCR product, an oligonucleotide comprising the sequence listed as SEQ ID NO: 2 as the forward primer and an oligonucleotide comprising the sequence listed as SEQ ID NO: 3 as the reverse primer, the reaction mixture was heat treated at 98° C. for 5 minutes, and then PCR was conducted by 30 cycles of reaction, where one cycle consisted of a first step at 98° C. for 10 seconds, a second step at 55° C. for 5 seconds and a third step at 72° C. for 1 minute, to obtain a polynucleotide encoding Fc-binding protein having valine at position 192 of FcR9 (SEQ ID NO: 20) substituted with an arbitrary amino acid. The obtained polynucleotide was designated as V192p3.
(123) TABLE-US-00013 TABLE 13 Composition Volume PCR product 2 μL 10 μM Forward primer 2 μL 10 μM Reverse primer 2 μL 5 × PrimeSTAR buffer 10 μL (Takara Bio, Inc.) 2.5 mM dNTPs 4 μL 2.5 U/μL PrimeSTAR HS 1 μL (Takara Bio, Inc.) H.sub.2O up to 50 uL
(124) (5) The V192p3 obtained in (4) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli BL21 (DE3).
(125) (6) The obtained transformants were cultured on LB medium containing 50 μg/mL added kanamycin. Plasmids were extracted from the collected cells (transformants).
(126) (7) The polynucleotide encoding Fc-binding protein and its surrounding regions in the obtained plasmids was supplied for cycle sequencing reaction using a BigDye Terminator v3.1 Cycle Sequencing Kit (product of Life Technologies Corp.) based on the chain terminator method, and the nucleotide sequence was analyzed with a fully automatic DNA sequencer, Applied Biosystems 3130 Genetic Analyzer (product of Life Technologies Corp.). For the analysis, an oligonucleotide comprising the sequence listed as SEQ ID NO: 2 or SEQ ID NO: 3 was used as the sequencing primer.
(127) As a result of the sequence analysis, transformants were obtained expressing Fc-binding proteins in which valine at position 192 of Fc-binding protein FcR9 (SEQ ID NO: 20) was substituted with alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan or tyrosine.
Reference Example 2: Measurement of Binding Activity of Fc-Binding Protein for IgG
(128) (1) Among the transformants obtained in Reference Example 1, the transformants expressing Fc-binding proteins in which the amino acid residue at position 192 of FcR9 (SEQ ID NO: 20) (position 176 in SEQ ID NO: 1) was substituted with isoleucine (hereunder indicated as Val192Ile), alanine (hereunder indicated as Val192Ala) or tyrosine (hereunder indicated as Val192Tyr) were each inoculated onto 2 mL of 2YT liquid medium containing 50 μg/mL kanamycin, and precultured overnight at 37° C. by aerobic shake culture.
(129) (2) This preculturing solution was inoculated at 0.2 mL into 20 mL of 2YT liquid medium (16 g/L peptone, 10 g/L yeast extract and 5 g/L sodium chloride) containing 50 μg/mL added kanamycin, and aerobically shake cultured at 37° C.
(130) (3) At 1.5 hours after the start of culturing, the culturing temperature was lowered to 20° C. and shake culturing was continued for 30 minutes. Next, IPTG ((isopropyl-β-thiogalactopyranoside) was added to a final concentration of 0.01 mM, and aerobic shake culturing was continued overnight at 20° C.
(131) (4) Upon completion of culturing, the cells were collected by centrifugal separation and a BugBuster Protein extraction kit (product of Takara Bio, Inc.) was used to prepare a protein extract.
(132) (5) The antibody-binding activity of the Fc-binding protein was measured by the ELISA method described below.
(133) (5-1) A gammaglobulin preparation (by Kaketsuken) as the human antibody, was added to and immobilized in the wells of a 96-well microplate at 1 μg/well (at 4° C. overnight), and then blocking was performed by addition of 20 mM Tris-HCl buffering solution (pH 7.4) containing 2% (w/v) SKIM MILK (product of BD Co.) and 150 mM sodium chloride to the wells.
