GENETICALLY MODIFIED RAT HAVING PKHD1L1 GENE WITH POINT MUTATION AND METHODS FOR ITS CONSTRUCTION, DETECTION AND USE

Abstract

A genetically-modified rat having a PKHD1L1 gene with a point or other mutation and a construction method thereof are disclosed. A CRISPR/Cas9 system knocks the PKHD1L1 gene into a mouse source, and a codon changes from TTA to TCA to construct the mutant PKHD1L1 gene. The genetically-modified rat can be applied to epilepsy pathogenesis studies and design and testing of new anti-epileptic drugs. Methods for detecting abnormal cortical excitability and detecting an epileptic phenotype of an animal can use the genetically-modified rat. A somatosensory evoked potential is used to detect whether the genetically-modified rat has an abnormal cortical excitability phenotype, so as to confirm whether the rat can be a successful model for testing anti-epileptic drugs. The method can detect abnormal cortical excitability and verify the effectiveness of anti-epileptic drugs or treatments.

Claims

1. A method for constructing a rat model with a PKHD1L1 gene point mutation, comprising designing single-guide RNA (sgRNA) using introns 22-23 and introns 24-25 of a PKHD1L1 gene as target sequences, annealing the sgRNA, ligating the sgRNA into a plasmid vector with a T7 promoter, transcribing the plasmid vector in vitro to obtain Cas9/sgRNA, injecting the Cas9/sgRNA and a targeting vector into fertilized rat eggs to obtain gene-edited fertilized eggs, and placing the gene-edited fertilized eggs in a uterus of pseudopregnant mice to obtain F.sub.0 generation rats having a PKHD1L1 gene point mutation chimeric.

2. The method described in claim 1, further comprising amplifying introns 22-23 by a polymerase chain reaction (PCR) using primer pairs including PKHD1L1-5 MSD-F and PKHD1L1-5 MSD-R), wherein a nucleotide sequence of PKHD1L1-5 MSD-F is shown in SEQ ID NO: 1 and a nucleotide sequence of PKHD1L1-5 MSD-R is shown in SEQ ID NO: 2, and amplifying introns 24-25 by the PCR using primer pairs including PKHD1L1-3 MSD-F and PKHD1L1-3 MSD-R, wherein a nucleotide sequence of PKHD1L1-3 MSD-F is shown in SEQ ID NO: 3 and a nucleotide sequence of PKHD1L1-3 MSD-R is shown in SEQ ID NO: 4.

3. The method described in claim 2, wherein the PCR includes conditions of 94 C. for 5 min; 94 C. for 30 s, 62 C. for 30 s, 72 C. at 1 kb/min, 30 cycles, and 72 C. for 10 min.

4. The method described in claim 1, wherein the sgRNA has a sequence as shown in SEQ ID NO: 5 and SEQ ID NO: 6.

5. The method described in claim 1, wherein the plasmid vector with the T7 promoter includes a pCS-3G vector.

6. The method described in claim 1, wherein the sgRNA is ligated into the pCS-3G vector by annealing polymerization to form a connected product, and the connected product is transcribed in vitro to obtain the Cas9/sgRNA.

7. The method described in claim 1, wherein the targeting vector has a nucleotide sequence shown as SEQ ID NO: 27.

8. The method described in claim 1, further comprising, after obtaining the F.sub.1 generation rats, identifying the rats having the PKHD1L1 gene point mutation chimeric by PCR, wherein the F.sub.0 generation rats having the PKHD1L1 gene point mutation chimeric include: when using PKHD1L1-L-GT-F (SEQ ID NO: 7) and PKHD1L1-L-GT-R (SEQ ID NO: 8) for PCR identification, amplifying a 2662 bp sequence, and when using PKHD1L1-R-GT-F (SEQ ID NO: 9) and PKHD1L1-R-GT-R (SEQ ID NO: 10) for PCR identification, amplifying a 2697 bp sequence.

9. The method described in claim 8, wherein the PCR for identifying the rats having the PKHD1L1 gene point mutation chimeric includes pre-denaturing at 94 C. for 2 min; denaturing at 98 C. for 10 s, annealing at 67 C. for 30 s, extending at 68 C. at 1 kb/min, 15 cycles, annealing at a temperature of 0.7 C. per cycle; denaturing at 98 C. for 10 s, annealing at 57 C. for 30 s, extending at 68 C. at 1 kb/min, 25 cycles; and extending at 68 C. for 10 min.

10. A PKHD1L1 gene point mutation rat model, obtained by the method described in claim 1.

11. A method for constructing a stable genetic PKHD1L1 gene point mutation rat model, comprising mating the F.sub.0 generation rat having the PKHD1L1 gene point mutation chimeric obtained by the method described in claim 1 with wild-type rats, wherein the stable genetic PKHD1L1 gene point mutation rat model is a heterozygote of an F.sub.1 generation.

12. The method described in claim 11, further including identifying the heterozygote of the F.sub.1 generation by genotype identification.

13. The method described in claim 12, wherein the genotype identification includes PCR identification, Southern blot identification, or sequencing identification.

