Pan-yeast autonomously replicating sequence

09670495 ยท 2017-06-06

Assignee

Inventors

Cpc classification

International classification

Abstract

A DNA sequence that functions as an origin in many different yeast species. From 1 to 17 mutations can be introduced into this sequence to improve its function across multiple yeasts. The resulting synthetic DNA sequence confers stable plasmid replication function in all yeast species tested, including but not limited to Saccharomyces cerevisiae, Lachancea kluyveri, Kluyveromyces lactis, Kluyveromyces wickerhammii, Hansenula polymorpha, and Pichia pastoris. Also provided are sequences that function as an optimal origin in the industrially useful Pichia pastoris.

Claims

1. A recombinant or synthetic nucleic acid molecule selected from the group consisting of SEQ ID NO:1-3, 5-10 and SEQ ID NO:12-19, wherein the nucleic acid molecule includes one or more mutations relative to the corresponding wild type sequence (SEQ ID NO: 11-13, or 16), and wherein the one or more mutations are selected from the optional bases of SEQ ID NO:1-3, 5, 14-15, and 17-18.

2. The nucleic acid molecule of claim 1, which comprises SEQ ID NO: 1 and wherein the nucleic acid sequence contains at least 2 mutations selected from the optional bases presented in SEQ ID NO: 1 relative to the corresponding wild type sequence shown in SEQ ID NO: 10.

3. The nucleic acid molecule of claim 1, which is SEQ ID NO: 6 or 7.

4. The nucleic acid molecule of claim 1, which is SEQ ID NO: 5 and wherein the nucleic acid sequence contains at least 2 mutations selected from the optional bases presented in SEQ ID NO: 5 relative to the corresponding wild type sequence shown in SEQ ID NO: 13.

5. The nucleic acid molecule of claim 1, which is SEQ ID NO: 9 or 19.

6. A plasmid comprising the nucleic acid molecule of claim 1.

7. A yeast cell comprising the nucleic acid molecule of claim 1.

8. The yeast cell of claim 7, which is a member of the genera consisting of Saccharomyces, Lachancea, Kluyveromyces, and Pichia (Komagataella).

9. The yeast cell of claim 7, which is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces bayanus, Saccharomyces paradoxus, Lachancea kluyveri, Lachancea waltii, Kluyveromyces lactis, Kluyveromyces wickerhammii, Hansenula polymorpha, Pichia pastoris, and Naumovozyma castellii.

10. The yeast cell of claim 9, which is Pichia pastoris, and wherein the nucleic acid molecule is SEQ ID NO: 9 or 19.

11. A method of producing stable plasmid replication in a yeast cell, the method comprising transforming the plasmid of claim 6 into the yeast cell.

12. The method of claim 11, wherein the yeast cell is a member of the genera consisting of Saccharomyces, Lachancea, Kluyveromyces, and Pichia (Komagataella).

13. The method of claim 11, wherein the yeast cell is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces bayanus, Saccharomyces paradoxus, Lachancea kluyveri, Lachancea waltii, Kluyveromyces lactis, Kluyveromyces wickerhammii, Hansenula polymorpha, Pichia pastoris, and Naumovozyma castellii.

14. The method of claim 13, wherein the yeast cell is Pichia pastoris, and wherein the nucleic acid molecule is SEQ ID NO: 9 or 19.

15. A method of enhancing plasmid replication in a yeast cell, the method comprising transforming the plasmid of claim 6 into the yeast cell.

16. The method of claim 15, wherein the yeast cell is a member of the genera consisting of Saccharomyces, Lachancea, Kluyveromyces, and Pichia (Komagataella).

17. The method of claim 15, wherein the yeast cell is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces bayanus, Saccharomyces paradoxus, Lachancea kluyveri, Lachancea waltii, Kluyveromyces lactis, Kluyveromyces wickerhammii, Hansenula polymorpha, Pichia pastoris, and Naumovozyma castellii.

18. The method of claim 17, wherein the yeast cell is Pichia pastoris, and wherein the nucleic acid molecule is SEQ ID NO: 9 or 19.

19. A method of producing a shuttle vector for use in multiple species of yeast, the method comprising introducing the nucleic acid molecule of claim 1 into a plasmid.

20. The method of claim 19, wherein the plasmid is pRS406.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIGS. 1A-1C. The function of panARS in different budding yeast species. FIG. 1A: The ARS-less URA3 vector pRS406 and its counterpart bearing the panARS sequence (pIL20) were used to transform ura3 strains of different budding yeast species. Transformations were plated on agar plates lacking uracil. The growth of URA3 colonies indicates ARS activity conferred by the panARS plasmid (right side of each plate) and not by the empty vector (left side of each plate). FIG. 1B: Relative coordinates of recovered functional subfragments of panARS in different species. FIG. 1C: Plasmid loss assays were performed on indicated yeast species transformed with plasmids bearing the wildtype panARS sequence (ARS) or the optimized mutant allele of panARS (OPT). Plasmid loss per generation of growth in non-selective medium is shown (y axis) with error bars representing standard deviations between at least four replicate experiments. Increased plasmid loss is indicative of weaker ARS function and decreased plasmid stability. Bars represent, from left to right, of S. cerevisiae, ARS & OPT, S. paradoxus, ARS & OPT, S. bayanus, ARS & OPT, L. waltii, ARS & OPT, L. kluyveri, ARS & OPT, K. wickerhamii, ARS & OPT, K. lactis, ARS & OPT, and P. pastoris, ARS & OPT, respectively.

(2) FIGS. 2A-2B. Comparison of ARS Consensus motifs and panARS sequences. FIG. 2A: Phylogenetic relationships and previously published ACS motifs are shown for S. cerevisiae (Broach et al. 1983; Liachko et al. 2013), L. waltii (Di Rienzi et al. 2012), L. kluyveri (Liachko et al. 2011), and K. lactis (Liachko et al. 2010). FIG. 2B: The sequences of the native (ARS; SEQ ID NO: 12) and optimized (OPT; SEQ ID NO: 7) panARS elements are shown. The region highlighted between the lines represents the only significant match to the K. lactis ACS within the minimal functional region of the panARS. The region highlighted with lighter shading represents a strong match to the K. lactis ACS outside of the main functional region. The region highlighted with darker shading represents the best match to the S. cerevisiae/L. waltii/L. kluyveri ACS motifs. Functional ARS sequence determinants in other species are not yet known. The mutations introduced into the optimized version of ARS are indicated by lowercase letters.

(3) FIGS. 3A-3B. Plasmid loss rates in Pichia pastoris. FIG. 3A: The P. pastoris strain was transformed with plasmid pRS316 and a derivative of pRS406 bearing PARS1. Plasmid loss rates are shown for these, as well as wt and optimized panARS plasmids for comparison. FIG. 3B: One-tailed two-sample T-tests were performed on data from plasmid loss assays. The resulting P-values are listed as a table.

(4) FIGS. 4A-4D. Mapping of replication origins in P. pastoris. FIG. 4A: Schematic of ARS-seq and miniARS-seq screens. Fragmented genomic DNA was ligated into non-replicating URA3 vectors and screened for ARS activity followed by deep sequencing of the resultant plasmid inserts (ARS-seq, top). ARS-seq plasmid inserts were amplified and sheared using DNase I. Short fragments of ARSs were ligated into the URA3 vectors and screened for ARS activity followed by deep sequencing of the plasmid inserts (miniARS-seq, bottom). FIG. 4B: The GC-ACS motif identified by the MEME algorithm (SEQ ID NO: 64). FIG. 4C: The distribution of MAST motif scores of the best match to the GC-ACS in every PpARS. FIG. 4D: 2D gel analysis at loci A2772 (putative AT-ARS at chromosome 1: 2,772 kb) and C379 (putative GC-ARS at chromosome 3: 379 kb). The arrows highlight arcs corresponding to replication bubble intermediates.

(5) FIG. 5. The GC-ACS is required for GC-ARS function. Wild type (WT) and mutant (MUT) alleles of the twelve ARSs indicated were cloned into a URA3 ARS-less vector and used to transform ura3 yeast on selective medium plates lacking uracil. Plates were grown at 30 for five days before pictures were taken. Colony formation indicates plasmid maintenance and ARS activity. The GC-ACS was positioned <15 bp away from the 5 endpoint in all ARS sequences. The sequences of the fragments tested are provided in the accompanying Sequence Listing (SEQ ID NO: 20-59).

(6) FIGS. 6A-6C. Deep mutational scanning of P. pastoris ARSs. FIG. 6A: Schematic of the mutARS-seq deep mutational scanning experiment. Auxotrophic ura3 yeast were transformed with a library of mutant ARS variants and competed in selective medium. The abundance of different ARS variants was determined by deep sequencing at intervals during competitive growth. FIG. 6B: Results of mutARS-seq of ARS-C379. The relevant sequence of ARS-C379 (SEQ ID NO: 13) is shown with the best match to the GC-ACS motif (SEQ ID NO: 64) underlined (and a 3 constrained dinucleotide also underlined). The log-transformed enrichment ratio is shown for each nucleotide at each position along the sequence. FIG. 6C: Results of mutARS-seq of ARS-A2772 (SEQ ID NO: 16). Same as in 6B, except that the motif logo (SEQ ID NO: 65) shown was constructed from the enrichment ratio scores post-analysis, whereas the motif shown in 6B was constructed from ARS alignments.

(7) FIG. 7. ARS-C379 mutARS-seq data during competitive growth. Data processed as described in Example 2 is shown as the average of two replicates for 12-, 24-, and 36-hour timepoints normalized against the same input sample. In each of the 3 upper panels, the y axis represents log.sub.2 (enrichment ratio), and the scale ranges from 4 to 0.8. Data are plotted on the same y-axis scale to aid visual comparison. Scatterplots show correlations between replicates of the same timepoint samples (lower panels; replicate 1 replicate 2). Lower left panel: y=0.7179x0.0131, R.sup.2=0.71383; lower middle panel: y=0.8805x0.0114, R.sup.2=0.92888; lower right panel: y=0.907x0.0149, R.sup.2=0.85484.

(8) FIG. 8. ARS-A2772 mutARS-seq data during competitive growth. Data processed as described in Example 2 is shown as the average of two replicates for 12-, 24-, and 36-hour timepoints normalized against the same input sample. In each of the 3 upper panels, the y axis represents log.sub.2 (enrichment ratio), and the scale ranges from 6 to 3. Data are plotted on the same y-axis scale to aid visual comparison. Scatterplots show correlations between replicates of the same timepoint samples (lower panels; replicate 1 replicate 2). Lower left panel: y=2.1157x0.0727, R.sup.2=0.92077; lower middle panel: y=1.0045x0.0096, R.sup.2=0.96722; lower right panel: y=1.4792x0.0247, R.sup.2=0.92684.

(9) FIG. 9. Comparisons of mutARS-seq data during competitive growth. Averaged mutARS-seq data from 12-, 24-, and 36-hour timepoints are plotted as scatterplots. Upper panels, ARS-C379; lower panels, ARS-A2772. Left column plots 24 hrs vs. 12 hours; center plots 36 hrs vs. 24 hrs; right plots 36 hrs vs. 12 hrs. From left to right, upper panel: y=3.311x0.0147; R.sup.2=0.9011; y=1.3241x+0.0089, R.sup.2=0.95367; y=4.2908x0.0141, R.sup.2=0.8231; and lower panel: y=1.7831x+0.0449, R.sup.2=0.98634; y=0.9095x0.0126, R.sup.2=0.98574; y=1.6157x+0.0262, R.sup.2=0.96515.

