Glucooligosaccharides comprising (alpha 1->4) and (alpha 1->6) glycosidic bonds, use thereof, and methods for providing them

Abstract

The invention relates to the field of poly-and oligosaccharides and their nutritional effects. In particular, it relates to the application of -glucanotransferases in methods for preparing dietary fibers, including prebiotic oligosaccharides, and to novel oligosaccharides obtainable thereby. Provided is a method for producing a mixture of gluco-oligosaccharides having one or more consecutive (1.fwdarw.6) glucosidic linkages and one or more consecutive (1.fwdarw.4) glucosidic linkages, comprising contacting a poly- and/or oligosaccharide substrate comprising at least two (1.fwdarw.4) linked D-glucose units with an -glucanotransferase capable of cleaving (1.fwdarw.4) glucosidic linkages and making new (1.fwdarw.4) and (1.fwdarw.6) glucosidic linkages. Also provided are (isolated) gluco-oligosaccharides obtainable thereby, and their application in nutritional and cosmetic compositions.

Claims

1. A method for producing a mixture of gluco-oligosaccharides having one or more consecutive (1.fwdarw.6) glucosidic linkages and one or more consecutive (1.fwdarw.4) glucosidic linkages, comprising contacting a poly- and/or oligosaccharide substrate comprising at its non-reducing end at least two 1.fwdarw.4-linked D-glucose units with an -glucanotransferase enzyme capable of cleaving (1.fwdarw.4) glucosidic linkages and making new (1.fwdarw.4) and (1.fwdarw.6) glucosidic linkages, wherein said -glucanotransferase enzyme comprises a polypeptide sequence having at least 60% identity to the catalytic core of -glucanotransferase enzyme GTFB from Lactobacillus reuteri 121(SEQ ID NO. 59), wherein the -glucanotransferase does not introduce (1.fwdarw.6) branching points.

2. The method according to claim 1, wherein said -glucanotransferase does not introduce (1.fwdarw.6) branching points nor (1.fwdarw.2) or (1.fwdarw.3) linkages.

3. The method according to claim 1, wherein said -glucanotransferase is from the GH70 glycoside hydrolase family.

4. The method according to claim 1, wherein said -glucanotransferase is selected from the group consisting of GTFB from Lactobacillus reuteri 121(SEQ ID NO. 59), GTF106B from Lactobacillus reuteri TMW 1.106(SEQ ID NO. 61), GTML4 from Lactobacillus reuteri ML1 (SEQ ID NO. 63), GTFDSM from Lactobacillus reuteri DSM 20016.sup.A(SEQ ID NO. 65), and GTF from Lactobacillus fermentum ATCC 14931 (SEQ ID NO. 67).

5. The method according to claim 1, wherein said substrate has a degree of polymerization of at least 4.

6. Method according to claim 1, wherein said substrate is selected from the group consisting of starch, waxy starch, high amylose starch, their derivatives, malto-oligosaccharides, amylose, amylopectin, maltodextrins, (1.fwdarw.4) glucans, reuteran, or combinations thereof.

7. Method according to claim 6, wherein said starch, waxy starch, high amylose starch or starch derivative is derived from potato, maize, tapioca, pea, mung bean, rice or wheat.

8. Method according to claim 6, wherein said starch derivative is produced by treating starch, waxy starch or high amylose starch with amylomaltase/4-alpha-glucanotransferase or glycogen -branching enzyme.

9. The method according to claim 1, further comprising the step of isolating from the mixture at least one gluco-oligosaccharides having one or more consecutive (1.fwdarw.6) glucosidic linkages and one or more consecutive (1.fwdarw.4) glucosidic linkages.

10. The method according to claim 9, wherein said isolation comprises at least one of precipitation-fractionation and chromatography.

11. The method according to claim 1, wherein said -glucanotransferase enzyme comprises at least one conserved amino acid residue selected from the group consisting of Asp1015, Glu1053, and Asp1125 of GTFB of Lactobacillus reuteri 121(SEQ ID NO. 59), and equivalent residues in-homologous -glucanotransferase enzymes selected from the group consisting of GTF106B from Lactobacillus reuteri TMW 1.106(SEQ ID NO. 61), GTML4 from Lactobacillus reuteri ML1 (SEQ ID NO. 63), GTFDSM from Lactobacillus reuteri DSM 20016.sup.A(SEQ ID NO. 65), and GTF from Lactobacillus fermentum ATCC 14931 (SEQ ID NO. 67).

12. The method according to claim 1, wherein said substrate has a degree of polymerization of at least 6.

13. The method according to claim 1, wherein said -glucanotransferase enzyme comprises at least three conserved amino acid residues selected from the group consisting of Arg1013, Asp1015, Ala1017, Asn1019, Glu1053, Gly1054, Tyr1055, His1124, Asp1125, Gln1126, Arg1127, Lys1128, Asp1479, lle1480, Met1482, Asn1483, and Gln1484 of GTFB of Lactobacillus reuteri 121 (SEQ ID NO. 59), and equivalent residues in homologous -glucanotransferase enzymes selected from the group consisting of GTF106B from Lactobacillus reuteri TMW 1.106(SEQ ID NO. 61), GTML4 from Lactobacillus reuteri ML1 (SEQ ID NO. 63), GTFDSM from Lactobacillus reuteri DSM 20016.sup.A(SEQ ID NO. 65), and GTF from Lactobacillus fermentum ATCC 14931 (SEQ ID NO. 67).

