Non-entomophilous tomato yellow leaf curl virus

09670465 ยท 2017-06-06

Assignee

Inventors

Cpc classification

International classification

Abstract

An object of the present invention is to provide a novel method of controlling TYLCV whereby the infection cycle of TYLCV can be broken. The present invention provides a novel virus that is not transmitted by an insect vector as a tomato yellow leaf curl virus. The present invention also provides a method of controlling a tomato yellow leaf curl disease and a method of preventing transmission of a yellow leaf curl virus by using a tomato yellow leaf curl virus not transmitted by an insect vector.

Claims

1. A tomato yellow leaf curl virus not transmitted by an insect vector, wherein said virus comprises the nucleotide sequence of SEQ ID NO:2.

2. The virus according to claim 1, wherein the insect vector is whitefly Bemisia tabaci (Gennadius).

3. A nucleic acid containing the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:5.

4. A method of controlling tomato yellow leaf curl disease by inoculating a yellow leaf curl disease tolerant tomato with the virus according to claim 1.

5. A method of preventing transmission of yellow leaf curl virus by inoculating a yellow leaf curl disease tolerant tomato with the virus according to claim 1.

6. An isolated plasmid comprising the nucleotide sequence of SEQ ID NO:4.

7. The isolated plasmid of claim 6, wherein said isolated plasmid encodes the polypeptide sequence of SEQ ID NO:7.

8. An isolated plasmid deposited at the National Institute of Advanced Industrial Science and Technology International Patent Organism Depository, Central 6, 1-1 Higashi 1-chome, Tsukuba-shi, Ibaraki Prefecture, Japan, said isolated plasmid having the deposit number of FERM BP-11450.

9. An isolated plasmid comprising the nucleic acid of claim 3.

10. An isolated plasmid comprising the nucleic acid of claim 3, wherein the nucleic acid contains the nucleotide sequence of SEQ ID NO:2.

11. An isolated plasmid comprising the nucleic acid of claim 3, wherein the nucleic acid contains the nucleotide sequence of SEQ ID NO:5.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows the results of agarose gel electrophoresis in a TYLCV assay test.

(2) FIG. 2 shows with underlines the amino acids in a TYLCV amino acid sequence that are different from those of other strains. Amino acids of isolates 17G, 10-1, mix8-2, Nagasaki, Omura (Eustoma), and Miyazaki are included as SEQ ID NOs:20-25.

(3) FIG. 3 shows with underlines the amino acids in the amino acid sequence of the TYLVC Rep region that are different from those of other strains. Amino acids of isolates 17G, 10-1, mix8-2, Nagasaki, Omura (Eustoma), and Miyazaki are included as SEQ ID NOs:26-31.

(4) FIG. 4 shows multiple sequence alignment results for the amino acid sequence of the CP region.

DESCRIPTION OF EMBODIMENTS

(5) Embodiments of the present invention are explained in detail below. The present invention is not limited to the following embodiments, and can be implemented with various modifications within the scope of its gist.

(6) The present invention relates to a tomato yellow leaf curl virus that is a virus not mediated by an insect vector.

(7) In the present invention, the term tomato yellow leaf curl virus (TYLCV) means a virus belonging to the genus Begomovirus in the Geminiviridae family, and having a single-segment genome of circular single-stranded DNA, with the viral particles being double particles comprising two linked spheres each 20 nm in diameter.

(8) The TYLCV genome has sequences coding for MP, CP, REn, TrAP, Rep and C4 proteins, with CP being a coat protein that envelopes the DNA of the virus, and is therefore involved in virus infection and insect-borne transmission.

(9) TYLCV occurs principally in the Middle East, North and Central America, Southeast Asia and East Asia (Japan and China). Primarily two strains of TYLCV occur in Japan: TYLCV Israel strain, which occurs in Kyushu and Kanto region (beginning with an isolated strain discovered in Nagasaki), and Israel mild strain, which occurs in Tokai and Kanto regions.

(10) In the present invention, the term insect vector means an insect capable of transmitting a plant virus from one individual plant to another. The term transmitting a plant virus here means not only cases in which symptoms of viral infection appear in a plant in which the plant virus was not originally confirmed, but also cases in which infection of a plant by the plant virus can be confirmed by genetic analysis or the like even if the plant does not exhibit any symptoms.

(11) In the present invention, as described in the examples, infection of a tomato by TYLCV can be verified by the TC-PCR method.

(12) An example of an insect vector that transmits the tomato yellow leaf curl virus includes Bemisia tabaci.

(13) Several types of Bemisia tabaci occur in Japan, but mainly there are two widespread types, the Bemisia tabaci biotype B (previously referred to as silverleaf whitefly; hereinafter occasionally referred to as Bemisia tabaci B) and Bemisia tabaci Q.

(14) Reports up to now have shown no difference in insect-mediation for transmitting TYLCV between Bemisia tabaci B and Bemisia tabaci Q (Kitamura et al., Proc. Kansai Pl. Prot. Vol. 51, pp. 81-83, 2009). Bemisia tabaci Q is more pesticide tolerant than Bemisia tabaci B.

