Reduced Genome Bacteria With Improved Genetic Stability
20170114318 ยท 2017-04-27
Inventors
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
C12N9/1252
CHEMISTRY; METALLURGY
C12Y201/01037
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
International classification
Abstract
Reduced genome bacteria with improved genetic stability are provided. Also provided are methods of producing polypeptides using the reduced genome bacteria with improved genetic stability.
Claims
1. A reduced genome Escherichia coli bacterium, having a genome that is genetically engineered to be from about 5% to about 22% smaller than the genome of its native parent strain, wherein said bacterium lacks all ISI, IS2, IS3, IS4, IS5, IS30, IS 150, IS 186, IS600, IS911 and IS 10 insertion sequences and lacks a functional polB gene and lacks a functional dinB gene and optionally lacks a functional umuDC gene.
2. The bacterium of claim 1, lacking a functional umuDC gene.
3. The bacterium of claim 1 comprising a heterologous nucleic acid.
4. The bacterium of claim 3 wherein said heterologous nucleic acid comprises a nucleic acid encoding a polypeptide operatively linked to an expression control sequence.
5. A method for producing a polypeptide comprising incubating the bacterium of claim 4 under conditions suitable for expressing the polypeptide and collecting the polypeptide.
Description
DESCRIPTION OF THE DRAWINGS
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
DETAILED DESCRIPTION OF THE INVENTION
[0020] While the present invention is capable of being embodied in various forms, the description below of several embodiments is made with the understanding that the present disclosure is to be considered as an exemplification of the invention, and is not intended to limit the invention to the specific embodiments illustrated. Headings are provided for convenience only and are not to be construed to limit the invention in any manner. Embodiments illustrated under any heading may be combined with embodiments illustrated under any other heading.
[0021] The use of numerical values in the various ranges specified in this application, unless expressly indicated otherwise, are stated as approximations as though the minimum and maximum values within the stated ranges were both preceded by the word about. In this manner, slight variations above and below the stated ranges can be used to achieve substantially the same results as values within the ranges. As used herein, the terms about and approximately when referring to a numerical value shall have their plain and ordinary meanings to one skilled in the pertinent art at issue. Also, the disclosure of ranges is intended as a continuous range including every value between the minimum and maximum values recited as well as any ranges that can be formed by such values. This includes ranges that can be formed that do or do not include a finite upper and/or lower boundary. This also includes ratios that are derivable by dividing a given disclosed numeral into another disclosed numeral. Accordingly, the skilled person will appreciate that many such ratios, ranges, and ranges of ratios can be unambiguously derived from the data and numbers presented herein and all represent various embodiments of the present invention.
[0022] The term reduced genome bacterium herein means a bacterium having about 1% to about 75% of its genome (e.g. protein coding genes) deleted, for example about 5%, about 10%, about 20%, about 30% about 40%, about 50% or about 60% of the genome deleted. In one embodiment, the reduced genome bacteria used in the practice of the present invention have a genome that is preferably genetically engineered to be at least two percent (2%) and up to twenty percent (20%) (including any number therebetween) smaller than the genome of a native parent strain. Preferably, the genome is at least five percent (5%) and up to thirty percent (30%) smaller than the genome of a native parent strain. More preferably, the genome is eight percent (8%) to fourteen percent (14%) to twenty percent (20%) (including any number therebetween) or more smaller than the genome of the native parent strain. Alternatively, the genome may be engineered to be less than 20%, less than 30%, less than 40% or less than 50% smaller than the genome of a native parental strain. The term native parental strain means a bacterial strain found in a natural or native environment as commonly understood by the scientific community and on whose genome a series of deletions can be made to generate a bacterial strain with a smaller genome. Native parent strain also refers to a strain against which the engineered strain is compared and wherein the engineered strain has less than the full complement of the native parent strain. The percentage by which a genome has become smaller after a series of deletions is calculated by dividing the total number of base pairs deleted after all of the deletions by the total number of base pairs in the genome before all of the deletions and then multiplying by 100. Similarly, the percentage by which the genome is smaller than the native parent strain is calculated by dividing the total number of nucleotides in the strain with the smaller genome (regardless of the process by which it was produced) by the total number of nucleotides in a native parent strain and then multiplying by 100
[0023] In one embodiment, the term reduced genome bacteria refers to bacteria for which removal of the above amounts of genome does not unacceptably affect the ability of the organism to grow on minimal medium. Whether removal of two or more genes unacceptably affects the ability of the organism to grow on minimal medium in the present context depends on the specific application. For example, a 30% reduction in proliferation rate may be acceptable for one application but not another. In addition, adverse effect of deleting a DNA sequence from the genome may be reduced by measures such as changing culture conditions. Such measures may turn an otherwise unacceptable adverse effect to an acceptable one. In one embodiment, the proliferation rate is approximately the same as the parental strain. However, proliferation rates ranging from about 5%, 10%, 15%, 20%, 30%, 40% to about 50% lower than that of the parental strain are within the scope of the invention. More particularly, doubling times of bacteria of the present invention may range from about five minutes to about three hours. Non-limiting examples of suitable reduced genome bacteria, as well as methods for deleting DNA from a bacterium such as E. coli, are disclosed in U.S. Pat Nos. 6,989,265 and 7,303,906, U.S. Pat. Pub. Nos. 20060270043, 2006/0199257 and 2007/0054358 and WIPO Pub. No. WO 2003/070880, each of which is hereby incorporated by reference herein.
