Lipids and compositions for intracellular delivery of biologically active compounds

09636302 ยท 2017-05-02

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides novel amino-lipids, compositions comprising such amino-lipids and methods of producing them. In addition, lipid nanoparticles comprising the novel amino-lipids and a biologically active compound are provided, as well as methods of production and their use for intracellular drug delivery.

Claims

1. A cyclic amino-lipid of the formula: ##STR00032## wherein: R1 is independently selected from (CH.sub.2).sub.2N(R).sub.2; (CH.sub.2).sub.2N(R)(CH.sub.2).sub.2N(R).sub.2, wherein R is independently selected from H, C6-40 alkyl, C6-40 alkenyl and C6-C40 alkynyl, provided that N(R).sub.2 is not NH.sub.2; C6-40 alkyl, and C6-40 alkenyl; and R2 is C6-40 alkyl, C6-40 alkenyl or C6-40 alkynyl; and m is 0 or 1, provided that when m is 0, R1 is not C6-C40 alkyl or C6-C40 alkenyl; and pharmaceutically acceptable salts thereof.

2. The cyclic amino-lipid of claim 1, selected from the group of ##STR00033##

3. A lipid nanoparticle comprising a cyclic amino-lipid of claim 1.

4. The lipid nanoparticle of claim 3, further comprising an additional lipid selected from the group consisting of: a cationic lipid, a helper lipid, and a PEG-lipid.

5. The lipid nanoparticle of claim 3, further comprising a hydrophobic small molecule.

6. The lipid nanoparticle of claim 3, further comprising a biologically active compound.

7. The lipid nanoparticle of claim 6, wherein the biologically active compound is selected from the group consisting of: a small molecule, a peptide, a protein, a carbohydrate, a nucleic acid, and a lipid.

8. The lipid nanoparticle of claim 4, wherein the cationic lipid is a lipid comprising a quaternary amine with a nitrogen atom having four organic substituents.

9. The lipid nanoparticle of claim 4, wherein the helper lipid is a neutral zwitterionic lipid.

10. The lipid nanoparticle of claim 5, wherein the hydrophobic small molecule is selected from the group consisting of a sterol and a hydrophobic vitamin.

11. The lipid nanoparticle of claim 10, wherein the hydrophobic small molecule is cholesterol.

12. The lipid nanoparticle of claim 7, wherein the protein is selected from the group consisting of a nucleoprotein, a mucoprotein, a lipoprotein, a synthetic polypeptide, a small molecule linked to a protein, and a glycoprotein.

13. The lipid nanoparticle of claim 7, wherein the nucleic acid is in the form of a single stranded or partially double stranded oligomer or a polymer composed of ribonucleotides.

14. The lipid nanoparticle of claim 7, wherein the nucleic acid is selected from the group consisting of miRNA, antisense oligonucleotides, siRNA, immune-stimulatory oligonucleotides, aptamers, ribozymes, and plasmids encoding a specific gene or siRNA.

15. A pharmaceutical composition comprising a cyclic amino-lipid according to claim 1.

16. A pharmaceutical composition comprising a lipid nanoparticle according to claim 3.

17. The pharmaceutical composition of claim 16, further comprising a biologically active compound.

18. The pharmaceutical composition of claim 17, wherein the biologically active compound is a nucleic acid.

19. The pharmaceutical composition of claim 18, wherein the nucleic acid is in the form of a single stranded or partially double stranded oligomer or a polymer composed of ribonucleotides.

20. A method of treating a disease that is caused by the over-expression of one or several proteins in a subject, said method comprising the administration of a lipid nanoparticle according to claim 6 to the subject, wherein the biologically active compound is a nucleic acid, and wherein treatment refers to alleviation of symptoms, decreasing the rate of disease progression, amelioration or palliation of the disease state, remission or improved prognosis, or slowing the progression of the disease.

21. A method of treating a disease that is caused by a reduced, suppressed or missing expression of one or several proteins in a subject, said method comprising administration of a lipid nanoparticle according to claim 6 to the subject, wherein the biologically active compound is a nucleic acid, and wherein treatment refers to alleviation of symptoms, decreasing the rate of disease progression, amelioration or palliation of the disease state, remission or improved prognosis, or slowing the progression of the disease.

22. A method for generating an immune response in a subject, said method comprising the administration of the lipid nanoparticle according to claim 6 to the subject, wherein the biologically active compound is an immune-stimulatory nucleic acid.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. Structures representing amino-lipids of the invention.

(2) FIG. 2. Bar graph illustrating improved LNP composition of the invention to reduce FVII mRNA levels in mice.

(3) FIG. 3. Graph illustrating GFP mRNA levels after orotracheal instillation of LNPs of the present invention into GFP transgenic mice (n=4). Individual siRNAs directed against the targets indicated below the bars were formulated into LNPs consisting of 50% KL25, 10% DSPC, 38.5% cholesterol and 1.5% PEG2000-c-DOMG. 48 h post administration animals were killed, bronchoalveolar lavage fluid (BALf) prepared and the GFP mRNA level determined using bDNA assay. Hatched bars represent GFP mRNA levels of animals treated with the unspecific siRNAs.

(4) FIG. 4. Graph illustrating CD45 mRNA levels after orotracheal instillation of LNPs of the present invention into GFP transgenic mice (n=4). Individual siRNAs directed against the targets indicated below the bars were formulated into LNPs consisting of 50% KL25, 10% DSPC, 38.5% cholesterol and 1.5% PEG2000-c-DOMG. 48 h post administration animals were killed, bronchoalveolar lavage fluid (BALf) prepared and the CD45 mRNA level determined using bDNA assay. Hatched bars represent CD45 mRNA levels of animals treated with the unspecific siRNAs.

(5) FIG. 5. Graph illustrating CD68 mRNA levels after orotracheal instillation of LNPs of the present invention into GFP transgenic mice (n=4). Individual siRNAs directed against the targets indicated below the bars were formulated into LNPs consisting of 50% KL25, 10% DSPC, 38.5% cholesterol and 1.5% PEG2000-c-DOMG. 48 h post administration animals were killed, bronchoalveolar lavage fluid (BALf) prepared and the CD68 mRNA level determined using bDNA assay. Hatched bars represent CD68 mRNA levels of animals treated with the unspecific siRNAs.

(6) FIG. 6. Graph illustrating Clec7a mRNA levels after orotracheal instillation of LNPs of the present invention into GFP transgenic mice (n=4). Individual siRNAs directed against the targets indicated below the bars were formulated into LNPs consisting of 50% KL25, 10% DSPC, 38.5% cholesterol and 1.5% PEG2000-c-DOMG. 48 h post administration animals were killed, bronchoalveolar lavage fluid (BALf) prepared and the Clec7a mRNA level determined using bDNA assay. Hatched bars represent Clec7a mRNA levels of animals treated with the unspecific siRNAs.

(7) FIG. 7. Graph illustrating Reln mRNA levels after siRNA treatment employing different LNPs of the present invention. The LNPs contained a pool of five different siRNAs directed against five different targets (FVII, Rein, Clec4f, Tek, GFP). The siRNA dose was 0.5 mg/kg per siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. and 48 h post dosing mRNA levels were measured using bDNA assay. For comparison and shown has hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

(8) FIG. 8. Graph illustrating Clec4f mRNA levels after siRNA treatment employing different LNPs of the present invention. The LNPs contained a pool of five different siRNAs directed against five different targets (FVII, Rein, Clec4f, Tek, GFP). The siRNA dose was 0.5 mg/kg per siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. and 48 h post dosing mRNA levels were measured using bDNA assay. For comparison and shown has hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

(9) FIG. 9. Graph illustrating Tek mRNA levels in liver after siRNA treatment employing different LNPs of the present invention. The LNPs contained a pool of five different siRNAs directed against five different targets (FVII, Rein, Clec4f, Tek, GFP). The siRNA dose was 0.5 mg/kg per siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. and 48 h post dosing mRNA levels were measured using bDNA assay. For comparison and shown has hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

(10) FIG. 10. Graph illustrating Tek mRNA levels in liver after siRNA treatment employing different LNPs of the present invention. The LNPs contained a pool of five different siRNAs directed against five different targets (FVII, Rein, Clec4f, Tek, GFP). The siRNA dose was 0.5 mg/kg per siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. 5 and 48 h post dosing mRNA levels were measured using bDNA assay. For comparison and shown has hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

(11) FIG. 11. Graph illustrating Tek mRNA levels in lung after siRNA treatment employing different LNPs of the present invention. The LNPs contained a pool of five different siRNAs directed against five different targets (FVII, Rein, Clec4f, Tek, GFP). The siRNA dose was 0.5 mg/kg per siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. and 48 h post dosing mRNA levels were measured using bDNA assay. For comparison and shown has hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

(12) FIG. 12. Graph illustrating Tek mRNA levels in jejunum after siRNA treatment employing different LNPs of the present invention. The LNPs contained a pool of five different siRNAs directed against five different targets (FVII, Reln, Clec4f, Tek, GFP). The siRNA dose was 0.5 mg/kg per siRNA (total siRNA dose 2.5 mg/kg). LNPs were dosed i.v. and 48 h post dosing mRNA levels were measured using bDNA assay. For comparison and shown has hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

(13) FIG. 13. Graph illustrating Reln mRNA expression levels of 2 individual animals per LNP relative to saline treated animals 48 h post iv dosing. LNPs contained a pool of five different siRNAs directed against FVII, GFP, Rein, Clec4f and Tek each at a dose of 0.5 mg/kg (total siRNA dose 2.5 mg/kg). LNPs were composed of 50 mol % amino-lipid designated by the KL numbers in the graphs below, 10 mol % DSPC, 38.5 mol % cholesterol and 1.5 mol % PEG-c-OMOG. For comparison and shown as hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

(14) FIG. 14. Graph illustrating Clec4f mRNA expression levels of 2 individual animals per LNP relative to saline treated animals 48 h post iv dosing. LNPs contained a pool of five different siRNAs directed against FVII, GFP, Rein, Clec4f and Tek each at a dose of 0.5 mg/kg (total siRNA dose 2.5 mg/kg). LNPs were composed of 50 mol % amino-lipid designated by the KL numbers in the graphs below, 10 mol % DSPC, 38.5 mol % cholesterol and 1.5 mol % PEG-c-OMOG. For comparison and shown as hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

(15) FIG. 15. Graph illustrating Tek mRNA expression levels of 2 individual animals per LNP relative to saline treated animals 48 h post iv dosing. LNPs contained a pool of five different siRNAs directed against FVII, GFP, Rein, Clec4f and Tek each at a dose of 0.5 mg/kg (total siRNA dose 2.5 mg/kg). LNPs were composed of 50 mol % amino-lipid designated by the KL numbers in the graphs below, 10 mol % DSPC, 38.5 mol % cholesterol and 1.5 mol % PEG-c-OMOG. For comparison and shown as hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

(16) FIG. 16. Graph illustrating Tek mRNA expression levels of 2 individual animals per LNP relative to saline treated animals 48 h post iv dosing. LNPs contained a pool of five different siRNAs directed against FVII, GFP, Rein, Clec4f and Tek each at a dose of 0.5 mg/kg (total siRNA dose 2.5 mg/kg). LNPs were composed of 50 mol % amino-lipid designated by the KL numbers in the graphs below, 10 mol % DSPC, 38.5 mol % cholesterol and 1.5 mol % PEG-c-OMOG. For comparison and shown as hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

(17) FIG. 17. Graph illustrating Tek mRNA expression levels of 2 individual animals per LNP relative to saline treated animals 48 h post iv dosing. LNPs contained a pool of five different siRNAs directed against FVII, GFP, Rein, Clec4f and Tek each at a dose of 0.5 mg/kg (total siRNA dose 2.5 mg/kg). LNPs were composed of 50 mol % amino-lipid designated by the KL numbers in the graphs below, 10 mol % DSPC, 38.5 mol % cholesterol and 1.5 mol % PEG-c-OMOG. For comparison and shown as hashed bar, a benchmark LNP in which XTC2 substituted the amino-lipid was included.

DETAILED DESCRIPTION OF THE INVENTION

(18) A. Amino-Lipids and Methods of Producing Them.

(19) The amino-lipids provided herein are produced by reductive amination of a (poly)amine and an aliphatic carbonyl compound according to the general reaction scheme:
RNH.sub.2+RCHO.fwdarw.RN(CHR).sub.2
RNH.sub.2+RCOR.fwdarw.RN(CR.sub.2).sub.2

(20) The amino-lipids may be prepared by reacting the aliphatic carbonyl compound and the (poly)amine in the presence of a reducing agent.