14. The method according to claim 1, wherein said -glucanotransferase enzyme comprises Asp1015, Glu1053, and Asp1125 of GTFB of Lactobacillus reuteri 121(SEQ ID NO. 59), or equivalent residues in homologous -glucanotransferase enzymes selected from the group consisting of GTF106B from Lactobacillus reuteri TMW 1.106(SEQ ID NO. 61), GTML4 from Lactobacillus reuteri ML1 (SEQ ID NO. 63), GTFDSM from Lactobacillus reuteri DSM 20016.sup.A(SEQ ID NO. 65), and GTF from Lactobacillus fermentum ATCC 14931 (SEQ ID NO. 67).

15. The method according to claim 1, wherein said -glucanotransferase enzyme comprises Arg1013, Asp1015, Ala1017, Asn1019, Glu1053, Gly1054, Tyr1055, His1124, Asp1125, Gln1126, Arg1127, Lys1128, Asp1479, Ile1480, Met1482, Asn1483, and Gln1484 of GTFB of Lactobacillus reuteri 121(SEQ ID NO. 59); or equivalent residues in homologous -glucanotransferase enzymes selected from the group consisting of GTF106B from Lactobacillus reuteri TMW 1.106(SEQ ID NO. 61), GTML4 from Lactobacillus reuteri ML1 (SEQ ID NO. 63), GTFDSM from Lactobacillus reuteri DSM 20016.sup.A(SEQ ID NO. 65), and GTF from Lactobacillus fermentum ATCC 14931 (SEQ ID NO. 67).

16. The method according to claim 1, wherein the catalytic core of GTFB from Lactobacillus reuteri 121 comprises SEQ ID NO. 60.

17. A method for producing starch derivatives or partially indigestible starch derivatives comprising contacting an enzyme capable of cleaving (1.fwdarw.4) glucosidic linkages and making new (1.fwdarw.4) and (1.fwdarw.6) glucosidic linkages, and/or transferring a maltose, maltotriose or maltotetraosyl-unit making a new (1.fwdarw.6) glucosidic linkage with a sequence having at least 60% identity to the catalytic core of an -glucanotransferase enzyme selected from the group consisting of GTFB from Lactobacillus reuteri 121(SEQ ID NO. 59).

Description

LEGENDS TO THE FIGURES

(1) FIG. 1. Amino acid sequence alignment of conserved regions (II, III, IV and I) in the catalytic domains of (A) (putative) -glucanotransferase enzymes, (B) DSRE and DSRP, glucansucrase enzymes containing two catalytic domains (CD1 and CD2) and (C) dextran-, mutan-, alternan- and reuteransucrase enzymes of lactic acid bacteria. The seven strictly conserved amino acid residues (1-7), having important contributions to the 1 and +1 subsites glucansucrase enzymes are also conserved in the -glucanotransferase enzymes (shown underlined GTFA and GTFB of L. reuteri 121). Amino acid numbering (italics) is according to GTF180 of L. reuteti 180. GTFB amino acid D1015 (putative nucleophilic residue) is shown in bold type.

(2) FIG. 2. Phylogenentic tree of GTFB-like proteins derived from ahylogenetic analysis of all 108 glycoside hydrolase family 70 protein sequences available in the Pfam database. See table 2 above for more details on the sequences in this cluster.

(3) FIG. 3. TLC analysis of the reaction products of 90 nM GTFB incubated for 13 h in 50 mM NaAc buffer pH 4.7, 1 mM CaCl.sub.2 with 25 mM sucrose or 25 mM malto-oligosaccharides. St=standard, Suc, sucrose; G1, glucose; G2, maltose; G3, maltotriose; G4, maltotetraose; G5, maltopentaose; G6, maltohexaose; G7, maltoheptaose; Pol, polymer

(4) FIG. 4. Dionex analysis of the reaction products of 90 nM GTFB incubated for either 0, 1, 2 or 8 h in 50 mM NaAc buffer pH 4.7, 1 mM CaCl.sub.2 with A) 25 mM maltohexaose or B) 25 mM maltoheptaose.

(5) FIG. 5. Dionex analysis of incubated substrate samples without enzyme (panels A) or with 90 nM GTFB (panels B) incubated overnight at 37 C. in 25 mM NaAc pH 4.7, 1 mM CaCl.sub.2 with 0.25% amylose-V (abbreviated to AMV) alone as donor substrate and amylose-V with 25 mM glucose (G1) or 25 mM maltose (G2) as acceptor substrates.

(6) FIG. 6. Schematic representation of the various -glucans in the product mixture of the incubation of malto-oligosaccharide DP7 with GTFB(-like) activity.

