1. Patent Search
  2. Details

Activity of Fe-S Cluster Requiring Proteins

20170101653 ยท 2017-04-13

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention is related to a recombinant host cell, in particular a yeast cell, comprising a dihydroxy-acid dehydratase polypeptide. The invention is also related to a recombinant host cell having increased specific activity of the dihydroxy-acid dehydratase polypeptide as a result of increased expression of the polypeptide, modulation of the FeS cluster biosynthesis of the cell, or a combination thereof. The present invention also includes methods of using the host cells, as well as, methods for identifying polypeptides that increase the flux in an FeS cluster biosynthesis pathway in a host cell.

    Claims

    1-3. (canceled)

    4. A recombinant host cell comprising at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity and at least one heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis.

    5. The recombinant host cell of claim 4, wherein said endogenous gene encoding a polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of the genes in Tables 8 and 9.

    6. The recombinant host cell of claim 4, wherein said heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of the genes in Table 7.

    7. The recombinant host cell of claim 4, wherein said polypeptide affecting FeS cluster biosynthesis is encoded by a gene selected from the group consisting of AFT1, AFT2, FRA2, GRX3, CCC1, and combinations thereof.

    8. The recombinant host cell of claim 7, wherein said polypeptide is encoded by a polynucleotide that is constitutive mutant.

    9. The recombinant host cell of claim 8, wherein said constitutive mutant is selected from the group consisting of AFT1 L99A, AFT1 L102A, AFT1 C291F, AFT1 C293F, and combinations thereof.

    10. The recombinant host cell of claim 7, wherein said polypeptide affecting FeS cluster biosynthesis is encoded by a polynucleotide comprising a high copy number plasmid or a plasmid with a copy number that can be regulated.

    11. The recombinant host cell of claim 7, wherein said polypeptide affecting FeS cluster biosynthesis is encoded by a polynucleotide integrated at least once in the recombinant host cell DNA.

    12-13. (canceled)

    14. The recombinant host cell of claim 4, wherein said at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity is expressed in multiple copies.

    15. The recombinant host cell of claim 14, wherein said at least one heterologous polynucleotide comprises a high copy number plasmid or a plasmid with a copy number that can be regulated.

    16. The recombinant host cell of claim 14, wherein said at least one heterologous polynucleotide is integrated at least once in the recombinant host cell DNA.

    17. The recombinant host cell of claim 4, wherein said FeS cluster biosynthesis is increased compared to a recombinant host cell having endogenous FeS cluster biosynthesis.

    18. The recombinant host cell of claim 4, wherein said host cell is a yeast host cell.

    19. The recombinant host cell of claim 18, wherein said yeast host cell is selected from the group consisting of Saccharomyces, Schizosaccharomyces, Hansenula, Candida, Kluyveromyces, Yarrowia, Issatchenkia and Pichia.

    20. The recombinant host cell of claim 4, wherein said heterologous polypeptide having dihydroxy-acid dehydratase activity is expressed in the cytosol of the host cell.

    21. (canceled)

    22. The recombinant host cell of claim 4, wherein said heterologous polypeptide having dihydroxy-acid dehydratase activity has an amino acid sequence with at least about 90% identity to SEQ ID NO: 168 or SEQ ID NO: 232.

    23-24. (canceled)

    25. The recombinant host cell of claim 4, wherein said recombinant host cell produces isobutanol.

    26. The recombinant host cell of claim 25, wherein said recombinant host cell comprises an isobutanol biosynthetic pathway.

    27. (canceled)

    28. A method of making isobutanol comprising: (a) providing the recombinant host cell of claim 25; (b) contacting the recombinant host cell of (a) with a fermentable carbon substrate in a fermentation medium under conditions wherein isobutanol is produced.

    29-62. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES

    [0029] FIG. 1A depicts a vector map of a vector for overexpression of the IlvD gene from S. mutans.

    [0030] FIG. 1B depicts a vector map of an integration vector for overexpression of the IlvD gene from S. mutans in the chromosome.

    [0031] FIG. 2 depicts a vector map of a centromere vector used to clone AFT1 or AFT1 mutants and useful for other genes of interest.

    [0032] FIG. 3 depicts a UV-Vis absorbance spectrum of purified S. mutans DHAD.

    [0033] FIG. 4 depicts an EPR spectrum of purified S. mutans DHAD.

    [0034] FIG. 5 depicts a biosynthetic pathway for biosynthesis of isobutanol.

    [0035] FIG. 6A depicts a schematic of Azotobacter vinelandii nif genes.

    [0036] FIG. 6B depicts a schematic of additional Azotobacter vinelandii nif genes.

    [0037] FIG. 6C depicts a schematic of the equation in which NFU acts as a persulfide reductase.

    [0038] FIG. 7 depicts a schematic of Helicobacter pylori nif genes.

    [0039] FIG. 8 depicts a schematic of E. coli isc genes.

    [0040] FIG. 9 depicts a schematic of E. coli suf genes.

    [0041] FIG. 10 depicts a schematic of the cytosolic [2Fe-2S] biosynthesis and assembly system.

    [0042] FIG. 11 depicts a vector map of a vector for overexpression of the IlvD gene from L. lactis.

    [0043] Table 12 is a table of the Profile HMM for dihydroxy-acid dehydratases based on enzymes with assayed function prepared as described in U.S. patent application Ser. No. 12/569,636, filed Sep. 29, 2009. Table 12 is submitted herewith electronically and is incorporated herein by reference.