[0024] In several embodiments, a reduced genome bacterium is provided having at least one non-functional gene selected from the group consisting of the gene(s) encoding DNA Polymerase II, DNA Polymerase IV and DNA Polymerase V. Reduced genome bacteria in which one or more of these genes are non-functional exhibit a substantial improvement in genetic stability compared to bacteria having the same genetic background but in which these genes are functional. In one aspect, the gene(s) are rendered non-functional by deletion, for example by the scarless deletion methods described at column 8, line 45 to column 14, line 41 of U.S. Pat. No. 6,989,265. These methods result in a precise deletion of the target gene with no inserted DNA resulting from the deletion process (i.e. scarless deletions) and are therefore the preferred deletion methods. It is to be understood, however, that any method of deleting target genes, in whole or in part, known in the art may be employed to render one or more of the genes encoding DNA Polymerase II, DNA Polymerase IV and DNA Polymerase V non-functional. Alternatively, one or more of the genes encoding DNA Polymerase II, DNA Polymerase IV and DNA Polymerase V may be rendered non-functional by disrupting the gene(s) by using any technique known in the art. For example, the target gene(s) may disrupted by replacing the gene with a non-functional allele by homologous recombination. Disruption and deletion may be used in combination to produce any combination of non-functional genes encoding DNA Polymerase II, DNA Polymerase IV and DNA Polymerase V in the bacterium.
[0025] In one embodiment, any one of the genes encoding DNA Polymerase II, IV and V may be rendered non-functional and the remaining two genes may be functional. In other embodiments, any combination of two of the genes encoding DNA Polymerase II, IV and V may be rendered non-functional in the reduced genome bacteria and the remaining gene may be functional. For example, the genes encoding DNA Polymerase II and IV may be rendered non-functional and the gene encoding DNA Polymerase V may be functional. Alternatively, the genes encoding DNA Polymerase II and V may be rendered non-functional and the gene encoding DNA Polymerase IV may be functional. Alternatively, the genes encoding DNA polymerase IV and V may be rendered non-functional and the gene encoding DNA Polymerase II may be functional. In a preferred embodiment, the genes encoding DNA Polymerase II and DNA Polymerase IV are non-functional in the reduced genome bacterium and the gene encoding DNA Polymerase V is either functional or non-functional. In a particularly preferred embodiment, the genes encoding DNA Polymerase II, DNA Polymerase IV and DNA Polymerase V are all non-functional in the reduced genome bacterium.
[0026] In another preferred embodiment, the reduced genome bacterium with one or more non-functional gene selected from the group consisting of the gene(s) encoding DNA Polymerase II, DNA Polymerase IV and DNA Polymerase V has a genome that is genetically engineered to be at least five percent (5%) and up to thirty percent (30%) (including any number therebetween) smaller than the genome of a native parent strain. In another preferred embodiment, the reduced genome bacterium has a genome that is between 4.41 Mb and 3.71 Mb, between 4.41 Mb and 3.25 Mb or between 4.41 Mb and 2.78 Mb.
[0027] The parent of the reduced genome bacterium of the invention may be any bacterial strain. In a preferred embodiment, the parent of the reduced genome bacterium of the invention is an E. coil strain, such as an E. coli K-12 or B strain. E. coli K12 strains include derivative strains such as MG1655, W3110, DNI, DI-110B, DH5, Inv, Top10, Top10F, JM103, JM105, JM109, MC1061, MC4100, XL1-Blue, EC100, BW2952, or EC300. E. coli B strains include REL606, BL/R and BL21(DE3).
[0028] The nucleotide sequence of the genome of the parental strain may be partially or completely known. The complete genomic sequence of several E. coli and other commonly used laboratory microorganisms is known (see e.g. Blattner et al., Science, 277:1453-74 (1997); GenBank Accession No. U00096; NCBI database, Accession No. AP009048, Perna et al., Nature, 409, 529-533 (2001); Hayashi et al., DNA Res., 8, 11-22 (2001); Welch et al., Proc. Natl. Acad. Sci., USA 99:17020-17024 (2002), GenBank Accession No. AE014075, EMBL Accession No. CP000948, EMBL Accession No. CP001637, EMBL Accession No. CP001396, EMBL Accession No. CP000819, and EMBL Accession No. CP001509, each of which is incorporated herein by reference).