(7) FIG. 7. .sup.1H NMR spectrum of the product mixture following incubation of malto-oligosaccharide DP7 (100 mM) with GTFB (250 mM) for 120 h.

(8) FIG. 8. Possible mode of action of GTFB. Schematic representation of the reaction sequences occurring in the active site of GTFB type of enzymes. The donor and (acceptor) subsites of GTFB type of enzymes are mapped out based on the available 3D structural information of glucansucrase enzymes (with one donor (1) sub site) and data obtained in the present study. Binding of G7 to subsites 1 and +1 to +6 results in cleavage of the -1,4 glycosidic bond (G6 released, shown in grey), and formation of a (putative) covalent intermediate at subsite 1 (indicated with a grey line). Depending on the acceptor substrate used, hydrolysis (with water) or glycosyltransfer with an oligosaccharide acceptor (see below). The Lb. reuteri 121 GTFB enzyme also catalyzes a disproportionation reaction with maltooligosaccharides. Two molecules of maltoheptaose (G7) for instance are converted into one G6 molecule and into a G8 product containing 8 glucose residues but with a newly synthesized -1,6 glycosidic linkage at the non-reducing end.

EXPERIMENTAL SECTION

(9) Introduction

(10) Glucansucrase (GS) (or glucosyltransferase; GTF) enzymes (EC 2.4.1.5) of lactic acid bacteria (LAB) use sucrose to synthesize a diversity of -glucans with (1.fwdarw.6) [dextran, mainly found in Leuconostoc], (1.fwdarw.3) [mutan, mainly found in Streptococcus], alternating (1.fwdarw.3) and (1.fwdarw.6) [alternan, only reported in Leuconostoc mesenteroides], (1.fwdarw.4) [reuteran, by GTFA and GTFO from Lactobacillus reuteri strains] glucosidic bonds {Monchois, 1999; van Hijum, 2006; Arguello-Morales, 2000; Kralj, 2002; Kralj, 2005}.

(11) Lactobacillus reuteri 121 uses the glucansucrase GTFA and sucrose as substrate to synthesize a reuteran product with large amounts of (1.fwdarw.4) glucosidic linkages. Upstream of this gtfA gene another putative glucansucrase gene was identified designated gtfB. Previously it has been shown that after cloning and expression of this gene the enzyme showed no activity on sucrose as substrate. Also in the genome of L. reuteri ML1 the putative catalytic and C-terminal domain of a gtfB homolog, gtfML4, was identified upstream of gtfML1 encoding a mutansucrase {Kralj, 2004}. In the recently elucidated genome sequence of L. reuteri DSM 20016 also a GTFB homolog could be identified (73% identity 85% similarity in 883 amino acids). Furthermore, also L. reuteri TMW1.106 contains besides a GTFA homolog (GTFA106) a GTFB homolog (GTFB106). This enzyme showed 92% identity and 95% similarity in 1383 amino acids with GTFB from L. reuteri 121. However, in contrast to GTFB, GTF106B showed low (after 27 h of incubation) hydrolyzing activity on sucrose {Kaditzky, 2008}.

(12) It is shown herein that GTFB has a disproportionation type and polymerizing type of activity on malto-oligosaccharides. The enzyme uses malto-oligosaccharides (containing only (1.fwdarw.4) glucosidic linkages) as substrate to synthesize oligosaccharides up to a degree of polymerization (DP) of 35. During this elongation/polymerization process large numbers of (1.fwdarw.6) glucosidic linkages (32%) are introduced in the final product. Furthermore, we show that with a large amylose substrate (Amylose-V) as donor and smaller saccharides (glucose, maltose) as acceptor also larger saccharides linked via (1.fwdarw.4) glucosidic linkages are synthesized containing more than five glucose units. Detailed analysis of the product synthesized from maltoheptaose by methylation analysis and 1H NMR showed that up to 32% of (1.fwdarw.6) glucosidic linkages were introduced in the final product. Although the primary structure of GTFB is similar to GH70 enzymes, including the permuted (/).sub.S barrel, its activity resembles more the GH13 -amylase type of enzymes using malto-oligosaccharides as preferred substrate.

(13) Materials and Methods

(14) Bacterial strains, plasmids, media and growth conditions. Escherichia coli TOP 10 (Invitrogen, Carlsbad, Calif.) was used as host for cloning purposes. Plasmids pET15b (Novagen, Madison, Wis.) was used for expression of the (mutant) gtfB genes in E. coli BL21 Star (DE3). (Invitrogen). E. coli strains were grown aerobically at 37 C. in LB medium {Ausubel, 1987}. E. coli strains containing recombinant plasmids were cultivated in LB medium with 100 g ml.sup.1 ampicillin. Agar plates were made by adding 1.5% agar to the LB medium.

(15) Amino acid sequence alignment of GTFB from L. reuteri. Multiple amino acid sequence alignments of GTFB and known glucansucrases and putative -glucanotransferases from lactic acid bacteria were made with the ClustalW interface in MEGA version 4with gap-opening and extension penalties of 10 and 0.2, respectively.

