Transformed Response Potentiometric Titrations
20170122900 ยท 2017-05-04
Inventors
Cpc classification
G01N27/4161
PHYSICS
G01N33/53
PHYSICS
International classification
Abstract
The present invention relates to a method and system for obtaining an interaction property between a molecule or biomolecule or particle or bioparticle or nano- or microparticle on the one hand and a target particle on the other hand. The method comprises obtaining potentiometric titration results for a potentiometric measurement during titration of a solution with a titrant, said solution being a solution of one of a ligand of the target particle or said molecule or biomolecule or particle or bioparticle or nano- or microparticle. Said titrant comprises the other of said target particle ligand or said molecule or biomolecule or particle or bioparticle or nano- or microparticle. The method also comprises deriving based on said potentiometric titration results an interaction property between said molecule or biomolecule or particle or bioparticle or nano- or microparticle and said target particle.
Claims
1-18. (canceled)
19. A method for obtaining an interaction property between a molecule or biomolecule or particle or bioparticle or a nano- or microparticle and a target particle, the method comprising obtaining potentiometric titration results for a potentiometric measurement during titration of a solution with a titrant, said solution being a solution of one of a ligand of the target particle or said molecule or biomolecule or particle or bioparticle or nano- or microparticle and said titrant comprising the other of said target particle ligand or said molecule or biomolecule or particle or bioparticle or nano- or microparticle, and deriving based on said potentiometric titration results an interaction property between said molecule or biomolecule or particle or bioparticle or nano- or microparticle and said target particle.
20. A method according to claim 19, wherein said solution comprises said target particle ligand and said titrant comprises said a molecule or biomolecule or particle or bioparticle or nano- or microparticle.
21. A method according to claim 19, wherein said potentiometric measurement is performed using a potentiometric indicator electrode and a reference electrode.
22. A method according to claim 19, wherein obtaining potentiometric titration results comprises obtaining the potential of the potentiometric indicator electrode in relation to the added titrant volume.
23. A method according to claim 22, wherein the method comprises transforming the obtained potentials to a concentration related signal and wherein said deriving comprises deriving an interaction property based on said concentration related signal.
24. A method according to claim 23, wherein said transforming is performed over a concentration interval including concentration where the relation between the obtained potential and the logarithm of the concentration of the target particle is not linear.
25. A method according to claim 23, wherein said transforming takes into account the following equation:
tR10.sup.E/S1 wherein tR is the transformed response, E is the obtained potential and S corresponds with (RT/zF) with zF the charge per mole of analyte present in the potential-forming process, R the molar gas constant and T the temperature (in Kelvin).
26. A method according to claim 19, wherein the potentiometric titration results are obtained at the equivalence point of the potentiometric titration.
27. A method according to claim 19, wherein the equivalence point is obtained using the Gran method.
28. A method according to claim 19, wherein the potentiometric titration results are obtained beyond an equivalence point.
29. A method according to claim 19, wherein the target particle is a small molecule, a molecule or a biomolecule, a virus, bacterium or a particle or bioparticle.
30. A method according to claim 19, wherein said interaction property is any of the binding strength K.sub.a, the dissociation constant K.sub.d or the Gibbs free energy G of interaction between the molecule or biomolecule or particle or bioparticle or nano- or microparticle and the target particle.
31. A system for obtaining an interaction property between a molecule or biomolecule or particle or bioparticle or nano- or microparticle and a target particle, the system being adapted for performing a method according to claim 19.
32. A system for obtaining an interaction property between a molecule or biomolecule or particle or bioparticle or nano- or microparticle and a target particle, the system comprising an input means for obtaining potentiometric titration results for a potentiometric measurement during titration of a solution with a titrant, said solution being a solution of one of a ligand of the target particle or said a molecule or biomolecule or particle or bioparticle or nano- or microparticle and said titrant comprising the other of said target particle ligand or said molecule or biomolecule or particle or bioparticle or nano- or microparticle, and a processing means for deriving based on said potentiometric titration results an interaction property between said molecule or biomolecule or particle or bioparticle or nano- or microparticle and said target particle.
33. A system according to claim 32, wherein the processing means is programmed for transforming the obtained potential to a concentration related signal and for deriving an interaction property based on said concentration related signal.
34. A system according to claim 33, wherein the processing means is programmed for transforming over a concentration interval including concentration where the relation between the obtained potential and the logarithm of the concentration of the target particle is not linear.
35. A system according to claim 34, wherein the input means comprises a controller for controlling a potentiometric titration and wherein the input means furthermore comprises a data receiver for obtaining the potentiometric titration results.