(10) FIGS. 10A-10D. Replication timing of the P. pastoris genome. FIG. 10A: Genomic DNA from G1 and S phase cells was sheared and sequenced. Normalized S/G1 DNA copy ratios (in 1 kbp windows) were smoothed and plotted against chromosomal coordinates. Peaks correspond to positions of replication initiation. The profile of chromosome 4 is shown (all chromosomes are shown in Figure S6) with ARS locations indicated by open (AT-ARSs) and shaded (GC-ARSs) circles. Un-smoothed ratio data for one of the replicates is shown are grey. Coordinates of replication timing peaks are indicated by dashed vertical lines. FIG. 10B: The distributions of smoothed S/G1 ratio data. The distribution of all ratios (Genome) is shown adjacent to the distribution of values at bins containing midpoints of GC-ACSs (GC) or AT-ARSs (AT). Values for ARSs that have no other ARSs within 40 kb in both directions are shown on the right (isolated). FIG. 10C: The complete genomic ratio distribution is shown relative to distributions after removal of data within 60 kb ranges centered on AT-ARSs (AT), GC-ARSs (GC), or all ARSs (all ARS). FIG. 10D: For each ARS, the distance to the nearest replication peak was calculated. The ARS-peak distances are shown as distributions separately for GC-ARSs (darkest bars) and AT-ARSs (medium-tone bars). Peak distances from simulated random sets of loci are shown in light grey.

(11) FIG. 11. Replication profiles of all P. pastoris chromosomes. Replication timing profiles were computed as discussed (see FIG. 10) and are shown for all four P. pastoris chromosomes. Un-smoothed ratio data for one of the replicates is shown in grey. Locations of GC-ARSs and AT-ARSs are indicated by open and shaded circles respectively.

DETAILED DESCRIPTION OF THE INVENTION

(12) The present invention is based on the discovery and identification of a 452 bp K. lactis genomic fragment that retains ARS function in at least 10 budding yeast species with diverse ARS sequence requirements. This sequence (panARS) maps to coordinates 781040-781491 bp on chromosome F of the K. lactis genome (strain NRRL Y-1140 (Dujon et al. 2004)).

(13) To delineate the region of panARS required for function in each of the different species, we sheared the 452 bp ARS fragment and cloned a library containing ARS sub-fragments. This library was used to transform the different yeast species in order to identify sub-fragments of the ARS that retain function. Short ARS fragments isolated from this screen were also tested for function across multiple species. In this manner we were able to isolate the minimal region of the ARS that confers function across all species to a region near one end of the ARS (e.g., within positions 188-371 relative to the 452 bp fragment; see FIG. 1B). All species listed except P. pastoris were able to initiate replication with ARS sub-fragments in a region between relative positions 188-316. For ARS function, P. pastoris required ARS DNA fragments within relative coordinates 256-371 (FIG. 1b).

(14) In addition, we describe herein a synthetically optimized mutant version of this sequence that performs either equivalently to or better than the wild type sequence. Additionally, this module performs significantly better than other characterized ARS plasmids in P. pastoris, with a stability that resembles ARS/CEN plasmids in better-studied models. These results suggest that panARS provides an efficient ARS module in other related yeast species and a superior construct even when cross-species performance is not required.

(15) We further show that P. pastoris has two general classes of originsNT-rich origins resembling those of most other yeasts, and a novel, G/C-rich class, that appear more robust and are associated with promoters. P. pastoris is the first known species using two kinds of origins and the first known budding yeast to use a G/C-rich origin motif. Additionally, we describe herein synthetically optimized mutant versions of this sequence that perform better than the wild type sequence.

DEFINITIONS

(16) All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified. As used in this application, the following words or phrases have the meanings specified.

(17) The term nucleic acid or polynucleotide refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally-occurring nucleotides.

(18) As used herein, a heterologous molecule is not identical to the reference molecule, nor is it, in the context of polypeptides and polynucleotides, an adjacent native sequence with respect to the reference molecule. Heterologous molecules are not limited to polypeptides and polynucleotides. Representative examples of heterologous molecules for use in accordance with the invention include, but are not limited to, labels, small molecules, vectors, and attachment domains.

(19) As used herein, small molecule refers to a low molecular weight organic compound having a molecular weight of less than 2000 Daltons, in some embodiments less than 1000 Daltons, and in still other embodiments less than 500 Daltons or less. A small molecule is typically between about 300 and about 700 Daltons. In a typical embodiment, a small molecule for use with the invention binds with high affinity to a protein, nucleic acid molecule, or a polysaccharide and alters the activity or function of the biopolymer to which it binds. Such molecules include, for example, heterocyclic compounds, carboxylic compounds, sterols, amino acids, lipids, and nucleic acids.

(20) As used herein, vector means a construct, which is capable of delivering, and preferably expressing, one or more gene(s) or sequence(s) of interest in a host cell. Examples of vectors include, but are not limited to, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells. Optionally, the vector may include a selectable marker. Examples of selectable markers for use with plasmids of the invention include, but are not limited to, KanMX, HygB, NatMX, and Bleomycin.

(21) As used herein, expression control sequence means a nucleic acid sequence that directs transcription of a nucleic acid. An expression control sequence can be a promoter, such as a constitutive or an inducible promoter, or an enhancer. The expression control sequence is operably linked to the nucleic acid sequence to be transcribed.

(22) As used herein, a or an means at least one, unless clearly indicated otherwise.

(23) Autonomously Replicating Sequences

(24) Autonomously replicating sequences (ARSs) as described herein may be of any length. Typically, the ARS will be between 50 and 500 nucleotides in length, more typically about 100 to about 450 bp in length. Optionally, the ARS further includes flanking sequence to facilitate incorporation into a delivery construct or carrier. The ARSs listed in the table below are shown in a form that is suitable for incorporation into a plasmid. Those skilled in the art will appreciate that flanking sequence may be provided to facilitate the insertion process, such as restriction sites and/or short regions of homology.

(25) TABLE-US-00001 ARS(uppercaseiswildtype; SEQ lowercaseisoptimizingmutation)* IDNO: 188-371(ofthefull452bp)panARSwithoptional 1 basesindicatedateachof5mutationsites: ACTTTAATAATTA(G,t)TTTAATATTT(G,t)(T,g)TTCTA(T,a)220 ATAATGAC(A,t)TTTAATTAAAAAAGATAAAATATAAAAACAT260 CATAATAACTCACCAGAGGTTAAGAACAAAAAAACAAATTAGATATCTGC310 TAATCCAATATAGTTAAATCAATCTTTCCTTGGTATAATGGGTATATTAC360 ATATATTTCAA371 Full452bppanARSwithoptionalbasesindicated 2 ateachof17mutationsites: TCAACATCTTTGGATAATATCAGAATGAGAAAGAACAGATACGCAGTACG50 TTTTTTGGTGAGCTCTTTGCACTTCTTTAGTTCTTTCCATCAATATCAGT100 T(G,t)(C,t)TTA(T,a)(G,a)C(A,t)(C,t)TTA(T,g)GACTA120 A(T,a)A(T,g)TGATGTTTAACTTCAA(T,a)AT(C,g)TTTAAA150 (C,a)TTTTGTTCTTCCCGACGTTCATTAAGAATACTAATACAC190 TTTAATAATTA(G,t)TTTAATATTT(G,t)(T,g)TTCTA(T,a)220 ATAATGAC(A,t)TTTAATTAAAAAAGATAAAATATAAAAACAT260 CATAATAACTCACCAGAGGTTAAGAACAAAAAAACAAATTAGATATCTGC310 TAATCCAATATAGTTAAATCAATCTTTCCTTGGTATAATGGGTATATTAC360 ATATATTTCAAGGACCGACACTCCTACCAAATATCTAAAATTTACCATAT410 TAACATAACATGTATATAAACGTCAAATCATAATCAGCACTA452 188-316of452panARSwithoptionalbasesindicated 3 ateachof5mutationsites: ACTTTAATAATTA(G,t)TTTAATATTT(G,t)(T,g)TTCTA(T,a)220 ATAATGAC(A,t)TTTAATTAAAAAAGATAAAATATAAAAACAT260 CATAATAACTCACCAGAGGTTAAGAACAAAAAAACAAATTAGATATCTGC310 TAATCC316 256-371of452panARS: 4 AACAT260 CATAATAACTCACCAGAGGTTAAGAACAAAAAAACAAATTAGATATCTGC310 TAATCCAATATAGTTAAATCAATCTTTCCTTGGTATAATGGGTATATTAC360 ATATATTTCAA371 PpARSwithoptionalbasesindicatedateachof9 5 mutationsites(1.sup.stpositionoptional): (G)TTGGGA(A,t)TCGAACC(C,t)(A,t)(A,c)GA20 (C,t)C(T,g)(C,g)(T,a)C(C,g)CTTGCAAGGGGAGCGCGCTACCA50 ACTACGCCACACGCCCGAATAATACAAACTAGGATAATGGAGTAATTATA100 188-371(ofthefull452bp)panARSwitheachof 6 the5optimizingmutations: AC190 TTTAATAATTAtTTTAATATTTtgTTCTAaATAATGACtTTTAATTAAAA240 AAGATAAAATATAAAAACATCATAATAACTCACCAGAGGTTAAGAACAAA290 AAAACAAATTAGATATCTGCTAATCCAATATAGTTAAATCAATCTTTCCT340 TGGTATAATGGGTATATTACATATATTTCAA371 Full452bppanARSwithoptionalbasesindicatedwith 7 eachofthe17optimizingmutations: TCAACATCTTTGGATAATATCAGAATGAGAAAGAACAGATACGCAGTACG50 TTTTTTGGTGAGCTCTTTGCACTTCTTTAGTTCTTTCCATCAATATCAGT100 TttTTAaaCttTTAgGACTAAaAgTGATGTTTAACTTCAAaATgTTTAAA150 aTTTTGTTCTTCCCGACGTTCATTAAGAATACTAATACACTTTAATAATT200 AtTTTAATATTTtgTTCTAaATAATGACtTTTAATTAAAAAAGATAAAAT250 ATAAAAACATCATAATAACTCACCAGAGGTTAAGAACAAAAAAACAAATT300 AGATATCTGCTAATCCAATATAGTTAAATCAATCTTTCCTTGGTATAATG350 GGTATATTACATATATTTCAAGGACCGACACTCCTACCAAATATCTAAAA400 TTTACCATATTAACATAACATGTATATAAACGTCAAATCATAATCAGCAC450 TA452 188-316of452panARSwitheachofthe5 8 optimizingmutations: AC190 TTTAATAATTAtTTTAATATTTtgTTCTAaATAATGACtTTTAATTAAAA240 AAGATAAAATATAAAAACATCATAATAACTCACCAGAGGTTAAGAACAAA290 AAAACAAATTAGATAT316 PpARS-C379witheachofthe9optimizingmutations 9 (1.sup.stpositionoptional): (G)TTGGGAtTCGAACCttcGAtCggaCgCTTGCAAGGGGAGCGCGCTACCA50 ACTACGCCACACGCCCGAATAATACAAACTAGGATAATGGAGTAATTATA100 188-371(ofthefull452bp)panARSwildtypesequence: 10 ACTTTAATAATT200 AGTTTAATATTTGTTTCTATATAATGACATTTAATTAAAAAAGATAAAAT250 ATAAAAACATCATAATAACTCACCAGAGGTTAAGAACAAAAAAACAAATT300 AGATATCTGCTAATCCAATATAGTTAAATCAATCTTTCCTTGGTATAATG350 GGTATATTACATATATTTCAA371 Full452bppanARSwildtypesequence: 11 TCAACATCTTTGGATAATATCAGAATGAGAAAGAACAGATACGCAGTACG50 TTTTTTGGTGAGCTCTTTGCACTTCTTTAGTTCTTTCCATCAATATCAGT100 TGCTTATGCACTTATGACTAATATTGATGTTTAACTTCAATATCTTTAAA150 CTTTTGTTCTTCCCGACGTTCATTAAGAATACTAATACACTTTAATAATT200 AGTTTAATATTTGTTTCTATATAATGACATTTAATTAAAAAAGATAAAAT250 ATAAAAACATCATAATAACTCACCAGAGGTTAAGAACAAAAAAACAAATT300 AGATATCTGCTAATCCAATATAGTTAAATCAATCTTTCCTTGGTATAATG350 GGTATATTACATATATTTCAAGGACCGACACTCCTACCAAATATCTAAAA400 TTTACCATATTAACATAACATGTATATAAACGTCAAATCATAATCAGCAC450 TA452 188-316of452panARSwildtypesequence: 12 ACTTTAATAATT200 AGTTTAATATTTGTTTCTATATAATGACATTTAATTAAAAAAGATAAAAT250 ATAAAAACATCATAATAACTCACCAGAGGTTAAGAACAAAAAAACAAATT300 AGATATCTGCTAATCC316 PpARS-C379wildtypesequence(1.sup.stpositionoptional): 13 (G)TTGGGAATCGAACCCAAGACCTCTCCCTTGCAAGGGGAGCGCGCTACCA50 ACTACGCCACACGCCCGAATAATACAAACTAGGATAATGGAGTAATTATA100 PpARS-C379optimization: 14 TTGGGAATCGAACCCA(A,c)GA (C,t)C(T,g)(C,r)(T,a)C(C,g)(C,A)T(T,c) GCA(A,y)(G,a)(G,t)(G,y)G(A,y)GCGCG(C,a)TACCA ACTACGCCACAC(G,t)CCC(G,y)(A,c)(A,y)(T,c) (A,b)(A,c)TAC(A,y)A(A,g)(C,t)(T,a) (A,b)(G,h)(G,w)(A,k)(T,r)(A,k)(A,k)(T,r)(G,w)(G,h) (A,k)(G,h)(T,a)(A,y)(A,t)T(T,a)(A,t)(T,a)(A,t) PpARS-C379verybeneficialmutations: 15 TTGGGAATCGAACCCAAGACCTCTCCCTTGCAAGG(G,t)G(A,t)G CGCGCTACCAACTACGCCACACGCCCGAATA(A,c)TACAAACT (A,g)(G,a)(G,a)A(T,r)(A,g)(A,g)(T,g)(G,a) (G,a)(A,g)(G,w)(T,a)A(A,t)TTATA PpARS-A2772wildtype: 16 AGATATCGTGCGAATAAACATGAATGTTTCATATTTATCAATTACGCTC49 ACTATTAAATTGTGAGAATCATATTATAAATCATGCTATATATTTATTCT99 PpARS-A2772optimization: 17 (A,t)(G,t)ATAT(C,w)(G,t)T(G,w)CGAA(T,a)AAA(C,w) (A,t)T(G,t)(A,t)(A,s)T(G,y)T(T,a)T C(A,b)T(A,g)(T,s)(T,g)(T,a)(A,b)(T,a)(C,a) (A,k)(A,t)(T,r)(T,g)(A,k)(C,g)(G,c)C(T,g)(C,a) (A,g)(C,r)(T,v)(A,b)(T,v)(T,g)(A,s)(A,s)(A,b) (T,c)T(G,y)T(G,w)(A,c)(G,w)A(A,t)(T,a)(C,w) (A,t)(T,a)ATTATAAAT(C,w)(A,b)(T,a)(G,a)CTATA TATT(T,a)ATTC(T,g) PpARS-A2772verybeneficialmutations: 18 (A,t)(G,t)ATAT(C,w)(G,t)TGCGAA(T,a)AAA(C,w) AT(G,t)(A,t)AT(G,t)TTTC(A,k)TA(T,s)(T,r) T(A,y)(T,a)(C,a)AATT(A,k)C(G,c)C(T,g)(C,a) (A,g)(C,r)(T,r)(A,y)(T,r)T(A,s)(A,s)(A,c)T T(G,y)T(G,w)(A,c)(G,a)AAT(C,w)(A,t)(T,a) ATTATAAAT(C,w)(A,k)TGCTATATATT(T,a)ATTCT PpARS-A2772fullyoptimizedsequence: 19 tttTAaatTaCGAAaAAAatgttgatTaTCgTgggacaattagtgcCga49 gggtgggcccctcacaAtaataATTATAAATataaCTATATATTaATTCG99 *Each nucleic acid recited in these sequences may optionally be substituted with a non-natural derivative of the indicated nucleic acid. Where parentheses are provided, the upper case letter indicates an option that would correspond to wild type sequence, while the lower case letter indicates an optimizing or non-detrimental mutation. An individual sequence may be prepared with some or all, or any combination, of the indicated optional mutations.