(15) TYLCV is transmitted by Bemisia tabaci. It can also be transmitted by grafting tomato plants infected with TYLCV, but is not transmitted by ovarian transmission, contact transmission, seed transmission, soil transmission, mechanical inoculation with infected leaf sap or the like.

(16) Thus, transmission of TYLCV in tomatoes becomes a problem of transmission by insect vectors such as Bemisia tabaci in actual cultivation facilities, and a new method of controlling tomato yellow leaf curl disease could be provided if transmission by the insect vector could be controlled. A new control method is provided by the tomato yellow leaf curl virus discovered in the present invention, which is not transmitted by an insect vector.

(17) In the present invention, the term not transmitted by an insect vector (non insect-mediated) means that a tomato yellow leaf curl virus is not transmitted by an insect vector from a tomato infected with a tomato yellow leaf curl virus to a tomato that is susceptible to a tomato yellow leaf curl virus but does not carry that virus (hereinafter occasionally referred to as test tomato) during seedling period. Specifically, being non insect-mediated can be verified as follows. Bemisia tabaci that does not carry TYLCV is allowed to feed on a TYLCV-infected tomato, and is collected after it has fed. A test tomato plant is prepared in a separate isolation case, and said Bemisia tabaci is released inside said isolation case and allowed to feed on the test tomato. Said Bemisia tabaci is then collected and is confirmed to carry TYLCV, and while the test tomato is raised and the absence of TYLCV infection in the test tomato is confirmed during the seedling period.

(18) The non insect-mediated tomato yellow leaf curl virus (non insect-mediated TYLCV) of the present invention is an virus that is obtainable by screening viruses that are not transmitted by an insect vector, by first allowing the insect vector to feed and then testing for transmission of the virus.

(19) The non insect-mediated TYLCV of the present invention is preferably a virus having DNA represented by the nucleotide sequence of SEQ ID NO:1. It may also be a virus having DNA represented by the nucleotide sequence of SEQ ID NO:2, which is obtained as a chimera clone. In the present invention, such nucleotide sequence may include nucleotide sequences with substitutions, deletions, additions or the like in SEQ ID NO:1 and SEQ ID NO:2 as long as it is capable of encoding the necessary proteins encoded by the nucleotide sequences of SEQ ID NO:1 and SEQ ID NO:2 in the same way.

(20) Because the non insect-mediated TYLCV of the present invention is not transmitted by an insect vector, a tomato carrying said non insect-mediated TYLCV has the advantage of not being a source of infection by a virus.

(21) Moreover, the benefits of the non insect-mediated TYLCV of the present invention can be exploited to advantage in yellow leaf curl disease tolerant tomatoes.

(22) In the present invention, the term yellow leaf curl disease tolerant tomato (hereinafter occasionally referred to as tolerant tomato) means a tomato having a tolerant gene that cannot prevent TYLCV infection, but is capable of suppressing symptoms of tomato yellow leaf curl disease caused by TYLCV.

(23) Examples of tolerant genes include Ty-1, Ty-2, Ty-3, Ty-3a, Ty-4 and Ty-5.

(24) A tolerant tomato may be a tomato of a wild strain that has acquired a tolerant gene naturally, a tomato having a tolerant gene introduced by hybridization, or a tomato having a tolerant gene introduced by genetic recombination techniques.

(25) Specific examples of tolerant tomatoes include TY Momotaro Sakura, TY Momotaro Arc, Shurei, TY Chie, TY Chika, AEGEAN. In a tolerant tomato, the tolerant gene may be introduced with homo- or hetero-zygous condition.

(26) A tolerant tomato refers to one in which symptoms of tomato yellow leaf curl disease are absent or slight even with TYLCV infection due to the presence of a tolerant gene that can suppress symptoms of tomato leaf curl disease caused by TYLCV. Slight symptoms here refer to condition in that leaf size is normal, the leaf margins are slightly rounded, and the leaf color is green as usual. Severe symptoms refer to condition in that leaf becomes small, leaf tips are curled towards the back, and the leaf has turned yellow.

(27) Because tolerant tomatoes may carry TYLCV even though symptoms of tomato yellow leaf curl disease are absent or slight, TYLCV can be transmitted from a tolerant tomato to another TYLCV-susceptible tomato by means of an insect vector if the tolerant tomato carries the TYLCV. Moreover, the fact that the symptoms of tomato yellow leaf curl disease are absent or slight in tolerant tomatoes makes it impossible to disrupt infection cycle of TYLCV by removing TYLCV-infected plants at an early stage.

(28) Thus, TYLCV control methods using tolerant tomatoes may not be sufficiently effective with respect to TYLCV susceptible tomatoes.

(29) When a tolerant tomato is infected with virulent TYLCV (TYLCV that produces severe symptoms in TYLCV susceptible tomatoes), even though the symptoms are generally absent or slight, the virulent TYLCV itself proliferates inside the tomato body, and if an insect vector such as Bemisia tabaci visits the plant, it can transmit the virulent TYLCV to another tomato.

(30) That is, the plant may become a source of contamination for secondary TYLCV infection, and this has delayed the adoption of tolerant tomatoes. If tolerant tomatoes are inoculated in advance with the non insect-mediated TYLCV of the present invention, however, at least this non insect-mediated TYLCV will not be transmitted to other tomatoes.