(16) Molecular techniques. General procedures for gene cloning, E. coli DNA transformations, DNA manipulations, and agarose gel electrophoresis were as described {Sambrook, 1989}. Restriction endonuclease digestions and ligations with T4 DNA ligase were performed as recommended by the enzyme suppliers (New England Biolabs, Beverly, Mass.; Roche Biochemicals, Basel, Switzerland). Primers were obtained from Eurogentec, Seraing, Belgium. Sequencing was performed by GATC (Konstanz, Germany). DNA was amplified by PCR on a DNA Thermal Cycler PTC-200 (MJ Research, Waltham, Mass.) using Pwo DNA polymerase (Roche Biochemicals) or Expand High Fidelity polymerase (Fermentas). Plasmid DNA of E. coli was isolated using a Wizard Plus SV plasmid extraction kit (Sigma)

(17) Construction of plasmids. Appropriate primer pairs and template DNA were used to create two different expression constructs with a C-terminal His-tag: for the complete GTFB (1587 amino acids), constructed using three separate PCR reactions using the method previously described for GTFA from Lb. reuteri 121 (see below){Kralj, 2002}, and an N-terminally truncated variant (without N-terminal) variable region of GTFB (889 amino acids).

(18) To facilitate future mutagenesis and nucleotide sequencing, gtfB was divided and cloned in three parts. The first of the two PstI restriction sites (1385 bp, 1751 bp) was altered, using the megaprimer method {Sarkar, 1990} and the following primers: BpstI for 5-GTAAGTCGTTACTCAGCAGATGCTAATGG-3 (SEQ ID NO. 5) containing a mutated PstI restriction site (underlined, silent mutation by change of base shown in bold face), and, BpstI rev 5-GGTCAGTAAATCCACCGTTATTAATTGG-3. (SEQ ID NO. 6) In a subsequent PCR reaction the amplified product (420 bp) was used as (reverse) primer together with Bfor: 5-GCAATTGTCGACCATGGATACAAATACTGGTGATCAGCAAACTGAACA-GG-3 (SEQ ID NO. 7) containing SalI (italics) and NcoI (bold) restriction sites. The resulting product of 1700 bp was digested with SalI and PstI and ligated in the corresponding sites of pBluescript II SK.sup.+, yielding pBSP1600. The amplified 420 by product was also used as a forward primer together with BrevBamHI 5-GGACTGTTATCACTATTATTATTTCCGGCC-3 (SEQ ID NO. 8)70 bp downstream of a BamHI restriction site. The resulting product of (4500 bp) was digested with Pst1 and BamHI and ligated in the corresponding sites of pBluescript II SK.sup.+, yielding pBPB1000. The third fragment was obtained using primers BforBamHI 5-CGCTATGTAATTGAACAGAGTATTGCTGC-3 (SEQ ID NO. 9) 200 bp downstream of a BamHI restriction site and BRevHis 5-CCTCCTTTCTAGATCTATTAGTGATGGTGATGGTGATGGTTGTTAAAGTTTAATG AAATTGCAGTTGG-3 (SEQ ID NO. 10) containing XbaI (italics) and BglI (bold) and a 6histidine tag (underlined). The resulting product of 2300 bp was digested with BamHI and XbaI and ligated in the corresponding sites of pBluescript II SK+, yielding pBBX2300. The complete gene was assembled as follows: pBPB1000 was digested with PstI and BamHI and the resulting fragment was ligated into pBSP1600 restricted with the same restriction enzymes yielding pBSB2600 (containing the first and second fragment). Subsequently, plasmid pBBX2300 was digested with BamHI and SacII (present on the plasmid, used instead of XbaI) and the fragment was ligated into pBSB2600 yielding pBSS4900 containing the full length gtfB gene. This plasmid was digested with NcoI and BglII and the gtfB gene was ligated in the NcoI and BamHI sites of pET15b, yielding pET15B-GTFB.

(19) Expression and purification of GTFB. An overnight culture of E. coli BL21star (DE3) harbouring (mutant) GTFB {Kralj, 2004} was diluted 1/100. Cells were grown to OD.sub.600 0.4 and induced with 0.2 mM IPTG, after 4 h of growth cells were harvested by centrifugation (10 mM at 4 C. at 10,000g). Proteins were extracted by sonication and purified by Ni-NTA and anion exchange chromatography as described previously for the GTFA (reuteransucrase) from Lactobacillus reuteri 121 {Kralj, 2004}, with the following modification: for anion exchange chromatography a 1 ml Hi-trapQ HP column was used (Ge Healthcare).

(20) (i) pH and temperature optima. pH and temperature optima were determined by measuring qualitatively on TLC the amount of oligo- and polysaccharides synthesized from 25 mM maltotetraose after overnight incubation (data not shown).