(21) In certain embodiments the aliphatic carbonyl compound is a ketone. In certain embodiments the aliphatic carbonyl compound is an aldehyde. Typically, the (poly)amine has two to five nitrogen atoms in its structure. In certain embodiments the (poly)amine contains primary and/or secondary and/or tertiary nitrogen atoms. Depending on the structure of the (poly)amine, and the aliphatic carbonyl compound employed regioselective alkylations can be achieved. Particularly, when ketones are reacted with polyamines displaying primary and/or secondary and/or tertiary nitrogens under reductive amination conditions selective alkylations of primary nitrogens can be achieved. The present invention covers procedures of making amino-lipids of the following structures:
RNH(CH.sub.2).sub.xNH.sub.2,
R.sub.2N(CH.sub.2).sub.xNH.sub.2,
R.sub.2N(CH.sub.2).sub.xNHR,
R.sub.2N(CH.sub.2).sub.xNR.sub.2,
RNH[(CH.sub.2).sub.x(C.sub.wH.sub.2wNH)y(CH.sub.2).sub.z]NH.sub.2,
RNH[(CH.sub.2).sub.x(C.sub.wH.sub.2wNR)y(CH.sub.2).sub.z]NH.sub.2,
RNH[(CH.sub.2).sub.x(C.sub.wH.sub.2wNR).sub.y(C.sub.vH.sub.2vNH).sub.u(CH.sub.2).sub.z]NH.sub.2,
R.sub.2N[(CH.sub.2).sub.x(C.sub.wC.sub.2wNH).sub.y(CH.sub.2).sub.z]NH.sub.2,
R.sub.2N[(CH.sub.2).sub.x(C.sub.wC.sub.2wNH).sub.y(CH.sub.2).sub.z]NH.sub.2,
R.sub.2N[(CH.sub.2).sub.x(C.sub.wC.sub.2wNR).sub.y(C.sub.vH.sub.2vNH).sub.u(CH.sub.2).sub.z]NH.sub.2,
RNH[(CH.sub.2).sub.x(C.sub.wH.sub.2wNH).sub.y(CH.sub.2).sub.z]NHR,
RNH[(CH.sub.2).sub.x(C.sub.wH.sub.2wNH).sub.y(CH.sub.2).sub.z]NHR,
RNH[(CH.sub.2).sub.x(C.sub.wH.sub.2wNR).sub.y(C.sub.vH.sub.2vNH).sub.u(CH.sub.2).sub.z]NHR,
R.sub.2N[(CH.sub.2).sub.x(C.sub.wH.sub.2wNH).sub.y(CH.sub.2).sub.z]NHR,
R.sub.2N[(CH.sub.2).sub.x(C.sub.wH.sub.2wNH).sub.y(CH.sub.2).sub.z]NHR,
R.sub.2N[(CH.sub.2).sub.x(C.sub.wH.sub.2wNR).sub.y(C.sub.vH.sub.2vNH).sub.u(CH.sub.2).sub.z]NHR,
R.sub.2N[(CH.sub.2).sub.x(C.sub.wH.sub.2wNH).sub.y(CH.sub.2).sub.z]NR.sub.2,
R.sub.2N[(CH.sub.2).sub.x(C.sub.wH.sub.2wNR).sub.y(CH.sub.2).sub.z]NR.sub.2,
R.sub.2N[(CH.sub.2).sub.x(C.sub.wH.sub.2wNR).sub.y(C.sub.vH.sub.2vNH).sub.u(CH.sub.2).sub.z]NR.sub.2,
N{[(CH.sub.2).sub.x(C.sub.wH.sub.2wNH).sub.y(CH.sub.2).sub.z]NHR}.sub.3,
N{[(CH.sub.2).sub.x(C.sub.wH.sub.2wNH).sub.y(CH.sub.2).sub.z]NR.sub.2}.sub.3,
HN{[(CH.sub.2).sub.x(C.sub.wH.sub.2wNH).sub.y(CH.sub.2).sub.z]NHR}.sub.2, and
HN{[(CH.sub.2).sub.x(C.sub.wH.sub.2wNH).sub.y(CH.sub.2).sub.z]NR.sub.2}.sub.2,
wherein R is selected from alkyl, alkenyl or alkynyl carbon chains ranging from C6 to C20. In certain embodiments these chains comprise at least one, at least two or at least three sites of unsaturation, for example one or more double bonds or triple bonds. In one embodiment, R comprises at least one aromatic cycle, including for example a heterocycle. In yet another embodiment, R may comprise at least one heteroatom in the carbon chain, for example O, NH, NW, S, SS, wherein R is an acyl, alkyl, alkenyl or alkynyl group consisting of two to 20 carbon atoms. In still another embodiment, at least one hydrogen in the hydrocarbon chain R may be replaced by F, Cl, Br, I. In one embodiment, w and v are independently 2, 3 or 4. In one embodiment, y and u are independently 0, 1, 2, 3 or 4. In one embodiment, x and z are independently 2, 3 or 4.

(22) In one aspect, the present invention provides cyclic amino-lipids of the formula (I):

(23) ##STR00001##
wherein
R.sup.1 is independently selected from (CH.sub.2).sub.2N(R).sub.2, (CH.sub.2).sub.2N(R)(CH.sub.2).sub.2N(R).sub.2, wherein R is independently selected from H, C6-40 alkyl, C6-40 alkenyl and C6-40 alkynyl, provided that N(R).sub.2 is not NH.sub.2, and C6-40 alkyl, and C6-40 alkenyl;
R.sup.2 is C6-40 alkyl, C6-40 alkenyl, or C6-40 alkynyl;
m is 0 or 1; and
pharmaceutically acceptable salts thereof.

(24) The term C6-40 alkyl as used herein means a linear or branched, saturated hydrocarbon consisting of 6 to 40 carbon atoms, preferably of 6 to 30 carbon atoms, most preferably of 6 to 20 carbon atoms. Especially preferred are alkyl groups containing 10, 14 or 15 carbon atoms.

(25) The term C6-40 alkenyl as used herein means a linear or branched, unsaturated hydrocarbon consisting of 6 to 40 carbon atoms, preferably of 6 to 30 carbon atoms, most preferably of 6 to 15 carbon atoms. In one embodiment the C6-40 alkenyl groups comprise 1 to 4 double bonds, preferably between 1 to 3 double bonds, most preferably 1 or 2 double bonds.

(26) The term C6-40 alkynyl as used herein means a linear or branched, unsaturated hydrocarbon consisting of 6 to 40 carbon atoms, preferably of 6 to 30 carbon atoms, most preferably of 6 to 20 carbon atoms. In one embodiment the C6-40 alkynyl groups comprise 1 to 4 triple bonds, preferably 1 to 3 triple bonds, most preferably 1 or 2 triple bonds.

(27) In another embodiment there are provided the cyclic amino-lipids selected from

(28) ##STR00002## ##STR00003## ##STR00004## ##STR00005##

(29) Preferred therein are the cyclic amino-lipids selected from

(30) ##STR00006##

(31) In one aspect, the present invention provides linear amino-lipids of the formula (II):

(32) ##STR00007##
wherein R.sup.3 is independently selected from C1-40 alkyl or C6-40 alkenyl, wherein up to 4 carbon atoms may be replaced by a heteroatom selected from oxygen or nitrogen; R.sup.4 is selected from C12-40 alkyl or C6-40 alkenyl, wherein up to 4 carbon atoms may be replaced by a heteroatom selected from oxygen or nitrogen; R.sup.5 is selected from hydrogen, C12-30 alkyl and C6-40 alkenyl; R.sup.6 is selected from hydrogen and C1-12 alkyl; n is 1, 2, or 3; and k is 1, 2, 3 or 4.

(33) In a preferred embodiment, a linear amino-lipids of the formula (II) is provided wherein R.sup.3 is independently selected from C1-, C12-, C14-, C27-, C30- and C37-alkyl, wherein 1 or 2 carbon atoms can be optionally replaced by an oxygen or a nitrogen atom; R.sup.4 is selected from C12-, C14-, C27-, C30- and C37-alkyl, wherein 1 or 2 carbon atoms can be optionally replaced by an oxygen or a nitrogen atom; R.sup.5 is selected from hydrogen, C12-, C14- and C30-alkyl, in which one carbon atom can be optionally replaced by a nitrogen atom; R.sup.6 is selected from hydrogen, C1- and C12-alkyl; and n and k have the meanings given in claim 1.

(34) In one embodiment there are provided the linear amino-lipids selected from

(35) ##STR00008## ##STR00009## ##STR00010## ##STR00011## ##STR00012##

(36) Preferred therein is the linear amino-lipid

(37) ##STR00013##

(38) In yet another embodiment an amino-lipid of formula

(39) ##STR00014##
is provided.

(40) In yet another embodiment an amino-lipid of formula

(41) ##STR00015##
is provided.

(42) In yet another embodiment an amino-lipid of formula

(43) ##STR00016##
is provided.

(44) In particular embodiments the amino-lipids of the present invention comprise Nitrogen atoms that are protonated depending on the pH of the environment, preferably at least one Nitrogen atom is positively charged at physiological pH or below. The extent of pH dependent protonation is effected by an equilibrium reaction and hence not the entire, but only the predominant lipid species is positively charged. At physiological pH at least one of the nitrogen atoms in the lipid structure is protonated.

(45) As used herein, the term (poly)amine refers to a saturated hydrocarbon linear or branched wherein 2 to 5 Carbon atoms are replaced by Nitrogen. Preferably said (poly)amine comprises two to five nitrogen atoms. Preferred therein are (poly)amines that comprise amine Nitrogens that are separated by 2 and/or 3 and/or 4 carbon atoms. Non-limiting examples of suitable (poly)amines are ethylenediamine, diethylenetriamine, triethylenetetramine, tetraethylenepentamine, tris-(2-aminoethyl)-amine, 3-dimethylamino-1-propylamine, spermine, spermidine, 2,2-(ethylenedioxy)-bis(ethylamine). The term aliphatic carbonyl compound as used herein refers to a compound RCOR, wherein R is a ketone or an aldehyde comprising of alkyl and/or alkenyl and/or alkynyl groups and R is H or a ketone or an aldehyde comprising of alkyl and/or alkenyl and/or alkynyl groups.

(46) The term reducing agent as used herein refers to a reagent that enables the reduction of the iminium ion intermediate in reductive amination reactions. Examples of such reagents include, but are not limited to hydride reducing reagents such as sodium cyanoborohydride, sodium triacetoxyborohydride and sodium borotetrahydride. Catalytic hydrogenation with metal catalyst such as nickel, palladium or platinum can also be used for this purpose. As used herein, the term lipid refers to amphiphilic molecules comprising a polar, water soluble headgroup and a hydrophobic tail. The headgroup preferably consists of a pH dependent charged group such as an amine. The tail preferably comprises aliphatic residues. Lipids can be of natural origin or of synthetic origin. Examples include, but are not limited to, fatty acids (e.g. oleic acid, lineolic acid, stearic acid), glycerolipids (e.g. mono-, di-, triglycerols such as triglycerides), phospholipids (e.g. phosphatidylethanolamine, phosphatidylcholine), and sphingolipids (e.g. sphingomyelin)

(47) As used herein, the term amino-lipid refers to lipids having at least one of the Nitrogen atoms incorporated in at least one fatty acid chain. This fatty acid chain may be an alkyl, alkenyl or alkynyl carbon chain. Lipids containing carbon chain lengths in the range from C10 to C20 are preferred. It is understood that the fatty acid portion of the amino-lipid of the present invention is incorporated through the use of suitable carbonyl compounds such as aldehydes (RCHO) and ketones (RCOR). Through the use of asymmetrical ketones (RCOR) corresponding unsymmetrical substituted lipids can be prepared. Likewise, through the use of carbonyl ethers, esters, carbamates and amides and suitable reducing agents the corresponding amino-lipids are accessible.

(48) The term cyclic amino-lipid as used herein refers to an amino-lipid of the general formula (I).

(49) The term linear amino-lipid as used herein refers to an amino-lipid of the general formula (II).

(50) In another aspect, novel amino-lipids can be prepared by reacting a suitable (poly)amine with a carbonyl compound in the presence of a reducing agent to form a cyclic or linear amino-lipid.

(51) In certain embodiments the alkyl, alkenyl and alkynyl groups as covered in the present invention contain 2 to 20 carbon atoms. In certain other embodiments these groups consists of 2 to 10 carbon atoms. In yet other embodiments the alkyl, alkenyl and alkynyl groups employed in this invention contain 2 to 8 carbon atoms. In still other embodiments these groups contain two to six carbon atoms. In yet other embodiments the alkyl, alkenyl and alkynyl groups of the invention contain 2 to four carbon atoms.

(52) The term alkyl as used herein means a chain of saturated hydrocarbons that is aliphatic, branched or cyclo-aliphatic. Saturated aliphatic hydrocarbons include methyl, ethyl, n-propyl, n-butyl and the like. Saturated branched alkyls include isopropyl, isobutyl, tert-butyl and the like. Representative cyclo-aliphatic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like.

(53) The term alkenyl denotes a chain of hydrocarbons that has at least one carbon-carbon double bond. For example alkenyl groups include ethenyl, propenyl, butenyl, isopropylidene and the like. The term also covers cyclic alkenyls such as cyclopropenyl, cyclobutenyl, cyclopentenyl and the like.

(54) The term alkynyl denotes a chain of hydrocarbons that has at least one carbon-carbon triple bond. Exemplary alkynyl groups include ethynyl, propynyl, butynyl and the like. The term also covers cyclic alkynyls such as cyclopentynyl, cyclohexynyl, and the like.

(55) The term acyl refers to any alkyl, alkenyl or alkynyl group that is linked through a carbonyl group. For example, acyl groups are (CO)-alkyl, (CO)-alkenyl and (CO)-alkynyl.

(56) B. Lipid Nanoparticles (LNPs) Comprising the Inventive Amino-Lipids

(57) Also provided herein are compositions comprising the amino-lipids of the invention that form lipid nanoparticles (LNPs). As used herein, the term lipid nanoparticles includes liposomes irrespective of their lamellarity, shape or structure and lipoplexes as described for the introduction of pDNA into cells (PNAS, 1987, 84, 7413). These lipid nanoparticles can be complexed with biologically active compounds such as nucleic acids and are useful as in vivo delivery vehicles. Preferably said in vivo delivery is cell-type specific.

(58) In one embodiment, said lipid nanoparticles comprise one or more amino-lipids of the invention described above and may furthermore comprise additional lipids and other hydrophobic compounds such as sterol derivatives, e.g. cholesterol. Those additional components of a lipid nanoparticle of the present invention serve various purposes such as aiding manufacturing and storage stability as well as modulation of the biodistribution. Biodistribution may also be modulated by incorporation of targeting ligands conjugated to the lipids part of the lipid nanoparticle. Specific examples of additional components of the lipid nanoparticles are given below.

(59) In one embodiment, lipid nanoparticles are provided that comprise the amino-lipids described above and one or more additional lipids. Additional lipids suitable to be incorporated into the lipid nanoparticles of the invention comprise cationic lipids, helper lipids and PEG lipids. Hence in one embodiment lipid nanoparticles are provided that comprise the amino-lipids described above and one or more additional lipids selected from the group of cationic lipid, helper lipid and PEG lipid. Cationic lipids as used herein refers to any lipid comprising a quaternary amine and are consequently permanently positively charged. The term quaternary amine as used herein refers to a nitrogen atom having four organic substituents. For example, the nitrogen atom in Tetramethylammonium chloride is a quaternary amine.