(31) Moreover, although the mechanism is unknown, the present invention provide a advantageous effect that if a tolerant tomato is inoculated in advance with non insect-mediated TYLCV, even if a Bemisia tabaci insect vector carrying virulent insect-mediated TYLCV subsequently comes into contact with the tolerant tomato that has been inoculated in advance with the non insect-mediated TYLCV, the virulent insect-mediated TYLCV carried by said Bemisia tabaci will not infect the tolerant tomato that has been inoculated with the non insect-mediated TYLCV, and will not be secondarily transmitted by insect-mediation from the tolerant tomato that has been inoculated with the non insect-mediated TYLCV to another TYLCV susceptible tomato.

(32) The non insect-mediated TYLCV of the present invention is a novel and superior virus that can compensate for the weakness of tolerant tomatoes, namely that they are a source of contamination for secondary infection, and that can provide a new control method as a method of controlling plant viruses. The present invention also provides a combination of non insect-mediated TYLCV with a tolerant tomato.

(33) With the non insect-mediated TYLCV of the present invention, it is possible to reduce the use of pesticides and the use of materials to prevent physical incursion when cultivating tolerant tomatoes, allowing tomatoes to be cultivated safely and with less labor. It is also expected that by cultivating a certain number of tolerant tomatoes infected with the non insect-mediated TYLCV of the present invention, it will be possible to effectively prevent the spread of TYLCV in that region. Moreover, if the tomatoes inoculated with the non insect-mediated TYLCV of the present invention are tolerant tomatoes, fruit yields will be little affected because symptoms of non insect-mediated TYLCV are absent or slight. In addition, because the non insect-mediated TYLCV of the present invention is not transmitted by an insect vector, it will not be transmitted to other tomatoes and cause symptoms of TYLCV infection.

(34) Thus, TYLCV that is not transmitted by an insect vector is a novel virus, and the effect of preventing virulent TYLCV transmission in tolerant tomatoes is one that has not been achieved in the past.

(35) The present invention also provides a nucleic acid containing the nucleotide sequence of SEQ ID NO:1, which is isolated from the non insect-mediated virus. The present invention also provides a nucleic acid containing the nucleotide sequence of SEQ ID NO:2, which is isolated from a chimera clone.

(36) The present invention also provides nucleic acids containing SEQ ID NO:4 encoding CP as a partial sequence in the nucleotide sequence of SEQ ID NO:1 and SEQ ID NO:5 encoding CP as a partial sequence in the nucleotide sequence of SEQ ID NO:2.

(37) The claimed nucleotide sequences of the nucleic acids of the present invention may be nucleotide sequences having one or more nucleotides deleted, added and/or substituted therein to the extent that this is not contrary to the gist of the present invention, and are preferably DNA having the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:5. When these nucleic acids are RNA, however T (thymine, shown as t in the sequence tables) becomes U (uracil) in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:5. Apart from ATGCU, bases that are equivalent to ATGCU may also be included in the nucleotide sequences represented by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:5, and equivalent bases may include those obtained by substituting or modifying the base part of ATGCU. The sugar part of the nucleic acid may also be substituted or modified as long as it is equivalent to ribose or deoxyribose.

(38) The present invention also provides nucleic acids containing nucleotide sequences complementary to the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:5. Although the nucleotide sequences of these nucleic acids are nucleotide sequences complementary to the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:5, they may be nucleotide sequences having one or more nucleotides deleted, added and/or substituted therein to the extent that this is not contrary to the gist of the present invention, and are preferably DNA or RNA having nucleotide sequences complementary to the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:5.

(39) The nucleotide sequence of SEQ ID NO:1 corresponds to the entire base sequence of the isolated strain 17G. The nucleotide sequence of SEQ ID NO:2 corresponds to the entire base sequence of the chimera clone. The chimera clone, which is described in detail in the examples, comprises the entire base sequence (SEQ ID NO:3) of ISR10-1, isolated as the TYLCV Israel Kumamoto virulent isolated strain from a farm in Kumamoto Prefecture, with mutations that change the A of base No. 705 to G, the A of base No. 906 to T and the G of base No. 979 to T.

(40) When used in combination with a tolerant tomato, the non insect-mediated TYLCV of the present invention can prevent the tolerant tomato from becoming a source of TYLCV infection, and prevent secondary TYLCV infection of TYLCV susceptible tomatoes from tolerant tomatoes. Moreover, a tolerant tomato that has been infected in advance with non insect-mediated TYLCV does not become a source of further infection by virulent insect-mediated TYLCV even when subsequently exposed to virulent insect-mediated TYLCV, thereby preventing the occurrence of tomato yellow leaf curl disease in TYLCV susceptible tomatoes.

(41) Non insect-mediated TYLCV is maintained by grafting or by propagation by cuttings. Graft inoculation of tomatoes with non insect-mediated TYLCV can be accomplished at any stage of tomato growth, but is preferably done after 2 to 6 true leaves have appeared in order to achieve efficient grafting and subsequent infection with the non insect-mediated TYLCV.

(42) A lateral shoot can be used as tomatoes infected with non insect-mediated TYLCV, and the presence of the virus was satisfactorily confirmed in the lateral shoot with two true leaves or more.