(134) (5-2) After rinsing with wash buffer (20 mM Tris-HCl buffer (pH 7.4) containing 0.05% (w/v) Tween 20 and 150 mM NaCl), a solution containing Fc-binding protein for evaluation of the antibody-binding activity was added, and reaction was conducted between the Fc-binding protein and the immobilized gammaglobulin (at 30° C. for 1 hour).
(135) (5-3) Upon completion of the reaction, it was rinsed with wash buffer, and Anti-6His antibody (product of Bethyl Laboratories) diluted to 100 ng/mL was added at 100 μL/well.
(136) (5-4) Reaction was conducted at 30° C. for 1 hour, and after rinsing with wash buffer, TMB Peroxidase Substrate (product of KPL) was added at 50 μL/well. Coloration was stopped by adding 1 M phosphoric acid at 50 μL/well, and the absorbance at 450 nm was measured with a microplate reader (product of Tecan).
(137) (6) The expression level of the Fc-binding protein obtained by the method of (5) above was calculated based on the binding activity of the obtained Fc-binding protein for IgG.
(138) The results are shown in Table 14. The Fc-binding protein expression levels per 1 L of culture solution were 130.6 mg, 21.7 mg and 14.6 mg by the respective transformants expressing FcR9_I (SEQ ID NO: 24) as the Fc-binding protein containing the amino acid substitution Val192Ile, FcR9_A (SEQ ID NO: 26) as the Fc-binding protein containing the amino acid substitution Val192Ala, and FcR9_Y (SEQ ID NO: 28) as the Fc-binding protein containing the amino acid substitution Val192Tyr.
(139) The amino acid sequence of FcR9_I as the Fc-binding protein examined for this Reference Example is listed as SEQ ID NO: 24, and the sequence of the polynucleotide encoding FcR9_I is listed as SEQ ID NO: 25. In SEQ ID NO: 24, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position 27 to methionine (Met) at position 32 is a linker sequence, the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is a polypeptide with the amino acid substitution Val192Ile in the amino acid sequence from glycine (Gly) at position 33 to glutamine (Gln) at position 208 of FcR9 (SEQ ID NO: 20), the region of glycine (Gly) from position 209 to position 210 is a linker sequence, and the region of histidine (His) from position 211 to position 216 is the tag sequence. The isoleucine of Val192Ile is also present at position 192 in SEQ ID NO: 24.
(140) The amino acid sequence of FcR9_A as the Fc-binding protein examined for this Reference Example is listed as SEQ ID NO: 26, and the sequence of the polynucleotide encoding FcR9_A is listed as SEQ ID NO: 27. Incidentally, SEQ ID NO: 26 is the same sequence as SEQ ID NO: 24, except that the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is a polypeptide with the amino acid substitution Val192Ala in the amino acid sequence from glycine (Gly) at position 33 to glutamine (Gln) at position 208 of FcR9 (SEQ ID NO: 20). The alanine of Val192Ala is also present at position 192 in SEQ ID NO: 26.
(141) The amino acid sequence of FcR9_Y as the Fc-binding protein examined for this Reference Example is listed as SEQ ID NO: 28, and the sequence of the polynucleotide encoding FcR9_Y is listed as SEQ ID NO: 29. Incidentally, SEQ ID NO: 28 is the same sequence as SEQ ID NO: 24, except that the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is a polypeptide with the amino acid substitution Val192Tyr in the amino acid sequence from glycine (Gly) at position 33 to glutamine (Gln) at position 208 of FcR9 (SEQ ID NO: 20). The tyrosine of Val192Tyr is also present at position 192 in SEQ ID NO: 28.