(21) (ii) Products synthesized from malto-oligosaccharides and other saccharides. Single substrate incubations 90 nM GTFB and 25 mM of sucrose (Acros), raffinose (Sigma), turanose (Sigma), palatinose (Sigma), panose (Sigma), 0.25% Amylose-V (Avebe, Foxhol, The Netherlands), 0.25% amylopectin, 25 mM isomaltopentaose, isomaltohexaose (sigma), malto-oligosaccharides with a different degree of polymerization (G2-G7) were incubated separately overnight in 25 mM NaAc pH 4.7 1 mM CaCl.sub.2 at 37 C. and analysed by TLC. Products synthesized from G6 and G7 over time were analyzed by TLC and HPAEC.

(22) Acceptor/donor studies. 90 nM GTFB and 25 mM of glucose and malto-oligosaccharides with a different degree of polymerization (G2-G7) were incubated overnight together with 0.25% amylose-V in 25 mM NaAc pH 4.7 1 mM CaCl.sub.2 at 37 C. and analysed by TLC.

(23) (i) Characterization of the oligosaccharides and polysaccharides produced from G7. Purified GTFB enzyme preparations (90 nM) were incubated for 7 days with 150 mM G7 (sigma), using the conditions described above under enzyme assays. Oligo- and polysaccharides produced by purified recombinant GTFB were separated by precipitation with 96% ethanol (most of the larger saccharide product precipitates) {van Geel-Schutten, 1999}.

(24) (ii) Methylation analysis. Oligo- and polysaccharides were permethylated using methyl iodide and dimesyl sodium (CH.sub.3SOCH.sub.2Na.sup.+) in DMSO at room temperature {Kralj, 2004}

(25) Results

(26) Alignment of GTFB

(27) GTFB is the first representative of a group of homologues enzymes identified in different Lactobacilli. Alignments of members of this novel group of enzymes with other glucansucrases showed similarities but also some characteristics differences. The three catalytic residues present (D1024, E1061 and D1133 GTFA L. reuteri 121 numbering used throughout unless indicated otherwise) in glucansucrases are also present in the group of -glucanotransferases (D1015, E1053 and D1125 GTFB L. reuteri 121 numbering. Nevertheless, a large number of amino acid residues conserved in glucansucrase in region I, II, III and IV are absent in the -glucanotransferase group of enzymes (FIG. 1). In region II (encompassing the putative nucleophilic residue) the conserved V1025 (Pro in GTFA and GTFO) is substituted by an alanine in the -glucanotransferases. Region III, the region downstream of the putative acid/base catalyst E1061 is completely different between the glucansucrases and the -glucanotransferases.

(28) Nevertheless, a large number of amino acid residues conserved in glucansucrase in region I, II, III and IV are absent in the -glucanotransferase group of enzymes (FIG. 1). In region II (encompassing the putative nucleophilic residue) the conserved P1025 (Pro in GTFA and GTFO, Val in most GTFs) is substituted by a alanine in the -glucanotransferases. Region III, the region downstream of the putative acid/base catalyst E1061 is completely different between the glucansucrases and the -glucanotransferases. The conserved tryptophan 1063 is substituted by a tyrosine residue in the -glucanotransferases (FIG. 1). In region IV the GTFB homologues contain a gap immediately upstream of the location of the Q1137 residue and at the position of the conserved glutamine a lysine residue is present.

(29) GTFB Homologs

(30) Gene and protein sequence databank searches showed several sequences that may have the same catalytic activity as GTFB. The info is based on a phylogenetic tree of all glycoside hydrolase family 70 members (108 sequences as available in the Pfam database on 27 Apr. 2010). Also the phylogenetic tree is available from the Pfam server, see FIG. 2.

(31) TABLE-US-00002 TABLE 2 Glycoside hydrolase family 70 sequences from the Pfam database (http://pfam.sanger.ac.uk) with clear similarity to GTFB, apparent from the alignments and phylogenetic trees. UniProt entry Microorganism 1 B1YMN6.sup.1 Exiguobacterium sibiricum 255-15 2 C0X0D3 Lactobacillus fermentum ATCC 14931 3 C2F8B9 Lactobacillus reuteri MM4-1 4 C0YXW9 Lactobacillus reuteri MM2-3 5 A5VL73 Lactobacillus reuteri DSM 20016 6 B2G8K2 Lactobacillus reuteri JCM 1112 7 B7U9D3 Weissella confusa MBF8-1 8 A9Q0J0 Lactobacillus reuteri TMW1.106 9 Q5SBM0 GTFB (Lactobacillus reuteri 121) 10 Q5SBN1 Lactobacillus reuteri ML1 11 Q9R4L7.sup.2 Leuconostoc mesenteroides 12 B1YMN6.sup.1 Exiguobacterium sibiricum 255-15 Note that no. 9 is GTFB and that the numbers follow the order as seen in the phylogenetic tree of FIG. 2. .sup.1This sequence is listed twice in the table since two fragments of this sequence are in the tree. .sup.2The apparent sequence similarity of number 11 is based on 20 amino acids only. This sequence is therefore ignored.