[0029] In a preferred embodiment, the parent of the reduced genome bacterium of the invention is E. coli strain K12 MG1655 (annotated version m56), (NCBI accession no. 0000961) with a genome having 4,639,674 base pairs. In another preferred embodiment, the parent of the reduced genome bacterium is E. coli strain BL21(DE3) (EMBL accession no. CP001509) with a genome having 4,557,508 base pairs. The coordinates of the genes encoding DNA Polymerase II (polB), DNA Polymerase IV (dinB) and DNA Polymerase V (umuDC) in the E. coli K12 MG1655 genome are provided at Table 1.
TABLE-US-00001 TABLE 1 Gene Coordinates polB (b0060) 63429-65780 dinB (b0231) 250898-251953 umuDC (b1183-b1184) 1229990-1231677
[0030] In a particularly preferred embodiment, a reduced genome E. coil bacterium is provided having a genome between five percent (5%) and thirty percent (30%) smaller than the genome of a native parent strain and lacking all insertion sequence (IS) elements and having at least one non-functional gene selected from the group consisting of the gene(s) encoding DNA Polymerase II, DNA Polymerase IV and DNA Polymerase V. Positions of the IS elements on a genome map of E. coli MG1655 (annotated version 54) are shown in
[0031] In a related embodiment, the reduced genome bacterium is an E. coli bacterium lacking at least the following genes (identified by b numbers based on the designations set out in Blattner et al., Science, 277:1453-74 and in GenBank Accession No. 400096): b0245-b0301, b0303-b0310, b1336-b1411, b4426-b4427, b2441-b2450, b2622-b2654, b2657-b2660, b4462, b1994-b2008, b4435, b3322-b3338, b2349-b2363, b1539-b1579, b4269-b4320, b2968-b2972, b2975-b2977, b2979-b2987, h4466-4468, b1137-b1172, b0537-b0565, b0016-b0022, b4412-b4413, b0577-b0582, b4415, b2389-b2390, b2392-b2395, b0358-b0368, b0370-b0380, b2856-b2863, b3042-b3048, b0656, b1325-b1333, b2030-b2062, b2190-b2192, b3215-b3219, b3504-b3505, b1070-b1083, b1878-b1894, b1917-b1950, b4324-b4342, b4345-b4358, b4486, b0497-b0502, b0700-b0706, b1456-h1462, h3481-b3484, b3592-b3596, b0981-b0988, b1021-b1029, b2080-b2096, b4438, b3440-b3445, b445I, b3556-b3558, b4455, b1786, b0150-b0153 and b2945 and also having one or more non-functional genes selected from polB, dinB and umuDC. In a particularly preferred embodiment, polB and dinB are non-functional and even more preferably polB, dinB and umuDC are all non-functional. The reduced genome E. coli bacterium may be strain MDS42, the genome of which lacks all insertion sequences, with one or more non-functional polB, dinB and wnuDC genes, preferably with non-functional polB and dinB genes and even more preferably with all three genes non-functional. The reduced genome may also be strain MDS43 or MDS66 (or any derivative strain), with one or more non-functional polB, dinB and umuDC genes, preferably with all three genes non-functional.
[0032] Various protein coding genes can be deleted to form reduced genome bacteria. In E. coli and other bacteria, a type of DNA sequence that can be deleted includes those that in general will adversely affect the stability of the organism or of the gene products of that organism. Such elements that give rise to instability include without limitation transposable elements, insertion sequences, and other selfish DNA elements which may play a role in genome instability. For example, insertion sequence (IS) elements and their associated transposes are often found in bacterial genomes, and thus are targets for deletion. IS sequences are common in E. coli, and all of them may be deleted. For purposes of clarity in this document, we use the term IS element and transposable element generically to refer to DNA elements, whether intact or defective, that can move from one point to another in the genome. An example of the detrimental effects of IS elements in science and technology is the fact that they can hop from the genome of the host E. coli into a BAC plasmid during propagation for sequencing. This artifact can be prevented by deletion from the host cells of all IS elements. For a specific application, other specific genes associated with genomic instability, such as active and inactive prophages may also be deleted.
[0033] Reduced genome bacteria of the invention may also be engineered to lack, for example, without limitation, certain genes unnecessary for growth and metabolism of the bacteria, pscudogenes, prophage, undesirable endogenous restriction-modification genes, pathogenicity genes, toxin genes, fimbrial genes, periplasmic protein genes, invasin genes, lipopolysaccharide genes, class III secretion systems, phage virulence determinants, phage receptors, pathogenicity islands, RI-IS elements, sequences of unknown function and sequences not found in common between two strains of the same native parental species of bacterium. Other DNA sequences that are not required for cell survival can also be deleted or omitted.