14. A stable genetic PKHD1L1 gene point mutation rat model, obtained by the method described in claim 11.

15. (canceled)

16. (canceled)

17. The method of described in claim 14, wherein the method for detecting cortical excitability abnormalities includes somatosensory evoked potentials.

18. A method of detecting a phenotype in an epileptic animal model, comprising fixing a head and limbs of the epileptic animal model in a prone position, electrically stimulating a posterior tibial nerve by the skin, inserting a recording needle electrode into a subcutaneous region of a Cz region of a cranial roof, inserting a reference needle electrode into a subcutaneous region above a nose, filtering and amplifying an extracted signal, inputting the extracted signal to a system, measuring a peak latency according to an output somatosensory evoked potential, evaluating a cortical excitability, and determining whether the animal model is epileptic according to the cortical excitability.

19. The method described in claim 18, wherein the electrical stimulation includes parameters comprising a constant pressure square wave having a wave width of 0.1 ms, a frequency of 3 Hz, and an intensity sufficient to cause back toe micro-movement, and a subcutaneous needle is grounded on a back.

20. The method described in claim 18, wherein after the extracted signal is filtered and amplified, the extracted signal is input to the system to measure the peak latency according to the output somatosensory evoked potential by inputting the filtered and amplified extracted signal to a computer operating system for average superposition, wherein a number of superposition times is 1024, an analysis time is 56 ms, and the system displays and prints somatosensory evoked potential graphics to measure the peak latency.

21. The method described in claim 18, wherein the epileptic animal model includes a rat epileptic model or a mouse epileptic model.

22. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] FIG. 1 shows the sequence of an exemplary PKDH1L1 gene mutation.

[0030] FIG. 2 is a diagram showing an exemplary construction strategy for a targeting vector useful in the present invention.

[0031] FIG. 3 shows the plasmid map of precut pCS-3G.

[0032] FIG. 4 shows the map of the targeting vector, created with SnapGene.

[0033] FIGS. 5A-B are graphs showing the activity detection results of various sgRNA sequences in accordance with the present invention.

[0034] FIG. 6 is a reproduction of a Southern blot showing the results of RNA electrophoresis at 65 C. for 5 min, in which sg1 refers to PKHD1L1-sgRNA1, and sg2 refers to PKHD1L1-sgRNA12;

[0035] FIG. 7 is a reproduction of a Southern blot showing the results of F.sub.0-generation identification by PCR using PKHD1L1-L-GT-F/PKHD1L1-L-GT-R in accordance with the present invention.

[0036] FIG. 8 is a reproduction of a Southern blot showing the results of F.sub.0-generation identification by PCR using PKHD1L1-R-GT-F/PKHD1L1-R-GT-R in accordance with the present invention.

[0037] FIG. 9 is a reproduction of a Southern blot showing the results of F.sub.1-generation identification by PCR using PKHD1L1-L-GT-F/PKHD1L1-L-GT-R in accordance with the present invention.

[0038] FIG. 10 is a reproduction of a Southern blot showing the results of F.sub.1-generation identification by PCR using PKHD1L1-R-GT-F/PKHD1L1-R-GT-R in accordance with the present invention.

[0039] FIG. 11 is a reproduction of a Southern blot from an exemplary analysis of F.sub.1-generation positive rats in accordance with the present invention.

[0040] FIG. 12 shows an exemplary genotype sequencing analysis of wild-type, heterozygous and positive F.sub.1 generation rats in accordance with the present invention.

[0041] FIGS. 13A-C are graphs showing the results of epileptic susceptibility determinations in wild-type rats and PKHD1L1+/ rats in accordance with the present invention.

[0042] FIGS. 14A-F are waveforms (FIGS. 14A and 14D) and graphs (FIGS. 14B-C and 14E-F) showing the effect of H89 on sEPSC/sIPSC measurements of cortical pyramidal neurons, in which FIG. 14A shows sEPSC currents of pyramidal neurons in groups of control, epileptic and treated rats, FIG. 14B shows the sEPSC amplitudes in pyramidal neurons in the rats, FIG. 14C shows the sEPSC frequencies in pyramidal neurons in the rats, FIG. 14D shows sIPSC currents in pyramidal neurons of each group of rats; FIG. 14E shows sIPSC amplitudes in the pyramidal neurons in the rats; and FIG. 14F shows sIPSC frequencies in the pyramidal neurons in the rats (3 rats in each group and 6 cells in each group, * refers to P<0.05, and ** refers to P<0.01).

[0043] FIGS. 15A-B are graphs showing the effect of H89 on the Na+ and K+ currents in the cerebral cortex of the control, epileptic and treated groups of rats, wherein FIG. 15A shows the Na+ currents in the pyramidal neurons of the rats, and FIG. 15B shows the K+ currents in the pyramidal neurons of the rats (3 rats in each group, 6 cells in each group, P<0.05).