EXAMPLES

(43) The present invention is explained in more detail below using examples, but the scope of the invention is not limited to these examples.

(44) <Maintenance Control of TYLCV>

(45) The tomato yellow leaf curl virus (TYLCV) used in the examples was a virus isolated in Kumamoto Prefecture. Maintenance control of TYLCV was accomplished by infecting tomatoes (House Momotaro, Reiyo, Shurei, etc.) with the isolated TYLCV and keeping then in an environment of 10 to 30 C. Successive generations of TYLCV were obtained by successively propagating lateral shoots (side shoots) of the tomatoes infected with TYLCV.

(46) <Testing for TYLCV>

(47) DNA was extracted by the tube capture (hereinafter referred to as TC) method as an easy DNA extraction method. PCR was performed with the extracted DNA as a template to verify whether or not a plant was infected with TYLCV. Specifically, the TC-PCR method was performed as follows.

(48) First, 100 mg to 1 g of TYLCV infected leaves were prepared, and ground in 5 to 20 times of its volume of extraction buffer (0.05 M carboxylic acid buffer, 0.01M phosphate buffer or 0.01M TRIS buffer). 1.5 mL of the sap was placed in a microtube, and kept for 30 minutes to overnight at 4 C. to room temperature. The sap in the microtube was discarded, and the tube was rinsed with TE buffer (0.01M TRIS, 0.001M EDTA) or 0.01M phosphate buffer or the like, after which sterile water was added to obtain a TYLCV DNA extract.

(49) One L of this DNA extract was taken and subjected to PCR in accordance with the methods of a Promega GoTaq Green Master Mix. PCR was performed in 35 cycles each consisting of 50 seconds at 95 C., 50 seconds at 56 C. and 45 seconds at 72 C. using the primers:

(50) TABLE-US-00001 TYPRB2F: (SEQIDNO:10) 5CCCTCTGGAATGAAGGAACA and TYC-R: (SEQIDNO:11) 5-TTGAAAAATTGGRCTCTCAA,
which are matched to regions that are relatively stable among isolated strains of TYLCV, to thereby amplify the target region. Following PCR, the target DNA was confirmed by 1.2% agarose gel electrophoresis. The results are shown in FIG. 1.

(51) <Selection and Stability Confirmation of Non Insect-Mediated TYLCV>

(52) A virus-free TYLCV-susceptible tomato variety (House Momotaro, Takii & Co., Ltd.) was infected by graft inoculation with several isolated strains of TYLCV that were isolated in Kumamoto Prefecture and were confirmed by agarose gel electrophoresis to have infected tomatoes.

(53) After TC-PCR to confirm that each isolated strain had thoroughly infected the susceptible tomato, the tomatoes were placed individually in isolation cases, and hundreds of virus-free Bemisia tabaci B (obtained in Chiba Prefecture) were released and allowed to feed for 3 days.

(54) Next, Bemisia tabaci B were collected, each of 10 new virus-free TYLCV-susceptible tomatoes (House Momotaro, hereinafter occasionally referred to as test tomato) were separately placed in the isolation case, and 10 to 20 of the Bemisia tabaci B were released per test tomato. After being allowed to feed for 3 days, the Bemisia tabaci B were collected. After collection, the test tomatoes were raised for 45 days. The presence or absence of TYLCV transmission was verified by TC-PCR three times during the raising period for each of the 10 test tomatoes.

(55) The same experiment was performed using a TYLCV Israel Kumamoto virulent isolated strain (hereinafter referred to as TYLCV-Isr) as a control test. The results are shown in Table 1. Data for some of the isolated strains is given for the isolated strain group.

(56) TABLE-US-00002 TABLE 1 Control test group Isolated strain group TYLCV-Isr 17G 21G 30G 48G 76G group Number of 0/10 10/10 10/10 9/10 7/10 18/20 transmission (plants/ plants) Transmission 0 100 100 90 70 90 rate (%)

(57) As a result, while the transmission rate of TYLCV was 90% in the control test group, in the case of 17G of the isolated strain group all of the 10 test tomatoes were TYLCV negative (infection rate 0%), showing that 17G TYLCV was not transmitted at all by Bemisia tabaci B.

(58) To verify the stability of the non insect-mediated TYLCV obtained from 17G, lateral shoots were taken from one 17G infected susceptible tomato and planted to propagate 8 tomato plants over the course of 5 months, and the non insect-mediation of each was evaluated in the same way by TC-PCR. The results are shown in Table 2.

(59) TABLE-US-00003 TABLE 2 Control test group Isolated strain (17G) group TYLCV-Isr (1) (2) (3) (4) (5) (6) (7) (8) group Transmission 0/10 0/10 0/10 0/10 0/10 0/10 0/10 0/10 18/20 number (plants/plants) Transmission 0 0 0 0 0 0 0 0 90 rate (%)

(60) As a result, none of 17G derived from the above 8 tomato plants infected with 17G and propagated separately was transmitted by Bemisia tabaci B. Thus, 17G retained stably non insect-mediation even after 5 months during which the tomatoes were divided by cutting propagation.