(60) Examples of cationic lipids comprising a quaternary amine include, but are not limited to, N-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N,N,-Distearyl-N,N-dimethylammonium bromide (DDBA), 1-methyl-4-(cis-9-dioleyl)-methylpyridinium-chloride (SAINT-solid), N-(2,3-dioleyloxy)propyl)-N,N,N-triethylammonium chloride (DOTMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), (1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (DIMRIE) and the like.

(61) Helper lipids, as used herein are preferably neutral zwitterionic lipids. Examples of preferred helper lipids used in this invention are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), or any related phosphatidylcholine such as natural sphingomyelin (SM) and synthetic derivatives thereof such as 1-oleoyl-2-cholesteryl-hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC). Other preferred helper lipids include I,2-dileoyl-sn-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanol-amine (ME 16:0 PE).

(62) In one embodiment, LNPs contain uncharged lipids modified with hydrophilic polymers, e.g. polyethylene glycol (herein also referred to as PEG-lipids) to stabilize the lipid nanoparticle and to avoid aggregation. The polyethylene glycol (PEG) size can vary from approximately 1 to 5 approximately kDa. Depending on the relative amounts of these molecules in the formulation and the length of the hydrocarbon chain, the PEG-lipid can influence the pharmacokinetic characteristics, biodistribution, and efficacy of a formulation. PEG lipids having relatively short lipid hydrocarbon chains of about 14 carbons dissociate from the LNP in vivo in plasma with a half-life of less than 1 h. In contrast, a PEG lipid with a relatively long lipid hydrocarbon chain length of about 18 carbons circulates fully associated with the formulation for several days. Hence, in one preferred embodiment, said PEG lipid comprises a lipid hydrocarbon chain of 12 to 20 carbon atoms, 14 to 18 carbon atoms, preferably of 14 carbon atoms.

(63) Typically, the concentration of the PEG-lipid is about 0.5 to 10 mol %. Examples of suitable PEG modified lipids include pegylated ceramide conjugates, pegylated distearoylphosphatidyl-ethanolamine (PEG-DSPE). Other compounds that can be used to stabilize lipid nanoparticles include gangliosides (GMt, GM3, etc.). Preferred PEG lipids have a PEG size ranging from about 1 to about 2 KDa. Specific examples are methoxy-polyethyleneglycol-carbamoyl-dimyristyloxy-propylamine (PEG2000-c-DMA), and (-(3-(1,2-dimyristoyl-3-propanoxy)-carboxamide-propyl]--methoxy-polyoxyethylene (PEG2000-c-DOMG).

(64) In one embodiment lipid nanoparticles are provided that comprise the amino-lipids described above and one or more hydrophobic small molecule. The term hydrophobic small molecule as used herein refers to a compound with a molecular weight of about 300 to about 700 Da comprising 2 or more carbon- or heterocycles providing a rigid core structure. Preferably said hydrophobic small molecule is selected from the group of sterols such as cholesterol or stigmasterol or a hydrophobic vitamin such as tocopherol. In a preferred embodiment said hydrophobic small molecule is cholesterol.

(65) In one embodiment the lipid nanoparticle comprises an amino-lipid of the present invention, one or more additional lipids selected from the group of cationic lipid, helper lipid and PEG lipid. and a hydrophobic small molecule selected from the group of a sterol or a hydrophobic vitamin. In one embodiment said lipid nanoparticle comprises an amino-lipid of the present invention, a helper lipid selected from DSPC or DPPC, PEG-DOMG and a hydrophobic small molecule selected from the group of a sterol or a hydrophobic vitamin.

(66) In one embodiment the lipid nanoparticle comprises an amino-lipid of the present invention, a helper lipid, a PEG modified lipid and cholesterol. In preferred embodiments the molar ratios of these components are 30-70% amino-lipid, 0-60% helper lipid, 0.1-10% PEG lipid and 0-50% cholesterol. More preferred lipid nanoparticle compositions comprise the above mentioned components in a molar ratio of about 40% to 60% amino-lipid, 0 to 20% helper lipid, 0.1% to 5% PEG lipid and 30 to 50% cholesterol. In certain other embodiments lipid nanoparticles are provided that do not comprise cholesterol. These formulations contain up to about 60 mol % of at least one helper lipid. Preferred helper lipids in these lipid nanoparticles are DSPC, SM, DOPE, 4ME16:0PE.

(67) In one embodiment the lipid nanoparticle comprises a cyclic amino-lipid of the present invention, DSPC or SM, PEG-c-DOMG and cholesterol. Preferably, said cyclic amino-lipid has the structure of

(68) ##STR00017##

(69) Preferred molar ratios of these components are about 50% of said cyclic amino-lipid, about 10% helper lipid, about 38% cholesterol and about 2% of the PEG lipid. Preferred N/P ratios range from approximately 6.9 to approximately 8.4.

(70) In another embodiment cholesterol free lipid nanoparticles are provided. These comprise a cyclic amino-lipid, the helper lipids DSPC and DOPE, as well as the PEG-lipid PEG-c-DMOG. LNPs comprising these components are not taken up by Kupffer cells in the liver, but mediate functional drug delivery to hepatocytes, stellate cells and endothelial cells. Preferably said cyclic amino-lipid has the structure of

(71) ##STR00018##

(72) In yet another embodiment cholesterol free lipid nanoparticles comprise just one helper lipid. In this case a preferred lipid nanoparticle contains a cyclic amino-lipid, the helper lipid 4ME 16:0PE and PEG-c-DMOG. LNPs comprising these components are barely taken up by hepatocytes, but mediate functional drug delivery to Kupffer cells, stellate cells and endothelial cells.

(73) Preferably said cyclic amino-lipid has the structure of

(74) ##STR00019##

(75) In one embodiment the lipid nanoparticle comprises an amino-lipid of the present invention, DSPC, a PEG lipid such as PEG-c-DOMG and cholesterol. Preferably, said amino-lipid has the structure of

(76) ##STR00020##

(77) Preferred molar ratios of these components are 40% to 60% of said amino-lipid, about 0% to 20% helper lipid, about 38% cholesterol and approximately 2% of a PEG 2000 lipid. The N/P ratio preferably is at least about 15:1, more preferably at least about 10:1, even more preferably at least about 7:1, and most preferably at least about 5:1. LNPs comprising these compositions are particularly well suited to functional deliver nucleic acids into endothelial cells of various organs.

(78) In another embodiment the lipid nanoparticle comprises an amino-lipid of the present invention, DSPC, a PEG lipid such as PEG-c-DOMG and cholesterol. Said amino-lipid has the structure of

(79) ##STR00021##

(80) Preferred molar ratios of these components are 40% to 60% of said amino-lipid, about 0% to 20% helper lipid, about 30% to 40% cholesterol and about 0.5% to about 2% of a PEG 2000 lipid. The N/P ratio preferably is at least about 8:1, more preferably at least about 15:1 and most preferably at least about 10:1.

(81) In another preferred embodiment the lipid nanoparticle comprises an amino-lipid of the present invention, DSPC, a PEG lipid such as PEG-c-DOMG and cholesterol. Said amino-lipid has the structure of

(82) ##STR00022##

(83) In another preferred embodiment the lipid nanoparticle comprises a cyclic amino-lipid of the present invention, DSPC, a PEG lipid such as PEG-c-DOMG and cholesterol. Said amino-lipid has the structure of

(84) ##STR00023##

(85) In another preferred embodiment the lipid nanoparticle comprises a cyclic amino-lipid of the present invention, DSPC, a PEG lipid such as PEG-c-DOMG and cholesterol. Said amino-lipid has the structure of

(86) ##STR00024##

(87) In one embodiment, the lipid nanoparticles described above are complexed with a biologically active compound. The term complexed as used herein relates to the non-covalent interaction of the biologically active compound with specific components of the lipid nanoparticle. In case of a nucleic acid as the biologically active compound the negatively charged phosphate backbone of the nucleic acid interacts with the positively charged amino-lipid. This interaction supports the stable entrapment of the nucleic acid into the LNP.

(88) The term biologically active compound as used herein refers to an inorganic or organic molecule including a small molecule, peptide (e.g. cell penetrating peptides), carbohydrate (including monosaccharides, oligosaccharides, and polysaccharides), protein (including nucleoprotein, mucoprotein, lipoprotein, synthetic polypeptide, or a small molecule linked to a protein, glycoprotein), steroid, nucleic acid, lipid, hormone, or combination thereof, that causes a biological effect when administered in vivo to an animal, including but not limited to birds and mammals, including humans. Preferably said biologically active compound is negatively charged.

(89) In one embodiment the lipid nanoparticles described above are complexed with a biologically active compound selected from the group of small molecule, peptide, protein, carbohydrate, nucleic acid, or lipid. Preferably said biologically effect is a therapeutic effect.

(90) The term nucleic acid as used herein means an oligomer or polymer composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, or compounds produced synthetically (e.g., PNA as described in U.S. Pat. No. 5,948,902 and the references cited therein) which can hybridize with naturally occurring nucleic acids in a sequence specific manner analogous to that of two naturally occurring nucleic acids, e.g., can participate in Watson-Crick base pairing interactions. Non-naturally occurring nucleic acids are oligomers or polymers which contain nucleobase sequences which do not occur in nature, or species which contain functional equivalents of naturally occurring nucleobases, sugars, or inter-sugar linkages, like peptide nucleic acids (PNA), threose nucleic acids (TNA), locked nucleic acids (LNA), or glycerol nucleic acids (GNA). This term includes oligomers that contain the naturally occurring nucleic acid nucleobases adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U), as well as oligomers that contain base analogs or modified nucleobases. Nucleic acids can derive from a variety of natural sources such as viral, bacterial and eukaryotic DNAs and RNAs. Other nucleic acids can be derived from synthetic sources, and include any of the multiple oligonucleotides that are being manufactured for use as research reagents, diagnostic agents or potential and definite therapeutic agents. The term includes oligomers comprising a single strand nucleic acid or a double strand nucleic acid. Examples of nucleic acids useful therein are miRNA, antisense oligonucleotides, siRNA, immune-stimulatory oligonucleotides, aptamers, ribozymes, or plasmids encoding a specific gene or siRNA.

(91) As used herein, the term peptide is used to refer to a natural or synthetic molecule comprising two or more amino acids linked by an amide bond consisting of the carboxylic acid group of one amino acid and the amino group by the other amino acid. A peptide is not limited by the number of amino acids and thus it can include polypeptides and proteins.

(92) Below embodiments are exemplified for the complexation and delivery of nucleic acids. It is understood that these embodiments are also applicable for any other biologically active compound.

(93) The complex comprising lipid nanoparticles and one or more nucleic acid are characterized by the following parameters: (1) nucleic acid to total lipid ratio; (2) nucleic acid to amino-lipid ratio; (3) encapsulation efficacy; (4) particle size; (5) particle size distribution and (6) zeta potential.

(94) The nucleic acid to total lipid ratio is the amount of the nucleic acid in a defined volume divided by the amount of total lipid in the same volume. Total lipid refers to all components in the particle formulations except for the nucleic acid. The ratio may be expressed on a mole per mole or weight by weight basis.

(95) The nucleic acid to amino-lipid ratio is the amount of the nucleic acid in a defined volume divided by the amount of amino-lipid in the same volume. The ratio may be expressed on a mole per mole or weight by weight basis; but is usually expressed as nitrogen to phosphorus (N/P) ratio. The (N/P) ratio is characterized by the number of positively charged nitrogen atoms present in the amino-lipid divided by the number of negatively charged phosphorus atoms present in the nucleic acid. Encapsulation efficacy is defined as the percentage of nucleic acid that is encapsulated or otherwise associated with the lipid nanoparticle. The encapsulation efficiency is usually determined by quantifying the amount of the nucleic acid in solution before and after breaking up the lipid nanoparticle by suitable organic solvents or detergents. A high encapsulation efficiency is a desirable feature of nucleic acid lipid nanoparticles particularly because of considerations regarding cost of goods.

(96) The particle size of lipid nanoparticles is typically measured by dynamic light scattering. Sizes of lipid nanoparticles in a given formulation are typically distributed over a certain range The size of lipid nanoparticles is typically expressed as the mean particle size or the Z.sub.average value. The particle size distribution of lipid nanoparticles is expressed as the polydispersity index (PI). Particles in the size range of 30 to 300 nm are considered advantageous for in vivo applications. Lipid nanoparticles with a mean particle size less than approximately 150 nm are advantageous, in particular to assess tissues characterized by a leaky vasculature as is the case for tumor tissue or liver. Lipid nanoparticles with a mean particle size greater than approximately 150 nm are advantageous, in particular to assess macrophages.

(97) Nucleic acid lipid nanoparticles are also characterized by their surface charge as measured by the zeta (0-potential. The basis of the measurement is the movement of particles in an electrical field as measured by dynamic light scattering. Particles with a near to neutral surface charge are advantageous for in vivo applications and are thus preferred herein.

(98) Particularly because of cost of goods and manufacturing reasons a high encapsulation efficiency of the nucleic acids complexed with the lipid nanoparticles is desirable. Particles in the size range of 30 to 300 nm with near to neutral surface charge are known to be advantageous for in vivo applications.

(99) C. Methods of Producing Lipid Nanoparticles (LNPs) Comprising the Inventive Amino-Lipids and Complexes Thereof with Biologically Active Compounds.

(100) In general, any method known in the art can be applied to prepare the lipid nanoparticles comprising one or more amino-lipids of the present invention and to prepare complexes of biologically active compounds and said lipid nanoparticles. Examples of such methods are widely disclosed, e.g. in Biochimica et Biophysica Acta 1979, 557:9; Biochimica et Biophysica Acta 1980, 601:559; Liposomes: A practical approach (Oxford University Press, 1990); Pharmaceutica Acta Helvetiae 1995, 70:95; Current Science 1995, 68:715; Pakistan Journal of Pharmaceutical Sciences 1996, 19:65; Methods in Enzymology 2009, 464:343.