(26) It is contemplated that, in some embodiments, where specifically indicated, the nucleic acid sequences of the present invention can comprise variants of SEQ ID NO: 1-19. It is contemplated that such variants have less than 100% sequence identity or similarity with the reference SEQ ID NO. In one embodiment, the variant will have a nucleotide sequence from about 75% to less than 100% nucleotide sequence identity or similarity with the nucleotide sequence of the reference SEQ ID NO., more preferably from about 80% to less than 100%, more preferably from about 85% to less than 100%, more preferably from about 90% to less than 100% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) and most preferably from about 95% to less than 100%, e.g., over the length of the variant molecule. Some variants will share 100% identity with contiguous adjacent nucleotides of the reference sequence, but will have a portion of the reference sequence omitted at either or both ends.

(27) The term percent identity, in the context of two or more nucleic acid sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent identity can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.

(28) For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

(29) Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).

(30) One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website.

(31) Polynucleotides of the invention comprise at least 50 consecutive nucleotides, typically at least about 100 consecutive nucleotides of a nucleic acid sequence shown in SEQ ID NO: 1-19. Polynucleotides that are fully complementary to any such sequences are also encompassed by the present invention. Polynucleotides may be single-stranded (coding or antisense) or double-stranded, and may be DNA or RNA molecules. Additional coding or non-coding sequences may, but need not, be present within a polynucleotide of the present invention, and a polynucleotide may, but need not, be linked to other molecules and/or support materials.

(32) Polynucleotides may be prepared using any of a variety of techniques known in the art, including, for example, oligonucleotide synthesis. Screening a prepared library with a selected probe may be conducted using standard procedures, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989).

(33) The oligonucleotide sequences selected as probes should be sufficiently long and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels, such as .sup.32P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are provided in Sambrook et al., supra.

(34) Polynucleotide variants may generally be prepared by any method known in the art, including chemical synthesis by, for example, solid phase phosphoramidite chemical synthesis. Modifications in a polynucleotide sequence may also be introduced using standard mutagenesis techniques, such as oligonucleotide-directed site-specific mutagenesis (see Adelman et al., DNA 2:183, 1983).

(35) Nucleotide sequences can be joined to a variety of other nucleotide sequences using established recombinant DNA techniques. For example, a polynucleotide may be cloned into any of a variety of cloning vectors, including plasmids, phagemids, lambda phage derivatives and cosmids. Vectors of particular interest include plasmids, such as pRS400, pRS40H, pRS40N, pRS40B, pBR322, pIL07 and pIL13, pRS406 and it's derivatives pIL19 and pIL22. Other elements will depend upon the desired use, and will be apparent to those of ordinary skill in the art.

(36) Methods

(37) In one embodiment, the invention provides a method of producing stable plasmid replication in a yeast cell. Also provided is a method of enhancing plasmid replication in a yeast cell. The method comprises transforming a plasmid comprising a nucleic acid molecule of the invention into the yeast cell. The methods comprise transforming a plasmid comprising a nucleic acid molecule of the invention into the yeast cell. The nucleic acid molecule is typically selected from SEQ ID NO: 1-19. In one embodiment, the yeast cell is a member of the genera consisting of Saccharomyces, Lachancea, Kluyveromyces, and Pichia (Komagataella). In some embodiments, the yeast cell is selected from the group consisting of Saccharomyces cerevisiae, Saccharomyces bayanus, Saccharomyces paradoxus, Lachancea kluyveri, Lachancea waltii, Kluyveromyces lactis, Kluyveromyces wickerhammii, Hansenula polymorpha, Pichia pastoris, and Naumovozyma castellii. In one embodiment, the yeast cell is Pichia pastoris, and the nucleic acid molecule is SEQ ID NO: 9 or 19. Alternatively, the nucleic acid molecule is one of SEQ ID NO: 14, 15, 17, or 18. In one embodiment, the method of enhancing plasmid replication in a yeast cell is performed in a yeast cell that is not K. lactis, S. cerevisiae, or L. kluyveri.

(38) The invention additionally provides a method of producing a shuttle vector for use in multiple species of yeast. The method comprises introducing a nucleic acid molecule of the invention into a plasmid. The plasmid is typically selected from pRS400, pRS40H, pRS40N, pRS40B, pBR322, pIL07 and pIL13, pRS406 and its derivatives pIL19 and pIL22. The vector can optionally include a selectable marker. In some embodiments, the insertion sites are the unique BamHI or the unique AatlI restriction site in these plasmids.

(39) Also described herein is a method of producing an optimized autonomous replicating sequence (ARS). The method comprises generating a library of mutagenized wild type ARSs; growing yeast containing the mutagenized ARSs on selective media; measuring the growth rate of the mutagenized ARSs relative to wild type ARSs; and identifying those mutagenized ARSs that grow at a faster rate on selective media relative to wild type ARS as optimized ARSs. The above method can further comprise sequencing the mutagenized ARSs to identify the mutations the effect the optimization of the ARS.

(40) Kits

(41) For use in the methods described herein, kits are also within the scope of the invention. Such kits can comprise a carrier, package or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in the method. For example, the container(s) can comprise a nucleic acid molecule that is, optionally, detectably labeled. Optionally, included in the same or a separate container, the kit comprises a vector attached or to be attached to the nucleic acid molecule. The kit can also include one or more containers for a reporter-means bound to a detectable label, e.g., an enzymatic, florescent, or radioisotope label for use in monitoring the nucleic acid molecule. The kit can include all or part of a nucleic acid sequence described herein, or a vector or host cell that includes the nucleic acid sequence described herein.

(42) The kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. In addition, a label can be provided on the container to indicate that the composition is used for a specific therapeutic or non-therapeutic application, and can also indicate directions for use, such as those described above. Directions and or other information can also be included on an insert which is included with the kit.

EXAMPLES

(43) The following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same. The examples are not intended in any way to otherwise limit the scope of the invention.

Example 1

Autonomously Replicating Sequence for Use in a Wide Range of Budding Yeasts

(44) This example describes a short ARS sequence that functions in at least 10 diverse species of budding yeast. These include, but are not limited to members of the Saccharomyces, Lachancea, Kluyveromyces, and Pichia (Komagataella) genera spanning over 500 million years of evolution. In addition to its wide species range, this ARS and an optimized derivative confer improved plasmid stability relative to other currently used ARS modules.

(45) DNA replication is an essential function of cellular biology. It is highly regulated at the initiation stage that occurs at loci termed replication origins. Yeast replication origins retain their initiation activity in a plasmid context allowing autonomous episomal plasmid maintenance (Stinchcomb et al. 1980). This cis-acting autonomously replicating sequence (ARS) function has been useful for both understanding the basic science of DNA replication (Nieduszynski et al. 2007; Liachko et al. 2013) and for industrial applications (Ber et al. 2007).

(46) The well-studied ARSs of the baker's yeast, Saccharomyces cerevisiae, are short (<100 bp) modular DNA sequences that require an 11-17 bp core sequence element called the ARS Consensus Sequence (ACS) as well as less well defined flanking sequences (Mchali et al. 2013). The ACS serves as a binding site for the Origin Recognition Complex (ORC), a six-member protein complex that serves as the landing pad for downstream replication initiation machinery.