(61) A total of 90 test tomatoes were used in all the 17G TYLCV insect-mediation evaluation tests, and the 17G TYLCV was not insect-mediated by Bemisia tabaci in any of the 90 tomatoes (transmission rate: 0%=0/90). Such non insect-mediated TYLCV has not previous been reported, and has now been obtained for the first time anywhere in the world.

(62) The entire DNA sequence of the resulting 17G non insect-mediated TYLCV was inserted into a pCAMBIA2300 (Cambia Co.) agrobacterium binary vector, and was accepted as a plasmid (pCAM17G1) on Nov. 2, 2010 by the National Institute of Advanced Industrial Science and Technology International Patent Organism Depositary, assigned the Receipt No. FERM-AP22037, and assigned the Accession No. FERM P-22037 on Dec. 3, 2010.

(63) The plasmid (pCAM17G1) was prepared specifically as follows.

(64) Because TYLCV is a circular single-stranded DNA virus, at least 2 of IR region (bases No. 1 to 306) in the TYLCV genome must be inserted into a plasmid when constructing an infectious clone plasmid. We therefore adopted the method of placing one additional IR region at the end of the full-length sequence.

(65) As shown by SEQ ID NO:1, 17G non insect-mediated TYLCV has 2774 bases in the form of single-stranded circular DNA with base No. 1 and base No. 2774 linked together. To construct a 17G infectious clone plasmid, bases Nos. 2769 (passing through 2774/1) to 1187 were amplified by PCR using 17G DNA as the template.

(66) PCR was performed using a forward primer comprising a HindIII restriction enzyme site added to the No. 2769 side:

(67) TABLE-US-00004 TY-1F-HIN: (SEQIDNO:12) 5-TATAAGCTTAGGCATGTTGAAATGAATCGG,
and a reverse primer containing a SphI restriction enzyme site:

(68) TABLE-US-00005 TY-1R-SPH: (SEQIDNO:13) 5-GATTAGAGGCATGCGTACATG.

(69) The resulting PCR amplified product was cleaved with the restriction enzymes HindIII and SphI, to obtain a DNA fragment having an IR region at the forward side (hereinafter referred to as DNA fragment A). The DNA fragment A was inserted into the HindIII and SphI cleavage sites of a pUC19 cloning vector (hereinafter referred to as Clone 1).

(70) Next, to prepare a DNA fragment having an IR region at the backward side (hereinafter referred to as DNA fragment B), bases No. 1170 to 334 (passing through 2774/1) were amplified by PCR using 17G viral DNA as the template.

(71) PCR was performed using a forward primer containing a SphI restriction enzyme site:

(72) TABLE-US-00006 TY-2F-SPH: (SEQIDNO:14) 5-GTACGCATGCCTCTAATCCAG,
and a reverse primer comprising a BamHI site added to the No. 334 side:

(73) TABLE-US-00007 TY-2R-BAM: (SEQIDNO:15) 5-ATGGATCCGAAACTCATTAAGAAGTGGGTC.

(74) The resulting PCR amplified product was cleaved with the restriction enzymes SphI and BamHI, to obtain a DNA fragment B. The DNA fragment B was inserted into the SphI and BamHI cleavage sites of the Clone 1 (hereinafter referred to as the Clone 2).

(75) As a result, a (roughly 3.1 kb) sequence was inserted between the HindIII and BamHI cleavage sites of the Clone 2, comprising DNA fragments A and B linked together, and consisting of bases Nos. 2769 to 2774, 1 to 2774 and an additional 1 to 334 to thereby provide an additional IR region at the backward side of the full-length sequence.

(76) Next, the Clone 2 was treated with the restriction enzymes HindIII and BamHI to excise the roughly 3.1 kb DNA fragment. The excised DNA fragment was inserted into the agrobacterium binary vector pCAMBIA2300 (Cambia Co.), to obtain a 17G infectious clone plasmid (pCAM17G1) (accession No. FERM P22037).

(77) The plasmid pCAM17G1 was assigned the Receipt No. FERM-AP22037 on Dec. 3, 2010 upon domestic deposit at the National Institute of Advanced Industrial Science and Technology International Patent Organism Depositary (Central 6, 1-1 Higashi 1-chome, Tsukuba-shi, Ibaraki Prefecture, Japan), and based on FERM P-22037 deposited on Nov. 2, 2010 (domestic receipt date), a transfer request was then accepted for deposit based on the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, and on Jan. 20, 2012 the plasmid was assigned the receipt number FERM BP-11450 for international accession based on the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.

(78) Plants were infected with this plasmid by the agroinfiltration method, the virus was expressed, and retention of non insect-mediation was confirmed.

(79) The agroinfiltration method is explained below. The plasmid (pCAM17G1) was mixed with Agrobacterium tumefacience, and the mixture was immersed for 5 minutes in a 37 C. water bath to introduce the plasmid into the agrobacterium. This was then cultured on LB agar medium containing kanamycin, and the resulting colony was cultured in LB liquid medium, and centrifuged. The precipitate was shaken in LB liquid medium containing kanamycin, and the resulting suspension containing cell bodies was injected with a syringe into two tomato leaves, 0.5 mL per leaf, to infect the tomato with 17G. This tomato was cultivated in an growth chamber for 2 weeks (25 C. constant, 16/8 hour light/dark cycle), and the virus was detected. Bemisia tabaci were allowed to feed on the tomato, and the same Bemisia tabaci were then allowed to feed on a virus-free test tomato to confirm retention of non insect-mediation. This plasmid and 17G have been maintained in storage by the applicants, and furnishings in accordance with the provisions of Article 27(3) of the Japanese Patent Law Enforcement Regulations are guaranteed by the applicants.