[0044] FIGS. 16A-F are waveforms (FIGS. 16A-B) and graphs (FIGS. 16C-F) showing the effect of H89 on the action potential of pyramidal neurons in the cerebral cortex of the control, epileptic and treated rats, wherein FIG. 16A are waveforms of the action potential of pyramidal neurons in the cerebral cortex of rats in each group, FIG. 16B are sample single action potentials of pyramidal neurons in each group of rats, FIG. 16C is a graph showing the action potential threshold of the pyramidal neurons in each group of rats, FIG. 16D is a graph showing the positive post-potential recovery of the action potential in each group of rats, FIG. 16E is a graph showing the half-duration of the action potential in each group of rats, and FIG. 16F is a graph showing the peak action potential in each group of rats (3 rats per group, 6 cells in each group, and * refers to P<0.05).

[0045] FIG. 17 is a diagram of an exemplary family with a history of familial adult myoclonic epilepsy.

DETAILED DESCRIPTION OF EMBODIMENTS

[0046] The invention concerns a method for constructing a genetically-modified rat having a PKHD1L1 gene with a mutation (e.g., a point mutation) therein, including the following steps: designing single-guide RNA (sgRNA) using introns 22-23 and introns 24-25 of a PKHD1L1 gene as target sequences, annealing the sgRNA, ligating the annealed sgRNA to a plasmid vector with a T7 promoter, and transcribing the plasmid vector in vitro to obtain Cas9/sgRNA. The Cas9/sgRNA and a targeting vector are injected into fertilized rat eggs to obtain gene-edited fertilized eggs, and the gene-edited fertilized eggs are placed or inserted into a uterus of one or more pseudopregnant mice (e.g., with false pregnancy) to obtain F.sub.0 generation, chimeric rats with the mutant PKHD1L1 therein.

[0047] The PKHD1L1 gene in the invention is preferably selected from a family with a history of familial adult myoclonic epilepsy. A family diagram showing such a family is shown in FIG. 17. The family has a total of 30 people in five generations and 6 patients with familial adult myoclonic epilepsy (identified in black), which conforms to the characteristics of autosomal dominant inheritance. All patients had myoclonic seizures with or without generalized tonic-clonic seizures and subtle tremors at the distal extremity. The onset of seizures was adult. Electroencephalographic examination (EEG) indicated bilateral symmetric spinoid-slow wave release, and evoked potential testing showed positive giant potential(s) and C-reflex. Anti-epileptic drug treatment effectively controlled the seizures, and the disease course was benign. All members of the family were effectively diagnosed and their clinical phenotypes were consistent. By whole genome exon sequencing combined with linkage analysis, it was found that 5 patients (1 of the 6 patients had died, as indicated by the slash through the black square in FIG. 17) had heterozygous mutations of the PKHD1L1 gene exon 23:c.2602A>T, and 11 family controls were homozygous with co-segregation.

[0048] The PKHD1L1 gene was further screened in 246 cases (e.g., persons) from a normal population, matched by age, sex, region and ethnicity, and did not find the mutation in the normal population. Therefore, the heterozygous mutation of the PKHD1L1 gene exon 23:c.2602A>T (see FIG. 1) was preliminarily confirmed as a pathogenic mutation in the family in FIG. 17.

[0049] The PKHD1L1 gene that encodes the polycystic kidney and hepatic disease 1-like protein 1 is on the positive chain of chromosome 7, and has a total length of about 172.46 kb. The Gene ID of this gene in Rattus norvegicus (Norway rats) is 314917. In one example, a PKHD1L1-201 transcript (ENSRNOT00000005958.7, NM_001034931; referred to hereinafter as the example PKHD1L1 gene) was used to conduct a point mutation study in rats. Specifically, amino acid Lys at 867 of the example PKHD1L1 gene was mutated to Ser by a CRISPR/Cas9 system, the corresponding base was changed from TTA to TCA, and the sgRNA was designed using intron(s) 22-23 and intron(s) 24-25 (FIG. 2).

[0050] In one embodiment, in order to ensure the efficiency of the designed Cas9/sgRNA, PCR amplification and sequencing verification was performed on the single-stranded DNA (SD) rat target site sequence to ensure that the sgRNA recognition sequence is completely consistent with the SD rat DNA sequence. When the primers included PKHD1L1-5 MSD-F (SEQ ID NO: 1) and PKHD1L1-5 MSD-R (SEQ ID NO: 2), the amplified product has a length of 754 bp. When the primers included PKHD1L1-3 MSD-F (SEQ ID NO: 3) and PKHD1L1-3 MSD-R (SEQ ID NO: 4), the amplification product has a length of 569 bp. The PCR amplification procedure and conditions preferably include a temperature of 94 C. for 5 min; a temperature of 94 C. for another 30 s, a temperature of 62 C. for 30 s, a temperature of 72 C. at 1 kb/min, carried out for 30 cycles; and a temperature of 72 C. for 10 min. The PCR products were sequenced, and the results showed that the SD rat target sequence was completely consistent with the sequence obtained from Genebank and Ensembl, and are suitable for point mutated sgRNA target genes.