(47) Large-scale studies have elucidated a diversity of ARS sequence determinants among the budding yeasts. Pre-Whole Genome Duplication (WGD) yeast Kluyveromyces lactis uses a 50 bp ACS motif that is very dissimilar from the canonical S. cerevisiae ACS (Liachko et al. 2010). Another pre-WGD species, Lachancea waltii, uses a motif that resembles a chimeric fusion between the S. cerevisiae and K. lactis ACS motifs (Di Rienzi et al. 2012) whereas its relative L. kluyveri has more relaxed sequence requirements (Liachko et al. 2011). While ARSs have also been described in other yeast species (Iwakiri et al. 2005; Iborra & Ball 1994; Vernis et al. 1997; Wright & Philippsen 1991; Cregg et al. 1985; Yang et al. 1994), the low-throughput nature of the relevant studies has precluded drawing any overarching conclusions about their origin structure.

(48) Due to the diversity of sequences required for origin function in different yeast species, ARSs are usually restricted to function in only a few yeast species. For example, K. lactis ARSs rarely work in non-Kluyveromyces yeasts and ARSs from other species rarely function in K. lactis host cells (Liachko et al. 2010; 2011). On the other hand, L. kluyveri is a permissive host species and can utilize most ARSs from S. cerevisiae and K. lactis (Liachko et al. 2011). The methylotrophic budding yeast Pichia pastoris uses at least two different kinds of ARS sequences, neither of which function in S. cerevisiae (see Example 2 below). Since ARSs are required for plasmid maintenance, an ARS that functions across all yeasts would be a useful genetic tool to develop shuttle vectors for cross-species studies, but to date such a module does not exist.

(49) We have identified a 452 bp K. lactis genomic fragment that retains ARS function in at least 10 budding yeast species with diverse ARS sequence requirements. This sequence (which we have named panARS) maps to coordinates 781040-781491 bp on chromosome F of the K. lactis genome (strain NRRL Y-1140 (Dujon et al. 2004)). The DNA fragment was originally identified as an ARS in K. lactis using a predict-and-verify approach used to generate a comprehensive K. lactis ARS map (Liachko et al. 2010). This ARS was subsequently cloned into a commonly used ARS-less URA3 vector, pRS406. The resulting plasmid (named pIL20) as well as the original plasmid from the K. lactis experiment were used to transform ura3-strains of S. cerevisiae, S. paradoxus, S. bayanus var uvarum, L. waltii, L. kluyveri, K. lactis, K. wickerhamii, and P. pastoris. ARS activity is exhibited by high-transformation efficiency and robust colony formation on selective media. We detected ARS activity (>500 colonies per microgram of transforming plasmid DNA) in all species tested (FIG. 1a).

(50) Additionally, for each species several colonies were re-streaked on selective medium agar plates and inoculated into selective liquid medium where they grew robustly at 30. We were able to recover plasmids from re-streaked colonies and cultures of all species using standard techniques. Sequencing and restriction digestion analysis confirmed the identity of the recovered plasmids to be the same as the input ARS plasmid. Recovered plasmids were used to transform the host species and displayed robust colony formation on selective media in all cases. These results suggest that panARS allows episomal plasmid maintenance in the yeast species listed above. We also detected ARS activity in Naumovozyma castellii and Hansenula polymorpha when panARS was cloned into vectors bearing antibiotic resistance markers (Chee & Haase 2012).

(51) To delineate the region of panARS required for function in each of the different species we sheared the 452 bp ARS fragment and cloned a library containing ARS sub-fragments. This library was used to transform the different yeast species in order to identify sub-fragments of the ARS that retain function. Short ARS fragments isolated from this screen were also tested for function across multiple species. In this manner we were able to isolate the minimal region of the ARS that confers function across all species to a region near one end of the ARS (FIG. 1b). All species listed except P. pastoris were able to initiate replication with ARS sub-fragments in a region between relative positions 188-316. For ARS function, P. pastoris required ARS DNA fragments within relative coordinates 256-371 (FIG. 1b).

(52) We modified the sequence of panARS in an attempt to simultaneously improve its function across multiple species. The sequence determinants of ARS function are not yet understood in most yeasts, precluding targeted optimization across the entire species panel. We introduced mutations into the best match to the S. cerevisiae and K. lactis ACS sequences within the functional panARS region and one strong match to the K. lactis ACS outside the minimal region (since this may be a dimeric K. lactis ARS) to improve the sequence matches to these known motifs (FIG. 2). The resulting mutations improved all motif matches as assayed by the FIMO motif-alignment program (Grant et al. 2011): the q-value of the S. cerevisiae ACS match decreased from 0.003 to 3.11e-05, and the q-value of the two K. lactis ACS matches decreased from 1.6e-08 to 7.25e-11 and from 1.89e-07 to 3.32e-12.

(53) We cloned the full length (452 bp) optimized ARS mutant sequence into vector pRS406 and tested ARS function in different yeast species. The mutant ARS fragment retained robust ARS activity in all species listed above. We also performed plasmid loss assays as described (Donato et al. 2006) to measure relative plasmid stability in the eight aforementioned species (FIG. 1c). The plasmid loss assay (also known as the minichromosome maintenance assay) measures the retention of the plasmid-borne selectable marker during growth in non-selective media. YPD media was inoculated with cells transformed with relevant plasmids and grown for 10-20 generations. Proportions of Ura+ cells within each culture were measured at the start and end of the non-selective growth by plating on YPD and selective agar plates and counting colonies. Plasmids with low or absent ARS activity are quickly lost from the population whereas plasmids with increased ARS activity are more readily retained during non-selective growth. The mutant ARS sequence showed a slightly improved stability (indicated by lower plasmid loss/generation) in the S. cerevisiae, S. bayanus, and L. waltii hosts relative to the original ARS sequence (one-tailed two-sample t-test p-values=0.0007, 0.0403, and 0.0086 respectively). In K. lactis and K. wickerhamii, we did not detect a significant change in plasmid stability between the two alleles (p-values=0.3872 and 0.1678 respectively). This may be due to the fact that this ARS originates from K. lactis and is already maximally efficient. In P. pastoris the optimized ARS showed improved efficiency relative to the wild type sequence (p-value=0.0115).

(54) We also tested the plasmid loss rate of the same vector backbone bearing the previously described P. pastoris ARS, PARS1. This 167 bp sequence is currently the most commonly used ARS module in P. pastoris (Lee et al. 2005; Cregg et al. 1985). Additionally, we tested the efficiency of pRS316, a S. cerevisiae ARS/CEN plasmid which replicates in P. pastoris. Plasmids carrying both the wild type and optimized ARS alleles were more stable than both the PARS1 plasmid and pRS316 (FIG. 3).

(55) In summary, we have identified a 452 bp ARS element that originates from K. lactis, but also retains ARS function in a number of other species with diverse sequence requirements for initiating DNA replication. The synthetically optimized mutant version of this sequence performs either equivalently to or better than the wild type sequence. Additionally, this module performs significantly better than other characterized ARS plasmids in P. pastoris, with a stability that resembles ARS/CEN plasmids in better-studied models. These results suggest that panARS provides an efficient ARS module in other related yeast species and a superior construct even when cross-species performance is not required.

References Cited in Example 1

(56) Ber E, et al. (2007) Appl. Microbiol. Biotechnol. 77: 513-523. Broach J R, et al. (1983) Cold Spring Harb. Symp. Quant. Biol. 47 Pt 2: 1165-1173. Chee M K & Haase S B (2012) G3 (Bethesda) 2: 515-526. Gregg J M, et al. (1985) Mol. Cell. Biol. 5: 3376-3385. Di Rienzi S C, et al. (2012) Genome Res. 22: 1940-1952. Donato J J, et al. (2006) PLoS Genet. 2: e141. Dujon B et al. (2004) Nature 430: 35-44. Grant C E, et al. (2011) Bioinformatics 27: 1017-1018. Iborra F & Ball M M (1994) Yeast 10: 1621-1629. Iwakiri R, et al. (2005) Yeast 22: 1049-1060. Lee C C, et al. (2005) Plasmid 54: 80-85. Liachko I et al. (2011) BMC Genomics 12: 633. Liachko I, et al. (2010) PLoS Genet. 6: e1000946. Liachko I, et al. (2013) Genome Res. 23: 698-704. Mchali M, et al. (2013) Curr. Opin. Genet. Dev. 23: 124-131. Nieduszynski C A, et al. (2007) Nucleic Acids Res. 35: D40-D46. Stinchcomb D T, et al. (1980) Proc. Natl. Acad. Sci. U.S.A. 77: 4559-4563. Vernis L, et al. (1997) Mol. Cell. Biol. 17: 1995-2004. Wright M C & Philippsen P (1991) Gene 109: 99-105. Yang V W, et al. (1994) Appl. Environ. Microbiol. 60: 4245-4254.

(57) TABLE-US-00002 TABLE 1 Strains and plasmids used in Example 1 Strains name species source W303-1a S. cerevisiae R. Rothstein YDG613 S. paradoxus D. Greig YZB5-113 S. bayanus Y. Zheng N/A L. waltii B. Brewer FM628 L. kluyveri M. Johnston ILY538 K. wickerhamii spontaneous FOAr revertant of strain Y-8286 MW98-8c K. lactis C. Newlon JC308 P. pastoris J. Cregg 4310 N. castellii D. Bartel Y-5445 H. polymorphs USDA Agricultural Research Service Plasmids name features pRS406 ampr, URA3 pRS406, pIL20 panARS pIL57 pRS406, optimized panARS pRS400 ampr, G418 pRS400, pIL48 panARS pRS40H ampr, HygB pRS40H, pIL50 panARS

Example 2

Optimizing Replication Origin Activity in the Methylotrophic Yeast Pichia pastoris

(58) This example comprehensively profiles replication origin location, structure, and dynamics in the methylotrophic budding yeast Pichia pastoris (Komagataella phaffii) [31, 32] using a number of massively parallel sequencing techniques. In addition, we generated a genome-wide profile of nucleosome occupancy. The findings show that this yeast, which is commonly used for industrial production of recombinant proteins [33], employs at least two distinct types of DNA sequences to initiate replication. Approximately one third of P. pastoris ARSs require a G/C-rich motif that closely matches one form of the binding site of the well-studied Hsf1 transcriptional regulator [34]. The remaining origins use A/T-rich sequences for initiation. Genome regions near G/C-rich origins replicate significantly earlier than regions near the other class of origins and have a unique pattern of nucleosome organization. Their organization suggests that local transcriptional regulation may be linked in some way to replication timing at these sites. Furthermore, the most common plasmid vector used in P. pastoris contains a member of the AT-rich class of origin, suggesting that use of plasmids bearing a G/C-rich origin will yield immediate improvements for strain engineering.

(59) Results

(60) Global Mapping of P. pastoris ARSs

(61) The classic ARS screen identifies sequences sufficient for the initiation of replication of plasmids [35, 36] by assaying for colony formation on selective medium. Non-replicating plasmids do not yield colonies. An early study identified two regions of the P. pastoris genome that have ARS function, but do not have ACS elements seen in S. cerevisiae ARSs [37]. To generate a comprehensive map of ARSs in the genome of P. pastoris (PpARSs) we utilized ARS-seq, a high-throughput ARS screen combined with deep sequencing (FIG. 4A) [38]. A 15 library of genomic DNA fragmented by one of four four-cutter restriction enzymes was constructed in a non-replicating URA3 shuttle vector. A P. pastoris ura3 strain (JC308) was transformed with this library and plated on medium lacking uracil (C-Ura) resulting in 20,000 colonies from an estimated 2-310.sup.6 transformants. Colonies were replica-plated on C-Ura plates and grown for four additional days before the growing colonies were pooled. Total DNA was extracted from pooled cells. ARS inserts were amplified using vector-specific Illumina primers and sequenced using paired-end deep sequencing. The sequencing reads were assembled into 971 unique genomic fragments (averaging 661 bp in length) and 358 overlapping contigs. The data were filtered both computationally and by manual verification (Methods) resulting in a final list of 311 ARS loci.