(80) The nucleotide sequence inserted into the deposited plasmid is the nucleotide sequence represented by SEQ ID NO:1. Being an infectious clone plasmid, a sequence consisting of bases Nos. 2769 to 2774, 1 to 2774 and 1 to 334 linked together to thereby provide an additional IR region at the backward side of the full-length DNA represented by SEQ ID NO:1 has been inserted into the plasmid.

(81) <Nucleotide Sequence of Non Insect-Mediated TYLCV>

(82) The nucleotide sequence of 17G non insect-mediated TYLCV was determined (SEQ ID NO:1) with a direct sequencing kit (Applied Biosystem BigDye Terminator v3.1 Cycle Sequencing Kit) and a 3500 Genetic Analyzer sequencer, using a combination of the primers UPV1

(83) TABLE-US-00008 SEQIDNO:16) (KSGGGTCGACGTCATCAATGACGTTRTAC: and PAV1c715 SEQIDNO:17) (GATTTCTGCAGTTDATRTTYTCRTCCATCCA: andacombinationof theprimersTY-ext01 SEQIDNO:18) (AGTATTGTCATTGAGGGTGATAGCAG: and TY-ext02 SEQIDNO:19) (GCCCATGTAAAGTCCAGTCTTATGAGC:.

(84) <Non Insect-Mediated TYLCV can Prevent Secondary Transmission of Virulent TYLCV>

(85) Virus-free tolerant tomatoes were infected with the 17G non insect-mediated TYLCV by grafting.

(86) The presence of TYLCV in the plant bodies of the tolerant tomatoes was confirmed by TC-PCR.

(87) Next, 200 of Bemisia tabaci B that had previously acquired TYLCV-Isr from separately-prepared TYLCV-Isr infected tomatoes were released for 5 days with the 17G infected tolerant tomatoes (this treatment is referred to as challenge inoculation).

(88) Next, the Bemisia tabaci B was collected, and 8 weeks after the challenge inoculation, virus-free Bemisia tabaci B was released with the 17G infected tolerant tomatoes and allowed to feed for 5 days, after which the Bemisia tabaci B was collected and released for 5 days 20 of the Bemisia tabaci B per plant with 20 virus-free susceptible tomatoes (this treatment is referred to secondary transmission).

(89) After 5 days, the Bemisia tabaci B was killed, the susceptible tomatoes were grown for 35 days, and TYLCV infection was investigated by TC-PCR.

(90) As a control test group, challenge inoculation of virus-free tolerant tomatoes by TYLCV-Isr was performed without infecting the tomatoes with 17G non insect-mediated TYLCV. The results are shown in Table 3.

(91) TABLE-US-00009 TABLE 3 17G Control test group group (untreated) Transmission number 0/36 34/36 (plants/plants) Secondary 0 94.4 transmission rate (%)

(92) When the susceptible tomatoes were analyzed after having been grown for 35 days following secondary transmission, the transmission rate was 94.4% (34/36) in the control group, but in the 17G group there was absolutely no TYLCV-Isr transmission, with all the plants testing negative for an transmission rate of 0% (0/36). This shows that when tolerant tomatoes are infected in advance with the 17G isolated strain, they are not subsequently infected by insect-mediated virulent TYLCV even when Bemisia tabaci carrying the insect-mediated virulent TYLCV are brought into contact with and allowed to feed on the infected tolerant tomatoes infected in advance with the 17G, nor is there any secondary transmission of the insect-mediated virulent TYLCV to other virus-free susceptible tomatoes.

(93) As mentioned above, with TYLCV, interference such as prevention of transmission of other insect-mediated TYLCV has not been reported before.

(94) <Preparation of Insect-Mediated Clone Plasmid>

(95) An insect-mediated ISR10-1 infectious clone plasmid was prepared by methods similar to those used in preparing the 17G non insect-mediated TYLCV infectious clone plasmid except that pR1909 (Takara Bio) was used as the agrobacterium binary vector.

(96) Using the isolated strain TYLCV-Isr (ISR10-1), which was isolated from tomatoes on a farm in Kumamoto Prefecture and has been confirmed to be insect-mediated, a roughly 3.1 kb DNA fragment consisting of the string of bases Nos. 2769 to 2774, 1 to 2774 and an additional 1 to 334 of ISR10-1 was inserted into the HindIII and BamHI cleavage sites of the agrobacterium binary vector pR1909 (Takara Bio) to obtain an ISR10-1 infectious clone plasmid.

(97) <Preparation of Chimera Clone Plasmid>

(98) Synthetic DNA comprising HindIII and SphI sites added to the termini of synthetic DNA homologous to the sequence from the HindIII site to base No. 1178 (SphI site) of the ISR10-1 infectious clone plasmid, and having G substituted for the A of base No. 705, T for the A of base No. 906 and T for the G of base No. 979, was cleaved with the restriction enzymes HindIII and SphI, and inserted into the HindIII and SphI cleavage sites of the ISR10-1 infectious clone plasmid to prepare a chimera clone plasmid.