36. A sensor, e.g. a biosensor, comprising a system according to claim 32.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054] The drawings are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes.
[0055] Any reference signs in the claims shall not be construed as limiting the scope.
[0056] In the different drawings, the same reference signs refer to the same or analogous elements.
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0057] The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. The dimensions and the relative dimensions do not correspond to actual reductions to practice of the invention.
[0058] Furthermore, the terms first, second and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequence, either temporally, spatially, in ranking or in any other manner. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.
[0059] Moreover, the terms top, under and the like in the description and the claims are used for descriptive purposes and not necessarily for describing relative positions. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other orientations than described or illustrated herein.
[0060] It is to be noticed that the term comprising, used in the claims, should not be interpreted as being restricted to the means listed thereafter; it does not exclude other elements or steps. It is thus to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more other features, integers, steps or components, or groups thereof. Thus, the scope of the expression a device comprising means A and B should not be limited to devices consisting only of components A and B. It means that with respect to the present invention, the only relevant components of the device are A and B.
[0061] Reference throughout this specification to one embodiment or an embodiment means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases in one embodiment or in an embodiment in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to one of ordinary skill in the art from this disclosure, in one or more embodiments.
[0062] Similarly it should be appreciated that in the description of exemplary embodiments of the invention, various features of the invention are sometimes grouped together in a single embodiment, figure, or description thereof for the purpose of streamlining the disclosure and aiding in the understanding of one or more of the various inventive aspects. This method of disclosure, however, is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive aspects lie in less than all features of a single foregoing disclosed embodiment. Thus, the claims following the detailed description are hereby expressly incorporated into this detailed description, with each claim standing on its own as a separate embodiment of this invention.
[0063] Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. For example, in the following claims, any of the claimed embodiments can be used in any combination.
[0064] In the description provided herein, numerous specific details are set forth. However, it is understood that embodiments of the invention may be practiced without these specific details. In other instances, well-known methods, structures and techniques have not been shown in detail in order not to obscure an understanding of this description.
[0065] Where in embodiments of the present invention reference is made to the equivalence point or stoichiometric point of a chemical reaction reference is made to the point at which an added titrant is stoichiometrically equal to the number of moles of substance (known as analyte) present in the sample: the smallest amount of titrant that is sufficient to fully neutralize or react with the analyte. In some cases there are multiple equivalence points, which are multiples of the first equivalence point. Where reference is made to measurement beyond the equivalence point, reference is made to measurements performed at a point where more titrant has been added than at the (first) equivalent point.
[0066] Where in embodiments of the present invention reference is made to a molecule or biomolecule or particle or bioparticle or nano- or microparticle, reference is made to a small molecule, a biomolecule, a dna or ma molecule, a virus, a bacterium, an organic or inorganic nanoparticle or microparticle, a bioparticle etc. Where in embodiments of the present invention reference is made to a target particle, reference may be made to another small molecule, a complex small molecule, large molecules, biomolecules, proteins, dna or ma, (bio)particles etc. With small molecule reference may be made to a molecule having a molecular weight lower than 1000.
[0067] According to a first aspect, the present invention relates to a method for obtaining an interaction property between a molecule or biomolecule or particle or bioparticle or nano- or microparticle on the one hand and a target particle on the other hand. Such an interaction property may for example be a dissociation constant for the interaction between the bioparticle and the target particle, a binding strength between the bioparticle and the target particle or a Gibbs free energy for the interaction between the bioparticle and the target particle. The method comprises obtaining potentiometric titration results for a potentiometric measurement during titration of a solution with a titrant,
[0068] said solution being a solution of one of a ligand of the target particle or said a molecule or biomolecule or particle or bioparticle or nano- or microparticle and
[0069] said titrant comprising the other of said target particle ligand or said molecule or biomolecule or particle or bioparticle or nano- or microparticle. Obtaining potentiometric titration results may be receiving the data of the potentiometric titration results (typically a voltage signal as function of the amount of titrant added) as data input through a data transmission line (wired or wireless) or retrieving it from a memory. The data may be previously recorded. Alternatively, obtaining potentiometric titration results may include performing potentiometric titration and gathering the results for use. The method also includes deriving, based on said potentiometric titration results, the interaction property between the molecule or biomolecule or particle or bioparticle or nano- or microparticle on the one hand and the target particle on the other hand. According to at least some embodiments of the present invention such deriving may include first transforming obtained potential data to concentration related data and deriving the interaction property based thereon. Further features and advantages may be as described in the example and/or as described above.