(62) To delineate the functional regions of P. pastoris ARSs with greater precision we used miniARS-seq, a follow-up ARS screen where the input library is constructed from short subfragments of ARSs isolated from the initial ARS-seq screen (FIG. 4A) [38]. The miniARS-seq screen returned 14,661 functional ARS fragments that were filtered and assembled into contigs (Methods). This procedure narrowed the functional regions of 100 ARSseq contigs to 150 bp. We have previously shown that ARS regions can be accurately narrowed by inferring functional cores based on regions of overlap among multiple ARS-seq/miniARS-seq fragments [38]. We combined data from both screens to generate a high-resolution map of ARS sites in the P. pastoris genome.

(63) At Least Two Classes of ARSs in P. pastoris

(64) Identification of conserved motifs within a set of sequences with a shared function is one of the cornerstones of comparative genomics. The S. cerevisiae ACS motif is present in all S. cerevisiae ARSs and is easily recognizable by motif discovery algorithms [39-42]. The same is also true for L. waltii [29], and in K. lactis the ACS motif can additionally be used to predict accurately genomic ARS locations [27, 43]. We used the de novo motif discovery tool MEME [44] to identify conserved motifs of varying lengths within the entire set of P. pastoris ARSs using the zero or one occurrence per sequence (zoops) setting. MEME identified a 20 bp G/C-rich consensus motif (GC-ACS, E-value=1.3e-248) with a TYGAAC core (FIG. 4B). However, not all PpARSs have a significant match to this motif. To determine the subset with a GC-ACS, we used the MAST algorithm to assign a score to the best occurrence of the motif within each sequence. The bimodal distribution of motif scores (FIG. 4C) indicated that 107/311 (34.4%) of the ARSs have much stronger matches to the motif than the remaining 204 ARSs. We were unable to detect any conserved motifs that were present among these 204 sequences.

(65) We found that P. pastoris ARSs were significantly enriched for G/C-content relative to combined intergenic sequences (binomial P=1.778e-06). Furthermore, the 107 ARSs bearing the GC-ACS motif (GC-ARSs) were significantly enriched (binomial exact test P=2.825e-15) for G/C-content relative to the 204 ARSs without the motif (AT-ARSs). In fact, the AT-ARSs alone are not significantly enriched for G/C or NT content relative to all of intergenic DNA (two-sided binomial exact test P=0.46), suggesting that GC-ARSs are chiefly responsible for the overall G/C enrichment in the ARS dataset. Additionally, while both classes of ARSs are predominantly intergenic, GC-ARSs associate with longer intergenes whereas AT-ARSs do not. The median length of all intergenes in the P. pastoris GS115 strain background is 216 bp [31], whereas the median length of GC-ARS intergenes is 869 bp, an enrichment that cannot be explained by the length of intergenes alone (Monte Carlo simulation P<0.01). In contrast, the median AT-ARS intergene at 566 bp is not significantly longer than the background (Monte Carlo simulation P=0.85). Another difference between the GC- and AT-ARSs is that the average combined ARS-seq read depths for individual ARSs of the AT-class are lower than for those of the GC-ARS class (one-tailed T-test P=0.035). This difference is most noticeable in that 61/204 AT-ARSs have a read depth <20, while all GC-ARSs have higher read depths, and only 9/107 GC-ARSs have read depths of <300. We validated a number of these low read depth AT-ARSs to ensure that they are not all false positives. This discrepancy in read depth between GC- and AT-ARSs suggests that the AT-ARS dataset may be enriched for ARSs that replicate less efficiently in this plasmid vector context.

(66) Similarly to other budding yeast ARSs, PpARSs are predominantly intergenic (hypergeometric test P<2.2e-16). However, unlike S. cerevisiae, where replication origins are enriched in convergently transcribed intergenes (where both adjacent genes are transcribed toward the intergene), P. pastoris ARSs are depleted in convergent intergenes (Chi-squared P=4.749e-05).

(67) To confirm that both GC-ARSs and AT-ARSs are bona fide replication origins in their chromosomal context, we assayed genomic origin firing by 2D-gel electrophoresis at two genomic loci (FIG. 4D). Replication intermediates were isolated from exponentially growing cells in YPD medium, subjected to 2D-gel electrophoresis as described [45], and probed for a GC-ARS locus (C379) and an AT-ARS locus (A2772). The presence of an upper arc on a 2D-gel blot results from replication bubble intermediates (FIG. 4D, arrows) and is indicative of replication initiation at the probed locus. We detected such bubble arcs at both loci, suggesting that members of both classes of sequences can function as replication origins in the genome.

(68) The GC-ACS Motif is Required for GC-ARS Function

(69) To test whether the GC-ACS identified from the sequence analysis is required for GC-ARS function, we used site directed mutagenesis to disrupt the motif within twelve different GC-ARSs and tested the effect of these mutations on ARS function (FIG. 5). We replaced the central GA dinucleotide within the best match of the GC-rich motif with a CC dinucleotide to disrupt the motif (TYGAAC. SEQ ID NO: 60, was changed to TYCCAC, SEQ ID NO: 61). We ligated short DNA fragments (125 bp) bearing both wild type and mutant alleles of each ARS into a URA3 plasmid and tested the resulting plasmids for ARS function by transformation of the P. pastoris ura3 strain (FIG. 5). Multiple individual clones of all plasmids carrying wild-type ARS alleles yielded colonies on selective media indicating ARS activity. All clones were functional, regardless of the relative orientation of the ARS insert within the vector. Three of the twelve wild-type ARSs (ARS-B1605, ARS-C937, and ARS-D781) showed a noticeably weaker ARS activity indicated by slower colony growth. This slow growth is likely due to the short fragment length of ARSs tested, since multiple flanking elements are commonly required to support or enhance ARS function. None of the clones bearing mutant ARS alleles showed colony formation indicating the absence of ARS function independent of insert orientation within the vector. Additionally, in all twelve cases, the wildtype ARSs retained function despite the GC-ACS being positioned <15 bp from the 5 end of the ARS fragment. These results indicate that the GC-ACS motif is required for GC-ARS function whereas sequences flanking the motif on the 5 side are not.

(70) At Least Two Distinct Motifs can Drive ARS Function in P. pastoris

(71) While the GC-ACS motif is not present in all PpARSs, the fact that it is present in over a third of ARS fragments and is essential for ARS function in the subset of GC-ARSs tested suggest that it plays an important role in ARS function. This hypothesis is further supported by the fact that ARS-seq identified most of the intergenic matches of this motif (106/134) across the genome. The remaining twenty-eight intergenic occurrences of this motif that were not detected by ARS-seq have significantly lower match scores than the motifs within ARS fragments (T-test P=1.49e-07) suggesting that strong matches to the GC-ACS are good indicators of ARS activity.

(72) To assay directly the sequence determinants of ARS function, we applied a deep mutational scanning [46, 47] approach, mutARS-seq [38], to 100 bp fragments of P. pastoris ARS-C379 and ARS-A2772. This method involves competitively growing yeast transformed with a library of randomly mutagenized variants of a given ARS and measuring the enrichment of each allele through paired-end deep sequencing of samples over time (FIGS. 6A, and 7-9). Stronger ARS variants increase in population frequency over the course of the competition and are given positive enrichment scores, whereas deleterious mutations result in depletion of these alleles and are given negative enrichment scores. We constructed mutARS-seq libraries for ARS-C379 and ARS-A2772 using oligonucleotides synthesized with a 2% chance of bearing a random mutation at each position. Each library contained >20,000 inserts. A ura3 strain of P. pastoris was transformed with the two libraries separately (two biological replicates for each library). Resulting colonies on selective medium plates (100,000 transformants for each experiment) were pooled and the cell mixture was used to inoculate a 1 L culture of liquid selective medium. The culture was grown at 30 and the abundance of each ARS variant at different times was measured by 101 bp paired-end sequencing.

(73) The results of mutARS-seq show a striking difference in the sequences required for function of the two types of PpARSs. ARS-C379 shows a zone of constraint within the region corresponding to the match of the GC-ACS motif (FIGS. 6B and 7) further supporting that the GC-ACS motif is required for ARS-C379 function. In contrast, ARS-A2772 does not have a GC-ACS and shows a region of constraint at a repetitive NT-rich sequence that is not present in ARS-C379 (FIGS. 6C and 8). In searching for matches to the A/T-rich motif within the ARS set we were able to detect strong matches within only two sequences, one of them being ARS-A2772. This result suggests further complexity within the AT-ARS functional determinants. Alternatively, this motif may be inherently elusive to alignment-based methods due to its repetitive A/T-rich structure. Our findings demonstrate that P. pastoris can utilize at least two different non-overlapping sequence motifs for the initiation of DNA replication. We also found that these ARSs retained function in both orientations within the vector, on different length inserts, and in other plasmid contexts, suggesting that at least one of these sequences, or an equivalent, must be present for the initiation of plasmid replication and that each is sufficient for initiation.

(74) GC-ARSs are Earlier Replicating than AT-ARSs

(75) While the ARS assay can be used for high-precision mapping of sequences required for replication initiation, it is not an accurate measure of origin activity in the genomic context. No correlation between ARS activity and genomic replication timing has been detected in either S. cerevisiae or S. pombe, presumably due to higher-level regulation of timing that is absent on plasmids. To overcome this limitation of the ARS assay, we used an approach that combines cell sorting and deep sequencing [17, 48, 49] to map the temporal patterns of replication within the P. pastoris genome. This method calculates the DNA copy number ratio between S phase and G1 phase cells in sliding windows across the genome. Since a replicated region is present in twice the copy number of a non-replicated region, this copy number ratio is proportional to the relative mean replication time of a given locus [49, 50].

(76) Approximately 1.5 million G1 and S phase cells were sorted from an exponentially growing culture using FACS. Total genomic DNA was isolated, randomly sheared, and sequenced to high coverage to measure the relative DNA copy number of all genomic loci. The ratios of sequence reads between G1 and S phase samples were calculated in non-overlapping 1 kb sliding windows across the genome and normalized based on the total number of reads within each sample (Methods). The resulting ratios from biological replicates were LOESS smoothed, yielding highly reproducible replication timing curves (Pearson and Spearman cor >0.94). To generate a composite replication timing profile, the unsmoothed ratios from both replicates were averaged, normalized to a baseline value of 1 and smoothed (Methods).

(77) Visual inspection of the chromosome replication profiles revealed 100 significant peaks corresponding to early replicating regions, or replication origins (FIGS. 10A and 11), as well as valleys that reflect replication termination loci. Additionally, we detected numerous small peaks and shoulders (small peaks at the edges of larger peaks) that we interpret to be later firing or less efficient origins. Quantitative analysis identified 176 peaks in replication timing peaks (FIGS. 10 and 11). Overlaying ARS coordinates with the replication curve showed that all large peaks except one contained at least one ARS. Examination of the sequence within the lone ARS-less peak (near position 1,565,000 on chromosome 1) revealed two strong matches to the GC-ACS motif within 2 kb of the peak. Manual validation of 200 bp fragments centered on each of the motif occurrences revealed them both to have ARS function indicating that they are ARS-seq false negatives. We also used the replication timing data to further validate the ARS screen to remove false positives. We manually validated low coverage ARS-seq fragments that did not appear to map at a replication peak. From forty-nine fragments with a read-depth 2-10 (fragments with read-depth 1 are filtered out at the ARS-seq stage; see Methods) eleven did not appear close to peaks and were manually tested for ARS function. Among these eleven (none of which had GC-ACS motifs), ARS activity was detected for only three.