(99) That is, the chimera clone had substitutions for three amino acids of the coat protein (CP) of the insect-mediated ISR10-1, namely, arginine (CGA) substituted for the No. 80 glutamine (CAA), phenylalanine (TTT) for the No. 147 tyrosine (TAT), and asparagine (AAT) for the No. 171 lysine (AAG).

(100) The resulting chimera clone plasmid was deposited internationally as pRI-ISR10-1chimera705-906-979 based on the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, received at the National Institute of Advanced Industrial Science and Technology International Patent Organism Depositary (Central 6, 1-1 Higashi 1-chome, Tsukuba-shi, Ibaraki Prefecture, Japan) on Jan. 30, 2012, and assigned the Receipt No. FERM ABP-11465.

(101) <Non Insect-Mediation of Chimera Clone>

(102) Tomatoes were inoculated with the resulting chimera clone plasmid by the agroinfiltration method using techniques similar to those described above, and non insect-mediation was confirmed as follows.

(103) Three weeks after inoculation with the chimera clone plasmid, systemic infection was confirmed by TC-PCR. Those chimera clone-infected tomatoes that were confirmed to be systemically infected (virus acquisition source) were placed in isolation cases, and 300 to 400 virus-free Bemisia tabaci Q were released and allowed to acquisition feed for 5 days.

(104) The Bemisia tabaci Q acquired the chimera clone were collected, each of 10 new test tomatoes was separately prepared in isolation case, and 20 to 30 of Bemisia tabaci Q were released per test tomato. These were allowed to feed for 5 days, and the Bemisia tabaci Q was collected and killed. After collection, the test tomatoes were raised for 35 days. During the raising period, each of the 10 tomatoes was checked 3 times by TC-PCR for transmission by the chimera clone.

(105) As a control test group, tomatoes infected with insect-mediated ISR10-1 were used as the virus acquisition source in a similar test. The results are shown in Table 4.

(106) TABLE-US-00010 TABLE 4 Control test Chimera clone group inoculation group ISR10-1 Transmission number 0/10 10/10 (plants/plants) Transmission rate (%) 0 100

(107) As a result, while all 10 of the tomatoes in the control test group were TYLCV positive, for the transmission rate of 100% (10/10), in the chimera clone inoculation group all of the 10 test tomatoes were TYLCV negative (0/10), showing that the chimera clone having three amino acid residues peculiar to non insect-mediated TYLCV substituted in the CP gene coding region of TYLCV is not transmitted at all by Bemisia tabaci Q.

(108) This shows that the insect-mediation of insect-mediated ISR10-1 is eliminated by substituting three residues in the CP gene coding region of TYLCV, namely arginine for the No. 80 glutamine, phenylalanine for the No. 147 tyrosine and asparagine for the No. 171 lysine, so it can be seen that these sites are involved in non insect-mediation.

(109) Bemisia tabaci was applied to tomatoes infected with insect-mediated ISR10-1 and the chimera clone, and allowed to acquisition feed for 5 days, 10 of Bemisia tabaci were sampled randomly from each tomato after 3 days of acquisition feeding, and the virus retention rates were investigated. As a result, it was found that 10/10 (100%) of the Bemisia tabaci still carried TYLCV in all cases.

(110) <Relationship Between CP Region Mutations and Non Insect-Mediation>

(111) When the nucleotide sequences of the CP regions of Geminiviridae including TYLCV recorded in GenBank, EMBL, DDBJ and PDB, specifically the Nagasaki strain, Omura (Eustoma) strain, Miyazaki strain, mix8-2 strain (an insect-mediated clone isolated as an Israel strain other than ISR10-1) and ISR10-1, were compared with the CP region of the non insect-mediated 17G, it was shown that the amino acids Nos. 80, 147 and 171 mentioned above were peculiar to 17G alone (FIG. 2, FIG. 3). In FIG. 2, the amino acids that are different from those of other strains are shown with underlines.

(112) In general, these Geminiviridae viruses are reported to be insect-transmitted, and this suggests that amino acid mutations of the CP region are involved in non insect-mediation.

(113) There appears to be a very close association between mutations of the CP region and non insect-mediation of TYLCV, and it has been confirmed that insect-mediated TYLCV strain can be converted to non insect-mediated by substituting amino acids of the CP region. FIG. 4 shows the results of multiple sequencing alignment of the amino acid sequences of the CP regions of 17G, ISR10-1 and the chimera clone.

(114) As discussed above, in the present invention, since it appears that three amino acids of the CP region of TYLCV are involved in insect-mediation, it was thought that TYLCV comprising the DNA represented by the nucleotide sequences of SEQ ID NO:4 and SEQ ID NO:5 encoding the CP region would have the property of non insect-mediation, and that TYLCV having a peptide with an amino acid sequence represented by SEQ ID NO:7 or SEQ ID NO:8 would also have the property of non insect-mediation.

(115) TYLCV having a peptide with an amino acid sequence represented by SEQ ID NO:7 or SEQ ID NO:8 with one or more amino acids deleted, added and/or substituted therein is also included in the scope of the present invention as long as TYLCV having the property of non insect-mediation can be provided thereby.