TABLE-US-00001 TABLE1 Primersforamplificationofrat targetsequencesbyPCR SEQ Prod. ID Tm size Primer Sequence(5-3) NO (C.) (bp) PKHD1L1-5 GCATCAAGCTTGGTACCGATAAT 1 61 754 MSD-F CACAAGACACAATAGACGCAGA PKHD1L1-5 ACTTAATCGTGGAGGATGATCTT 2 63 MSD-R GCTTCACAAACAAAGGGACCTG PKHD1L1-3 GCATCAAGCTTGGTACCGATGAC 3 60 569 MSD-F AGAAGCAAAGCCAGAGAATAAA PKHD1L1-3 ACTTAATCGTGGAGGATGATGAA 4 60 MSD-R GTTTACATAACTCAAGCAGTCCA

[0051] Two sgRNAs were designed and made based on the target gene(s), and the sgRNAs are specifically PKHD1L1-sgRNA1 (SEQ ID NO: 5) and PKHD1L1-sgRNA12 (SEQ ID NO: 6; see Table 2). The sgRNA(s) are optimally connected to a pCS-3G carrier (shown in FIG. 3) by annealing polymerization, and the connected product is converted into a sample for sequencing verification (e.g., Cas9/sgRNA that can be microinjected). The annealing polymerization preferably includes annealing at 65 C. for 5 min.

TABLE-US-00002 TABLE2 sgRNAsequence SEQ ID sgRNA GuideRNAsequence NO PKHD1L1-sgRNA1 GGTAGGCTAGACTTTAA 5 PKHD1L1-sgRNA2 GGCCTTCGTATTAGCTATA 11 PKHD1L1-sgRNA3 GGAATCCCTATAGCTAATACGA 12 PKHD1L1-sgRNA4 GGCTACTATGTTAAATATG 13 PKHD1L1-sgRNA5 GGAGTCTTAAAGTGAACC 14 PKHD1L1-sgRNA6 GGGAAGTTAAGAAACACAAT 15 PKHD1L1-sgRNA7 GGCACCTGTGGGCATGTGTAGA 16 PKHD1L1-sgRNA8 GGTCACCCTTAAGCCCCCAAAA 17 PKHD1L1-sgRNA9 GGTCTACATGTATGTCACCACC 18 PKHD1L1-sgRNA10 GGTTAATTTAGTCATGTATA 19 PKHD1L1-sgRNA11 GGTCAAATAACTAGAACTGC 20 PKHD1L1-sgRNA12 GGAAAGTTGAGTGTTCCA 6 PKHD1L1-sgRNA13 GGAAGTTATTTGTTATGAA 21 PKHD1L1-sgRNA14 GGAAATCTGGGTCCTTAGAA 22

[0052] The plasmid profile of the targeting vector for microinjection is shown in FIG. 4, and the nucleotide sequence of the targeting vector is shown in SEQ ID NO: 27.

[0053] Cas9/sgRNA and the targeting vector were microinjected into fertilized eggs of rats, and the F.sub.0 rats were born after the injection (and implantation into female mice or other suitable rodent hosts, such as rats, with false pregnancy). The Fo rats obtained were chimeras due to the rapid cleavage rate of the embryos in the early stage, and the chimeric rats were also identified by PCR after the F.sub.0 generation. Chimeric rats are positive for both PKHD1L1-L-GT-F/PKHD1L1-L-GT-R (2662 bp) and PKHD1L1-R-GT-F/PKHD1L1-R-GT-R (2697 bp).

[0054] Preferably, PCR identification uses a Touchdown mode, and constructs the reaction system according to the instruction manual for KOD-FX enzyme (available from Toyobo Co., Ltd., Osaka, Japan). The PCR identification procedure preferably includes: pre-denaturing at 94 C. for 2 min; denaturing at 98 C. for 10 s, annealing at 67 C. for 30 s, extending at 68 C. at 1 kb/min, and repeating the denaturing, annealing, and extending steps for a total of 15 cycles, annealing at a temperature of 0.7 C. per cycle; a second denaturing at 98 C. for 10 s, a second annealing at 57 C. for 30 s, a second extending at 68 C. at 1 kb/min, and repeating the second denaturing, annealing, and extending steps for a total of 25 cycles; and finally extending at 68 C. for 10 min.

TABLE-US-00003 TABLE3 Primersforidentificationof pointmutationchimera SEQ ID Tm Product Primer Sequence(5-3) NO (C.) size(bp) PKHD1L1- tgcagatgttgtga 7 60 Mut:2662 L-GT-F gaaaagcaagaca PKHD1L1- ccagtcttgatgtt 8 59 WT:2650 L-GT-R ttatagatacttcc cc PKHD1L1- tccaatccatttat 9 62 Mut:2697 R-GT-F gtggatgccgtgt PKHD1L1- aggatgcttgaatc 10 60 WT:2680 R-GT-R tttcttctaagggg

[0055] The invention also concerns a method for constructing a stable genetically modified rat with a point mutation in a PKHD1L1 gene, including the following steps: mating an F.sub.0 generation chimeric rat with the point mutation (which may be obtained by the present method of constructing the F.sub.0 generation chimeric rat) with a wild-type rat to produce an F.sub.1 generation including the stable genetically modified rat with the point mutation in the PKHD1L1 gene. The F.sub.1 generation rat with the PKHD1L1 gene point mutation is genetically stable and heterozygous.