(78) To test whether ARSs bearing the GC-ACS motif are regulated differently than those without, we compared the replication curve values between the two classes of ARSs (FIG. 10B). Our data show that while GC-ARS regions are replicated significantly earlier than the background genomic distribution, AT-ARSs are not (T-test P<2.2e-16 and 0.0699 respectively). Consistently, GC-ARSs are replicated earlier than AT-ARSs (T-test P<2.2e-16). This result holds true even if only loci without neighboring ARSs (within a two-sided 40 kb window) are compared (T-test P=6.267e-07). Chromosomal regions with single isolated AT-ARSs replicate significantly later relative to the pool of all AT-ARSs (T-test P=0.0003), suggesting that clustering of these elements increases their local replication signal. This effect was not seen at the GC-ARS loci (T-test P=0.88), indicating that clustering does not significantly affect their timing.

(79) Another way to detect differences in replication timing between the two classes of ARSs is to measure the effect of removing their signals from the genomic dataset (FIG. 10C). Removing all points within 30 kb windows centered on GC-ARSs significantly shifted the distribution of remaining replication timing signals in the later direction (T-test P<2.2e-16). On the other hand, removing signals around AT-ARSs did not significantly affect the distribution of remaining points (T-test P=0.07094). When signal was removed around all ARSs, it shifted the distribution relative to removing just GC-ARSs (T-test P<2.2e-16), consistent with the AT-ARSs occupying a lower tier in the hierarchy of origin activation times.

(80) Additionally, we found the distance from each ARS to the nearest replication peak and plotted histograms of these distances for AT- and GC-ARS's (FIG. 10D). We find that both types of ARSs are significantly associated with peaks (Kolmogorov-Smirnoff test, P=7.1810e-5 for GC-ARSs and P=0.0293 for AT-ARSs). GC-ARS's were significantly closer to peaks than AT-ARS's (Kolmogorov-Smirnoff test, P=6.1310e-7). Taken together, our data suggests that while both types of ARSs correlate with genomic replication origins, GC-ARSs are more often found associated with early origins and early replicating regions, whereas AT-ARSs show the opposite tendency.

(81) Nucleosome Positioning at P. pastoris Origins

(82) One common feature of replication origins is a nucleosome depletion region (NDR) close to the site of initiation [13, 14, 26, 30, 51, 52]. To investigate whether this feature holds true for P. pastoris, we generated a complete map of nucleosome positions within the P. pastoris genome by sequencing genomic DNA digested with micrococcal nuclease [53]. Our results revealed gross nucleosome positioning features similar to those seen in other yeasts, such as an NDR at transcriptional start sites (TSS) followed by regularly positioned nucleosomes within the body of transcripts [54, 55]. This result suggests that our experimental methods accurately captured the positions of nucleosomes in this strain. We also detected NDRs at replication origin sites; however, GC-ARS and AT-ARS sites showed striking differences in nucleosome occupancy relative to other budding yeasts [13, 14, 29]. When centered on the GC-ACS, we observed a relative depletion in nucleosome occupancy approximately 40 bp to the 5 side of the motif (in the TYGAAC orientation). However, unlike other yeast origins where the NDR spans the length of approximately one nucleosome, the P. pastoris GC-ARS depletion region spans approximately 450 bp and appears to be excluding three nucleosomes. On the other hand, AT-ARS sites showed a nucleosome depletion region of 150 bp in length, a pattern more closely resembling that in other budding yeasts. However, this NDR was not flanked by well-ordered nucleosomes at all AT-ARS sites and suggests either that there are key regulatory differences with other budding yeasts or that not all AT-ARSs use the same sequence determinant for origin firing.

(83) Genome Location and Motif Sequence Identify a Class of Origins Associated with Promoters

(84) The underrepresentation of GC-ARSs in convergently transcribed intergenes suggests that these elements may be associated with promoters. As in promoters, the NDR near GC-ACS sites is followed by regularly spaced nucleosomes. To test the putative association of the GC-ACS with gene promoters, we searched for this motif in the regulatory motif databases and found that it is a match to one of the motifs annotated as the binding sites of the human Hsf1 [34] heat shock factor (HSF) transcriptional regulator [56] (factorbook.org/mediawiki/index.php/HSF1). Additionally, when centered on the GC-ACS motif (in the TYGAAC orientation), GC-ARSs show a pronounced poly(dA) region around 10 bp to 35 bp upstream of the motif. Notably, this poly(dA) tract is not present near the non-ARS occurrences of this motif and is not required for ARS function (FIG. 5). It has been previously shown that such a neighboring poly(dA) region is a conserved feature of Hsf1 binding sites in the sensu stricto group of budding yeasts [57], though we note that the TYGAAC portion of the motif does not match the canonical budding yeast HSF motif. To determine whether the GC-ACS is likely to be a binding site for Hsf1 or one of its homologs, we aimed to test whether this motif is overrepresented in promoters of genes likely to be regulated by HSF. We used BLAST to identify homologs of S. cerevisiae genes regulated by HSF [58] and filtered the list to include only strong matches (PBLAST E-value<1e-10), resulting in a set of 120 gene homologs. We used the FIMO algorithm to identify significant matches to the GC-ACS within 500 bp regions upstream of all 5037 P. pastoris genes. We identified 451 genes that had GC-ACS motifs and 716 genes with matches to the HSF binding site (the Heat Shock Element, HSE [56, 59]), within 500 bp upstream of the start codon. In our set of 120 potential HSF-regulated P. pastoris genes, 45 had at least one match to the HSE (hypergeometric test P=3.1e-11) and 16 genes had GC-ACSs within 500 bp upstream of the start codon (hypergeometric test P=0.037).

(85) We also used an independent approach to test whether GC-ACS motifs associate with HSE motifs throughout the genome. We mapped separately all occurrences of the GC-ACS and of the HSE. We then assigned to each motif occurrence the nearest annotated gene. There are 5037 annotated genes in P. pastoris. From these, 1,188 unique genes were assigned as closest gene to an occurrence of the GC-ACS and 1,236 unique genes were assigned as closest to an HSE. A significant number (524) of unique genes were present in both lists, suggesting an association between GC-ACS and HSE motifs (hypergeometric test P=4.6e-67). While HSF function in P. pastoris has not been studied, these results show an enrichment of GC-ACS motifs in regions likely to be regulated by HSF. Furthermore, the GC-ACS motif is positioned close to TSSs and ORF start sites upstream of the motif suggesting some functional overlap between transcription and early origin firing.

(86) Since the GC-ACS is associated with promoters, it raises the possibility that transcription is required for origin activation. If this possibility were true, then the DNA between the GC-ACS and the TSS may be required for ARS function. Since miniARS-seq screens large numbers of randomly sheared ARS sub-fragments, we were able to test this possibility by determining what sequences flanking the GC-ACS are required for ARS function. Using the full list of inferred functional ARS cores we calculated the length of sequence between the edge of the consensus motif and the edge of the ARS core on either side of the motif. The distributions of 5 and 3 lengths show that several GC-ARSs require <10 bp of sequence on the 5 of the GC-ACS while more ARS sequence is required on the 3 side of the motif. In fact, the fragment of ARS-C379 that was used for mutARS-seq (FIG. 6A) retained function with only 2 bp of ARS sequence to the 5 side. Additionally, the twelve wild-type ARS fragments that were tested for activity (FIG. 5) all contained <15 bp of sequence to the 5 of the GC-ACS. The fact that all tested ARSs retained function in the absence of 5 flanking DNA shows that this region, and the 5 poly(dA) sequence, are not required for GC-ARS function. While it is possible that transcription can initiate at ectopic sites in the plasmid, these results suggest that transcription per se may not be required for GC-ARS function in P. pastoris. Consistent with these findings, we have been unable to detect a correlation between expression and replication initiation/timing.

(87) The majority of ARSs in budding yeast require sequences on the 3 side of the ACS (on the T-rich strand) collectively called B-elements [38, 42, 60]. Our data show that GC-ARSs also require flanking sequence on the 3 side of the GC-ACS motif (in the TYGAAC orientation) for ARS function. This result is supported by our mutARS-seq data where we detected a minor region of constrained nucleotides 50 bp to the 3 side of the GC-ACS in ARS-C379 (FIG. 6B). The required flanking DNA lies distal to the TSS and may explain the extended nucleosome depletion regions seen at these loci.

(88) Discussion

(89) Faithful genome duplication is essential to all living organisms. Like many other cellular processes, DNA replication is primarily regulated at the initiation step. Understanding the regulation of initiation at replication origins is therefore key to understanding how different species replicate their genomes. The extensively studied yeasts S. cerevisiae and S. pombe have yielded great insights into origin function, but lack several properties exhibited by metazoan origins. For one, metazoan origins have G/C-rich signatures whereas all yeast origin sequence determinants described to date are NT-rich with the possible exception of fission yeast S. japonicus, where GC-rich motifs have been implicated in origin function through sequence analysis. Another key difference between yeast and metazoan origins is the connection between replication initiation and transcription. While promoter-associated origins tend to be early-firing in metazoans, this phenomenon has not been previously described in yeast. These discrepancies limit the value of most yeast species as models for the study of replication origins from higher eukaryotes. A better model would ideally possess the beneficial characteristics of yeast (genetic and molecular tools) while also recapitulating more of the traits displayed by metazoans.

(90) In this study we generated a comprehensive profile of replication origins in P. pastoris, a budding yeast that is very distantly related to both the S. cerevisiae and S. pombe yeasts [61]. This methylotrophic budding yeast has traditionally been utilized as an industrial organism valued for its ability to convert methanol to biomass and for its ability to produce and secrete recombinant proteins in high yields [33]. An early study showed that two native P. pastoris ARSs did not function in S. cerevisiae, suggesting key mechanistic differences in replication initiation between the two species [37]. We identified 311 ARSs in P. pastoris and were able to delineate the essential functional regions to <200 bp in most cases. As in other budding yeasts we found PpARSs to reside predominantly in intergenic regions. However, unlike other studied yeasts, P. pastoris displayed a conserved G/C-rich motif (GC-ACS) in approximately 35% of its ARSs. In fact, almost all strong intergenic matches to this motif were isolated in our ARS screen, suggesting a causal role for this motif in origin function. We were unable to detect a strong conserved motif within the other origins (AT-ARSs). It is possible that the AT-ARSs function with an ill-defined sequence determinant similar to those seen in S. pombe and L. kluyveri [22, 28] or that the sequence required for AT-ARS function is innately elusive to traditional alignment-based methods due to its nucleotide composition.

(91) To identify experimentally the nucleotides required for ARS function, we used mutARS-seq, a massively parallel approach that allows simultaneous measurement of the effects of all mutations on the function of an ARS [38]. This approach showed that the GC-ACS is indeed required for GC-ARS function (FIG. 6B). Notably, the GC-ACS was the most constrained element within the ARS tested, suggesting that this motif is the primary element used for ARS function and not a supporting element akin to S. cerevisiae B-elements. The fact that the GC-ACS motif retains function within different plasmid contexts supports this hypothesis. The mutARS-seq experiment on ARS-A2772, an AT-ARS, revealed a very different region of functional constraint (FIG. 6C). A repetitive A/T-rich element was required for the function of this ARS. Other than its general A/T-richness, this element is significantly different from all previously identified ACS elements. Similarly to the GC-ACS, this motif is also the only strong region of functional constraint within the ARS and functions within different plasmid contexts, suggesting that it is a primary ARS element. While it is tempting to speculate that both of these motifs act as ORC binding sites (or in some other way recruit relevant protein factors), we have no direct evidence to this effect. To our knowledge P. pastoris is the first organism that simultaneously uses such diverse sequences as ARS elements.