[0034] The reduced genome bacteria of the invention may comprise a heterologous nucleic acid encoding a polypeptide. The polypeptide may be a therapeutic protein such as insulin, an interleukin, a cytokine, a growth hormone, a growth factor, erythropoietin, a colony stimulating factor, interferon, or an antibody. The heterologous nucleic acid may be placed within a vector such as a plasmid and operatively linked to a promoter and optionally additional regulatory sequences.
[0035] Reduced genome bacteria having one or more non-functional polB, dinB and umuDC genes, preferably with at least non-functional polB and dinB genes, and further lacking all insertion sequences exhibit surprising genetic stability that enables the cloning of toxic nucleic acids which are difficult or impossible to isolate or maintain even in reduced genome bacteria lacking all insertion sequences. A toxic nucleic acid may be a nucleic acid which, when propagated in a host strain, results in an elevated mutation rate. A toxic nucleic acid may also result in an elevated rate of IS element transposition. An elevated rate of mutation of a toxic nucleic acid may be determined by comparison to a host strain propagating a control nucleic acid.
[0036] The reduced genome bacteria comprising one or more non-functional polB, dinB and umuDC genes may be used to produce polypeptides. Briefly a bacterium of the invention comprising a heterologous nucleic acid encoding a polypeptide operatively linked to an expression control sequence, as described above, may be incubated under conditions sufficient to allow expression of the polypeptide product.
[0037] Overexpression of even a well-tolerated protein of interest may lead to elevated IS transposition rates and activate the stress response of the cell leading to significantly increased mutation rates. Plasmids encoding the protein of interest rapidly acquire loss-of-function mutations under these conditions and bacteria carrying these mutated plasmids quickly take become dominant in the culture due at least in part to the growth inhibitory effect of intact plasmids encoding the overexpressed protein. Bacteria of the invention, which exhibit a surprising genomic stability and fidelity, delay the appearance of such mutant plasmids and the cells can produce the functional toxic protein for an extended period of time.
[0038] Recombinant proteins may be expressed in the periplasm or cytoplasm. The expression of proteins in the periplasm is routinely used for industrial use and has been reviewed in Manahan, J. Mol. Biol., 166:557-580 (1983); Hockney, Trends Biotechnol., 12:456-632 (1994); and Hannig et al., Trends Biotechnol., 16:54-60 (1998), each of which is incorporated herein by reference. Recombinant proteins may be produced in the periplasm by expressing fusion proteins in which they are attached to a signal peptide that causes secretion into the periplasmic space. There, the signal peptide may be cleaved off by specific signal peptidases. The protein transported into the periplasmic space may be biologically active.
[0039] The recombinant protein may be co-expressed with chaperones/disulfide-bond forming enzymes, which may provide proper folding of the recombinant protein. Nucleic acid sequences of such proteins useful for periplasmic expression of recombinant protein include, without limitation, those described in U.S. Pat. Nos. 5,747,662; 5,578,464 and 6,022,952, each of which is incorporated herein by reference.
EXAMPLE 1
Production of Reduced Genome E. coli
[0040] Reduced genome strain MDS39 was produced as described in International Patent Publication No. WO 2003/070880, which is incorporated herein by reference. Briefly, a series of reduced genome strains (MDS01-MDS39) were produced by making a series of 39 cumulative deletions (approximately 14.1% of the genome) of nucleic acid sequences from the parental strain E. coli MG1655.
[0041] Hybridization to genome scanning chips (NimbleGen Systems, Madison, Wis.) containing the K-12 sequence and all sequences in the IS database revealed that MDS39, the first strain designed to lack all IS elements, unexpectedly contained additional copies of an IS element that had hopped to new locations during its production. These IS elements were deleted to produce MDS40. The fhuACDB (the tonA locus) was deleted from MDS40 to produce MDS41. The location and function of each cumulative deletion made to produce MDS01-MDS41 can be found at Table 2 of U.S. Application Publication No. 2007/0054358, the entire content of which is incorporated herein by reference. The endA gene was then deleted from MDS41 to produce MDS42.
[0042] Over 69 deletions (amounting to deletion of over 900 genes) have been serially accumulated in the E. coli genome resulting in net reductions of 21.55% of the E. coli genome with no decrease in growth rate compared to the intact parent strain. These deletions were made utilizing methods and target sequences described in U.S. Pat. Nos. 6,989,265 and 7,303,906 as well as U.S. Pat. Pub. Nos. 2006/0270043, 2006/0199257 and 2007/0054358, the contents of which are herein incorporated by reference. Throughout the process of creating these deletions, intermediate multiple deletion strainseach containing unique sets of serially accumulated deletionswere tested and found to be viable.
