Fused NHase with improved specific activity and stability

09670474 ยท 2017-06-06

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a fused NHase with improved specific activity and stability, which relates to the field of genetic engineering. This invention provides a method of overexpressing a fused NHase in E. coli and producing a mutant NHase with improved the stability and product tolerance. The invention provides a simple, efficient and safe method of making mutant NHase, and can produce a large amount of soluble NHases in a short period. The present invention makes a contribution to large-scale industrial production and further theoretical study of NHases.

Claims

1. A mutant Nitrile hydratase (NHase) comprising a fusion protein having from N-terminus to C-terminus the following NHase subunits and protein: -subunit, -subunit and activator protein, wherein said fusion protein has improved specific activity and stability compared to an NHase having the same subunits not together as a fusion protein.

2. The mutant NHase of claim 1, wherein said -subunit and said -subunit are linked by a linker, wherein the nucleotide sequence encoding said linker is set forth in SEQ ID NO: 5.

3. The mutant NHase of claim 1, wherein the amino acid sequence of said -subunit, said -subunit and said activator protein are set forth in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

4. The mutant NHase of claim 1, wherein the nucleotide sequence encoding said mutant NHase is set forth in SEQ ID NO: 7.

5. The mutant NHase of claim 1, wherein said mutant NHase is expressed by a plasmid.

6. The mutant NHase of claim 1, wherein said mutant NHase is expressed by a genetically engineered strain.

7. The mutant-NHase of claim 6, wherein said genetically engineered strain is Escherichia coli.

8. The mutant NHase of claim 6, wherein said genetically engineered strain is constructed by the following steps: a), cloning the nucleotide sequence shown in SEQ ID NO: 7 to the expression vector of pET-28a to create a recombinant plasmid; and b), transforming the recombinant plasmid into E. coli BL21.

9. A method of improving the specific activity and stability of a NHase, comprising fusing from the N-terminus to the C-terminus the following NHase subunits and protein: -subunit, -subunit and activator protein.

10. A method of producing acrylamide, comprising contacting the mutant NHase of claim 1 with a substrate to make acrylamide.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1. SDS-PAGE of the wild type NHases and the fused NHases expressed by E. coli. Line 1, molecular weight marker; line 2, the wild type NHases; line 3, the mutant NHase-(BA); line 4, the mutant NHase-(BA)P14K; line 5, the mutant NHase-(BAP14K).

(2) FIG. 2. Half-time in 50 C. of the wild type NHase and the fused NHases.

(3) FIG. 3. Product tolerance of the wild type NHase and the fused NHases.

(4) FIG. 4. The optimal pH of the wild type NHase and the fused NHases.

EXAMPLES

(5) Materials and Methods:

(6) 2YT medium: 16 g.Math.L.sup.1 tryptone, 10 g.Math.L.sup.1 yeast extract, 5 g.Math.L.sup.1 NaCl.

(7) The activity of NHase was detected by the method described as follows. The reaction mixture contained 500 L 200 mM 3-cyanopyridine and 10 l of the appropriate amount of the enzyme solution. The reaction was performed at 25 C. for 10 min and terminated with the addition of 500 L of acetonitrile. Then the supernatant was collected by centrifugation and filtered though a 0.22 m pore-size filter before measured by HPLC. One unit (U) of NHase activity is defined as the amount of enzyme that released 1 mol nicotinamide per min under these assay conditions.

(8) HPLC conditions: the mobile phase was water-acetonitrile buffer; detection wavelength was 215 nm; the column was C18 column.

Example 1: Construction of the Recombinant E. coli Expressing the Wild Type NHases-BAP14K

(9) Construction of the recombinant E. coli expressing the wild type NHases-BAP14K was carried out by the following steps:

(10) (1) Amplification of the parent NHase gene: Primers were designed according to the published sequence in NCBI to amplify the ABP14K gene encoding the parent NHase from P. Putida. The amino acid sequence of the -subunit, -subunit and regulatory subunit of the parent NHases were SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

(11) (2) Construction of recombinant plasmid containing the ABP14K gene: the amplified DNA fragment of step 1 was digested with Nde I and Hind III, and then ligated into the Nde I and Hind III sites of pET-24a to create a recombinant plasmid containing the ABP14K gene. The recombinant plasmid was named pET-24a-ABP14K.