[0056] In the present invention, the F.sub.0 generation genotype-positive rat is selected to mate with one or more wild-type rats to obtain the F.sub.1 generation rat with a stable genotype. The genotype of the F.sub.1 generation rats is identified by PCR, Southern blot analysis and sequencing, in which the PCR for identification is the same or substantially the same as that for constructing and/or determining the F.sub.0 generation, and it will not be repeated here. EcoRV and Spel were used as restriction enzyme sites for Southern blot analysis. Correct recombination was determined and/or detected using 3 Probe-A. When recombination is correct, two bands, wild-type and mutant type, appear (e.g., in the Southern blot). Random insertion was determined and/or detected using LR Probe-A. When no random insertion is detected, two bands, wild-type and mutant type, appear (e.g., in the Southern blot).

TABLE-US-00004 TABLE4 Primerinformationof3Probe-A andLRProbe-A Product SEQ Sequence size Tm ID Primer (5-3) (bp) (C.) NO PKHD1L1-LR- aggatctctggc 470 60 23 Probe-A-F caacttcattgg PKHD1L1-LR- ttctgtttctaa 55 24 Probe-A-R tgttagtggaaa tgc PKHD1L1-3 ccagtccccaga 546 61 25 Probe-A-F acaattggctag a PKHD1L1-3 actgtgtggagg 61 26 Probe-A-R caaagaagcatga

[0057] For F.sub.1 and successive generations with point mutations, heterozygous and homozygous genotypes can also be detected by PCR validation and sequencing. The primers used for this detection include PKHD1L1-R-GT-F and PKHD1L1-L-GT-R, and the optimized conditions include a first stage at a temperature of 94 C. for 5 min, a cycling stage including a temperature of 94 C. for 30 s, a temperature of 62 C. for 30 s, a temperature of 72 C. at 1 kb/min, and a total of 30 cycles; and a final stage at a temperature of 72 C. for 10 min. Since the mutated and the wild-type sequences are both 625 bp, the homozygous, heterozygous and wild-type genotypes are confirmed by sequencing.

[0058] The invention also concerns methods of screening and/or developing epilepsy drugs, using a genetically modified rat having a PKHD1L1 gene with a point mutation therein or a stable genetically modified rat with the point mutation in the PKHD1L1 gene. The (stable) genetically modified rat may be obtained by one or more of the present construction methods.

[0059] The invention also provides a method of or application for detecting abnormal cortical excitability and/or detecting or determining a phenotype of an epileptic or possibly epileptic animal.

[0060] The method of detecting abnormal cortical excitability preferably includes determining (e.g., testing or obtaining) a somatosensory evoked potential (SEP) in the animal. There is no special limitation on the specific construction method or animal, although the animal is preferably a rat, mouse or zebrafish. A genetically-modified rat is an example and/or embodiment of the invention, but the invention is not limited to genetically-modified rats.

[0061] A mutation in the PKHD1L1 gene exon 23:c.2602A>T (which may be heterozygous) was confirmed as a pathogenic mutation in the family shown in FIG. 17 through a pathogenicity study of familial adult myoclonic epilepsy (FAME) in the family, and in one example, a CRISPR/Cas9 system was used to knock in the P.L867S mutation into the PKHD1L1 gene to change the corresponding codon from TTA to TCA, resulting in the construction of a PKHD1L1 point-mutant rat. An electrophysiological examination of the epileptic seizure patients in the family in FIG. 17 found increased cortical excitability (e.g., relative to a reference standard, an average for patients without epileptic seizures, or family members who do not experience epileptic seizures), and the seizures were effectively controlled by anti-epileptic drug treatment. At the same time, the genetically modified rats having or expressing the mutant PKHD1L1 gene constructed in accordance with the invention showed significantly shorter incubation periods and increased SEP amplitudes, compared with wild-type rats with matching body weight, suggesting that the cortical excitability of PKHD1L1+/ rats was significantly higher than that of wild-type rats. This study further verified the increased cortical excitability of PKHD1L1+/ rats, which can better simulate the FAME phenotype and phenotypes of other epilepsy patients, and can be further applied to research into the pathogenesis of epilepsy and the design and testing of new anti-epileptic drugs.

[0062] The invention concerns a method for detecting a phenotype in an epileptic or possibly epileptic animal (e.g., an epileptic animal model), which comprises the following steps: fixing the head and limbs of the animal in a prone position, electrically stimulating the posterior tibial nerve of the ankle of a hind limb (e.g., the right hind limb) through the skin, subcutaneously placing a recording needle and/or electrode into the Cz region of the cranial roof, and subcutaneously placing a reference needle and/or electrode into an area above the nose (e.g., the bridge of the nose, the forehead, etc.).

[0063] The method for detecting a phenotype in an epileptic or possibly epileptic animal may further comprise extracting a signal (e.g., from the recording needle and/or electrode). After the extracted signal is filtered and amplified, an input system measures the peak latency according to one or more somatosensory evoked potentials (e.g., in or derived from the signal), evaluates a cortical excitability (e.g., based on the somatosensory evoked potential[s]), and determines whether the animal is epileptic according to the cortical excitability (or a level or value thereof).