(32) Of the nine GTFB-like sequences, the putative dextransucrase from Lactobacillus reuteri DSM 20016 (nr. 5 in the table) was cloned and expressed in Escherichia coli. The recombinant protein was purified by a combination of affinity and anion exchange chromatography. The purified protein showed GTFB-like activity when incubated with malto-oligosaccharides. The putative dextransucrase from Lactobacillus reuteri DSM 20016 showed no activity with sucrose, instead it uses maltose, maltotriose, maltotetraose, maltopentaose, maltohexaose and maltoheptaose as substrate producing a ladder of shorter and longer products. Proton-NMR analysis of the products demonstrated that -1,6-glycosidic bonds were introduced, as also seen for the GTFB incubations. Moreover, the putative dextransucrase from Lactobacillus reuteri DSM 20016 also increased the percentage of -1,6-glycosidic bonds in soluble potato starch of Sigma-Aldrich.

(33) Cloning and Expression of GTFB

(34) The full length, N-terminal truncated version and putative nucleophilic mutant of GTFB were constructed and expressed successfully. Both the full length as well as the N-terminal truncated variant showed clear activity on malto-oligosacharides as measured by TLC (data not shown). The constructed truncated GTFB version (GTFB-N) was not expressed as efficiently as the full length GTFB and therefore all experiments were performed using full length GTFB. To rule out any background activity emerging from E. coli itself, an empty pET15b plasmid was purified, and already after His-tag purification no activity on malto-oligosaccharides (G2-G7) was detected (data not shown). Furthermore, the purified full length D1015N (putative) nucleophilic mutant showed no activity on malto-oligosaccharides (G2-G7; data not shown).

(35) Enzyme Characteristics

(36) The optimal activity for GTFB with maltotetraose as a substrate as determined qualitatively by TLC was at a temperature of 30-37 C. and a pH of 4-5 (data not shown). Combinations of different temperatures and pH buffers indicated optimal activity at a temperature of 37 C. and a pH of 4.7, which was used in all subsequent assays.

(37) Donor Substrates

(38) Since it had already been shown that GTFB is not able to use sucrose as donor substrate {Kralj, 2004}, different sucrose analogues (turanose, palatinose) and raffinose were tested for activity. We were not able to detect activity on any of these substrates (data not shown). Also no activity was observed on isomalto-oligosaccharides (IG5 and IG6) substrates (data not shown). Activity on oligosaccharides derived from a partially purified reuteran (GTFA) hydrolysate or panose was also not detected (data not shown). However, on linear malto-oligosaccharides clear activity was observed already after short incubation times. Especially on malto-oligosaccharides with a degree of polymerization of 4 and larger, different oligosaccharides were synthesized (FIG. 3). From a DP of 6 and larger, besides oligosaccharides also larger polymeric material started to accumulate. On amylose-V (Avebe, Foxhol, The Netherlands) also low activity (mainly G1 and G2 release) was observed (FIG. 5). On maltose alone virtually no activity was observed. However, when amylose-V was incubated simultaneously with glucose or maltose a range of oligosaccharides were synthesized (FIG. 5). Using amylose-V as donor and glucose as acceptor larger numbers of maltose were synthesized compared to incubation on amylose-V alone, indicating (1.fwdarw.4) synthesizing capability. On amylose-V alone virtually no G3 was released. Incubation of amylose-V with maltose as acceptor clearly yielded panose and G3 indicating GTFB capability to besides panose (indicating (1.fwdarw.6) synthesizing capability) also maltotriose was synthesized demonstrating the enzyme capability to synthesize (1.fwdarw.4) glucosidic linkages.

(39) Product Characterization in Time on G6 and G7

(40) The first reaction products detectable on G6 were G1 (glucose) and G5 (maltopentaose) (FIG. 4). Also on G7 the first products released were G1 (glucose) and G6 (maltohexaose). Later in time on G6 also other malto-oligosaccharides such as G2, G3 and G4 appeared. Also unknown saccharides next to G7 and G8 were identified, which besides (1.fwdarw.4) glucosidic linkages also must contain other linkages indicated by the shift in their retention time.

(41) After incubation of maltoheptaose with GTFB for 120 h, the 1D .sup.1H-NMR spectrum of the total product mixture (FIG. 7) indicated the presence of newly formed (1.fwdarw.6) linkages by a broad signal at .sub.H-14.96. The (1.fwdarw.4) signal is present at .sub.H-15.39. After 120 h of incubation, the ratio (1.fwdarw.4):(1.fwdarw.6) is 67:33 in the product mixture. MALDI-TOF MS analysis of the product mixture revealed the presence of compounds ranging from DP2 up to DP35 (m/z 365-m/z 5711, [M+Na].sup.+).

(42) In the reaction mixture obtained from incubation of MOS DP7 with recombinant GFTB, seventeen different structures (FIG. 6), ranging from DP2-DP10, could be elucidated in detail by NMR spectroscopy. The elucidated structures constitute only a part of the total number of compounds that were formed. More high molecular mass products are present, including polysaccharides. It is clear that the oligosaccharides smaller than DP7 must be stemming from hydrolysis activity of GTFB on the substrate [products containing (1.fwdarw.4) only] as well as from hydrolysis activity on the formed oligosaccharides [products containing (1.fwdarw.4) and (1.fwdarw.6)]. It has to be noted that no structures were found having a 6-substituted reducing-end glucose residue. Until now, only one structure (DP8) was found having a (1.fwdarw.6)-linked glucose residue elongated by successive (1.fwdarw.4)-linked glucose residues. In the other cases, only (successive) (1.fwdarw.6) elongation has occurred. All oligosaccharides have a 4-substituted glucose residue at the reducing end. However, in the 1D .sup.1H NMR spectrum (FIG. 7) of the total product mixture a trace of a terminal reducing-(1.fwdarw.)-D-Glc unit was found (H-1 at 5.240 and H-1 at 4.669), but this unit was not found in the elucidated structures.