(101) Below embodiments are exemplified for the complexation and delivery of nucleic acids. It is understood that these embodiments are also applicable for any other biologically active compound.

(102) In one embodiment, the components of the lipid nanoparticles as outlined above are mixed in a solvent that is miscible with water, such as methanol, ethanol isopropanol or acetone. Preferred solvents are alcohols, most preferable ethanol. In most preferred embodiments the solvent is commercially available ethanol. In certain embodiments the lipid mixture consists of the above components in a molar ratio of about 30 to 70% amino-lipid:0 to 60% helper lipid:0.1 to 10% PEG-lipid and 0 to 50% cholesterol. More preferred lipid nanoparticle compositions comprise the above mentioned components in a molar ratio of about 40% to 60% amino-lipid, 0 to 20% helper lipid, 0.1% to 5% PEG lipid and 30 to 50% cholesterol. In certain other embodiments lipid nanoparticles lack cholesterol. These formulations contain up to about 60 mol % of at least one helper lipid. Preferred helper lipids in these lipid nanoparticles are DSPC, SM, DOPE, 4ME16:0PE.

(103) In one embodiment, the nucleic acid is dissolved in an aqueous buffer. The pH of the buffer is such that at least one of the nitrogen atoms of the amino-lipids of the present invention will become protonated upon mixing the aqueous nucleic acid solution with the solution comprising the components of the lipid nanoparticles. Examples of appropriate buffers include, but are not limited to acetate, phosphate, citrate, EDTA and MES. Preferred concentration of the buffers are in the range of about 1 to about 500 mM. Typically the concentration of the nucleic acid in the aqueous buffer is in the range of about 0.1 to about 250 mg/mL, more preferably from about 0.5 to about 150 mg/mL.

(104) The solution comprising the components of the lipid nanoparticles is then combined with the buffered aqueous solution of the nucleic acid. Acidic pH is preferred, particularly a pH below 6.8, more preferably a pH below 5.4 and most preferably about 4.0. Optionally, the entire mixture may be sized according to known methods, e.g. by extrusion. Particles with a mean diameter of preferably 40 to 170 nm, most preferably of about 50 to 120 nm are generated. Subsequently, the pH is neutralized yielding an at least partially surface-neutralized nucleic acid lipid nanoparticle complex. Due to the fact that amino-lipids of the present invention have at least two nitrogen atoms, pKa values can differ substantially. Formation of complexes with nucleic acids is most supported at low pH in the range of about 3 to about 5. At a pH of about 7, at least partial surface neutralization is achieved.

(105) In one embodiment, the ratio of lipid:nucleic acid is at least about 2:1, at least about 3:1, at least about 4:1, at least about 5:1, at least about 6:1, at least about 7:1, at least about 8:1, at least about 10:1, at least about 15:1.

(106) Techniques to combine the solutions comprising the components of the lipid nanoparticles and the buffered aqueous solution of the nucleic acid can vary widely and may be dependent on the scale of production. Preparations in the range of a few mL may be made by pipetting one solution into the other followed by mixing with e.g. a vortex mixture. Larger volumes can be preferentially prepared by a continuous mixing method using pumps, e.g. a piston pump such as Pump 33 (Harvard Apparatus) or most preferably HPLC pumps such as AKTA pumps (GE Healthcare). With the aid of such pumps the two solutions are pumped out of their individual reservoirs and combined by delivering the fluids through a suitable connector piece or mixing chamber. By varying the concentrations of the two solutions and their flow rates, the mean size of the resulting lipid nanoparticles can be controlled within a certain range. Preferably, the compositions provided herein are sized to a mean diameter from about 50 nm to about 200 nm, more preferably about 50 nm to about 150 nm and most preferably about 50 nm to 120 nm.

(107) In certain embodiments, methods of the present invention further comprise a processing step that ensures the substantial removal of the solvent that was used to dissolve the lipid mixture and to exchange the buffer used to dissolve the therapeutically active agent. Suitable techniques to carry out this processing step include, but are not limited to diafiltration or tangential flow filtration. For buffer exchange a physiologically compatible buffer such as phosphate or HEPES buffered saline with a pH of about 7.4 or 5% dextrose solution (DSW) is used.

(108) Optionally, nucleic acid lipid nanoparticles can be produced using the lipid film hydration method followed by extrusion. In this case, the components of the lipid nanoparticle, i.e. one of the amino-lipids as described in the present invention, a helper lipid, a PEG-lipid (e.g. PEG-c-DOMG) and a sterol, e.g. cholesterol, are dissolved in an organic solvent such as chloroform. The solvent is evaporated yielding a thin lipid film, which is subsequently hydrated with an aqueous buffer containing the therapeutically active agent to form the desired lipid nanoparticle. Alternatively, the lipid film is hydrated with buffer and the nucleic acid is added in a subsequent incubation step.

(109) D. Pharmaceutical Compositions and Medical Uses.

(110) In another object the present invention relates to a pharmaceutical composition comprising the amino-lipids of the invention. Preferably said pharmaceutical composition comprises the lipid nanoparticles of the present invention and a biologically active compound. In one embodiment said biologically active compound is selected from the group of a small molecule, a peptide, a protein or a nucleic acid. In a preferred embodiment, said biologically active compound is a nucleic acid. Examples of nucleic acids useful therein are miRNA, antisense oligonucleotides, siRNA, immune-stimulatory oligonucleotides, aptamers, ribozymes, or plasmids encoding a specific gene or siRNA.

(111) The pharmaceutical compositions provided herein may additionally contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.

(112) Regardless of the route of administration selected, the lipid nanoparticles of the present invention, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.

(113) The phrases administration and administered as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrastemal injection and infusion.

(114) Actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

(115) The pharmaceutical composition must be sterile and fluid to the extent that the composition is deliverable through syringe or infusion techniques. In addition to water, the carrier is preferably an isotonic sugar solution and most preferably an isotonic buffered saline solution.

(116) Proper fluidity can be maintained, for example, by use of coating such as lecithin, by maintenance of required particle size and by use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol or sorbitol, and sodium chloride in the composition.

(117) In another object the present invention relates to the use of the lipid nanoparticles of the invention complexed to a biologically active compound as a medicament for treatment of a disease. In one embodiment the biologically active compound is a nucleic acid that may comprise a single strand or a double strand DNA or RNA which may or may not be chemically modified. Examples of nucleic acids useful therein are miRNA, short interfering RNA (siRNA), antisense oligonucleotides, immune-stimulatory oligonucleotides, aptamers, ribozymes, or plasmids encoding a specific gene or a siRNA. In particular embodiments the biologically active compound is a short interfering RNA (siRNA) and is complexed with the lipid nanoparticles of the present invention, thus enabling intracellular delivery of said biologically active compound.

(118) In one embodiment the present invention provides a method of treating a disease that is caused by the over-expression of one or several proteins in a subject, said method comprising administration of the a pharmaceutical composition of the present invention to said subject. The pharmaceutical composition comprises the LNP of the invention and a biologically active compound selected from the group of siRNA, miRNA, antisense oligonucleotides, ribozyme or a plasmid encoding for an siRNA, all being able to interfere with the expression of the disease causing protein(s).

(119) In another embodiment, the present invention provides a method of treating a disease that is caused by a reduced expression or a suppressed expression of one or several proteins in a subject, said method comprising administration the pharmaceutical composition of the present invention to the subject. The pharmaceutical composition comprises the LNP of the invention and a biologically active compound selected from the group of a plasmid encoding for the corresponding protein(s) or a nucleic acid that interferes with the suppressor molecule.

(120) In yet another embodiment, the present invention provides for a method of generating an immune response in a subject upon administration of a pharmaceutical composition of the present invention to said subject. The pharmaceutical composition comprises the LNP of the invention and a biologically active compound, wherein the biologically active compound is an immune-stimulatory nucleic acid such as a CpG oligonucleotide. As used herein, treatment (and grammatical variations thereof such as treat or treating) refers to clinical intervention in an attempt to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In some embodiments, antibodies of the invention are used to delay development of a disease or to slow the progression of a disease.

EXAMPLES

(121) The following are examples of methods and compositions of the invention. It is understood that various other embodiments may be practiced, given the general description provided above.

(122) Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, the descriptions and examples should not be construed as limiting the scope of the invention. The disclosures of all patent and scientific literature cited herein are expressly incorporated in their entirety by reference.

Example 1. Amino-Lipids

(123) Examples of amino-lipids of the present invention synthesized by reaction of an amine and a carbonyl compound under reductive amination conditions are listed in Table 1. Solvents and reagents were purchased from Sigma Aldrich (Taufkirchen, Germany) or TCI Europe (Eschborn, Germany) and were used as received (FIG. 1).

(124) A) General Synthesis Procedure for Amino-Lipids Generated by Reaction of Amines and Aldehydes.

(125) The aldehydes needed for the preparation of KL5, KL6 KL7, KL8, KL12, KL15, KL16, KL34, KL35, KL37 were prepared by oxidation of the corresponding alcohols using 2-Iodoxybenzoic acid (IBX) according to the following general procedure:

(126) The alcohol was dissolved in anhydrous ethyl acetate (EtOAc, 10 mL/1.0 mmol). IBX (1.1 eq) was added to form a suspension. The mixture was stirred briskly and refluxed at 80 C. under Argon. DMSO (2.2 eq.) was added via a syringe and the suspension was refluxed for 1.5 h. The insoluble o-iodobenzoic acid by-product was filtered off. The solvent was removed under reduced pressure and the crude product purified by flash-chromatography (HexanHexcan/EtOAc=10:1, Rf=0.35 in Hexan/EtOAc=5:1). The final products were characterized by HPLC and mass spectrometry.

(127) Ether containing alcohols were prepared following a published procedure (Bioconjugate Chemistry 2006, 19:1283). The subsequent oxidation to the corresponding aldehyde was again accomplished with IBX according to the procedure given above.

(128) ##STR00025##

(129) The aldehydes needed for the preparation of KL52 and KL56 were synthesized by oxidation of the corresponding alcohols employing pyridinium chlorochromate (PCC) in Dichloromethane according to standard procedures (Synthesis, 1982, 245). Other aldehydes are commercially available. The amine in KL12, KL22, KL33, KL34 and KL35 was made pursuing a published synthesis route (PNAS 2010, 5:1864).

(130) B) Preparation of N-Peralkylated Amino-Lipids.

(131) KL4, KL9, KL22, KL33, KL34, KL35, KL36, KL37, KL51, KL52, KL53, and KL56 were prepared by combining the corresponding aldehyde and corresponding amine in dichloroethane (DCE) in a ratio of 1.75 equivalents per amino function of the amine. To this solution was added at room temperature sodium triacetoxyborohydride (NaBH(OAc).sub.3) (1.3 equivalents per aldehyde) and acetic acid (HOAc, 1.3 equivalents per aldehyde). The reaction mixture was stirred at ambient temperature until thin layer chromatography indicated completion of reaction. After hydrolysis with 2N NaOH, the reaction mixture was extracted twice with dichloromethane (DCM). The combined organic layers were washed with saturated NaCl solution and dried over Na.sub.2SO.sub.4. The solvent was removed under reduced pressure and the crude product was subject to flash chromatography or reversed phase (RP) HPLC.

(132) Amino-lipids were analyzed for purity using analytical reversed phase HPLC. For this purpose, an XBridge C4 column (2.150 mm, 3.5 m) from Waters (Eschborn, Germany) was used. Eluent was A 0.1% TFA in water and eluent B was 0.1% TFA in 90% Acetonitrile (ACN). Elution was achieved at a column temperature of 60 C. running a gradient from 50% to 100% B in 20 min at a flow rate of 0.5 mL/min. Amino-lipids were detected using an evaporative light scattering detector (PL-ELS 2100, Agilent, Waldbronn, Germany) with evaporation temperature set to 90 C., nebulizer temperature set to 40 C. and a nitrogen flow of 1 mL/sec. Identity was established by electrospray ionization (ESI) mass spectrometry (MS) and direct infusion technique.

(133) 1) Synthesis of KL22.

(134) ##STR00026##

(135) To a solution of Dodecanal (11.6 g, 62.8 mmol, 9.0 eq, 1.75 eq/amine function) and 2-[4-(2-Amino-ethyl)-piperazin-1-yl]-ethyl}-ethane-1,2-diamine (1.5 g, 7.0 mmol. 1.0 eq) in 100 mL dichloroethane (DCE) was added sodium triacetoxyborohydride (NaBH(OAc).sub.3) (17.3 g, 81.6 mmol, 11.7 eq) and acetic acid (HOAc) (81.6 mmol, 5.0 mL) at room temperature. The reaction mixture was stirred for 16 h at ambient temperature. After hydrolysis with 2N NaOH the reaction mixture was extracted twice with dichloromethane (DCM). The combined organic layers were washed with saturated NaCl-solution and dried over Na.sub.2SO.sub.4. The solvent was removed under reduced pressure and the crude product was subject to flash chromatography (DCMDCM/CH.sub.3OH=100:6, Rf=0.05 in DCM/CH.sub.3OH=100:1 (0.5% NEt.sub.3)) to afford the title compound as a pale yellow oil.

(136) ESI-MS (direct infusion): [M+H]+: 1058.5

(137) A comparison of crude synthesis products obtained by an alternate peralkylation procedure (ring opening reaction of terminal epoxides by amines) detailed in WO2010/053572A2 and PNAS 2010, 5:1864 underscores the high efficiency of the chemistry disclosed herein allowing for high isolated yields (FIG. 1).

(138) 2) Synthesis of KL10.

(139) ##STR00027##

(140) To a solution of Dodecanal (15.1 g, 82.1 mmol, 6.0 eq) and Tris-(2-aminoethyl)-amine (2.0 g, 13.7 mmol. 1.0 eq) in 100 mL DCE was added NaBH(OAc).sub.3 (26.1 g, 123.1 mmol, 9.0 eq) and HOAc (123.1 mmol, 7.0 mL) at room temperature. The reaction mixture was stirred for 16 h at ambient temperature. After hydrolysis with 2N NaOH the reaction mixture was extracted twice with DCM. The combined organic layers were washed with saturated NaCl-solution and dried over Na.sub.2SO.sub.4. The solvent was removed under reduced pressure and the crude product was subject to flash chromatography (DCMDCM/CH.sub.3OH=10:1DCM/CH.sub.3OH=5:1, Rf=0.01 in DCM (0.5% NEt.sub.3)) to concentrate the title compound as a pale yellow oil. KL10 was further purified to homogeneity using RP HPLC. ESI-MS (direct infusion): [M+H]+: 986.1

(141) 3) Synthesis of KL36.