[0064] Electrically stimulating the posterior tibial nerve may include transmitting a constant pressure square wave with a pulse or wave width of 0.1 ms and a frequency of 3 Hz (e.g., to the nerve). The intensity of the square wave may be sufficient to cause movement (e.g., micro-movement) in the back toe. Electrically stimulating the posterior tibial nerve may further include subcutaneously placing a needle in the back of the animal, and the needle may be grounded. The method for detecting a phenotype in an animal optimally filters and amplifies the extracted signal, and inputs it into a computer operating system for determining an average superposition (e.g., of the extracted signal). The average superposition may be determined from 1024 instances (e.g., superpositions), the analysis time may be 56 ms, and the computer operation system may be configured to display and print a pattern of somosensory evoked potentials to determine or measure a peak latency (e.g., of the somosensory evoked potentials, the pattern thereof, the average superposition, etc.).

[0065] In order to further illustrate the invention, the construction of a genetically-modified, mutant rat as a model for epilepsy and an application thereof are described in detail in combination with the accompanying drawings and below examples, but the invention is not limited to the drawings or examples.

Example 1: Screening for Disease-Causing Mutated Genes

[0066] In the family shown in FIG. 17 (Family 1), there are 30 people in five generations, of whom 6 had the disease (e.g., epilepsy), all 6 of which were consistent with autosomal dominant inheritance. All 6 patients had myoclonic seizures with or without generalized tonic-clonic seizures, and with or without subtle tremors at the distal extremity. The onset of seizures was adult, and electrophysiological examination showed increased cortical excitability. The seizures were effectively controlled by anti-epileptic drug treatment, and the course of the disease was benign. All patients in Family 1 were diagnosed clearly, and their clinical phenotypes were consistent. Whole genome exon sequencing combined with linkage analysis showed that 5 patients (1 of the 6 patients had died) had heterozygous mutations in PKHD1L1 gene exon 23:c.2602A>T, and 11 controls were homozygous with co-segregation.

[0067] The PKHD1L1 gene was screened in 246 normal people matched by age, sex, region, and ethnicity, and the mutation site could not be found in the normal population, so it was preliminarily confirmed by genetics that this site in PKHD1L1 was a pathogenic mutation in this family.

TABLE-US-00005 TABLE 5 Clinical data of Family 1 patients Age Seizure G.sup.1 (Yrs) Onset.sup.2 type T.sup.3 P.sup.4 SEP.sup.5 C.sup.6 AEDs Cure.sup.7 II1 M D.sup.8 58 GTC + NA NA NA PHT No seizure III3 F 59 40 M.sup.9 + + NA 38.0 + PHT No GTC seizure III7 F 52 38 M + + NA 75.5 + PB No GTC and seizure PHT III9 M 49 30 M + + NA 19.04 + PB No GTC and seizure PHT IV6 F 36 35 M + NA 22.28 + PHT No GTC seizure IV1 M 24 11 M + + NA 11.97 + VPA No 1 GTC seizure .sup.1G: Gender .sup.2Age of patient in years at time of disease onset. .sup.3T: tremor .sup.4P: Polycystic kidney/polycystic liver .sup.5SEP: Upper limb SEP (P25-N 30), in V. .sup.6C: C reflex .sup.7Cure: AED Curative effect. .sup.8D: Deceased .sup.9M: Myoclonus

[0068] Preparation of the genetically-modified rat in knock-in mode using a PKHD1L1gene (Gene ID: 314917, Pkhd111-201 transcript ENSRNOT00000005958.7, NM_001034931):

1. Cas9/sgRNA Design and Construction

1.1 Cas9/sgRNA Design

[0069] Based on sgRNA design principles, 7 sgRNAs were designed in the 5 target site and 3 target site area, respectively (Table 1).

1.2 Construction of Cas9/sgRNA Plasmid

[0070] The sgRNA sequence synthesis primers shown in Table 1 were designed and connected to the pCS-3G carrier shown in FIG. 3 by annealing polymerization (65 C., 5 min). After the conversion of the connected product, the sample was sent for sequencing verification.

[0071] The CRISPR/Cas9 activity detection method developed by Bioxetus-UCATM was used to detect sgRNA activity, and the results are shown in FIGS. 5A-B. PKHD1L1-sgRNA1 (Guide #1) and PKHD1L1-sgRNA12 (Guide #12) were selected to carry out the next experiment.

1.3 RNA Preparation of sgRNA

[0072] PKHD1L1-sgRNA1 and PKHD1L1-sgRNA12 were connected to plasmid vectors with a T7 promoter and transcribed in vitro to obtain RNA for microinjection (FIG. 6).

[0073] 1.4 Construct the Targeting Vector Shown in FIG. 4.

[0074] 1.5 Microinjection of Cas9/sgRNA

[0075] Cas9/sgRNA and the targeting vector were microinjected into fertilized rat eggs, and the rat eggs injected with the Cas9/sgRNA and the targeting vector were implanted into female mice exhibiting false pregnancy. Data for the F.sub.0 rats at/after birth is shown in Table 6.