[0043] The genes coding for DNA polymerase II (polB), DNA polymerase IV (dinB) and DNA polymerase V (umuDC) were deleted from the genome of MDS42 in a scarless manner using a suicide plasmid-based method as described in U.S. Pat. No. 6,989,265 and Feher et al., Methods Mol. Biol., 416:251-259 (2008) with plasmids pST76-A and pSTKST. Gene deletions were made individually and also joined in all possible combinations to produce the following strains: MDS42polB, MDS42dinB, MDS42umuDC, MDS42polBdinB, MDS42polBumuDC, MDS42dinBumuDC and MDS42polBdinBumuDC. Individual deletions were combined by P1 phage transduction of the marked (with integrated suicide-plasmids) intermediates of the deletion constructs, followed by endonuclease cleavage-stimulated out-recombination and loss of the plasmid. All deletions were verified by polymerase chain reaction (PCR) and sequencing using flanking primers. Primer sequences used in the study are listed at Table 2:
TABLE-US-00002 TABLE2 Primer Name Sequence(5-3) Application polB-A ccgaattcagtatccaggcgagt(SEQIDNO:1) deletionofpolB polB-BR caggcaggtgtggcggagggaatact(SEQIDNO:2) deletionofpolB polB-BF tccgccacacctgcctgcgccacgct(SEQIDNO:3) deletionofpolB polB-C ccggatccattggcggcattgt(SEQIDNO:4) deletionofpolB polB-D tgctgaacaccagtttgct(SEQIDNO:5) deletionofpolB polB-E aaccggtgaagtggttga(SEQIDNO:6) deletionofpolB dinB-A ccggtaccgggcataccgatgcga(SEQIDNO:7) deletionofdinB dinB-BR cagaatatacattgctcacctctcaacact(SEQIDNO: deletionofdinB 8) dinB-BF gaggtgagcaatgtatattctggtgtgca(SEQIDNO: deletionofdinB 9) dinB-C ccggatccgccgttaacgcatcaa(SEQIDNO:10) deletionofdinB dinB-D gtgttcgactcgctcgat(SEQIDNO:11) deletionofdinB dinB-E gagtcgtcgtagagtgcat(SEQIDNO:12) deletionofdinB umuDC-A ggaattcggatgagcgtcgtcgcca(SEQIDNO:13) deletionofumuDC umuDC-BR ttgagcgcaacaacagcagcgatgacaa(SEQIDNO: deletionofumuDC 14) umuDC-BF gctgctgttgttgcgctcaatgaacctt(SEQIDNO:15) deletionofumuDC umuDC-C gctgcagatcgcttacctgattgtc(SEQIDNO:16) deletionofumuDC umuDC-D aatgctccatctgcggtt(SEQIDNO:17) deletionofumuDC umuDC-E gctctatccttcgccgtt(SEQIDNO:18) deletionofumuDC lexA-A gttatggtcgcattttggata(SEQIDNO:19) modificationoflexA lexA-BR gatatctttcatcgCcatcccgctgacgcgca(SEQID modificationoflexA NO:20) lexA-BF ggatgGcgatgaaagatatcggca(SEQIDNO:21) modificationoflexA lexA-C ccggatcccagcaacggaacggt(SEQIDNO:22) modificationoflexA lexA-D cggtgctgattgccatta(SEQIDNO:23) modificationoflexA lexA-E gggctatcaagatgacca(SEQIDNO:24) modificationoflexA recA-D cggctagcgacgggatgttgattc(SEQIDNO:25) deletionofrecA recA-E gtgctgattatgccgtgt(SEQIDNO:26) deletionofrecA BMD30-A ccgaattcagtccgcacgcaactt(SEQIDNO:27) deletionofmcrBC BMD30-BR ctcgccttaatttacatacttttggtgc(SEQIDNO:28) deletionofmcrBC BMD30-BF tatgtaaattaaggcgagattattaaa(SEQIDNO:29) deletionofmcrBC BMD30-C ccggatccacatggcgcgttacaa(SEQIDNO:30) deletionofmcrBC BMD30-D tgataccgccgcacaaca(SEQIDNO:31) deletionofmcrBC BMD30-E actggtgtgtacgcaag(SEQIDNO:32) deletionofmcrBC cycA-D ctgatgccggtaggttct(SEQIDNO:33) analysisofcycA mutations cycA-E gcgccatccagcatgata(SEQIDNO:34) analysisofcycA mutations AK54-D atgataatgaatgacatca(SEQIDNO:35) sequencingofsinI AK55-E ctcgagttagaccaactctccaaa(SEQIDNO:36) sequencingofsinI Sce2 attaccctgttatcccta(SEQIDNO:37) pST76sequencing primer T7 taatacgactcactataggg(SEQIDNO:38) pST76sequencing primer Primers marked with A, C, BF, and BR were used to create homology regions by recombinant PCR for genomic integration of the suicide plasmids. Primers marked with D or E were homologous to flanking genomic regions, and were used for checking the deletions/allele replacements by PCR and sequencing. Capital letters in lexA primers indicate the point mutation introduced in the gene.