[0070] According to a second aspect, the present invention relates to a system for obtaining an interaction property between a molecule or biomolecule or particle or bioparticle or nano- or microparticle on the one hand and a target particle on the other hand. Such a system may comprise an input means for obtaining potentiometric titration results for a potentiometric measurement during titration of a solution with a titrant, said solution being a solution of one of a ligand of the target particle or said (bio)molecule or (bio)particle or nano- or microparticle and said titrant comprising the other of said target particle ligand or said (bio)molecule or (bio)particle or nano- or microparticle. The input means may be a data receiving means for obtaining data, e.g. through a dataline, or it may comprise a potentiometric titration measurement system, a controller for controlling such a system, or alike, whereby the results obtained through measurement using the measurement system or controller are provided as data to receive. The system also comprises a processing means for deriving based on said potentiometric titration results an interaction property between the molecule or biomolecule or particle or bioparticle or nano- or microparticle on the one hand and the target particle on the other hand. Such a processing means may be any suitable processing means, such as a microprocessor, a CPU, etc. This may be programmed for performing a number of calculations for deriving based on the potentiometric titration results an interaction property. According to some embodiments, the processing means may be programmed for first transforming obtained potential data to concentration related data and deriving the interaction property based thereon. Further features and advantages may be as described in the example and/or as described above. The system may be especially suitable for performing a method as described in the first aspect.
EXAMPLE
[0071] By way of illustration, embodiments of the present invention not being limited thereto, an example illustrating standard and optional features of embodiments of the present invention is discussed below.
[0072] In the example, the utility of a special potentiometric titration approach for recognition and calculation of bioparticle/small molecule interactions is illustrated. The potentiometric titration measurement is based on the use of a classical polymeric membrane indicator electrode in a solution of the small molecule ligand. The bioparticle is used as a titrant. The potential is measured versus a reference electrode and transformed to a concentration related signal over the entire concentration interval, also at low concentrations, where the mV (y-axis) versus log c.sub.analyte (x-axis) function is not linear. In the specific example, the association constant value K.sub.a is calculated for the interaction of cocaine with a cocaine binding aptamer and with an anti-cocaine antibody. To study the selectivity and cross-reactivity, other oligonucleotides are tested, as well as other small ligand molecules such as tetrakis (4-chlorophenyl)borate, metergoline, lidocaine, and bromhexine. The calculated K.sub.a compares favorably to the value reported in the literature using SPR. The newly presented potentiometric titration method (called Transformed Response Potentiometry), makes it possible to determine K.sub.a for a large variety of macromolecular target particles and small molecule ligands.
Experimental
Chemicals
[0073] All the chemicals were of analytical reagent grade. 2-(N-morpholino)ethanesulfonic acid (MES) hydrate and high-molecular mass polyvinylchloride (PVC) was purchased from Acros Organics (Geel, Belgium). The other membrane components such as tetrakis chlorophenyl borate (TCPB), methyltridodecylammoniumchloride (MTDDACl), 2-nitrophenyloctylether (NPOE) and tetrahydrofuran (THF) as solvent for the membrane's components were of the highest quality and from Fluka (Bornem, Belgium). Metergoline, lidocaine, cocaine and bromhexine were obtained from Sigma-Aldrich (Bornem, Belgium). Anti-cocaine antibody was purchased from Abcam (Cambridge, England).
[0074] The sequence of different oligonucleotides that were used in this research are as shown below:
TABLE-US-00001 CocaineBindingAptamer(CBA),43mer: 5-ATCTCGGGACGACAGGATTTTCCTCAATGAAGTGGGTCGTCCC-3 Non-specificoligonucleotide(25-mer-DNA): 5-AAAATATCATCTTTGGTGTTTCCTA-3 43merRandomPrimer(43-mer-RP): 5-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-3 ChloramphenicolBindingAptamer(CAPBA),80mer: 5- AGCAGCACAGAGGTCAGATGACTTCAGTGAGTTGTCCCACGGTCGGCGA GTCGGTGGTAGCCTATGCGTGCTACCGTGAA-3
[0075] The 25-mer-DNA and random primers were obtained from Integrated DNA Technologies (IDT, Gent, Belgium) and the others from Eurogentec (Liege, Belgium).
Instrumentation
Potentiometric Working Electrodes
[0076] The indicator electrode was made of a PVC cylinder (5 mm OD40 mm length). It contained a cylindrical substrate electrode (3 mm diameter1 mm length), which is an electronically conducting graphite/PVC composite material. The composite substrate electrode was polished with Carbimet grit 600 (Buehler Ltd, USA). The rubber phase sensing membrane was coated on the composite substrate electrode. The electrodes with a composite substrate had the important property that the coated membrane and the composite were tightly mixed at the interface.