TABLE-US-00006 TABLE 6 Birth statistics of F.sub.0 rats Number of transferred Number of Positive Date Family zygotes Due date births number 2018 Jan. 12 SD 210 2018 Feb. 3 41 0 2018 Mar. 30 SD 250 2018 Apr. 21 35 2 2018 Apr. 8 SD 328 2018 Apr. 30 44 5

1.6 Genotype Detection of F.SUB.0 .Generation Rats

[0076] Primers PKHD1L1-L-GT-F/PKHD1L1-L-GT-R (Mut: 2662 bp, WT: 2650 bp) and PKHD1L1-R-GT-F/PKHD1L1-R-GT-R (Mut: 2697 bp, WT: 2680 bp) were identified by PCR, and the genotype of the F.sub.0 generation rats was conventionally determined. The results are shown in FIGS. 7 and 8. The PCR products and sequencing showed that EY55-072 and EY55-073 are positive F.sub.0 rats.

1.7 Genotypes and Southern Blot Identification of F.SUB.1 .Generation Rats

[0077] An F.sub.0 generation rat having a positive genotype were selected to mate with a wild-type rat to obtain F.sub.1 generation rats with a stable positive genotype (e.g., for having or exhibiting a positive phenotype for epilepsy). The mating results are shown in Table 7.

TABLE-US-00007 TABLE 7 Mating statistics No. Rat OD Mating date Maturity date Birth number Positive EY55-073 () 2018 May 24 2018 Jun. 14 24 10

1.7.1 Genotype Identification of F.SUB.1 .Generation:

[0078] The primers for identification of F.sub.1 generation rats are the same and/or were designed according to the same procedure(s) as those in the method of genotype identification and/or detection in the F.sub.0 generation. The results are shown in part in FIGS. 9 and 10. PCR identification and point mutation site sequencing are used to obtain the results. The results indicated that 1EY55-025, 1EY55-027, 1EY55-029, 1EY55-030, 1EY55-031, 1EY55-032, 1EY55-034, 1EY55-035, 1EY55-036, 1EY55-037 and 1EY55-038 were positive F.sub.1 generation rats.

1.7.2 Southern Blot Analysis of F.SUB.1 .Generation Positive Rats

[0079] The DNA of F.sub.1 generation rats (e.g., obtained from the tail) identified as positive by PCR was extracted and tested by Southern blotting and sequencing. The test results are shown in FIG. 11, and show that 1EY55-025, 1EY55-027, 1EY55-029, 1EY55-030, 1EY55-031, 1EY55-032, 1EY55-034, 1EY55-036, 1EY55-037 and 1EY55-038 are correctly reassembled and do not have a random insertion.

1.7.3 Genotype Analysis

[0080] Primers PKHD1L1-R-GT-F and PKHD1L1-L-GT-R were used for PCR validation and sequencing on positive F.sub.1 generation mice with correct recombination and no random insertions. The results are shown in FIG. 12, where Mut/Mut refers to a homozygous genotype, Mut/+ refers to a heterozygous genotype, and +/+ refers to a wild-type genotype.

Example 2

[0081] The epileptic behavior and phenotype(s) of rats having the PKHD1L1 gene with the point mutation constructed in Example 1 were analyzed.

[0082] Three male heterozygous rats having the PKHD1L1 gene with the point mutation (PKHD1L1+/) were first observed for 5 consecutive days for spontaneous epilepsy. However, no spontaneous epileptic behavior was observed.

[0083] Subsequently, the epileptic susceptibility of PKHD1L1+/ rats was studied using a PTZ-induced epilepsy model: A total of 10 male PKHD1L1+/ rats and 10 male wild-type (WT) rats with body weights matched with age (in weeks) were selected for inducing epileptic seizures with PTZ (40 mg/kg). The dose of PTZ selected is lower than the conventional dose in such animal modeling. Only 2 out of the 10 wild-type rats (20%), but 7 out of the 10 (70%) PKHD1L1+/ rats, were induced to have grand mal seizures of grade 4-5 (see FIG. 13A). The maximum seizure level reached by the PKHD1L1+/ rats was significantly higher than that of the wild-type rats (see FIG. 13B). Further, additional PTZ injections (5 mg/kg at 15-minute intervals) were administered in rats that did not reach grade 4-5. The mean dose of PTZ required for wild-type rats to exhibit such seizures was statistically significantly higher than that required for PKHD1L1+/ rats (see FIG. 13C). These results indicate that PKHD1L1+/ rats having a PKHD1L1 gene with the c.2602A>T point mutation have seizure susceptibility characteristics.

[0084] The PKHD1L1+/ rats were further tested by SEP to detect a phenotype corresponding to abnormal cortical excitability. The specific methods are as follows.

[0085] The head and limbs of PKHD1L1+/ rats were fixed in a prone position, and the posterior tibialis nerve of the ankle of the right hind limb was stimulated by electrocutaneous stimulation. The stimulation parameters included a constant pressure square wave having a wave or pulse width of 0.1 ms and a frequency of 3 Hz. The intensity of the stimulation was regulated and/or adjusted to cause posterior toe micromovement. A subcutaneous needle on the back was grounded. The recording needle/electrode was inserted subcutaneously into the Cz region at the top of the skull, and the reference needle/electrode was inserted subcutaneously above the nose. The signal extracted from the recording needle/electrode was filtered and amplified, and input into a computer for determining an average superposition of 1024 superposition times, using an analysis time of 56 ms. The resulting somosensory evoked potential pattern was displayed and printed to measure its peak latency. Waves are labelled according to their polarity and order of occurrence (P1, P2, . . . . N1, N2, where P is a positive wave and N is a negative wave). The number indicates the number of the wave in the order in which the waves appear.