(43) Thus, recombinant GTFB catalyzes the cleavage of only (1.fwdarw.4) linkages and initiates formation of new (1.fwdarw.4) and (1.fwdarw.6) bonds. In this way, many products are formed, ranging from monosaccharide to polysaccharide (DP>30). Different structures for a single-molecular-mass product are possible, as is shown clearly for the formed DP7- and DP8-oligosaccharides(-alditols). Furthermore, it was observed that the amount of (1.fwdarw.6) bonds compared to (1.fwdarw.4) bonds increases with increasing chain length, to a maximum of 50:50. No 4,6- or other types of branching points are introduced. The fact that the recombinant GTFB enzyme showed similar activities on the free malto-oligosaccharides as well as on their reduced forms (malto-oligosaccharide-alditols), demonstrates a non-reducing end elongation mechanism.

(44) Important conclusions which can be drawn from the above results are the following: no structures were found having a 6-substituted reducing-end glucose residue; GTFB catalyzes the cleavage of only (1.fwdarw.4) linkages and initiates formation of new (1.fwdarw.4) and (1.fwdarw.6) bonds; the amount of (1.fwdarw.6) bonds compared to (1.fwdarw.4) bonds increases with increasing chain length, to a maximum of 50:50. no 4,6- or other types of branching points are introduced; GTFB has a non-reducing end elongation mechanism.
Introducing GTFB Like Activity in GTFA Via Protein Engineering

(45) Previous protein engineering studies have demonstrated that amino acid residues located in conserved sequence region III and IV (see FIG. 1 for a sequence alignment) control the product specificity of GTF enzymes regarding the glycosidic bonding type formed. Also region I and region II contain amino acid residues that contribute to enzyme activity and reaction specificity. The amino acid residues of the conserved sequence regions form part of the acceptor substrate binding region of GTF enzymes. In the polymerization reaction using sucrose as substrate these residues interact with the glucose (subsite-1) and fructose (subsite+1) moiety of sucrose. As GTFB utilizes maltoheptaose (and other malto-oligosaccharides) as substrate a glucose moiety will interact at the acceptor subsites in the GTFB enzyme. The unique substrate specificity of GTFB compared to the traditional GTFs is therefore most likely determined by differences at the acceptor subsites. Thus, to introduce GTFB-like activity in a traditional GTFA enzyme it is envisaged to substitute residues at the acceptor subsites, located in the regions I, II, III and IV, to resemble the sequence of the GTFB enzyme.

(46) Furthermore, the 3D structure of GTF180 (Vujicic, PhD thesis University of Groningen) shows some additional residues interacting at subsites 1 and +1 that are likely important for the interconversion of reaction specificity of GTFs. The 981 L.fwdarw.V mutations is based on an interaction seen in the 3D structure of GTF180, where Leu981 has a Van Der Waals interaction with the fructosyl moiety of sucrose. In GTFB this position is occupied by a valine residue as well as in the other -glucanotransferases GTFDSM, GTF106B, GTFML4. The 1463 D.fwdarw.R, T or M mutations are aimed at substituting the aspartate residue, which is highly conserved in glucansucrases, but not in GTFB and the related enzymes, and interacts with the glucose moiety at subsite 1 in GTF180 3D structure.

(47) Additionally, the mutations may be combined in any manner to obtain a stronger effect in alteration of the reaction specificity GTF enzymes. The proposed mutations are as follows:

(48) Region I

(49) position W1510:W.fwdarw.I/L position P1512:P.fwdarw. position D1513:D.fwdarw.N
Region II position 1026: P.fwdarw.A
Region III position 1062: D.fwdarw.G position 1063: W.fwdarw.Y position 1064: N.fwdarw.H position 1062-1064 DWN.fwdarw.GYH
Region IV position 1134: N.fwdarw.Q position 1135: N.fwdarw.R position 1136: S.fwdarw.delete this residue position 1134-1136: NNS.fwdarw.QR position 1137:Q.fwdarw.K
3D structure position 981: L.fwdarw.V position 1414: N.fwdarw.L position 1463: D.fwdarw.R, T or M