(92) The dynamics of replication in this species showed a surprising difference in replication timing between GC-ARSs and AT-ARSs (FIG. 10). While both types of origins exist within replication peaks, as a class, GC-ARS sites replicate significantly earlier and/or more efficiently than AT-ARS sitesalthough there are individual exceptions to this general categorization (FIG. 10B). Our data also show that while the timing/efficiency of AT-ARS benefits from clustering with other ARSs, GC-ARSs are not affected by clustering, suggesting that they are operating at maximal initiation potential. While it is not yet clear how such a hierarchy of replication timing is achieved mechanistically, in metazoan cells promoter-associated origins fire earlier than the others and this difference is usually attributed to increased chromatin accessibility at transcription start sites [1]. Our findings are consistent with the difference in timing being associated with differences in chromatin structure. We assayed global positioning of nucleosomes in P. pastoris by sequencing mononucleosomal DNA from MNase-treated chromatin. The results of this experiment showed an atypical pattern of nucleosome depletion at GC-ARSs that resembles the depletion pattern seen at TSSs, but with two additional nucleosomes depleted upstream of the TSS. In contrast, nucleosome depletion at AT-ARSs resembles the S. cerevisiae ARS pattern with a single nucleosome depleted close to the location of the A/T-rich functional element. It should also be noted that while the A/T-rich motif identified by mutARS-seq is essential for the function of ARS-A2772, it is possible that other AT-ARSs use other elements. This possibility is supported by the fact that many AT-ARSs do not have strong matches to the motif generated from the mutARS-seq data despite showing a nucleosome depletion region at the site of best match.

(93) Combined, our findings suggest that P. pastoris can utilize at least two distinct sequences for origin selection and activation. One group of origins is A/T-rich and their replication times are distributed across S phase. The other type of origin is G/C-rich, disproportionally early replicating, and shows a close association with transcription start sites, properties usually associated with metazoan origins. In fact, the conserved motif required for GC-ARS firing is a very close match to the binding site of the human Hsf1 transcriptional activator [34]. Additionally, we have detected a statistical association between GC-ACS motifs and genes likely to be regulated by Hsf1 or its homologs. While the mechanistic nature of GC-ARS function will require additional investigation, our data could suggest that the Hsf1 binding site in P. pastoris is capable of recruiting either directly or indirectly the replication initiation machinery. Our data also suggest that transcription per se may not be required for GC-ARS function, as sequences between the GC-ACS and transcription start sites are not required for ARS function, but are likely to be required for transcription. Consistent with this model, we have not been able to detect a correlation between gene expression and replication timing, but this lack of correlation may also be due to a combination of subtle regulation patterns and scarcity of available expression data. It is worth noting that the GC-ACS motif does not match the well-defined S. cerevisiae Hsf1 binding site that has the sequence structure TTCTAGAAnnTTCT [62] (SEQ ID NO: 62) and is often represented as three evenly-spaced trinucleotides TTCnnGAAnnTTC [59] (SEQ ID NO: 63). However, Hsf1 is known to directly regulate genes lacking this motif, suggesting an ability to interact with diverse sequences [58]. Barring a mis-annotation, it is possible that in P. pastoris at least one of the four Hsf1 homologs is able to interact with and recruit ORC whereas the single Hsf1 protein in S. cerevisiae cannot bind to this atypical motif and thus relies exclusively on A/T-rich ARSs. This hypothesis would imply that the ability to use GIG-rich motifs for replication initiation is an ancestral trait that was lost in the lineage leading to the Saccharomyces, Lachancea, and Kluyveromyces clades. Whether other budding yeasts can utilize G/C-rich sites for initiation is not yet known. Alternatively, since a connection between Hsf1 and replication initiation has not yet been described, it is possible that this novel function is specific to the Pichia (Komagataella) genus, or perhaps only P. pastoris. Another observation that points to this motif being used for multiple functions is that a G/C-rich motif constructed from mutARS-seq data (FIG. 6B) is less information-rich than the motif obtained from alignment (contrary to the case of the A/T-rich motif which is difficult to produce by alignment, but is very obvious in the mutARS-seq data). While the optimal bases within the mutARS-seq data perfectly match the alignment-based motif, the cost of changing to a sub-optimal nucleotide is lower at most positions than the alignment-based motif would suggest. This observation can be explained by hypothesizing that this GC-motif is used for both origin activity as well as transcriptional regulation. If transcriptional regulation of the genes affected by this motif is evolutionarily more constrained than is ARS activity, then we would expect that the G/C-rich motifs would be selected upon primarily for their regulatory function.

(94) Additionally, it is possible that GC-ACS motifs act as enhancer elements to other, potentially A/T-rich primary elements. Transcription factors such as Fkh1, Abf1, and Mcm1 have been previously shown to enhance origin activity in S. cerevisiae [10-12]. This model would argue that the G/C-rich motif does not act as a primary site of initiation, but enables nearby dormant elements to initiate DNA replication possibly through the chromatin-modifying activity of Hsf1. However, the fact that approximately one-third of all active origins have the same G/C-rich motif and that almost all intergenic occurrences of this motif are in ARSs is very different from what has been previously observed in other yeast models where connections between ARSs and transcription factors are much less obvious.

(95) In addition to elucidating the features of replication dynamics, our data offer useful tools and data resources for this industrially important yeast. We anticipate that our nucleosome position map will be useful for studies of chromatin and gene expression, especially when combined with transcriptome data [55, 63]. More practically, replication origins are regulators of genome duplication and cell cycle progression, and are essential for episomal plasmid maintenance [64]. Current episomal vectors used in P. pastoris contain the original PARS1 (ARS-B413 in our data), an ARS discovered almost three decades ago [37, 65]. Our data show that PARS1 is one of the less efficient AT-ARSs [64], suggesting that using a different ARS may result in improvements in plasmid stability. Previously, we used mutARS-seq data to optimize ARS function in S. cerevisiae [38] and this approach can potentially be used to further improve plasmid maintenance in P. pastoris, facilitating strain engineering efforts in this system.

(96) Materials and Methods

(97) Strains, Plasmids, and Reagents.

(98) The P. pastoris strain used in these studies was JC308 (James Gregg), a ura3 auxotroph of the GS115 background strain. All yeast growth was performed at 30; all bacterial growth was performed at 37. The plasmid vectors used in this study were previously described [38]. All E. coli work was done using Alpha-Select Gold Efficiency competent cells (Bioline). All enzymes used were from New England Biolabs unless otherwise noted. Primers were purchased from IDT unless otherwise noted. PCR purification and purification of digested plasmids was done using the DNA Clean and Concentrator-5 Kit (Zymo Research). Plasmid DNA was purified using the Wizard Plus SV Miniprep Kit (Promega).

(99) ARS-Seq and miniARS-Seq.

(100) ARS-seq and miniARS-seq screens were performed largely as described [38]. P. pastoris genomic DNA was isolated from cells grown in YPD using a phenol/chloroform bead-disruption method followed by ultracentrifugation in a CsCl gradient (to remove mitochondrial DNA) followed by EtOH precipitation. Genomic DNA was fragmented and ligated as described [38]. Cloning efficiencies of resultant libraries were verified by colony PCR and P. pastoris cells were transformed with libraries using a custom lithium acetate protocol as follows. To make competent cells yeast were grown in YPG medium (10 g/L yeast extract, 20 g/L Peptone, 3% v/v glycerol) until OD.sub.600 density of 1. Cells from 1 L of culture were spun down, rinsed and resuspended in 10 mL of TE/LiOAc (10 mM Tris-HCl, 1 mM EDTA, 100 mM lithium acetate). Cell suspensions were incubated at 30 with shaking for 30 minutes, dispensed into 100 L aliquots and frozen at 80. For transformations competent cells were thawed at room temperature, mixed with 1-5 g of plasmid DNA, 600 L of two-step transformation buffer (40% polyethylene glycol-4000, 100 mM LiOAc, 10 mM Tris-HCl, 1 mM EDTA, 12 mM DTT, 0.12 mg/mL fish sperm carrier DNA) and incubated at 30 with gentle rotation for 30 minutes. The cell mixture was then heat-shocked at 42 for 30 minutes and plated. Cells were grown for five days, replica-plated, and grown for three more days before cells were pooled for plasmid extraction. DNA shearing for miniARS-seq, plasmid recovery from yeast, and Illumina sequencing were performed as described [38].

(101) ARS-Seq and miniARS-Seq Sequence Analysis.

(102) Illumina paired end sequencing reads were uniquely mapped to the GS115 genome [31] using Bowtie version 0.12.7. Custom Python scripts were used to detect relevant restriction sites at the ends of all mapped fragments that were extended to remove truncation products. Overlapping fragments were assembled into contigs. Contigs that had a combined read-depth of 1 were removed from the dataset. Cases where multiple discontinuous contigs were joined by overlapping fragments were manually resolved based on read depth. To maximize miniARS-seq data recovery, 101 bp paired end reads were mapped in full and unmapped reads were trimmed to 50 bp and mapped again. Resulting fragments with read depth >1 were assembled into contigs and contigs consisting of fewer than three unique fragments were removed. Both ARS-seq and miniARS-seq fragments were used to delineate minimal overlapping regions (inferred functional cores). To prevent data loss, cores that were <150 bp in length were extended bi-directionally to a final length of 150 bp.

(103) mutARS-Seq.

(104) mutARS-seq was performed largely as described [38]. Mutagenized oligos of ARS-C379 and ARS-A2772 were synthesized by Trilink Biotechnologies. The resulting libraries contained 24,000-40,000 ARS inserts. Yeast were transformed with mutagenized libraries as described above in two biological replicate pools each containing 100,000 transformed colonies. After five days of growth on selective agar plates, colonies were pooled and inoculated into 1 L cultures of liquid selective medium. Cultures were grown for 36 hours with periodic dilution to prevent saturation. Samples were taken at 0, 12, 24, and 36 hours. Sequencing data were analyzed using the Enrich software package [66]. For maximum separation averaged data from the 36-hour samples are shown in FIG. 6. To create a position-weighted matrix from mutARS-seq data, the enrichment ratio values within the constrained region were converted into relative allele frequencies after an arbitrary cutoff minimum of 0.2 was applied. Logo images were generated using Weblogo software [67].

(105) Site-Directed Mutagenesis.

(106) ARS sequences bearing mutations (see accompanying Sequence Listing) were ordered as custom designed double stranded gBlock DNA fragments (Integrated DNA Technologies). The gBlocks were used as PCR templates to amplify the mutant alleles prior to cloning. Wild type ARS alleles were PCR amplified from the gDNA of the parent strain (JC308).

(107) Conserved Motif Analysis.

(108) The MEME de novo motif discovery tool [44] was applied to identify conserved motifs within the entire set of PpARSs using the 5th order Markov background model and the entire set of P. pastoris intergenic sequences. Both MAST [68] and FIMO [69] programs from the MEME suite were used to map motif occurrences within different sets of ARS sequences.

(109) 2D Gel Analysis.

(110) A 1 L culture of P. pastoris was grown to early log phase in YEPD and harvested for genomic DNA isolation [70]. Approximately 8 g of DNA was cleaved with NcoI or StuI to release genomic fragments of 4.575 kb or 4.043 kb containing ARS-C379 or the ARS-A2772, respectively. Replication intermediates were separated on a first dimension gel of 0.4% ME agarose in 1TBE for 20 hours at 1 V/cm. Lanes for the second dimension gel were sliced from the gel and encased in a second gel of 0.9% ME agarose in 1TBE with 0.3 g/ml. Electrophoresis for the second dimension was carried out for 4.5 hours at 5.5 V/cm at 4 C. The genomic fragments were detected on Southern blots using .sup.32P-dATP labeled PCR probes.

(111) Replication Timing Measurements.