(12) (3) Construction of recombinant plasmid containing the full-length BAP14K gene: pET-24a-ABP14K was used as a template. B gene was amplified by primer pairs B-up (SEQ ID NO: 8) and B-down(BA) (SEQ ID NO: 9), A gene was amplified by primer pairs A-up(BA) (SEQ ID NO: 10) and A-down(AP) (SEQ ID NO: 11), and the P14K gene was amplified by primer pairs P14K-up(AP) (SEQ ID NO: 12) and P-down (SEQ ID NO: 13). The same amount of B, A, P gene were used as templates and the full-length BAP14K gene was amplified by an overlap extension PCR protocol with primer pairs B-up (SEQ ID NO: 8) and P-down (SEQ ID NO: 13). The recombinant plasmid containing the BAP14K gene was named pET-24a-BAP14K, and the NHase expressed by pET-24a-BAP14K was defined as the wild type NHase.

(13) Transformation of pET-24a-BAP14K into E. coli BL21 (DE3): The recombinant plasmid pET-24a-BAP14K was transformed into E. coli BL21 (DE3). The positive transformants expressing the wild type NHase were screened.

(14) Primers used in the present invention were shown in Tab. 1.

(15) TABLE-US-00001 TABLE1 Primers SEQ ID Primer sequence(5 to3) NO B-up GGAATTCcustom character AATGGCATTCACGATACT 8 B-down CATATCTATATCTCCTTTCACGCTGGCTCCAGGTAGTC 9 (BA) A-up(BA) TGAAAGGAGATATAGATATGGGGCAATCACACACGC 10 A-down CATATCTATATCTCCTTTTAATGAGATGGGGTGGGTT 11 (AP) P14K-up TAAAAGGAGATATAGATATGAAAGACGAACGGTTTC 12 (AP) P-down CCGcustom character TCAAGCCATTGCGGCAACGA 13 B-NdeI- GGAATTCcustom character AATGGCATTCACGATAC 14 up P- GCCCcustom character TCAAGCCATTGCGGCAACGA 15 HindIII- down A- GCCCcustom character TCAATGAGATGGGGTGGGTT 16 HindIII- down Linker1- TACCTGGAGCCAGCGCCAGGTGGGCAATCACACACGCAT 17 up Linker1- CGTGTGTGATTGCCCACCTGGCGCTGGCTCCAGGTAGTC 18 down Linker2- CCCACCCCATCTCATCCAAATGGAGATATAGATATG 19 up Linker2- CATATCTATATCTCCATTTGGATGAGATGGGGTGGG 20 down Note: restriction sites were in italics and bold; overlapping sequences were underlined.

Example 2: Construction of the Recombinant E. coli Expressing the NHase-(BA)P14K

(16) The recombinant E. coli expressing the NHase-(BA)P14K was constructed by the following steps:

(17) (1) The B and A gene were fused by linker 1 (SEQ ID NO: 5) by primer pairs Linker1-up (SEQ ID NO: 17) and Linker1-down (SEQ ID NO: 18) using pET-24a-BAP14K as a template. The resulted pET-24a-(BA)P14K was used as a template to amplify the (BA)P14K gene by primer pairs B-Nde I-up (SEQ ID NO: 14) and P-Hind III-down (SEQ ID NO: 15). The amplified (BA)P14K fragment was then digested with Nde I and Hind III, ligated into the Nde I and Hind III sites of pET-28a. The resulted recombinant plasmid pET-28a-(BA)P14K could express a fused NHase (nucleotide sequence shown in SEQ ID NO: 6), whose - and -subunits were fused together and the regulatory subunit was coexpressed. The NHase expressed by pET-28a-(BA)P14K was defined as NHase-(BA)P14K.

(18) (2) The recombinant plasmid pET-28a-(BA)P14K was transformed into E. coli BL21 (DE3). Positive transformants expressing the NHase-(BA)P14K were screened.

Example 3: Construction of the Recombinant E. coli Expressing the NHase-(BAP14K)

(19) The recombinant E. coli expressing the NHase-(BAP14K) was constructed by the following steps:

(20) Primer pairs Linker2-up (SEQ ID NO: 19) and Linker2-down (SEQ ID NO: 20) were used to connect the A gene and P14K gene and pET-28a-(BA)P14K was the template. The resulted plasmid pET-28a-(BAP14K) contained a fused NHase gene whose B, A, and P14K gene fragments were fused together (nucleotide sequence shown in SEQ ID NO: 7). The NHase expressed by pET-28a-(BAP14K) was defined as NHase-(BAP14K).

(21) The recombinant plasmid pET-28a-(BAP14K) was transformed into E. coli BL21 (DE3). The positive transformants expressing the NHase-(BAP14K) were screened.

Example 4: Expression and Characterization of the NHases

(22) The E. coli recombinants obtained in example 1-3 were used to express the NHases.