(142) TABLE-US-00014 TABLE 14 Fc-binding protein Expression level Reference Amino acid [mg/L (culture Example Name substitution solution)] Reference FcR9_I Val192Ile 130.6 Example 2 FcR9_A Val192Ala 21.69 FcR9_Y Val192Tyr 14.60 Reference FcR9 — 1.387 Example 3 Reference FcR9_F Val192Phe 0.263 Example 4 FcR9_R Val192Arg 0.254 FcR9_L Val192 Leu 0.192 FcR9_N Val192Asn 0 FcR9_D Val192Asp 0 FcR9_C Val192Cys 0 FcR9_Q Val192Gln 0 FcR9_E Val192Glu 0 FcR9_G Val192Gly 0 FcR9_H Val192His 0 FcR9_K Val192Lys 0 FcR9_M Val192Met 0 FcR9_P Val192Pro 0 FcR9_S Val192Ser 0 FcR9_T Val192Thr 0 FcR9_W Val192Trp 0
Reference Example 3
(143) This was carried out in the same manner as Reference Example 2, except for using transformants expressing the Fc-binding protein FcR9 (SEQ ID NO: 20) disclosed in Japanese Unexamined Patent Publication No. 2016-169197 (PTL 3) as the transformants.
(144) The results are shown in Table 14. The expression level of the Fc-binding protein per 1 L of culture solution was 1.4 mg. These results show that transformants expressing Fc-binding protein having the amino acid substitution Val192Ile, Val192Ile or Val192Tyr introduced into FcR9 have vastly increased expression levels compared to transformants expressing FcR9.
Reference Example 4
(145) This was carried out in the same manner as Reference Example 2, except for using transformants expressing Fc-binding proteins having the amino acid residue at position 192 of FcR9 (SEQ ID NO: 20) (position 176 in SEQ ID NO: 1) replaced with phenylalanine (hereunder indicated as Val192Phe), arginine (hereunder indicated as Val192Arg), leucine (hereunder indicated as Val192Leu), asparagine (hereunder indicated a Val192Asn), aspartic acid (hereunder indicated as Val192Asp), cysteine (hereunder indicated as Val192Cys), glutamine (hereunder indicated as Val192Gln), glutamic acid (hereunder indicated as Val192Glu), glycine (hereunder indicated as Val192Gly), histidine (hereunder indicated as Val192His), lysine (hereunder indicated as Val192Lys), methionine (hereunder indicated as Val192Met), proline (hereunder indicated as Val192Pro), serine (hereunder indicated as Val192Ser), threonine (hereunder indicated as Val192Thr) or tryptophan (hereunder indicated as Val192Trp) as the transformants.
(146) The results are shown in Table 14. The expression levels of the Fc-binding proteins per 1 L of culture solution were all zero or <1 mg.
Reference Example 5: Evaluation of Binding Affinity Between Fc-Binding Protein and IgG1
(147) (1) Of the transformants obtained in Reference Example 1, the transformants expressing FcR9_I (SEQ ID NO: 24) or FcR_A (SEQ ID NO: 26) were each inoculated onto 100 mL of 2YT liquid medium containing 50 μg/mL kanamycin and precultured overnight at 37° C. by aerobic shake culture.
(148) (2) This preculturing solution was inoculated at 10 mL into 1000 mL of 2YT liquid medium (16 g/L peptone, 10 g/L yeast extract and 5 g/L sodium chloride) containing 50 μg/mL added kanamycin, and aerobically shake cultured at 37° C.
(149) (3) At 1.5 hours after the start of culturing, the culturing temperature was lowered to 20° C. and shake culturing was continued for 30 minutes. Next, IPTG was added to a final concentration of 0.01 mM, and aerobic shake culturing was continued overnight at 20° C.
(150) (4) Upon completion of culturing, the cells were collected by centrifugal separation and suspended in buffer (20 mM Tris-HCl buffer containing 150 mM NaCl (pH 7.4)) and subjected to ultrasonic disruption. The supernatant was then collected by centrifugal separation.
(151) (5) The collected supernatant was passed through a column packed with Ni Sepharose6 Fast Flow (GE Healthcare) and thoroughly washed with wash buffer (20 mM Tris-HCl buffer containing 150 mM NaCl (pH 7.4)), after which it was eluted with elution buffer (20 mM Tris-HCl buffer containing 150 mM NaCl and 500 mM imidazole (pH 7.4)) and the elution fraction was recovered.