EXAMPLE 2
Spontaneous Mutation Rates in Reduced Genome E. coli
[0044] The spontaneous mutation rate of each strain was then determined using a D-cycloserine resistance assay, detecting all types of mutations in the cycA gene, as described in Feher et al., Mutat. Res. 595(1-2):184-190 (2006). Briefly, in a fluctuation assay, 20 tubes of 1 ml MS medium (as described in Hall, Mol. Biol. Evol., 15(1):1-5 (1998)) supplemented with 0.2% glucose were inoculated with approximately 10.sup.4 cells each, and cultures were grown to early stationary phase. Aliquots of 50 l from each tube were then spread on MS plates containing D-cycloserine (0.04 mM). The estimated number of mutations per tube (in) was calculated from the number of colonies by using the Ma-Sandri-Sarkar maximum likelihood method (Sarkar et al., Genetica, 85(2):173-179 (1992)). Equation 41 from Stewart et al., Genetics, 124(1):175-185 (1990) was used to extrapolate the obtained m value, valid for 50 l, to 1 ml. Statistical comparisons of m values were made only when the difference in total cell number was negligible (<3%, P0.6, with a two-tailed, unpaired t test). The total number of cells in a tube was calculated by spreading dilutions from three random tubes onto nonselective plates. Dividing the number of mutations per tube by the average total number of cells in a tube gave the mutation rate (mutation/cell/generation).
[0045] The deletion of each gene by itself results in at least a 20% decrease in mutation rate measured by this method (all values significant, P<0.05, two-tailed, unpaired t test). The results are graphically depicted at
[0046] To verify that the absence of genes encoding DNA polymerase II, IV and V has no adverse effect on fitness, growth rates of the different strains were measured in MOPS minimal medium. Ten parallel cultures originating from 10 individual colonies for each strain were picked and grown in a Bioscreen C instrument. Growth curves were measured by following the optical densities (O.D.) at 540 nm of each culture. None of the deletions had a significant effect on fitness in MOPS minimal medium, even when combined in the triple deletion strain MDS42polbdinBumuDC.
[0047] To determine whether upstream inactivation of the entire SOS response via regulator mutants would have the same effects on the spontaneous mutation rate as elimination of the genes encoding DNA polymerase II, IV and V, MDS42recA and MDS42lexA were created. MDS42recA comprises a scarless deletion of recA (coordinates 2820783-2821861 of MG1655), the product of which is required for induction of the autoproteolysis of LexA. MDS42lexA comprises a replacement of the lexA gene with a non-functional allele in which the serine at position 119 is replaced with alanine (S 119A). Each of these genes (recA and lexA) is required in order to de-repress the SOS regulon genes. Accordingly, neither MDS42recA nor MDS42/exA is able to induce the SOS pathway. None of these modifications had an adverse effect on the overall fitness of the strains, as measured by growth rates of the strains in MOPS minimal medium as described above. Surprisingly, neither strain showed a significant decrease in spontaneous mutation rate when compared to MDS42. In the case of MDS42lexA, a slight increase was actually observed (2.0710.sup.7 compared to 8.210.sup.8 of MDS42). The results are illustrated at
EXAMPLE 3
Stress-Induced Mutation Rates in Reduced Genome E. coli
[0048] The mutation rates of MDS42recA, MDS42lexA and MDS42polbdinBumuDC under stressful conditions were then measured and compared.
[0049] Mitomycin-C, a DNA cross-linking agent that causes lesions in double stranded DNA, directly activates the SOS response, leading to up-regulation of DNA polymerases II, IV and V. A sub-inhibitory concentration (0.1 g/ml) of mitomycin-C was used to stress the cells and the effect on mutation rates was analyzed. The results are illustrated at
[0050] Protein overproduction imposes stress on the host cell. The effect of overproduction of a benign protein, Green Fluorescent Protein (GFP), on mutation rates was tested. The gene encoding GFP was cloned on a plasmid as an inducible construct controlled by a T7 promoter. To express the GFP, T7 RNA polymerase encoding variants of strains MDS42polBdinBumuDC (MDS42polBdinBumuDC-T7), MDS42recA (MDS42recA-T7), and MDS42lexA (MDS42lexA-T7) were constructed by replacing the yahA-yaiL genomic region with an IPTG-inducible lac operator/T7 polymerase cassette. T7 RNA polymerase encoding variants of MDS42 (MDS42-T7), MG1655 (MG1655-T7), and the widely used protein production strain BL21(DE3) were also constructed and the effects of overexpression of GFP on mutation rate in each strain was measured and compared. The results are illustrated at
[0051] Next, the effect of overproduction of a toxic protein (ORF238, a small, leucine-rich hydrophobic protein) on mutation rates in the bacteria was tested by transforming the strains with plasmid pSG-ORF238, an IPTG-inducible, pSG1144-based construct capable of overproducing the ORF238 protein. The results are illustrated at
[0052] The results demonstrate that, with the exception of MDS42recA and MDS42polBdinBumuDC, the various stresses increased the mutation rate of all strains including MDS42. Overproduction of the toxic ORF238 protein had the largest effect: a greater than 5-fold increase in mutation rate was measured. Sub-inhibitory concentration of mitomycin-C caused a greater than 2-3-fold increase in the mutation rate and BL21(DE3) and MDS42recA were unable to grow under these conditions. Overproduction of GFP had a relatively minor effect, resulting in a 1.5 to 2-fold increase in mutation rates.