(23) The E. coli recombinants were firstly cultivated in 10 ml of liquid 2YT medium containing 50 g/ml kanamycin at 37 C., then transferred to 500 ml of liquid 2YT medium with 1% inoculation. When OD.sub.600 of the culture reached 0.8, IPTG was added to a final concentration of 0.4 mM to induce NHase expression, and CoCl.sub.2.6H.sub.2O was added to a final concentration of 0.05 g/l to obtain mature NHase. The culture was subsequently incubated at 24 C. for 16 h and then the cells were harvested for SDS-PAGE.

(24) Results indicated that the wild type NHase, NHase-(BA)P14K and NHase-(BAP14K) were successfully expressed, as shown in FIG. 1. The line 3 represented the mutant NHase-(BA) whose -subunit and -subunit were just fused in the absence of the regulatory subunit.

(25) The characteristics of the subunits fused NHases:

(26) Specific Activity

(27) Determination of NHases was conducted by the following method. The E. coli recombinants were collected by centrifugation and resuspended with a 0.01M phosphate buffer (pH 7.5) twice before ultrasonic disruption. The enzyme in the supernatant was purified and then the enzyme activity was detected by HPLC.

(28) Compared with 324.8 U/mg of the wild type NHase, the specific activity of NHase-(BA)P14K and NHase-(BAP14K) were 499.2 U/mg and 452.5 U/mg, which were increased by 53.7% and 39.3%, respectively. In addition, the specific activity of NHase-(BA) (FIG. 1, line 3) was 69.1 U/mg, indicating that the P14K was also necessary for cobalt incorporation in the fused NHase.

(29) Furthermore, the kinetic parameters (K.sub.m, V.sub.max, k.sub.cat and k.sub.cat/K.sub.m) of NHase-(BA)P14K and NHase-(BAP14K) were compared with the wild-type NHase. Results showed that the k.sub.cat value of NHase-(BA)P14K (723.4 s.sup.1) and NHase-(BAP14K) (676.5 s.sup.1) were both approximately 2-fold of the wild-type NHase (335.1 s.sup.1), indicating that the fused NHases exhibited faster catalyze rate. In addition, the k.sub.cat/K.sub.m value of NHase-(BA)P14K (11.8.Math.10.sup.3 s.sup.1M.sup.1) was about 1.5 fold of the wild-type NHase (8.1.Math.10.sup.3 s.sup.1M.sup.1), indicating higher catalytic efficiency of NHase-(BA)P14K.

(30) Thermostability

(31) The thermostability of the NHases was measured by the following steps. First, the eppendorf tube containing the enzyme solution was placed in a metal bath at 50 C. for a while before placed on ice. And then, the tube was placed at 25 C. in the metal bath and 200 mM 3-cyanopyridine (substrate) was added to it. Ten minutes later, acetonitrile was added to terminate the reaction.

(32) As shown in FIG. 2, the half-life times of NHase-(BA)P14K and NHase-(BAP14K) were 26 min and 18 min, respectively, while that of the wild-type NHase was 9 min. Results suggested that the NHase-(BA)P14K and NHase-(BAP14K) exhibited higher thermostability than the wild-type NHase.

(33) Product Tolerance of the NHases

(34) The product tolerance of the NHases was measured by the following method. The reaction was conducted in 20 mM 3-cyanopyridine (substrate) with and without 0.5 M nicotinamide (product) for 10 min. The reduction of 3-cyanopyridine in each reaction was measured (FIG. 3), and the reduction ratio (the proportion of the reduced 3-cyanopyridine amount in the reaction with and without 0.5 M nicotinamide) was calculated.

(35) Results showed that the consumption of substrate of NHase-(BA)P14K and NHase-(BAP14K) in product containing reaction systems were increased by 26% and 18%, respectively compared with the wild type NHase, and increased by 23% and 15% respectively in reaction systems without product. In addition, the reduction ratios of NHase-(BA)P14K (0.86) and NHase-(BAP14K) (0.83) were higher than that of the wild type (0.80), indicating that the fused NHases exhibited stronger product tolerance than that of the wild type.

(36) The Optimum pH

(37) The enzyme activities of the fused NHases were measured under different pH and compared with the wild type, and the activity under their respective optimum pH was defined as 1(100%). As shown in FIG. 4, the optimum pH of the three NHases were about 7.5.

(38) These data showed that the specific activity, thermostability and product tolerance of NHase could be significantly increased by fusing the subunit and the subunit with the regulatory subunit fused or coexpressed at the same time.

(39) While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, appendices, patents, patent applications and publications, referred to above, are hereby incorporated by reference.