(152) (6) The elution fraction recovered in (5) was passed through a column packed with IgG Sepharose6 Fast Flow (GE Healthcare) and thoroughly washed with wash buffer (20 mM Tris-HCl buffer containing 150 mM NaCl (pH 7.4)), after which it was eluted with elution buffer (100 mM glycine buffer containing (pH 3.0)) and the elution fraction was recovered.
(153) (7) The affinity between IgG1 and each Fc-binding protein recovered as the elution fraction in (6) was evaluated by the surface plasmon resonance method. For measurement of the affinity using the surface plasmon resonance method, a Biacore T100 (GE Healthcare) was used as the measuring apparatus, a Sensor Chip CMS (GE Healthcare) was used as the sensor chip and Biacore T100 Evaluation Software (GE Healthcare) was used as the analysis software.
(154) (8) An Amine Coupling Kit (GE Healthcare) was used for flow of a solution comprising IgG1 (product of Sigma-Aldrich) diluted with HBS-EP (GE Healthcare) on a sensor chip immobilizing the Fc-binding protein, to obtain a sensorgram. Curve fitting was carried out based on the sensorgram to calculate the affinity for IgG1.
(155) The results of calculating the affinity for IgG1 are shown in Table 15. In Table 15, a lower K.sub.D value (dissociation constant) indicates higher affinity (binding affinity). The K.sub.D values of FcR9_I (SEQ ID NO: 24) and FcR9_A (SEQ ID NO: 26) were 6.0×10.sup.−8 M and 3.6×10.sup.−8 M, respectively.
Reference Example 6
(156) This was carried out in the same manner as Reference Example 5, except for using transformants expressing the Fc-binding protein FcR9 (SEQ ID NO: 20) disclosed in Japanese Unexamined Patent Publication No. 2016-169197 (PTL 3) as the transformants.
(157) The results of calculating the affinity for IgG1 are shown in Table 15. The K.sub.D value of FcR9 was 7.7×10.sup.−8 M, which was affinity equivalent to FcR9_I (SEQ ID NO: 24) and FcR9_A (SEQ ID NO: 26). This suggests that FcR9_I and FcR9_A, as forms of the Fc-binding protein of the invention, similar to FcR9, can be used as antibody adsorbents for process analysis and separation in the production of an antibody drug, by immobilization on an insoluble support.
(158) TABLE-US-00015 TABLE 15 Binding Binding Fc-binding protein rate rate Dissociation Reference Amino acid constant ka constant kd constant K.sub.D Example Name substitution [1/Ms] [1/s] [M] Reference FcR9_I Val192Ile 2.0 × 10.sup.5 1.2 × 10.sup.−2 6.0 × 10.sup.−8 Example 5 FcR9_A Val192Ala 1.0 × 10.sup.5 3.5 × 10.sup.−3 3.6 × 10.sup.−8 Reference FcR9 — 4.1 × 10.sup.5 3.1 × 10.sup.−2 7.7 × 10-.sup.−8 Example 6 Reference FcR9_F Val192Phe 0.9 × 10.sup.5 3.0 × 10.sup.−1 3.3 × 10.sup.−6 Example 7
Reference Example 7
(159) This was carried out in the same manner as Reference Example 5, except for using transformants expressing Fc-binding protein (FcR_F), having phenylalanine substituting for valine at position 192 of FcR9 (SEQ ID NO: 20) (position 176 in SEQ ID NO: 1), as the transformants.
(160) The results of calculating the affinity for IgG1 are shown in Table 15. The K.sub.D value of FcR9_F was 3.3×10.sup.−6 M, thus confirming that it has lower affinity than the Fc-binding proteins of the invention, FcR9_I (SEQ ID NO: 24) and FcR_A (SEQ ID NO: 26), as well as FcR9 (SEQ ID NO: 20).