[0053] In contrast, no significant increase in mutation rate in the presence of any of the stressors could be seen in either MDS42recA or MDS42polBdinBumuDC. Interestingly, MDS42lexA did not follow this behaviorthe strain showed an increase in mutation rate in response to all of the stresses. MDS42polBdinBumuDC can be characterized as the genetically most stable strain, displaying the lowest spontaneous mutation rate and showing negligible response to stressful conditions.
[0054] The most commonly used protein production strain, BL21(DE3), displayed a mutation rate nearly two orders of magnitude higher than MDS42polBdinBumuDC when overproducing the toxic ORF238 protein. To analyze this difference, mutation spectra of BL21(DE3), MG 1655, MDS42 and MDS42polBdinBumuDC were studied by PCR analysis of cycA in cycloserine-resistant mutants. Briefly, a 1,877-bp genomic segment encompassing the entire gene was amplified from mutant cells using the primer pair cycA1-D/cycA2-E. A representative sample was obtained by analyzing 5 colonies from each parallel plate, yielding a total of 96 samples per experiment. The amplified fragments were resolved on an agarose gel and compared to a fragment generated from the wild-type template. Identical sizes indicated a mutation affecting only one or a few nucleotides, a decrease in size or failure of amplification indicated a deletion, and a detectable size increase indicated in IS insertion. The results are illustrated at
[0055] To confirm the data obtained using the cycA fluctuation assay, mutation rates of MDS42 and MDS42polBdinBurnuDC under each of the different stress conditions were also measured using the rifampicin resistance assay. This assay detects point mutations in the essential rpoB gene, as described in Jin and Gross, J. Mol. Biol., 202(1):45-58 (1988). Briefly, twenty tubes of 1 ml LB were inoculated with 10.sup.4 cells each, and cultures grown to early stationary phase. Appropriate dilutions were spread onto non-selective LB agar plates and LB agar plates containing rifampicin (100 g/ml). Colony counts were performed after 24 or 48 hours, respectively. Mutation frequencies were reported as a proportion of the number of rifampicin-resistant colonies relative to the total viable count. The results correspond to the mean value obtained in three independent experiments for each strain and condition. When required, different stress conditions were provided in the same manner as in the cycA assay. The data obtained using the rifampicin resistance assay were consistent with the cycA fluctuation data, as illustrated at
EXAMPLE 4
[0056] MDS42polBdinBunntDC Provides Improved Stability to a Toxic Protein-Expressing Plasmid
[0057] To demonstrate the surprising advantage of reduced genome bacteria comprising non-functional polB, dinB and/or umuDC genes, a plasmid-based mutation screen was designed. Plasmid pSin32 carries an inducible copy of sinI, coding for the SinI methyltransferase of Salmonella enterica serovar Infantis, cloned into the XhoI site of the pET3-His plasmid. SinI methylates the inner cytosines in DNA at GG(A/T)CC sites, producing 5-methylcytosine, thereby creating targets for the McrBC endonuclease, which cleaves DNA containing methylcytosine. A plasmid carrying methylated SinI sites (e.g. pSin32, self-methylated at its 8 SinI sites), therefore cannot establish itself in a mcrBC.sup.+ host. When introduced into mcrBC.sup. hosts, the plasmid is methylated when expression of sinI is induced, but can be maintained.
[0058] The mcrBC gene was deleted during production of MDS42 and accordingly all MDS42 strains are mcrBC.sup.. The mcrBC gene was deleted from BL21(DE3) to create strain BL21(DE3)mcrBC. Plasmid pSin32 was electroporated into MDS42-T7, MDS42polBdinBumuDC-T7 and BL21(DE3)mcrBC. After 1 hour of recovery incubation at 37 C. in 1 ml LB, 100 l of the transformed cultures were placed in 100 ml LB supplemented with ampicillin (Ap) and incubated at 37 C. From the remaining 900 l, plasmid DNA was isolated according to standard protocols. After 7 hours of incubation, the cultures reached O.D..sub..Math.540=0.2, at which point the samples were induced with 1PTG (1 mM final concentration). Samples for plasmid preparation were also taken at this time (8-hour samples), followed by additional samples being taken every 2 hours, up to 18 hours, then at 24 and 36 hours of post-transformation growth. Purified pSin32 plasmid samples (9 from each strain) were then transformed into MDS42 (McrBC.sup.) and MG1655 (MerBC.sup.+). By counting transformed MG1655 and MDS42 colonies for each plasmid sample, the relative number of mutated plasmids could be calculated. To obtain an absolute value for mutated plasmid numbers, each batch of electrocompetent MDS42 and MG1655 indicator strains was transformed with a control (pST76-A) plasmid carrying an Ap resistance cassette. The ratio of MG1655 and MDS42 tansformants was then used as a correcting factor to calculate the absolute values for the number of mutated pSin32 plasmids for each sample.