(116) Moreover, TYLCV having arginine (80), phenylalanine (147) and asparagine (171) as amino acids of the coat protein (CP) is also included in the scope of the present invention as a non insect-mediated virus. These three amino acids do not necessarily have to be located exactly at the Nos. 80, 147 and 171 positions of the CP region, and a virus having an amino acid sequence in which the corresponding amino acids are arginine, phenylalanine and asparagine when aligned by known methods by a person skilled in the art is also included in the scope of the present invention. Moreover, structurally similar amino acids may also be substituted for the arginine (80), phenylalanine (147) and asparagine (171) as long as the function of non insect-mediation retained in the virus. The arginine (80), phenylalanine (147) and asparagine (171) are described as R80, F147 and N171 using single-letter nomenclature. In the present invention, TYLCV having the three amino acids R80, F147 and N171 in the coat protein is a non insect-mediated virus as long as the function of the coat protein is not lost. In the present invention, non insect-mediated TYLCV having arginine (80), phenylalanine (147) and asparagine (171) as amino acids in the viral coat protein may be a virus having R80, F147 and N171 as mutations corresponding to Q80R, Y147F and K171N in the CP protein of insect-mediated TYLCV, or may be a virus that is not derived from insect-mediated TYLCV having Q80, Y147 and K171 exactly, but in which the corresponding amino acids are arginine, phenylalanine and asparagine as a result of alignment.

CROSS-REFERENCE TO RELATED APPLICATIONS

(117) The present application is based on a Japanese Patent Application submitted on Feb. 4, 2011 (Japanese Patent Application No. 2011-023199), the content of which is herein incorporated by reference

SEQUENCE TABLE FREE TEXT

(118) SEQ ID NO: 1 shows the entire nucleotide sequence of the isolated strain 17G.

(119) SEQ ID NO: 2 shows the entire nucleotide sequence of a non insect-mediated chimera clone obtained from TYLCV-Isr (ISR10-1).

(120) SEQ ID NO: 3 shows the entire nucleotide sequence of TYLCV-Isr (ISR10-1).

(121) SEQ ID NO: 4 shows the entire nucleotide sequence of the CP region of the isolated strain 17G.

(122) SEQ ID NO: 5 shows the entire nucleotide sequence of the CP region of a non insect-mediated chimera clone obtained from TYLCV-Isr (ISR10-1).

(123) SEQ ID NO: 6 shows the entire nucleotide sequence of the CP region of TYLCV-Isr (ISR10-1).

(124) SEQ ID NO: 7 shows the amino acid sequence of the CP region of the isolated strain 17G.

(125) SEQ ID NO: 8 shows the amino acid sequence of the CP region of a non insect-mediated chimera clone obtained from TYLCV-Isr (ISR10-1).

(126) SEQ ID NO: 9 shows the amino acid sequence of the CP region of TYLCV-Isr (ISR10-1).

(127) SEQ ID NO: 10 shows the nucleotide sequence of the TC-PCR primer TYPRB2F used in an assay test of TYLCY. SEQ ID NO:2 corresponds to bases Nos. 1040 to 1059 of TYLCV-Ng (Nagasaki strain).

(128) SEQ ID NO: 11 shows the nucleotide sequence of the TC-PCR primer TYC-R used in an assay test of TYLCY. SEQ ID NO: corresponds to bases Nos. 1814 to 1796 of TYLCV-Ng.

(129) SEQ ID NO: 12 shows the nucleotide sequence of the forward primer TY-1F-HIN, corresponding to bases Nos. 2769 to 15 of 170 with the HindIII sequence added to the 5 side, which was used to amplify bases 2769 to 1187 by PCR using viral DNA of 17G as the template.

(130) SEQ ID NO: 13 shows the nucleotide sequence of the reverse primer TY-1R-SPH, corresponding to bases Nos. 1187 to 1167 of 170, which was used to amplify bases 2769 to 1187 by PCR using viral DNA of 170 as the template.

(131) SEQ ID NO: 14 shows the nucleotide sequence of the forward primer TY-2F-SPH, corresponding to bases Nos. 1170 to 1190 of 170, which was used to amplify bases 1170 to 334 by PCR using viral DNA of 17G as the template.

(132) SEQ ID NO: 15 shows the nucleotide sequence of the reverse primer TY-2R-BANS, corresponding to bases Nos. 334 to 313 of 170 with the BamHI sequence added to the 5 side, which was used to amplify bases 1170 to 334 by PCR using viral DNA of 170 as the template.

(133) SEQ ID NO: 16 shows the nucleotide sequence of primer UPV1 used in determining the nucleotide sequence of the non insect-mediated TYLCV.

(134) SEQ ID NO: 17 shows the nucleotide sequence of the primer PAV1c715 used in determining the nucleotide sequence of the non insect-mediated TYLCV.

(135) SEQ ID NO: 18 shows the nucleotide sequence of the primer TY-ext01 used in determining the nucleotide sequence of the non insect-mediated TYLCV.

(136) SEQ ID NO: 19 shows the nucleotide sequence of the primer TY-ext02 used in determining the nucleotide sequence of the non insect-mediated TYLCV.