[0086] The results are shown in Table 8. Compared with wild-type (WT) rats with matched body weight, PKHD1L1+/ (MU) rats had a significantly shorter incubation period of SEP (10.171.17, vs. 12.321.65, P=0.0071), and the amplitude of SEP tended to increase (3.951.72, vs. 2.871.6, P=0.1794), indicating that the cortical excitability of PKHD1L1+/l -rats was significantly higher than that of wild-type rats. This study further verified the increased cortical excitability of PKHD1L1+/ rats, which better simulate the phenotype of FAME patients and other epilepsy patients.

TABLE-US-00008 TABLE 8 Latency and amplitude of SEP in WT and MU rats P40-N50 Wave P40 Weight amplitude Latency No. Gender (g) Group (V) (ms) 20230304001 M 244 WT 1.76 13.6 20230304002 F 226 WT 2.4 10.5 20230304003 F 273 WT 4 10.4 20230304004 F 261 WT 5.4 10.9 20230304005 M 428 WT 3.3 13.8 20230317006 F 308 WT 4.2 14 20230317007 M 475 WT 2.2 13.9 20230317008 M 477 WT 2.1 13.5 20230317009 M 480 WT 3.2 14.8 20230317010 M 487 MU 6.8 10 20230330011 M 385 WT 5.6 11.5 20230330012 F 365 WT 0.3 11.7 20230330013 M 586 MU 1.92 10.9 20230330014 M 572 MU 4 9.7 20230330015 M 608 MU 2.1 12.5 20230403016 F 342 MU 3.4 9.5 20230403017 F 320 MU 5.3 9.1 20230403018 F 315 MU 4.1 9.5 20230428019 F 403.9 WT 1.8 10.1 20230428020 M 495.8 WT 1.05 11.4

Example 3

Results of Electrophysiological Examination of Transgenic Animal Brain Slices

[0087] In transgenic animals (PKHD1L1+/ rats), neuronal excitability increased, and H89 reduced the frequency of spontaneous excitatory post synaptic currents (sEPSC) in pyramidal neurons in the cerebral cortex.

[0088] A patch clamp technique was used to record sEPSC and sIPSC (e.g., spontaneous inhibitory post synaptic currents) of cortical pyramidal neurons in the computer, and to observe the changes in excitatory synaptic transmission and inhibitory synaptic transmission of pyramidal neurons in each group of rats, so as to reflect any changes in neuronal excitability. It was found that the sEPSC amplitude and frequency were higher in the epilepsy group (e.g., the PKHD1L1+/ rats) than in the control group (e.g., the wild-type rats), and the amplitude and frequency (e.g., in sEPSC) decreased after H89 treatment. Experimental results also showed that excitability was increased in the epileptic group (e.g., the PKHD1L1+/ rats), and H89 could be used to reduce the amplitude and frequency of cortical sEPSC and reduce its excitability (e.g., in the PKHD1L1+/ rats), thus playing a therapeutic role (see FIGS. 14A-F).

[0089] H89 does not affect the excitability of pyramidal neurons (and optionally affect Na.sup.+ and K.sup.+ currents) in the cerebral cortex. Neuronal excitability is related to Na.sup.+ and K.sup.+ currents, so the Na.sup.+ and K.sup.+ currents in pyramidal neurons in the cerebral cortex of each group of rats (e.g., PKHD1L1+/-and wild-type) were recorded. As shown in FIGS. 15A-B, there was no difference in Na.sup.+ and K.sup.+ currents in pyramidal neurons of rats among all groups (3 mice in each group, 6 cells in the control [WT] group, 6 cells in the epilepsy [e.g., PKHD1L1+/] group, and 6 cells in the epilepsy+H89 group), P<0.05.

[0090] H89 can reduce the excitability of pyramidal neurons in the cerebral cortex of rats with epilepsy. In order to further confirm the excitability of pyramidal neurons in the cerebral cortex, the action potential of pyramidal neurons was recorded. Action potential can intuitively reflect the excitability of neurons. The recorded action potentials of pyramidal neurons showed that the action potential threshold of rats in the epilepsy group (e.g., PKHD1L1+/ rats) decreased (P<0.05), but the action potential threshold increased after H89 treatment (P<0.05). Compared with the control group (e.g., WT rats), the positive potential of the epileptic group was decreased after H89 treatment, and the neuronal potential was increased after H89 treatment (P>0.05). There was no difference in the peak and half-duration of the action potential between the two groups. A decrease in positive post-potential of pyramidal neurons in epileptic rats indicated that the function of the sodium ion pump was weakened. It was shown that a reduced neuron action potential threshold in epileptic rats indicates decreased excitability of pyramidal neurons, and H89 reversed this trend and improved epileptic symptoms in rats (FIGS. 16A-F).

[0091] Although the above embodiments give a detailed description of the invention, they are only part of the embodiments of the invention, not all embodiments, and other embodiments can be obtained according to the embodiments without creativity, which are within the scope of protection of the invention.