(142) ##STR00028##

(143) To a solution of Dodecanal (3.22 g, 17.5 mmol, 4.5 eq) and Diethylentriamine (0.40 g, 3.88 mmol. 1.0 eq) in 50 mL DCE was added NaBH(OAc).sub.3 (5.56 g, 26.3 mmol, 6.75 eq) and HOAc (26.3 mmol, 1.6 mL) at room temperature. The reaction mixture was stirred for 16 h at ambient temperature. After hydrolysis with 2N NaOH the reaction mixture was extracted twice with DCM. The combined organic layers were washed with saturated NaCl-solution and dried over Na.sub.2SO.sub.4. The solvent was removed under reduced pressure and the crude product was subject to flash chromatography (DCMDCM/CH.sub.3OH=10:1DCM/CH.sub.3OH=5:1, Rf=0.01 in DCM (0.5% NEt.sub.3)) to concentrate the title compound as a pale yellow oil and to remove the excess aldehyde. The crude product was finally purified by HPLC employing a C4 reversed phase column (YMC-Pack C4, 15020 mm, 10 m. Dienslaken, Germany). Eluent A was H.sub.2O containing 0.1% Trifluoroacetic acid (TF A) and eluent B was 90% ACN containing 0.1% TFA. For elution at room temperature, a gradient from 70-100% Eluent B and a flow rate of 45 mL/min was used. 5 ESI-MS (direct infusion): [M+H]+: 776.7

(144) 4) Synthesis of KL37.

(145) ##STR00029##

(146) To a solution of octadecanal (1.20 g, 4.51 mmol, 5.5 eq) and Tris-(2-aminoethyl)-amine (0.12 g, 0.82 mmol. 1.0 eq) in 50 mL DCE was added NaBH(OAc).sub.3 (1.43 g, 6.77 mmol, 6.75 eq) and HOAc (6.77 mmol, 0.4 mL) at room temperature. The reaction mixture was stirred for 16 h at ambient temperature. After hydrolysis with 2N NaOH, the reaction mixture was extracted twice with DCM. The combined organic layers were washed with saturated NaCl-solution and dried over Na.sub.2SO.sub.4. The solvent was removed under reduced pressure and the crude product was subject to flash chromatography (DCMDCM/CH.sub.3OH=10:1DCM/CH.sub.3OH=5:1, Rf=0.01 in DCM (0.5% NEt.sub.3)) to concentrate the title compound as a pale yellow oil and to remove the excess aldehyde. The crude product was finally purified by HPLC on a C4 reversed phase column (YMC-Pack C4, 15020 mm, 10 m). Eluent A was H.sub.2O containing 0.1% Trifluoroacetic acid (TFA) and eluent B was 90% ACN containing 0.1% TFA. For elution at room temperature, a gradient from 70-100% Eluent Band a flow rate of 45 mL/min was used.

(147) ESI-MS (direct infusion): [M+H]+: 1386.2

(148) C) Preparation of Selectively Alkylated Amino-Lipids.

(149) Amino-lipids KL5, KL6, KL7, KL8, KLI2, KL15, KL16, were generated by a stepwise synthetic protocol published in J Org Chem. 1996, 61:3849-3862:

(150) ##STR00030##

(151) The corresponding aldehyde (2.0 eq) and amine (1.0 eq) were mixed in MeOH (20 mL/1.0 mmol) at room temperature under an Argon atmosphere. The mixture was stirred at ambient temperature for 3 h, until the aldimine formation was completed. The solvent was removed under reduced pressure and the crude product was dissolved in DCE (20 mL/1.0 mmol) and treated with NaBH(OAc).sub.3 (3.0 eq) and AcOH (3.0 eq) and stirred under Argon for 3 h. The reaction was quenched with 2M NaOH and the product was extracted with EtOAc. The combined organic layers were dried over Mg.sub.2SO.sub.4 and the solvent was evaporated under reduced pressure. The crude product was subject to flash chromatography (DCMDCM/MeOH=9:1, Rf 0.25 in DCM/MeOH=0:1 (0.5% NEt.sub.3)) to afford the desired compound as a pale yellow oil. The final product was characterized by HPLC and mass spectrometry.

(152) D. General Synthesis Procedure for Amino-Lipids Derived from Amines and Ketones.

(153) The ketone needed for the preparation of KL32 and KL39 was prepared in 4 steps according to a published synthesis route (Nature Biotechnology 2010, 28:172). Other ketones are commercially available. The amine in KL23, KL30 and KL39 was made pursuing a published synthesis route (PNAS 2010, 5:1864).

(154) The amino-lipids KL23, KL24, KL25, KL26, KL27, KL28, KL30, KL32, KL39, KL43, KL49 and KL58 were prepared by combining the corresponding ketone and the corresponding amine in DCE in a ratio of one equivalent of ketone per amine group. Subsequently, NaBH(OAc).sub.3 (3.0 eq) and HOAc was added and stirred at room temperature until thin layer chromatography indicated completion of reaction. The reaction mixture was worked up by addition of 2N NaOH and extraction with DCM. The organic phase was dried and the solvent removed under reduced pressure. The amino-lipids were purified by flash column chromatography and analyzed by analytical reversed phase HPLC and direct infusion ESI-MS.

(155) 1) Preparation of KL25.

(156) ##STR00031##

(157) To a solution of Heptacosan-14-one (11.0 g, 27.9 mmol, 2.0 eq, 1.0 eq/amine function) and Triethylenetetraamine (2.03 g, 13.9 mmol. 1.0 eq) in 200 mL DCE was added NaBH(OAc).sub.3 (8.90 g, 41.9 mmol, 3.0 eq) and HOAc (41.9 mmol, 2.5 mL) at room temperature. The reaction mixture was stirred for 72 h at ambient temperature. After hydrolysis with 2N NaOH the reaction mixture was extracted twice with DCM. The combined organic layers were washed with saturated NaCl solution and dried over Na.sub.2S0.sub.4. The solvent was removed under reduced pressure and the crude product was subject to flash chromatography (DCMDCM/CH.sub.3OH=10:1DCM/CH.sub.3OH 5:1, Rf=0.3 in DCM/CH.sub.3OH=4:1 (0.1% aq. NH.sub.3)) to afford the title compound as a pale yellow wax.

(158) ESI-MS (direct infusion): [M+H]+: 904.0

Example 2. siRNA Synthesis

(159) siRNAs were synthesized by standard solid phase RNA oligomerization using the phosphoramidite technology. Depending on the scale either an ABI 394 synthesizer (Applied Biosystems) or an Akta oligopilot 100 (GE Healthcare, Freiburg, Germany) was used. In order to increase siRNA stability and abrogate immune responses, 2-O-methyl modified nucleotides were placed within certain positions in the siRNA duplex. Ancillary synthesis reagents, RNA and 2-O-Methyl RNA phosphoramidites were obtained from SAFC Proligo (Hamburg, Germany). Specifically, 5-O-(4,4-dimethoxytrityl)-3-O-(2-cyanoethyl-N,N-diisopropyl) phosphoramidite monomers of uridine (U), 4-N-acetylcytidine (C.sup.Ac), 6-N-benzoyladenosine (A.sup.bz) and 2-N-isobutyrlguanosine (G.sup.iBu) with 2-O-t-butyldimethylsilyl were used to build the oligomers sequence. 2-O-Methyl modifications were introduced employing the corresponding phosphoramidites carrying the same nucleobase protecting groups as the regular RNA building blocks. Coupling time for all phosphoramidites (100 mM in Acetonitrile) was 6 min employing 5-Ethylthio-1H-tetrazole (ETT) as activator (0.5 M in Acetonitrile). Phosphorothioate linkages were introduced using 50 mM 3-((Dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole-3-thione (DDTT, AM Chemicals, Oceanside, Calif., USA) in a 1:1 (v/v) mixture of pyridine and Acetonitrile. Upon completion of the solid phase synthesis oligoribonucleotides were cleaved from the solid support and deprotected using slight modification of published methods (Wincott F. et al. Synthesis, deprotection, analysis and purification of RNA and ribozymes. Nucleic Acids Res 1995, 23:2677-2684).

(160) Crude oligomers were purified by anionic exchange HPLC using a column packed with Source Q15 (GE Healthcare) and an kta Explorer system (GE Healthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 (Fluka, Buchs, Switzerland) and contained 20% Acetonitrile. Buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 22% B to 42% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3M NaOAc, pH 5.2 and 70% ethanol Finally, the pellet was washed with 70% ethanol.

(161) Isolated RNAs were shown to be at least 85% pure by analytical strong anion exchange chromatography. Identity of the RNA single strands was confirmed by LC-ESI-MS.

(162) siRNAs were prepared by combining equimolar amounts of the complementary RNA strands in sodium citrate buffer (10 mM Na-Citrate, 30 mM NaCl, pH 6), heating to 70 C. for 5 min and slow cooling to room temperature over a time period of 2 h. siRNAs were further characterized by capillary gel electrophoresis and were stored frozen until use.

(163) siRNA sequences are listed in Table 2. As indicated in the table, these siRNAs are directed against gene targets that are exclusively expressed in certain cells in the liver. In certain embodiments the individual siRNAs were employed in the inventive formulations. In certain other embodiments a mixture of all the indicated siRNAs were incorporated into the inventive formulations to address siRNA delivery to other cell types than hepatocytes. Those additional cell types are listed in Table 2 as well.

(164) TABLE-US-00001 TABLE 2 siRNAs employed in LNPs of the present invention. ssRNA ID (SEQ ID Duplex-ID NO:) Sequence 5-3 type Target Cell type 1/2 1 GcAAAGGcGuGccAAcucAdTsdT s Factor VII hepatocytes 1/2 2 UGAGUUGGcACGCCUUUGCdTsdT as 3/4 3 AcGucuAuAucAuGGccGAdTsdT s EGFP ubiquitous 3/4 4 UCGGCcAUGAuAuAGACGUdTsdT as 7/8 7 cuuuucucGuGAcAAGAAGdTsdT s CLEC4F Kupffer cells 7/8 8 CUUCUUGUcACGAGAAAAGdTsdT as 9/10 9 GGucucAAGccAcucGuuudTsdT s RELN Stellate cells 9/10 10 AAACGAGUGGCUUGAGACCdTsdT as 11/12 11 GAAGAuGcAGuGAuuuAcAdTsdT s TEK endothelial 11/12 12 UGuAAAUcACUGcAUCUUCdTsdT as cells 13/14 13 GcGcAGAAuucAucucuucdTsdT s CD68 Macrophages 13/14 14 GAAGAGAUGAAUUCUGCGCdTsdT as 15/16 15 cuGGcuGAAuuucAGAGcAdTsdT s CD45 Leukocytes 15/16 16 UGCUCUGAAAUUcAGCcAGdTsdT as 5/6 5 AAcGAGAAGcGcGAucAcAdTsdT s EGFP Ubiquitous 5/6 6 UGUGAUCGCGCUUCUCGUUdTsdT as 17/18 17 agAuGGAuAuAcucAAuuAdTsdT s Clec7a Macrophages 17/18 18 uAAUUGAGuAuAUCcAUCUdTsdT as Key: Upper case letters A, C, G, U represent RNA nucleotides; lower case letters a, c, g, u, are 2-O-Methyl nucleotides. A phosphorothioate linkage is symbolized with a lower case s. dT is deoxythimidine.

Example 3. Lipid Nanoparticles

(165) A. siRNA Lipid Nanoparticle Preparation.

(166) Helper lipids were purchased from Avanti Polar Lipids (Alabaster, Ala., USA). PEGylated lipids were obtained from NOF (Bouwelven, Belgium). Small molecules such as cholesterol were purchased from Sigma-Aldrich (Taufkirchen, Germany).

(167) Lipid nanoparticles containing siRNAs as described in the section below were compared against a standard formulation containing the lipid 2,2-dilinoleyl-4-dimethylaminoethyl[1,3]-dioxolane (XTC2) discovered by Tekmira Pharmaceuticals. XTC2 was synthesized according to published procedures (Nature Biotechnology, 2010, 28:172). The corresponding standard formulation was prepared, unless otherwise stated, according to a published composition (PNAS, 2010, 107:1854). For this purpose, stock solutions of 1,2-distearoyl-3-phosphatidylcholine (DSPC, 10%), XTC2 (50%), cholesterol (38.5%), and -[3-(1,2-dimyristoyl-3-propanoxy)-carboxamide-propyl]--methoxy-polyoxyethylene (PEG-c-DOMG 1.5%) were prepared at concentrations of 50 mM in ethanol.

(168) The inventive lipid nanoparticle formulations of the present invention contain the amino-lipids disclosed herein instead of XTC2. Initially, the other components were kept unchanged.

(169) siRNA stock solutions at a concentration of 10-20 mg/mL in 10 mM sodium citrate buffer, 30 mM NaCl, pH 6 were diluted in 50 mM citrate buffer, pH 4 to the desired total siRNA concentration (1 mg/mL).

(170) siRNA lipid nanoparticles were manufactured at a total lipid to siRNA mass ratio of 7 by combining the lipid solution in ethanol with the buffered siRNA solution in a mixing tee (e.g. CM1XPK, VICI AG International, Schenkon, Switzerland) by using either a Harvard Pump 33 Syringe Pump (Harvard Apparatus Holliston, Mass.) or for larger batches (>15 mL) an kta 900 HPLC Pump (GE Healthcare Bio-Sciences Corp., Piscataway, N.J.). Flow rates ranged from (17 mL/min to 67 mL/min for the siRNA solution and from 8 mL/min to 33 mL/min for the lipid solution.