[0059] Following transformation of BL21(DE3)mcrBC, MDS42-T7 and MDS42polBdinBumuDC-T7 with pSin32, it was found that, upon induction by IPTG, overproduction of the SinI enzyme had a moderate growth-inhibiting effect even in McrBC.sup. strains (
[0060] Following IPTG-induction, plasmid samples were taken at regular intervals. The fraction of the plasmid sample that carried sinI-disabling mutations (unmethylated plamids) was detected by transforming the plasmid samples back into MG1655 (merBC.sup.+). The total plasmid number per sample was determined by simultaneously transforming the samples into MDS42. After correcting each value with the transformant number from a control plasmid for each set of electrocompetent cells, the ratio of plasmids coding for functional/non-functional sinI was calculated. The results are illustrated at
[0061] Surprisingly, 96.7% of the starting (0 hour) plasmid sample, originating from MDS42, could not be established in MG1655. This indicated that, even in a host lacking T7 polymerase, spurious transcription of sinI had resulted in SinI expression, and consequently methylation of sinI sites. The methylated status of the SinI sites in the original plasmid sample was confirmed by their uncleavability by SinI.
[0062] Differences regarding clone stability in the different strains became evident after IPTG-induction of SinI expression. Thirty-six hours after transformation (28 hours after IPTG-induction), 51.7% of pSin32 harbored in BL21(DE3)mcrBC cells carried mutations preventing the production of active SinI. This value was significantly lower in MDS42-T7 (25.8%). In MDS42potBdinBunluDC-T7 , the fraction of mutated pSin32 plasmids was even lower (8.2%). The non-methylated status of the SinI sites on the plasmids carrying a mutated sinI gene was confirmed by their cleavability by SinI.
[0063] The accumulation of mutant plasmids in BI,21(DE3)mcrBC and MDS42-T7 was due to a combined effect of stress-induced mutagenesis and growth inhibition by the SinI-expressing plasmid. Overproduction of the enzyme elevated mutation rates and reduced growth. In these slow-growing cultures, over time, SinI-inactivating mutations arose, which then, having resumed their normal growth rate, quickly outgrew the rest of the culture. In low-mutation-rate MDS42polBdinBumuDC-T7, SinI-inactivating mutations developed, on average, over a longer time period. Growth curve measurements of 50 independent colonies of MDS42-T7 and MDS42polBdinBumuDC-T7, all carrying the pSin32 plasmid, support this notion (
[0064] To verify that mutations had indeed taken place in the plasmids that allowed for growth in McrBC.sup.+ cells, the sinI region of 8 different plasmid samples (taken from viable, pSin32-transformed MG1655 colonies) were sequenced (
[0065] These results demonstrate a clear and unexpected practical advantage of reduced genome bacteria having non-functional genes encoding DNA polymerase II, IV and/or V particularly in an IS element-free genetic background. When SinI was overproduced, the sinI gene, carried on a plasmid, acquired loss-of-function mutations approximately three times less frequently in MDS42polBdinBumuDC than in MDS42, and over five times less frequently than in BL21(DE3)merBC. Remarkably, after only 16 hours of overproduction in BL21(DE3)mcrBC, nearly half of all sinI genes encoded on the plasmids had suffered a disabling mutation.
[0066] The unexpectedly high ratio of mutated clones in the SinI-overexpressing culture cannot be explained solely by the stress-induced mutagenesis, the overall mutation rate of which is too low in absolute values (in the order of 10.sup.6 mutations/gene/generation) to cause such a dramatic effect. Rather, the phenomenon is in large part due to the growth inhibitory effect of the plasmid carrying the toxic gene. The chain of events is the following: Upon expression of a toxic gene, the growth rate of the cell is reduced. At the same time, mutation rate is increased by the stress. Once a mutant that no longer expresses the toxic function arises in the plasmid population, the cell harboring it can resume normal growth and become dominant in the culture. In reduced genome bacteria having one or more non-functional polB, dinB and/or umuDC genes, as exemplified by MDS42polBdinBumuDC, appearance of such mutants is delayed and the cells can produce the functional toxic product for an extended period of time. The advantage of strains such as MDS42polBdinBunmDC over parent strain MDS42 and the commonly used production strain BL21(DE3) is striking and increases as the severity of the stress of overproducing a product increases. Bacterial strains with high genomic stability as described herein are particularly valuable in therapeutic applications, where fidelity of the nucleic acid and/or protein product is of primary importance. Bacteria of the invention are also surprisingly useful where long-term continuous culture conditions are required.