[0077] The membrane coating used for the detection of positively charged analytes contained 2% (w/w) TCPB, 33% (w/w) PVC and 65% (w/w) NPOE. 100 mg of this mixture was dissolved in 1 mL THF and 240 L of this solution were applied on the electrode surface (dip-coating) by 2 sequential steps. After evaporation at room temperature (1 h) the resulting ionically conductive rubber polymeric phase coated membrane had a thickness of 100 m. The electrodes were kept in buffer solution (1 mM MES pH 7.0) for at least 3 h to obtain a stable baseline for the potentiometric titration. A membrane coating used for the detection of negatively charged analytes can optionally be used, containing 2% (w/w) MTDDACl, 33% (w/w) PVC and 65% (w/w) NPOE.
Potentiometric Setup
[0078] The potentiometric titrations were performed using an indicator electrode and a reference electrode, in a 10 mm diameter beaker. The buffer solution (1 mM MES pH 7.0) was stirred during the entire experiment with a magnetic stirrer (52 mm). After obtaining a stable baseline, the first injection was done by addition of the analyte (5 L) to 500 L of the buffer solution. Always, an increase in potential could be seen in this step. After obtaining a stable signal, the titrant was added using a micropipette at constant time intervals. The usual volume of the titrant was 8 L and pipetting was done every 30 s, unless otherwise stated. The membrane potential was measured against a homemade miniaturized (1.4 mm OD40 mm length) reference electrode (Ag/AgCl) using a high impedance (10.sup.13) homemade amplifier. The detection signals were recorded on a data station composed of a PC equipped with a 6013 NI DA converter and LabVIEW 7 (National Instruments, US) based software. The overall time constant of the high impedance amplifier plus data station was set to 200 ms. All the measurements were done at least three times on three different working electrodes after conditioning and stabilization in the MES buffer solution.
Results and Discussion
Potentiometric Detection of Cocaine in Batch System
[0079]
[0080] The potentiometric indicator electrode used was of the coated wire type, containing TCPB as an ionophore. Some initial spiking phenomena are observed (
E=E.sup.0+S Log(c.sub.analyte+Cst)Eqn. 1
[0081] This function has the typical form shown in
[0082] The equation for the calibration function as exemplified by
c.sub.analyte=(10.sup.E/S1)LODEqn. 2
[0083] The mV signal of the potentiometric sensor was transformed to c.sub.analyte. In the present example this is performed by Equation 2 being the transpose of equation 1. The latter is illustrated in
tR10.sup.E/s1Eqn. 3
Interaction Analysis with Transformed Response Potentiometric Titration
[0084] The potentiometric titrations were used to examine the small molecule/bioparticle interactions, by measuring the potential of a working electrode in relation to the added titrant volume. Two different models were explored: one method measures the concentrations of the complexing species and the complex at the equivalence point (EP). Another method measures these concentrations at an arbitrarily chosen point largely surpassing the equivalence point (post-EP: PEP). The reason to do this, is that equivalence points are easy to localize when K.sub.a values are e.g. in the 10.sup.10 M.sup.1 region, but can be difficult to localize when they are in the region of molecule/bioparticle values, i.e. around 10.sup.6 M.sup.1. A classical titration curve (mV y-axis) is shown in
[0085] The study of the binding strength (K.sub.a, Eqn. 3) starts with the well-known bimolecular phenomenon between an analyte (A) and a (bio)molecule or (bio)particle (M). We assume 1:1 complex formation:
[0086] The dissociation constant
and the Gibbs free energy of interaction can be calculated (G=RTlnK.sub.a) from K.sub.a.
[0087] The first approach, which will be called in the text Equivalence Point Method, uses the equivalence point of the potentiometric titration curve to determine the K.sub.a. Equivalence points were obtained with the Gran method, because a small amount of titration points (less than 50) was used, and e.g. a first derivative method would be inaccurate. The Gran method is described educationally on several (internet) documents (see above), and originates in more than 60 year old publications. In the case of the titration of cocaine with CBA or TCPB (
[0088] [A].sub.EP can be calculated from tR at the equivalence point (see eqn. 2), tR.sub.EP, and from tR at the beginning of the titration, tR.sub.0, as tR.sub.EP and tR.sub.0 are linearly related to [A].sub.EP and to [A].sub.0 respectively. [A].sub.0 is chosen so as to have a good compromise between sufficient sensor response (mV), and analyte concentrations which allow to reduce the quantity (the cost) of the titrant bioparticle. Using 500 L of a 10.sup.5 M cocaine analyte solution was a good compromise. In the future, smaller indicator electrodes (e.g. 1 mm diameter) will allow to work in more miniaturized and automated systems, which are available on the market. Working with 10.sup.5 M analyte solutions also implies that, during titration, we will approach (or reach) the non-linear part of the potentiometric mV versus log c.sub.analyte calibration graph. Therefore, it is needed to work with the Transformed Response, tR, as outlined above.