(171) Subsequent to the initial testing in mice efficacious siRNA lipid nanoparticle formulations were further optimized. Formulation variations were generated by variation of the compositions. Differences between formulations reflect differences in the lipid species or differences in the molar percentages of the lipid components, or differences in the ratio between positively and negatively charged components of the formulation.

(172) The primary product, i.e. the product resulting by combining the two input solutions, was dialyzed 2 against phosphate buffered saline (PBS), pH 7.4 at volumes 100 of that of the primary product using Spectra/Por dialysis tubing (Spectrum Europe B.V., Breda, The Netherlands) with a MWCO of 100 or 250 kDa (CE, or PVDF membrane) or using Slide-A-Lyzer cassettes (Thermo Fisher Scientific Inc. Rockford, Ill.) with a MWCO of 10 kD (RC membrane).

(173) If desired siRNA lipid nanoparticles were concentrated at a 4 C. by using Vivaspin 20 centrifugation tubes (Sartorius AG, Gottingen, Germany) with a MWCO of 50 kD at 700 g using a table-top centrifuge.

(174) The lipid nanoparticle suspension was filtered through a Filtropur S 0.2 filter with a pore size of 0.2 m (Sarstedt, Numbrecht, Germany) and filled into glass vials with a crimp closure.

(175) B. siRNA Lipid Nanoparticle Characterization.

(176) To determine the siRNA concentration, formulations were diluted to a theoretical siRNA concentration of approximately 0.02 mg/mL in phosphate buffered saline (PBS). A volume of 100 L of the diluted formulation was added to 900 L of a 4:1 (vol/vol) mixture of methanol and chloroform. After vigorous mixing for 1 min, the absorbance spectrum of the solution was recorded at wavelengths between 230 nm and 330 nm on a DU 800 spectrophotometer (Beckman Coulter, Beckman Coulter, Inc., Brea, Calif.). The siRNA concentration in the liposomal formulation was determined based on the extinction coefficient of the siRNA used in the formulation. If extinction coefficient was not known, an average value of 22 OD/mg was used. The siRNA concentration was calculated based on the difference between the absorbance maximum at a wavelength of 260 nm and the baseline value at a wavelength of 330 nm.

(177) To determine the mean size of siRNA lipid nanoparticles, formulations were diluted in PBS to a concentration of approximately 0.05 mg/mL siRNA in a disposable polystyrene cuvette. The mean particle size was determined by using a Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK).

(178) To determine the zeta potential of siRNA lipid nanoparticles, formulations were diluted in PBS, pH 7.4 and in citrate buffer, pH 4 to a concentration of approximately 0.01 mg/mL siRNA in a disposable zeta cell (DTS1060C, Malvern Instruments Ltd, Malvern, Worcestershire, UK). The zeta potential was determined by using a Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK).

(179) To determine the percentage of siRNA entrapped in lipid nanoparticles the Quant-iT RiboGreen RNA assay (Invitrogen Corporation Carlsbad, Calif.) was used according to the manufacturer's instructions. In brief, samples were diluted to a concentration of approximately 5 g/mL in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5). Volumes of 50 L of the diluted samples were transferred to a polystyrene 96 well plate. To the samples, either 50 L of TE buffer or 50 L of a 2% Triton X-100 solution was added. The plate was incubated at 35 C. for 15 min. The RiboGreen reagent was diluted 1:100 in TE buffer and a volume of 100 L of was added to each well. The fluorescence intensity in each well was determined using a fluorescence plate reader (Wallac Victor 1420 Multilabel Counter; Perkin Elmer, Waltham, Mass.) at an excitation wavelength of 480 nm and an emission wavelength of 520 nm. The fluorescence values of the reagent blank were subtracted from that of each of the samples and siRNA concentrations were determined based on a standard curve of fluorescence intensities versus RNA concentrations. The percentage of free siRNA was determined by dividing the fluorescence intensity of the intact sample (without addition of Triton X-100) by the fluorescence value of the disrupted sample (with addition of Triton X-100).

Example 4. Animal Experiments

(180) Mice (strain C57BL/6) were obtained from Charles River (Sulzfeld, Germany) or were bred in house (EGFP transgenic mice in C57Bl/6 background) and were between 6 and 8 weeks 30 old at the time of the experiments. Intravenously administered LNPs were injected by infusion of 200 L into the tail vein. LNPs administered to the lung were orotracheally instilled by applying 50 L into the pharynx of isoflurane anaesthetized mice and making mice breathe in the LNP solution while blocking their obligate nose breathing 48 h post administration, mice were anaesthetized by CO.sub.2 inhalation and sacrificed by cervical dislocation. Blood was collected during the experiment by submandibular vein bleed orafter sacrificing the animalsby cardiac puncture and serum isolated with serum separation tubes (Greiner Bio-One, Frickenhausen, Germany). Factor VII protein levels were analyzed by a chromogenic assay (see below). For preparation of bronchoalveolar lavage (BAL) fluid, the lungs were flushed 3 with 1 ml PBS via an intratracheally inserted canula and cells were pelleted by centrifugation. For quantitation of mRNA levels, organs were harvested and organ homogenates were prepared. Tissues were snap frozen in liquid nitrogen and powdered with mortar and pestle on dry ice. 30-50 mg of tissue was transferred to a chilled 1.5 mL reaction tube. 1 mL Lysis Mixture (Epicenter Biotechnologies, Madison, USA) and 3.3 L Proteinase K (50 g/4) (Epicenter Biotechnologies, Madison, USA) was added and tissues were lysed by sonication for several seconds using a sonicator (HD2070, Bandelin, Berlin, Germany) and digested with Proteinase K for 15 min at 65 C. in a thermomixer (Thermomixer comfort, Eppendorf, Hamburg, Germany). BAL lysates were obtained by resuspending BAL cells in 200 L Lysis Mixture, followed by incubation at 53 C. for 30 min. Lysates were stored at 80 C. until analysis. For mRNA analyses, lysates were thawed and mRNA levels were measured using either QuantiGene 1.0 or Quantigene 2.0 branched DNA (bDNA) Assay Kit (Panomics, Fremont, Calif., USA, Cat-No: QG0004) according to the manufacturer's recommendations. In order to assess the FVII, EGFP, Clec4f, RELN, TEK, CD45, CD68, Clec7a and GAPDH mRNA content, the following probe sets were employed:

(181) TABLE-US-00002 TABLE 3 Quantigene 1.0 probe sets. SEQ ID Oligo Name Sequence 5.fwdarw.3 No. mRNA mGAP 2001 gagagcaatgccagccccTTTTTctcttggaaagaaagt 19 mouse GAPDH mGAP 2002 ggtccagggtttcttactccttgTTTTTctcttggaaagaaagt 20 mouse GAPDH mGAP 2003 ccctaggcccctcctgttattTTTTTctcttggaaagaaagt 21 mouse GAPDH mGAP 2004 tgcagcgaactttattgatggTTTTTctcttggaaagaaagt 22 mouse GAPDH mGAP 2005 gcacgtcagatccacgacgTTTTTaggcataggacccgtgtct 23 mouse GAPDH mGAP 2006 ggcaggtttctccaggcgTTTTTaggcataggacccgtgtct 24 mouse GAPDH mGAP 2007 gccctcagatgcctgcttcaTTTTTaggcataggacccgtgtct 25 mouse GAPDH mGAP 2008 gccgtattcattgtcataccaggTTTTTaggcataggacccgtgtct 26 mouse GAPDH mGAP 2009 gtccaccaccctgttgctgtaTTTTTaggcataggacccgtgtct 27 mouse GAPDH mGAP 2010 aattgtgagggagatgctcagtTTTTTaggcataggacccgtgtct 28 mouse GAPDH mGAP 2011 ccaccttcttgatgtcatcatactt 29 mouse GAPDH mGAP 2012 cccaagatgcccttcagtgg 30 mouse GAPDH mGAP 2013 gagacaacctggtcctcagtgtag 31 mouse GAPDH mGAP 2014 ggagttgctgttgaagtcgcag 32 mouse GAPDH mGAP 2015 ggcatcgaaggtggaagagtg 33 mouse GAPDH mGAP 2016 aaatgagcttgacaaagttgtcatt 34 mouse GAPDH mGAP 2017 gaggccatgtaggccatgag 35 mouse GAPDH mGAP 2018 gtccttgctggggtgggt 36 mouse GAPDH mGAP 2019 tagggcctctcttgctcagt 37 mouse GAPDH mGAP 2020 gttgggggccgagttggga 39 mouse GAPDH mGAP 2021 atgggggtctgggatgga 39 mouse GAPDH mGAP 2022 tattcaagagagtagggagggct 40 mouse GAPDH mmFak7 001 gagaagcagcagcccatgcTTTTTctcttggaaagaaagt 41 mouse Factor VII mmFak7 002 tggagctggagcagaaagcaTTTTTctcttggaaagaaagt 42 mouse Factor VII mmFak7 003 tgcttcctcctgggttatgaaaTTTTTctcttggaaagaaagt 43 mouse Factor VII mmFak7 004 ccgggccaaagctcctccTTTTTctcttggaaagaaagt 44 mouse Factor VII mmFak7 005 cttgaagatctcccgggccTTTTTctcttggaaagaaagt 45 mouse Factor VII mmFak7 006 ctgcttggtcctctcagggctTTTTTctcttggaaagaaagt 46 mouse Factor VII mmFak7 007 actgcagtccctagaggtcccTTTTTaggcataggacccgtgtct 47 mouse Factor VII mmFak7 008 tttgcctgtgtaggacaccatgTTTTTaggcataggacccgtgtct 48 mouse Factor VII mmFak7 009 tcctcaaaggagcactgttccTTTTTaggcataggacccgtgtct 49 mouse Factor VII mmFak7 010 ccccatcactgtaaacaatccagaaTTTTTaggcataggacccgtgtct 50 mouse Factor VII mmFak7 011 tggattcgaggcacactggtTTTTTaggcataggacccgtgtct 51 mouse Factor VII mmFak7 012 tggcaggtacctacgttctgacaTTTTTaggcataggacccgtgtct 52 mouse Factor VII mmFak7 013 cttgcttttctcacagttccgaTTTTTaggcataggacccgtgtct 53 mouse Factor VII mmFak7 014 aggagtgagttggcacgcc 54 mouse Factor VII mmFak7 015 tcattgcactctctctccagagag 55 mouse Factor VII mmFak7 016 gcagacgtaagacttgagatgatcc 56 mouse Factor VII mmFak7 017 ccctcaaagtctaggaggcagaa 57 mouse Factor VII mmFak7 018 ttgcacagatcagctgctcatt 58 mouse Factor VII EGFP 001 ggcacgggcagcttgcTTTTTctcttggaaagaaagt 59 EGFP EGFP 002 ggtagcggctgaagcactgTTTTTctcttggaaagaaagt 60 EGFP EGFP 003 cctggacgtagccttcgggTTTTTctcttggaaagaaagt 61 EGFP EGFP 004 ccttgaagaagatggtgcgctTTTTTctcttggaaagaaagt 62 EGFP EGFP005 cgaacttcacctcggcgcTTTTTctcttggaaagaaagt 63 EGFP EGFP006 ccttcagctcgatgcggtTTTTTctcttggaaagaaagt 64 EGFP EGFP 007 gtcacgagggtgggccagTTTTTaggcataggacccgtgtct 65 EGFP EGFP 008 cacgccgtaggtcagggtgTTTTTaggcataggacccgtgtct 66 EGFP EGFP 009 gtgctgcttcatgtggtcggTTTTTaggcataggacccgtgtct 67 EGFP EGFP 010 tcaccagggtgtcgccctTTTTTaggcataggacccgtgtct 68 EGFP EGFP 011 cggtggtgcagatgaacttca 69 EGFP EGFP 012 catggcggacttgaagaagtc 70 EGFP EGFP 013 cgtcctccttgaagtcgatgc 71 EGFP mmClec4f 001 ggtcccttctcagggtctgtaaTTTTTctcttggaaagaaagt 72 mouse Clec4f mmClec4f 002 tctgtcttggccctctgaagatTTTTTctcttggaaagaaagt 73 mouse Clec4f mmClec4f 003 ccccaggcgattctgctcTTTTTctcttggaaagaaagt 74 mouse Clec4f mmClec4f 004 tctgctcctgcttctgtgcagTTTTTctcttggaaagaaagt 75 mouse Clec4f mmClec4f 005 cagaacttctcagcctcccgTTTTTctcttggaaagaaagt 76 mouse Clec4f mmClec4f 006 tgcgctccctgggacgtaTTTTTctcttggaaagaaagt 77 mouse Clec4f mmClec4f 007 gacttcaaagctgagacatcactcaTTTTTaggcataggacccgtgtct 78 mouse Clec4f mmClec4f 008 gatctgccttcaaactctgcatcTTTTTaggcataggacccgtgtct 79 mouse Clec4f mmClec4f 009 ggctttggtcgcctgcaTTTTTaggcataggacccgtgtct 80 mouse Clec4f mmClec4f 010 ttccagttctgcgcgatcaTTTTTaggcataggacccgtgtct 81 mouse Clec4f mmClec4f 011 agaggtcaccgaagccaggTTTTTaggcataggacccgtgtct 82 mouse Clec4f mmClec4f 012 tgctctgtagcatctggacattg 83 mouse Clec4f mmClec4f 013 cccctgaatcttggcagtgag 84 mouse Clec4f mmClec4f 014 ccacagcttcctgcagggc 85 mouse Clec4f mmClec4f 015 gctggagaacctgattctgagtct 86 mouse Clec4f mmClec4f 016 aaaagtaataaaagtttccattgaagtac 87 mouse Clec4f mmClec4f 017 ccacggcttcttgtcacgag 88 mouse Clec4f mmReln 001 cagagatcttgaactgcatgatccTTTTTctcttggaaagaaagt 89 mouse Reln mmReln 002 tcggcgggtaagcactgaTTTTTctcttggaaagaaagt 90 mouse Reln mmReln 003 cgcttccagaacactttgggTTTTTctcttggaaagaaagt 91 mouse Reln mmReln 004 ttcaggaagcgggtaggtgaTTTTTctcttggaaagaaagt 92 mouse Reln mmReln 005 gtccatcatggctgccacaTTTTTaggcataggacccgtgtct 93 mouse Reln mmReln 006 tcatgagtcactgcatacacctctcTTTTTaggcataggacccgtgtct 94 mouse Reln mmReln 007 ttcaggcactttgcatccaaTTTTTaggcataggacccgtgtct 95 mouse Reln mmReln 008 tgaatttgattctgggcaattttTTTTTaggcataggacccgtgtct 96 mouse Reln mmReln 009 gggactaaataactccagctcacgTTTTTaggcataggacccgtgtct 97 mouse Reln mmReln 010 tccttttccacccttcagttgTTTTTaggcataggacccgtgtct 98 mouse Reln mmReln 011 ttacaggattccccgttaagctTTTTTaggcataggacccgtgtct 99 mouse Reln mmReln 012 gggtcacagatacactgttcctttTTTTTaggcataggacccgtgtct 100 mouse Reln mmReln 013 agtcacagaatctttccactgtacag 101 mouse Reln mmReln 014 gagcatgacaccatctggcg 102 mouse Reln mmReln 015 agttctcagtgggcgtcagg 103 mouse Reln mmReln 016 ccaaagtcagtagaaaactgcacg 104 mouse Reln mmReln 017 ggaagaacacagacggttgagaaa 105 mouse Reln mmReln 018 tctgagtacttttggtagaacctaaatc 106 mouse Reln mmTek 001 tgagtccctgggaagctttcaTTTTTctcttggaaagaaagt 107 mouse Tek mmTek 002 acttccccagatctccccatTTTTTctcttggaaagaaagt 108 mouse Tek mmTek 003 taagccggctaaagagtccatTTTTTctcttggaaagaaagt 109 mouse Tek mmTek 004 aatgcaggtgagggatgtttTTTTTctcttggaaagaaagt 110 mouse Tek mmTek 005 tcctatggtgatgggctcatggTTTTTctcttggaaagaaagt 111 mouse Tek mmTek 006 ccgctcgcatggtccactTTTTTaggcataggacccgtgtct 112 mouse Tek mmTek 007 acaactcacaactttgcgacttcTTTTTaggcataggacccgtgtct 113 mouse Tek mmTek 008 ccagcgtccacagatgagcaTTTTTaggcataggacccgtgtct 114 mouse Tek mmTek 009 agcaagctgactccacagagaacTTTTTaggcataggacccgtgtct 115 mouse Tek mmTek 010 gcgccttctactactccataaaggTTTTTaggcataggacccgtgtct 116 mouse Tek mmTek 011 cggcatcagacacaagaggtaggTTTTTaggcataggacccgtgtct 117 mouse Tek mmTek 012 gggtgccacccagaggcTTTTTaggcataggacccgtgtct 118 mouse Tek mmTek 013 gcaaggagaaacaccacagaag 119 mouse Tek mmTek 014 cgctcttgtttacaagttggcg 120 mouse Tek mmTek 015 gaattgatcaagatcaggtccatg 121 mouse Tek