(112) Replication timing experiments were performed largely as described [48]. Exponentially growing (in YPD medium) P. pastoris cells were subjected to flow sorting using standard techniques on a BD FACsAria II cell-sorter. The purity of each sorted sample was determined to be 95%. Genomic DNA from 1.5-2 million G1 and S-phase cells was isolated using the YeaStar Genomic DNA Kit (Zymo Research). Randomly fragmented sequencing libraries were prepared using the Nextera DNA Sample Preparation Kit (Illumina) [71]. Approximately 29 million 50 bp reads were recovered for each sample of each replicate. More than 90% of the reads in all samples were mapped to the P. pastoris GS115 reference genome and 1% of the reads in each sample were removed due to multiple mapping sites. After processing, 25-27 million reads were assigned to 1 kb bins across the genome resulting in average count-depth of 2936 reads/bin for G1 sample of replicate 1, 2796 reads/bin for G1 sample of replicate 2, 2843 reads/bin for S sample of replicate 1, and 2913 reads/bin for S sample of replicate 2. Reads were mapped using Bowtie and custom scripts were used to generate replication timing profiles as described [48]. The total number of reads for each replicate was equalized in each sample and a ratio of S/G1 reads was calculated for each replicate. These ratios were multiplied by 1.5 to account for the fact that the average cell in the middle of S-phase will have replicated half of its DNA. We fitted a loess curve to the mean of the two replicate ratio measurements, then found peaks along this curve using the turnpoints( ) function from the R package, pastecs. The resulting curves were normalized to a baseline value of 1.

(113) Nucleosome Mapping.

(114) Nucleosome positions were mapped similarly to the method described [53]. Two colonies were grown in 400 mL of YPD media until an OD.sub.600 of 1 and then cross-linked with formaldehyde. The two samples were bead disrupted in 10 mM Tris-HCl pH8.0 with 1 mM CaCl.sub.2. Visually lysed samples were then MNase digested for 30 minutes at increasing concentrations of MNase. Cross-links were removed by overnight incubation at 65 followed by DNA extraction with phenol/chloroform. Extracted DNA was separated using a 2% agarose gel to visualize the mononucleosome enriched band. DNA corresponding to 150 bp was then extracted and sequenced using the Illumina HiSeq platform. The samples were divided in half to provide technical replicates.

(115) Supplemental Notes on Methods & Results

(116) Nucleosome profile of P. pastoris. Nucleosome density was plotted for sites centered on all TSSs as a control to test the overall quality of the mapping data, non-overlapping GC-ARS sites with a single match to the GC-ACS, or the A/T-rich motif shown in FIG. 6C. TSS sites are ranked based on expression in the SDEG condition [55]. GC-ARS and AT-ARS sites are ranked by the strength of the best match to the G/C- and the A/T-rich motif respectively.

(117) Sequence features of GC-ARSs. Average nucleotide frequencies around 107 GC-ARS sites and twenty-eight non-ARS intergenic occurrences of the GC-ACS, were centered on the best match of the GC-ACS. The nucleotide frequencies were calculated at all flanking regions around the motif independent of whether the flanking region is present in ARS contigs or cores. The distribution of distances between the GC-ACS motif and the TSS for adjacent genes transcribing away from the ARS with available TSS annotations. Distances to the 5 side of the motif, and distances to the 3 side of the motif were noted. The distribution of sequence lengths was noted between the GC-ACS and the end of the inferred functional core region for each GC-ARS.

(118) Accession Numbers

(119) All sequencing data presented are available from the National Center for Biotechnology Information Sequence Read Archive (ARS-seq-SRP031643; miniARS-seq-SRP031646; mutARSseq-SRP031760; replication timing-SRP031759; nucleosome mapping-SRP031651).

(120) TABLE-US-00003 TABLE 2 Sequences of ARS mutagenized in FIG. 5 fragment_name chrom start end length Combined_rd fxn Manual validation summary (SEQ ID NO: 20-35, respectively) 1_1843383_1843731 1 1843383 1843731 348 5 No 1_713599_713789 1 713599 713789 190 6 No 2_3962_4915 2 3962 4915 953 6 very weak 3_499687_499988 3 499687 499988 301 6 No 4_341217_341721 4 341217 341721 504 6 No 3_1970779_1970969 3 1970779 1970969 190 7 No 2_970074_970511 2 970074 970511 437 8 No 2_2281275_2281434 2 2281275 2281434 159 8 No 1_2060258_2060474 1 2060258 2060474 216 9 No 4_1647690_1648691 4 1647690 1648691 1001 9 weak 1_197_4023 1 197 4023 3826 10 weak 1_278500_281500 1 278500 281500 3000 manual No 1_315141_318141 1 315141 318141 3000 manual very weak 3_267500_270500 3 267500 270500 3000 manual No 4_684500_687500 4 684500 687500 3000 manual weak 4_1047500_1050500 4 1047500 1050500 3000 manual No Candidate ARSs and mutant variants tested (FIG. 5; SEQ ID NO: 36-59, respectively) A76_WT 1 76846 76970 125 38076 Yes A76_MUT 1 76846 76970 125 38076 No A366_WT 1 366441 366565 125 26366 Yes A366_MUT 1 366441 366565 125 26366 No A405_WT 1 405388 405512 125 5389 Yes A405_MUT 1 405388 405512 125 5389 No A427_WT 1 427956 428080 125 16604 Yes A427_MUT 1 427956 428080 125 16604 No B864_WT 2 864224 864348 125 8405 Yes B864_MUT 2 864224 864348 125 8405 No B1605_WT 2 1605269 1605145 125 55795 Yes B1605_MUT 2 1605269 1605145 125 55795 No B1739_WT 2 1739383 1739507 125 19427 Yes B1739_MUT 2 1739383 1739507 125 19427 No C562_WT 3 562487 562611 125 22676 Yes C562_MUT 3 562487 562611 125 22676 No C937_WT 3 937624 937500 125 14995 Yes C937_MUT 3 937624 937500 125 14995 No C1122_WT 3 1122505 1122381 125 6298 Yes C1122_MUT 3 1122505 1122381 125 6298 No D258_WT 4 258716 258840 125 8990 Yes D258_MUT 4 258716 258840 125 8990 No D781_WT 4 781423 781547 125 7714 Yes D781_MUT 4 781423 781547 125 7714 No

References Cited in Example 2

(121) 1. Mchali M (2010) Nat Rev Mol Cell Biol 11: 728-738. 2. Eaton M L, et al. (2011) Genome Res 21: 164-174. 3. Dellino G I, et al. (2013) Genome Res 23: 1-11. 4. Costas C, et al. (2011) Nat Struct Mol Biol 18: 395-400. 5. Hansen R S, et al. (2010) Proc Natl Acad Sci USA 107: 139-144. 6. Mchali M, et al. (2013) Curr Opin Genet Dev 23: 124-131. 7. Cayrou C, et al. (2011) Genome Res 21: 1438-1449. 8. Stinchcomb D T, et al. (1979) Nature 282: 39-43. 9. Bell S P, Dutta A (2002) Annu Rev Biochem 71: 333-374. 10. Chang V K, et al. (2004) Mol Cell Biol 24: 6514-6524. 11. Walker S S, et al. (1989) Mol Cell Biol 9: 2914-2921. 12. Knott S R V, et al. (2012) Cell 148: 99-111. 13. Eaton M L, et al. (2010) Genes Dev 24: 748-753. 14. Berbenetz N M, et al. (2010) PLoS Genet 6. doi:10.1371/journal.pgen.1001092. 15. Lin S, Kowalski D (1997) Mol Cell Biol 17: 5473-5484. 16. Donaldson A D, et al. (1998) Mol Cell 2: 173-182. 17. Koren A, et al. (2010) PLoS Genet 6: e1001068. 18. Mantiero D, et al. (2011) EMBO J 30: 4805-4814. 19. Bechhoefer J, Rhind N (2012) Trends Genet 28: 374-381. 20. de Moura A P S, et al. (2010) Nucleic Acids Res 38: 5623-5633. 21. Chuang R Y, Kelly T J (1999) Proc Natl Acad Sci USA 96: 2656-2661. 22. Dai J, et al. (2005) Proc Natl Acad Sci USA 102: 337-342. 23. Patel P K, et al. (2006) Mol Biol Cell 17: 308-316. 24. Ryba T, et al. (2011) PLoS Comput Biol 7: e1002225. 25. Delgado S, et al. (1998) EMBO J 17: 2426-2435. 26. MacAlpine H K, et al. (2010) Genome Res 20: 201-211. 27. Liachko I, et al. (2010) PLoS Genet 6: e1000946. 28. Liachko I, et al. (2011) BMC Genomics 12: 633. 29. Di Rienzi S C, et al. (2012) Genome Res 22: 1940-1952. 30. Xu J, et al. (2012) Genome Biol 13: R27. 31. De Schutter K, et al. (2009) Nat Biotechnol 27: 561-566. 32. Kurtzman C P (2009) J Ind Microbiol Biotechnol 36: 1435-1438. 33. Macauley-Patrick S, et al. (2005) Yeast 22: 249-270. 34. Anckar J, Sistonen L (2011) Annu Rev Biochem 80: 1089-1115. 35. Chan C S, Tye B K (1980) Proc Natl Acad Sci USA 77: 6329-6333. 36. Tanaka S, et al. (1996) Yeast 12: 101-113. 37. Cregg J M, et al. (1985) Mol Cell Biol 5: 3376-3385. 38. Liachko I, et al. (2013) Genome Res 23: 698-704. 39. Keich U, et al. (2008) BMC Bioinformatics 9: 372. 40. Ng P, Keich U (2008) Bioinformatics 24: 2256-2257. 41. Breier A M, et al. (2004) Genome Biol 5: R22. 42. Nieduszynski C A, et al. (2006) Genes Dev 20: 1874-1879. 43. Bhaskar A, Keich U (2010) Stat Appl Genet Mol Biol 9: Article28. 44. Bailey T L, Elkan C (1994) Proc Int Conf Intel! Syst Mol Biol 2: 28-36. 45. Brewer B J, Fangman W L (1987) Cell 51: 463-471. 46. Fowler D M, et al. (2010) Nat Methods 7: 741-746. 47. Patwardhan R P, et al. (2009) Nat Biotechnol 27: 1173-1175. 48. Mller C A, Nieduszynski C A (2012) Genome Res. doi:10.1101/gr.139477.112. 49. Mller C A, et al. (2013) Nucleic Acids Res. doi:10.1093/nar/gkt878. 50. Mller P, et al. (2010) Genes Dev 24: 1418-1433. 51. Lantermann A B, et al. (2010) Nat Struct Mol Biol 17: 251-257. 52. Lubelsky Y, et al. (2011) Nucleic Acids Res 39: 3141-3155. 53. Lee W, et al. (2007) Nat Genet 39: 1235-1244. 54. Tsankov A M, et al. (2010) PLoS Biol 8: e1000414. 55. Liang S, et al. (2012) BMC Genomics 13: 738. 56. Wang J, et al. (2012) Genome Res 22: 1798-1812. 57. Yuan G-C, et al. (2005) Science 309: 626-630. 58. Hahn J-S, et al. (2004) Mol Cell Biol 24: 5249-5256. 59. Trinklein N D, et al. (2004) Mol Biol Cell 15: 1254-1261. 60. Shirahige K, et al. (1993) Mol Cell Biol 13: 5043-5056. 61. Dujon B (2010) Nat Rev Genet 11: 512-524. 62. Harbison C T, et al. (2004) Nature 431: 99-104. 63. Gasser B, et al. (2007) BMC Genomics 8: 179. 64. Liachko I, Dunham M J (2013) FEMS Yeast Res. doi:10.1111/1567-1364.12123. 65. Lee C C, et al. (2005) Plasmid 54: 80-85. 66. Fowler D M, et al. (2011) Bioinformatics. doi:10.1093/bioinformatics/btr577. 67. Crooks G E, et al. (2004) Genome Res 14: 1188-1190. 68. Bailey T L, Gribskov M (1998) Bioinformatics 14: 48-54. 69. Grant C E, et al. (2011) Bioinformatics 27: 1017-1018. 70. Huberman J A (1997) Methods 13: 247-257. 71. Adey A, et al. (2010) Genome Biol 11: R119.

(122) From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.