[0089] [A].sub.0 being known, we have to derive [A].sub.EP via eqn. 5:
[0090] E.sub.0 being the potential at the start of the titration (not to be confused with E.sup.0), i.e. at titrant volume equal to zero, and E.sub.EP being the potential at the equivalence point. As mentioned above, these potentials are offset to a zero value at zero analyte concentration (pure buffer solution).
[0091] The second approach, which will be called in the text Post-EP Method, uses a point after the equivalence point of the potentiometric titration curve to determine the K.sub.a. The Post-EP Method is used to calculate the association constant (Eqn. 6), as a function of the concentration of the analyte at the start, [A].sub.0, (which is known) and at the post-equivalence point (PEP). For the latter point we took the point at the end of the titration in the present study (Eqn. 7):
[0092] The titration of cocaine with TCPB is used as an example to explain the two different models (
[0093] As shown in table 1 the obtained K.sub.a values using either the Equivalence Point Method (Eqn. 4) or the Post-EP Method (Eqn. 6) both are in the 10.sup.9 M.sup.1 range. G.sup.0 values are completely comparable as calculated by the two suggested methods. Similar results were obtained for potentiometric titrations of cocaine with CBA, yielding a G value of 8.560.10 kcal mol.sup.1 with the EP Method and 8.000.13 kcal mol.sup.1 with the PEP Method.
[0094] Table 1: Comparison of the potentiometric titration of cocaine with TCPB between the two suggested methods based on the Equivalence Point (EP) and Post-EP (PEP). Mean values (n=amount of different electrodes tested) of K.sub.a, K.sub.d and G values with their corresponding standard deviations (SD) are presented.
TABLE-US-00002 Potentiometric titration of cocaine with TCPB Ka SD G.sup.0 SD Method (M.sup.1) (M.sup.1) (kcal mol.sup.1) (kcal mol.sup.1) n EP 3 10.sup.9 1 10.sup.9 12.8 0.2 3 PEP 9 10.sup.9 2 10.sup.9 13.3 0.1 3
[0095] All the results given below are calculated with the Post-EP Method, because the latter method is much more suited for working in biomolecular conditions. These conditions include firstly them availability of biocomponents at high cost, leading to small numbers of titrant injections. Secondly, the K.sub.a values of the bioparticle/small molecule complex are often in the order of 10.sup.6 or lower. This is at the limits of obtaining clear equivalence points in classical potentiometric titrations. In titration methods, clearly observable equivalence points are needed for quantitative determinations of analyte concentrations by addition of known concentrations of titrant. To determine K.sub.a values however, they are no prerequisite. Furthermore, if the described transformed response potentiometry titration method is used, we can work with a ligand concentration related y-axis.
Specificity of the Small Molecule/Bioparticle Complex Formation
[0096] Titration of Cocaine (as Ligand) with Different Oligonucleotides (as Titrants)
[0097] Four different oligonucleotides were used for the selectivity study. The specific selected anti-cocaine aptamer (CBA) was compared with an anti-chloramphenicol aptamer (CAPBA) and with two randomly chosen oligonucleotides (25-mer-DNA and 43-mer-RP).
[0098] That means that CBA has a better interaction with cocaine because of the specificity of the selected bioparticle. Because the sequence of CBA had 43 bases, the 43-mer-RP was chosen for the investigation of the diagnostic performance. In the series of titrants, the CAPBA is the second, the 43-mer-RP is the third and 25-mer-DNA is the last one. Therefore, 25-mer-DNA and 43-mer-RP have little or no specific interaction with cocaine. This illustrates that the synthesized aptamer for cocaine has good recognition properties for its target, as shown by Hilton et al.
[0099] The calculated association constants for interaction between cocaine and different titrants shown in
Titration of Cocaine with Different Bioparticles
[0100] In order to validate the suggested model for potentiometric titrations, cocaine was also titrated with another type of recognition element, i.e. an anti-cocaine antibody.
Titration of Different Ligands with CBA (as Biomolecular Titrant)
[0101] For studying the cross-reactivity of the specific biomolecular interaction, positively charged molecules (in MES buffer solution pH 7) were titrated with CBA.