(182) TABLE-US-00003 TABLE 4 Quantigene 2.0 probe sets. SEQ ID Oligo Name Sequence 5.fwdarw.3 No. mRNA Q2 mCD45 1 tgacgagttttacaccgcgatTTTTTgaagttaccgtttt 122 mouse CD45 Q2 mCD45 2 aatctgtctgcacatttataacattttTTTTTctgagtcaaagcat 123 mouse CD45 Q2 mCD45 3 ggcgtttctggaatccccaTTTTTctcttggaaagaaagt 124 mouse CD45 Q2 mCD45 4 tggatccccacaactaggcttaTTTTTgaagttaccgtttt 125 mouse CD45 Q2 mCD45 5 agagactaacgtttttcttgcagcTTTTTctgagtcaaagcat 126 mouse CD45 Q2 mCD45 6 gtttagatacaggctcaggccaTTTTTctcttggaaagaaagt 127 mouse CD45 Q2 mCD45 7 tggggtttagatgcagactcagTTTTTgaagttaccgtttt 128 mouse CD45 Q2 mCD45 8 attgttcttatagcataaaacatatccaTTTTTctgagtcaaagcat 129 mouse CD45 Q2 mCD45 9 taggcaaacttttacatttttctgaTTTTTctcttggaaagaaagt 130 mouse CD45 Q2 mCD45 10 ccacctcaaaactggtcacattatTTTTTgaagttaccgtttt 131 mouse CD45 Q2 mCD45 11 tcatagtatttataaggtttcaagctttTTTTTctgagtcaaagcat 132 mouse CD45 Q2 mCD45 12 ttgacataggcaagtagggacact 133 mouse CD45 Q2 mCD45 13 cccatttctttgaatcttcccaTTTTTctcttggaaagaaagt 134 mouse CD45 Q2 mCD45 14 tgaaaattgcacttctcagcagtTTTTTgaagttaccgtttt 135 mouse CD45 Q2 mCD45 15 ccggacgatctgcttttgtgTTTTTctgagtcaaagcat 136 mouse CD45 Q2 mCD45 16 ggttttcattccattgaccttgtTTTTTctcttggaaagaaagt 137 mouse CD45 Q2 mCD45 17 ttgtctgtcggccgggaTTTTTgaagttaccgtttt 138 mouse CD45 Q2 mCD45 18 ggaggaccacatgtaacatttatactaTTTTTctgagtcaaagcat 139 mouseCD45 Q2 mCD45 19 ggttttagggccattagtttcataaTTTTTctcttggaaagaaagt 140 mouse CD45 mGAPDH QG2 1 cgaggctggcactgcacaaTTTTTctcttggaaagaaagt 141 mouse GAPDH mGAPDH QG2 2 cttcaccattttgtctacgggaTTTTTgaagttaccgtttt 142 mouse GAPDH mGAPDH QG2 3 ccaaatccgttcacaccgacTTTTTctgagtcaaagcat 143 mouse GAPDH mGAPDH QG2 4 ccaggcgcccaatacggTTTTTctcttggaaagaaagt 144 mouse GAPDH mGAPDH QG2 5 caaatggcagccctggtgaTTTTTgaagttaccgtttt 145 mouse GAPDH mGAPDH QG2 6 aacaatctccactttgccactgTTTTTctgagtcaaagcat 146 mouse GAPDH mGAPDH QG2 7 tgaaggggtcgttgatggc 147 mouse GAPDH mGAPDH QG2 8 catgtagaccatgtagttgaggtcaa 148 mouse GAPDH mGAPDH QG2 9 ccgtgagtggagtcatactggaaTTTTTctcttggaaagaaagt 149 mouse GAPDH mGAPDH QG2 10 ttgactgtgccgttgaatttgTTTTTctcttggaaagaaagt 150 mouse GAPDH mGAPDH QG2 11 agcttcccattctcggccTTTTTgaagttaccgtttt 151 mouse GAPDH mGAPDH QG2 12 gggcttcccgttgatgacaTTTTTctgagtcaaagcat 152 mouse GAPDH mGAPDH QG2 13 cgctcctggaagatggtgatTTTTTctcttggaaagaaagt 153 mouse GAPDH mGAPDH QG2 14 cccatttgatgttagtggggtct 154 mouse GAPDH mGAPDH QG2 15 atactcagcaccggcctcacTTTTTctcttggaaagaaagt 155 mouse GAPDH QG2 mCD68 1 ctgggagccgttggccTTTTTctcttggaaagaaagt 156 mouse CD68 QG2 mCD68 2 ggcttggagctgaacacaaggTTTTTgaagttaccgtttt 157 mouse CD68 QG2 mCD68 3 ggtataggattcggatttgaatttgTTTTTctgagtcaaagcat 158 mouse CD68 QG2 mCD68 4 acctttcttccaccctgaattgTTTTTctcttggaaagaaagt 159 mouse CD68 QG2 mCD68 5 tctttaagccccactttagctttTTTTTgaagttaccgtttt 160 mouse CD68 QG2 mCD68 6 acagatatgccccaagcccTTTTTctgagtcaaagcat 161 mouse CD68 QG2 mCD68 7 cttggttttgttgggattcaaaTTTTTgaagttaccgtttt 162 mouse CD68 QG2 mCD68 8 ccgtcacaacctccctggacTTTTTctgagtcaaagcat 163 mouse CD68 QG2 mCD68 9 agagacaggtggggatgggtaTTTTTctcttggaaagaaagt 164 mouse CD68 QG2 mCD68 10 ggtaagctgtccataaggaaatgagTTTTTgaagttaccgtttt 165 mouse CD68 QG2 mCD68 11 tgtaggtcctgtttgaatccaaaTTTTTctgagtcaaagcat 166 mouse CD68 QG2 mCD68 12 ggtagactgtactcgggctctgaTTTTTctcttggaaagaaagt 167 mouse CD68 QG2 mCD68 13 tccaccgccatgtagtccaTTTTTgaagttaccgtttt 168 mouse CD68 QG2 mCD68 14 cctgtgggaaggacacattgtatTTTTTctgagtcaaagcat 169 mouse CD68 QG2 mCD68 15 ccatgaatgtccactgtgctgTTTTTgaagttaccgtttt 170 mouse CD68 QG2 mCD68 16 tctcgaagagatgaattctgcgTTTTTctgagtcaaagcat 171 mouse CD68 QG2 mCD68 17 cccaagggagcttggagcTTTTTctcttggaaagaaagt 172 mouse CD68 QG2 mCD68 18 tttccacagcagaagctttgg 173 mouse CD68 QG2 mCD68 19 ctggagaaagaactatgcttgca 174 mouse CD68 QG2 mCD68 20 agagagcaggtcaaggtgaacagTTTTTctcttggaaagaaagt 175 mouse CD68 QG2 eGFP 1 ggctgaagcactgcacgcTTTTTgaagttaccgtttt 176 EGFP QG2 eGFP 2 gaagtcgatgcccttcagctTTTTTctgagtcaaagcat 177 EGFP QG2 eGFP 3 ggatgttgccgtcctccttTTTTTgaagttaccgtttt 178 EGFP QG2 eGFP 4 tactccagcttgtgccccaTTTTTctgagtcaaagcat 179 EGFP QG2 eGFP 5 agacgttgtggctgttgtagttgTTTTTgaagttaccgtttt 180 EGFP QG2 eGFP 6 tctgcttgtcggccatgatatTTTTTctgagtcaaagcat 181 EGFP QG2 eGFP 7 aagttcaccttgatgccgttctTTTTTgaagttaccgtttt 182 EGFP QG2 eGFP 8 cgatgttgtggcggatcttgTTTTTctgagtcaaagcat 183 EGFP QG2 eGFP 9 ctgcacgctgccgtcctTTTTTctcttggaaagaaagt 184 EGFP QG2 eGFP 10 gctggtagtggtcggcgag 185 EGFP QG2 eGFP 11 cgccgatgggggtgttct 186 EGFP QG2 EGFP 12 cttcatgtggtcggggtagcTTTTTctgagtcaaagcat 187 EGFP QG2 EGFP 13 gcagcacggggccgt 188 EGFP QG2 EGFP 14 caggtagtggttgtcgggca 189 EGFP QG2 EGFP 15 agggcggactgggtgctTTTTTctcttggaaagaaagt 190 EGFP QG2 EGFP 16 tctcgttggggtctttgctc 191 EGFP QG2 EGFP 17 aggaccatgtgatcgcgctTTTTTctcttggaaagaaagt 192 EGFP QG2 EGFP 18 gcggtcacgaactccagcTTTTTctcttggaaagaaagt 193 EGFP QG2 EGFP 19 cggacttgaagaagtcgtgctg 194 EGFP QG2 EGFP 20 cgtagccttcgggcatggTTTTTctcttggaaagaaagt 195 EGFP QG2 EGFP 21 aagatggtgcgctcctggaTTTTTgaagttaccgtttt 196 EGFP QG2 EGFP 22 agttgccgtcgtccttgaagTTTTTctgagtcaaagcat 197 EGFP QG2 EGFP 23 tcggcgcgggtcttgt 198 EGFP QG2 EGFP 24 gtcgccctcgaacttcaccTTTTTctcttggaaagaaagt 199 EGFP QG2 EGFP 25 cgatgcggttcaccagggtTTTTTgaagttaccgtttt 200 EGFP QG2 mClec7a 1 tttctctgatcccctgggcTTTTTgaagttaccgtttt 201 mouse Clec7a QG2 mClec7a 2 gaagatggagcctggcttccTTTTTctgagtcaaagcat 202 mouse Clec7a QG2 mClec7a 3 gcaatgggcctccaaggtTTTTTctcttggaaagaaagt 203 mouse Clec7a QG2 mClec7a 4 gcacagga ttcctaaacccactTTTTTgaagttaccgtttt 204 mouse Clec7a QG2 mClec7a 5 gcagcaaccactactaccacaaaTTTTTctgagtcaaagcat 205 mouse Clec7a QG2 mClec7a 6 tgctagggcacccagcactTTTTTctcttggaaagaaagt 206 mouse Clec7a QG2 mClec7a 7 cctgaattgtgtcgccaaaaTTTTTgaagttaccgtttt 207 mouse Clec7a QG2 mClec7a 8 ttgtctttctcctctggatttctcTTTTTctgagtcaaagcat 208 mouse Clec7a QG2 mClec7a 9 tggttctctttatttcttgataggaagTTTTTctcttggaaagaaagt 209 mouse Clec7a QG2 mClec7a 10 ctaaagatgattctgtgggcttgTTTTTgaagttaccgtttt 210 mouse Clec7a QG2 mClec7a 11 ggagggagccaccttctcatTTTTTctgagtcaaagcat 211 mouse Clec7a QG2 mClec7a 12 ctcctgtagtttgggatgccttTTTTTctcttggaaagaaagt 212 mouse Clec7a QG2 mClec7a 13 ggaaggcaaggctgagaaaaacTTTTTgaagttaccgtttt 213 mouse Clec7a QG2 mClec7a 14 cttcccatgcatgatccaattaTTTTTctgagtcaaagcat 214 mouse Clec7a QG2 mClcc7a 15 cctgagaagctaaataggtaacagctTTTTTctcttggaaagaaagt 215 mouse Clec7a QG2 mClec7a 16 tctcttacttccataccaggaatttTTTTTgaagttaccgtttt 216 mouse Clec7a QG2 mClec7a 17 gcacctagctgggagcagtgTTTTTctgagtcaaagcat 217 mouse Clec7a QG2 mClec7a 18 ttttgagttgtctatcttcagtagatga 218 mouse Clec7a QG2 mClec7a 19 tggctttcaatgaactcaaattcTTTTTctcttggaaagaaagt 219 mouse Clec7a QG2 mClec7a 20 gcattaatacggtgagacgatgttTTTTTgaagttaccgtttt 220 mouse Clec7a QG2 mClec7a 21 cgggaaaggcctatccaaaatTTTTTctgagtcaaagcat 221 mouse Clec7a QG2 mClec7a 22 catggcccttcactctgattgTTTTTctcttggaaagaaagt 222 mouse Clec7a QG2 mClec7a 23 gctgatccatcctcccagaacTTTTTctcttggaaagaaagt 223 mouse Clec7a QG2 mClec7a 24 ttgaaacgagtggggaagaatTTTTTctcttggaaagaaagt 224 mouse Clec7a QG2 mClec7a 25 cctggggagctgtatttctgacTTTTTgaagttaccgtttt 225 mouse Clec7a QG2 mClec7a 26 catacacaattgtgcagtaagctttTTTTTctgagtcaaagcat 226 mouse Clec7a