REFERENCES

(50) Arguello-Morales M A, Remaud-Simeon M, Pizzut S, Sarcabal P & Monsan P (2000) FEMS Microbiol. Lett. 182, 81-85. Ausubel, F. M., Brent, R. E., Kingston, D. D., Moore, J. G., Seidman, J. G., Smith, J. A., & Struhl, K. (1987) Current protocols in molecular biology. John Wiley & Sons, Inc, New York. Barends T R, Bultema J B, Kaper T, van der Maarel M J, Dijkhuizen L & Dijkstra B W (2007) J. Biol. Chem. 282, 17242-17249. Fabre E, Bozonnet S, Arcache A, Willemot R M, Vignon M, Monsan P & Remaud-Simeon M (2005) J. Bacteriol. 187, 296-303. van Geel-Schutten G H, Faber E J, Smit E, Bonting K, Smith M R, Ten Brink B, Kamerling J P, Vliegenthart J F & Dijkhuizen L (1999) Appl. Environ. Microbiol. 65, 3008-3014. Hard K, Van Z G, Moonen P, Kamerling J P & Vliegenthart F G (1992). Eur. J. Biochem. 209, 895-915. Hondoh H, Kuriki T & Matsuura Y (2003) J. Mol. Biol. 326, 177-188. van Hijum S A, Kralj S, Ozimek L K, Dijkhuizen L & van Geel-Schutten IG (2006). Microbiol. Mol. Biol. Rev. 70, 157-176. Kaditzky, S., Behr, J., Stocker, A., Kaden, P., & Vogel, R. F. Food Biotechnol. 22[4], 398-418. 2008. Kamerling, J. P. & Vliegenthart, J. F. (1989) Mass Spectrometry. In Clinical BiochemistryPrinciples, Methods, Applications. (Lawson, A. M., ed), pp. 176-263. Walter de Gruyter, Berlin. Kelly R M, Dijkhuizen L & Leemhuis H (2009). J. Biotechnol. 140, 184-193 Kralj S, van Geel-Schutten G H, Rahaoui H, Leer R J, Faber E J, van der Maarel M J & Dijkhuizen L (2002) Appl. Environ. Microbiol. 68, 4283-4291. Kralj S, van Geel-Schutten G H, van der Maarel M J & Dijkhuizen L (2003). Biocatal. Biotransform. 21, 181-187. Kralj S, van Geel-Schutten G H, Dondorff M M, Kirsanovs S, van der Maarel M J & Dijkhuizen L (2004) Microbiology 150, 3681-3690. Kralj S, van Geel-Schutten G H, van der Maarel M J & Dijkhuizen L (2004) Microbiology 150, 2099-2112. Kralj S, Stripling E, Sanders P, van Geel-Schutten G H & Dijkhuizen L (2005). Appl. Environ. Microbiol. 71, 3942-3950. van Leeuwen S S, Kralj S, van Geel-Schutten I H, Gerwig G J, Dijkhuizen L & Kamerling J P (2008) Carbohydr. Res. 343, 1237-1250. van Leeuwen S S, Kralj S, van Geel-Schutten I H, Gerwig G J, Dijkhuizen L & Kamerling J P (2008) Carbohydr. Res. 343, 1251-1265. van Leeuwen S S, Leeflang B R, Gerwig G J & Kamerling J P (2008) Carbohydr. Res. 343, 1114-1119. Linden A, Mayans O., Meyer-Klaucke W, Antranikian G & Wilmanns M (2003). J. Biol. Chem. 278, 9875-9884. MacGregor E A, Jespersen H M & Svensson B (1996) FEBS Lett. 378, 263-266. MacGregor E A, Janecek S & Svensson B (2001) Biochim. Biophys. Acta 1546, 1-20. Monchois V, Willemot R M & Monsan P (1999) FEMS Microbiol. Rev. 23, 131-151. Moore A D, Bjorklund A K, Ekman D, Bornberg-Bauer E & Elofsson A (2008). Trends Biochem. Sci. 33, 444-451. Peisajovich S G, Rockah L & Tawfik D S (2006) Nat. Genet. 38, 168-174. Pijning T, Vuiji{hacek over (c)}i-{hacek over (Z)}agar A, Kralj S, Eeuwema W, Dijkstra BW & Dijkhuizen L (2008). J. Biocatal. Biotransform. 26, 12-17. Przylas I, Tomoo K, Terada Y, Takaha T, Fujii K, Saenger W & Strater N (2000) J. Mol. Biol. 296, 873-886. Rondeau-Mouro C, Veronese G & Buleon A (2006) Biomacromolecules. 7, 2455-2460. Sambrook, J., Fritsch, E. F., & Maniates, T. (1989) Molecular cloning: a laboratory manual, 2 edn. Cold Spring Harbor Laboratory Press, New York. Sarkar G & Sommer S S (1990). Biotechniques 8, 404-407. Stam M R, Danchin E G, Rancurel C, Coutinho P M & Henrissat B (2006) Protein Eng Des Sel. 19, 555-562. Tokuriki N & Tawfik D S (2009). Science. 324, 203-207. Uitdehaag J C, Mosi R, Kalk K H, van der Veen B A, Dijkhuizen L, Withers S G & Dijkstra B W (1999) Nat. Struct. Biol. 6, 432-436. Vuiji{hacek over (c)}i-{hacek over (Z)}agar, A. 2007. University of Groningen. PhD Thesis/Dissertation