(183) The bDNA assay was performed using 20 L lysate and the corresponding gene specific probe sets. For normalization purposes GAPDH mRNA expression was analyzed using 40 L lysate and Rattus norvegicus probe sets shown to be cross-react with mice (sequences of probe sets see above). As assay readout the chemiluminescence signal was measured in a Victor 2 Light luminescence counter (Perkin Elmer, Wiesbaden, Germany) as relative light units (RLU). The signal for the corresponding mRNA was divided by the signal for GAPDH mRNA from the same lysate. Values are reported as mRNA expression normalized to GAPDH.

(184) For measurement of FVII activity, plasma samples from mice were prepared by collecting blood (9 volumes) by submandibular bleeding into microcentrifuge tubes containing 0.109 mol/L sodium citrate anticoagulant (1 volume) following standard procedures. FVII activity in plasma was measured with a chromogenic method using a BIOPHEN VII kit (Hyphen BioMed/Aniara, Mason, Ohio) following manufacturer's recommendations. Absorbance of colorimetric development was measured using a Tecan Safire2 microplate reader (Tecan, Crailsheim, Germany) at 405 nm. Results are shown in FIGS. 2-17.

(185) TABLE-US-00004 TABLE 5 Composition and physico-chemical parameters of the benchmark formulation RLX-165 and the LNP RLK-044 containing lipid KL22 of the present invention. The benchmark formulation was prepared according to a published protocol (Nature Biotechnology 2010, 28: 172) with the exception of a slightly different PEG-lipid. Instead of PEG2000-c-DMA (methoxypolyethyleneglycol-carbamoyl- dimyristyloxy-propylamine), PEG2000-c-DMOG (-[3-(1,2-dimyristoyl- 3-propanoxy)-carboxamide-propyl]--methoxy-polyoxyethylene) was used. Amino-lipid Helper lipid Chol PEG2000-lipid Size Encap LNP mol % mol % mol % mol % N/P (nm) % RLX-165 57.1 XTC2 7.1 DPPC 34.4 1.4 DMOG 2.2 92 92 RLK-044 .sup.50 KL22 10 DSPC 38.5 1.5 DMOG 7.6 92 80

(186) TABLE-US-00005 TABLE 6 LNPs based on the amino-lipid KL10. Compositions, physico-chemical properties and serum FVII activity upon treatment with 0.1 mg/kg siRNA directed against FVII. PEG2000- KL10 DSPC Chol c-DOMG Size Encap FVII No mol % mol % mol % mol % N/P (nm) (%) (%) 1 50 10 38.5 1.5 4.9 106 74 81 2 50 10 38.5 1.5 6.9 108 78 55 3 60 0 38.5 1.5 5.9 79 36 54 4 50 10% C16 38.5 1.5 5.9 110 84 69 Diether PC 5 50 10 38.5 1.5 8.4 80 83 23 6 65 3.5 30 1.5 6.9 83 56 107 7 60 8.5 30 1.5 6.9 93 71 52 8 60 9.5 30 0.5 6.9 121 75 60 9 60 0 30 10 6.9 49 36 84 10 65 0 30 5 6.9 64 29 129 11 98.5 0 0 1.5 6.9 122 53 110 12 50 10% DMPC 38.5 1.5 6.9 99 79 78 13 50 10% DPPC 38.5 1.5 6.9 100 81 43 14 50 10% DOPC 38.5 1.5 6.9 90 75 122 15 50 10% DLIPC 38.5 1.5 6.9 89 74 128 16 50 10% POPC 38.5 1.5 6.9 86 76 128 17 50 10% C18 38.5 1.5 6.9 96 86 46 Diether PC 18 50 10% C16 38.5 1.5 6.9 91 75 77 Lyso-PC 19 50 10% DOPE 38.5 1.5 6.9 88 69 124 20 50 10% DOPG 38.5 1.5 6.9 92 39 77 21 50 10% 5M 38.5 1.5 6.9 101 90 27 22 50 10 38.5% OChemsPC 1.5 6.9 75 89 140 23 50 10 38.5% DOPE 1.5 6.9 99 89 153 24 50 10 38.5 1.5% mPEG- 6.9 129 88 97 1000 DM 25 50 10 38.5 1.5% mPEG- 6.9 120 88 108 2000 DS 26 50 10 38.5 1.5% PEG- 6.9 109 88 91 2000 Chol 29 50 0 48.5% 4ME16:0PE 1.5 6.9 111 86 81 XTC2 57.1 7.1% DPPC 34.4 1.4 2.2 95 92 65

(187) TABLE-US-00006 TABLE 7 LNPs based on the amino-lipid KL22. Compositions, physico-chemical properties and serum FVII activity upon treatment with 0.1 mg/kg siRNA directed against FVII. PEG2000-c- KL22 DSPC Chol DOMG Size Encap FVII No mol % mol % mol % mol % N/P (nm) % % 1 50 10 38.5 1.5 5.5 78 46 68 2 50 10 38.5 1.5 10 76 63 45 3 50 10 38.5 1.5 15 81 69 61 4 50 10 39.5 0.5 7.6 126 84 64 5 50 10 40 0 7.6 736 40 78 6 50 20 30 0 7.6 414 9 nd 7 60 0 38.5 1.5 7.6 84 28 nd 8 60 8.5 30 1.5 7.6 92 36 80 9 40 20 38.5 1.5 7.6 93 82 79 10 65 0 30 5 7.6 59 5 nd 11 98.5 0 0 1.5 7.6 95 0 nd 12 50 10% DMPC 38.5 1.5 7.6 78 57 92 13 50 10% DPPC 38.5 1.5 7.6 90 47 73 14 50 10% DOPC 38.5 1.5 7.6 71 62 57 15 50 10% DLiPC 38.5 1.5 7.6 84 59 63 16 50 10% POPC 38.5 1.5 7.6 74 55 81 17 50 10% C18 38.5 1.5 7.6 96 61 103 Diether PC 18 50 10% C16 38.5 1.5 7.6 75 38 75 Lyso-PC 19 50 10% DOPE 38.5 1.5 7.6 75 49 59 20 50 10% DOPG 38.5 1.5 7.6 80 48 131 21 50 10% SM 38.5 1.5 7.6 92 64 68 22 50 10 38.5% OChemsPC 1.5 7.6 76 84 107 23 50 10 38.5% DOPE 1.5 7.6 93 75 127 24 50 10 38.5% DSPC 1.5 7.6 246 1 nd 25 50 10 38.5 1.5% mPEG- 7.6 122 86 112 1000 DM 26 50 10 38.5 1.5% mPEG- 7.6 91 36 nd 5000 DM 27 50 10 38.5 1.5% mPEG- 7.6 119 86 106 1000 DS 28 50 10 38.5 1.5% mPEG- 7.6 106 68 107 2000 DS 29 50 10 38.5 1.5% PEG- 7.6 147 90 110 1000 Chol 30 50 10 38.5 1.5% PEG- 7.6 101 64 134 2000 Chol XTC2 57.1 7.1% OPPC 34.4 1.4 2.2 95 92 44

(188) TABLE-US-00007 TABLE 8 LNPs based on the amino-lipid KL25. Compositions, physico-chemical properties and FVII mRNA levels upon treatment with 0.1 mg/kg siRNA directed against FVII. PEG2000c- KL25 DSPC Cholesterol DOMG Size Encap FVII No mol % mol % mol % mol % N/P (nm) % % Std 50 10 38.5 1.5 6.7 142 90 81 1 50 10 38.5% DOPE 1.5 6.7 nd nd 2 50 10 40 0 6.7 nd nd 3 50 10 38.5 1.5 5 109 31 nd 4 50 10 38.5 1.5 10 128 68 35 5 50 10 38.5 1.5 15 120 72 34 6 40 20 38.5 1.5 6.7 111 47 39 7 60 0 38.5 1.5 6.7 113 34 40 8 50 10% C16 38.5 1.5 6.7 132 65 67 Diether PC 9 50 10% SM 38.5 1.5 6.7 123 58 51 10 50 10 38.5 1.5% mPEG- 6.7 177 59 47 1000 DM 11 50 10 38.5 1.5% mPEG- 6.7 122 80 50 1000 DS 12 50 10 38.5 1.5% mPEG- 6.7 123 49 74 2000 DS 13 50 10 38.5 1.5% PEG- 6.7 207 9 nd 1000 Chol 14 50 10 38.5 1.5% PEG- 6.7 141 46 68 2000 Chol

(189) TABLE-US-00008 TABLE 9 LNPs based on the amino-lipid KL25. Compositions and physico-chemical properties. PEG2000- KL25 DSPC Chol c-DOMG Size Encap No mol % mol % mol % mol % N/P (nm) % std 50 10 38.5 1.5 6.7 142 90 1 50 10 38.5% DOPE 1.5 6.7 nd 2 50 10 40 0 6.7 nd 3 50 10 38.5 1.5 5 109 31 4 50 10 38.5 1.5 10 128 68 5 50 10 38.5 1.5 15 120 72 6 40 20 38.5 1.5 6.7 111 47 7 60 0 38.5 1.5 6.7 113 34 8 50 10% C16 38.5 1.5 6.7 132 65 Diether PC 9 50 10% SM 38.5 1.5 6.7 123 58 10 50 10 38.5 1.5% mPEG- 6.7 177 59 1000 DM 11 50 10 38.5 1.5% mPEG- 6.7 122 80 1000 DS 12 50 10 38.5 1.5% mPEG- 6.7 123 49 2000 DS 13 50 10 38.5 1.5% PEG- 6.7 207 9 1000 Chol 14 50 10 38.5 1.5% PEG- 6.7 141 46 2000 Chol

(190) TABLE-US-00009 TABLE 10 Tek mRNA levels in various organs upon treatment with LNPs based on amino-lipid KL25. LNPs contained a pool of 5 siRNA of which one was directed against Tek (0.2 mg/kg of each siRNA, total siRNA dose 1 mg/kg). Values are given as the mean of two treated animals relative to saline treated animals. Kidney Lung Jejunum Spleen Muscle No % Tek % Tek % Tek % Tek % Tek std 41 43 72 47 77 3 20 21 25 31 34 4 18 17 27 25 38 5 35 35 58 32 40 6 22 18 41 28 25 7 38 33 57 31 48 8 42 43 47 40 65 9 51 48 39 32 43 10 40 42 26 27 47 11 45 37 67 60 88 12 54 49 60 62 56 13 54 64 47 48 73 14 53 52 54 51 68 saline 100 100 100 100 100

(191) TABLE-US-00010 TABLE 11 mRNA levels in liver after treatment with LNPs based on amino-lipid KL25. LNPs contained a pool of 5 siRNAs directed against the targets listed in the table (0.2 mg/kg of each siRNA, total siRNA dose 1 mg/kg). Values are given as the mean of two treated animals relative to saline treated animals. No % FVII % Clec4f % Rein % Tek % GFP std 81 51 32 51 80 3 35 29 28 57 61 4 34 29 23 60 58 5 39 31 51 91 75 6 40 27 58 66 72 7 67 44 41 64 80 8 51 36 40 59 84 9 47 36 57 58 74 10 50 33 30 61 80 11 74 46 43 65 82 12 68 59 55 66 89 13 65 63 55 59 72 14 55 42 17 67 70 saline 100 100 100 100 100

(192) TABLE-US-00011 TABLE 12 Composition and physico-chemical properties of selected LNPs based on amino-lipid KL10. KL10 DSPC Chol PEG2000- mol mol mol c-DOMG Size Encap No % % % mol % N/P (nm) % 21 50 10% SM 38.5 1.5 6.9 92 64 23 50 10 38.5 DOPE 1.5 6.9 93 75 29 50 0 48.5% 4ME16:0PE 1.5 6.9 111 86

(193) TABLE-US-00012 TABLE 13 mRNA levels of targets expressed in the liver upon treatment with LNPs based on amino-lipid KL10. LNPs contained a pool of 5 siRNA directed against the targets in the table below (0.5 mg/kg of each siRNA). LNP Animal Rein GFP Tek Clec4f FVII KL 10-21 K1 13% 82% 25% 19% 102% K2 15% 104% 30% 13% 106% KL 10-23 L1 17% 10% 46% 136% 28% L2 14% 8% 35% 113% 22% KL 10-29 H1 12% 77% 33% 5% 88% H2 13% 65% 33% 12% 86% Saline S1 95% 101% 100% 97% 101% S2 105% 99% 100% 103% 99%