    DETAILED DESCRIPTION OF THE INVENTION

    [0044] Described herein is a method to increase the fraction of the FeS cluster requiring proteins that are loaded with FeS clusters. Also described are recombinant host cells that express functional FeS cluster requiring proteins, such as DHAD enzymes, and at least one heterologous Fe uptake, utilization, or FeS cluster biosynthesis protein, recombinant host cells that express functional DHAD enzymes and comprise at least one deletion, mutation, and/or substitution in a native protein involved in Fe utilization or FeS cluster biosynthesis, or recombinant host cells comprising combinations thereof. In addition, the present invention describes a method to identify polypeptides that increase the flux in an FeS cluster biosynthesis pathway in a host cell. Also described is a method to identify polypeptides that alter the activity of an FeS cluster requiring protein.

    DEFINITIONS

    [0045] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present application including the definitions will control. Also, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. All publications, patents and other references mentioned herein are incorporated by reference in their entireties for all purposes.

    [0046] In order to further define this invention, the following terms and definitions are herein provided.

    [0047] As used herein, the terms comprises, comprising, includes, including, has, having, contains or containing, or any other variation thereof, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. For example, a composition, a mixture, a process, a method, an article, or an apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus. Further, unless expressly stated to the contrary, or refers to an inclusive or and not to an exclusive or. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).

    [0048] As used herein, the term consists of or variations such as consist of or consisting of, as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, but that no additional integer or group of integers may be added to the specified method, structure, or composition.

    [0049] As used herein, the term consists essentially of, or variations such as consist essentially of or consisting essentially of, as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, and the optional inclusion of any recited integer or group of integers that do not materially change the basic or novel properties of the specified method, structure or composition. See M.P.E.P. 2111.03.

    [0050] Also, the indefinite articles a and an preceding an element or component of the invention are intended to be nonrestrictive regarding the number of instances, i.e., occurrences of the element or component. Therefore a or an should be read to include one or at least one, and the singular word form of the element or component also includes the plural unless the number is obviously meant to be singular.

    [0051] The term invention or present invention as used herein is a non-limiting term and is not intended to refer to any single embodiment of the particular invention but encompasses all possible embodiments as described in the application.

    [0052] As used herein, the term about modifying the quantity of an ingredient or reactant of the invention employed refers to variation in the numerical quantity that can occur, for example, through typical measuring and liquid handling procedures used for making concentrates or solutions in the real world; through inadvertent error in these procedures; through differences in the manufacture, source, or purity of the ingredients employed to make the compositions or to carry out the methods; and the like. The term about also encompasses amounts that differ due to different equilibrium conditions for a composition resulting from a particular initial mixture. Whether or not modified by the term about, the claims include equivalents to the quantities. In one embodiment, the term about means within 10% of the reported numerical value, preferably within 5% of the reported numerical value.

    [0053] The term isobutanol biosynthetic pathway refers to an enzyme pathway to produce isobutanol from pyruvate.

    [0054] The term a facultative anaerobe refers to a microorganism that can grow in both aerobic and anaerobic environments.

    [0055] The term carbon substrate or fermentable carbon substrate refers to a carbon source capable of being metabolized by host organisms of the present invention and particularly carbon sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and one-carbon substrates or mixtures thereof.

    [0056] The term FeS cluster biosynthesis refers to biosynthesis of FeS clusters, including, e.g., the assembly and loading of FeS clusters. The term FeS cluster biosynthesis genes, FeS cluster biosynthesis proteins or FeS cluster biosynthesis pathway refers to those polynucleotides/genes and the encoded polypeptides that are involved in the biosynthesis of FeS clusters, including, e.g., the assembly and loading of FeS clusters.

    [0057] The term Fe uptake and utilization refers to processes which can effect FeS cluster biosynthesis such as Fe sensing, uptake, utilization, and homeostasis. Fe uptake and utilization genes refers to those polynucleotides/genes and the encoded polypeptides that are involved in Fe uptake, utilization, and homeostasis. Some of these polynucleotides/genes are contained in the Fe Regulon that has been described in the literature and is further described hereafter. As used herein, Fe uptake and utilization genes and FeS cluster biosynthesis genes can encode a polypeptide affecting FeS cluster biosynthesis.

    [0058] The term specific activity as used herein is defined as the units of activity in a given amount of protein. Thus, the specific activity is not directly measured but is calculated by dividing 1) the activity in units/ml of the enzyme sample by 2) the concentration of protein in that sample, so the specific activity is expressed as units/mg. The specific activity of a sample of pure, fully active enzyme is a characteristic of that enzyme. The specific activity of a sample of a mixture of proteins is a measure of the relative fraction of protein in that sample that is composed of the active enzyme of interest. The specific activity of a polypeptide of the invention may be selected from greater than about 0.25 U/mg; greater than about 0.3 U/mg; greater than about 0.4 U/mg; greater than about 0.5 U/mg; greater than about 0.6 U/mg; greater than about 0.7 U/mg; greater than about 0.8 U/mg; greater than about 0.9 U/mg; greater than about 1.0 U/mg; greater than about 1.5 U/mg; greater than about 2.0 U/mg; greater than about 2.5 U/mg; greater than about 3.0 U/mg; greater than about 3.5 U/mg; greater than about 4.0 U/mg; greater than about 5.5 U/mg; greater than about 5.0 U/mg; greater than about 6.0 U/mg; greater than about 6.5 U/mg; greater than about 7.0 U/mg; greater than about 7.5 U/mg; greater than about 8.0 U/mg; greater than about 8.5 U/mg; greater than about 9.0 U/mg; greater than about 9.5 U/mg; greater than about 10.0 U/mg; greater than about 20.0 U/mg; or greater than about 50.0 U/mg. In one embodiment, the specific activity of a polypeptide of the invention is greater than about 0.25 U/mg. In another embodiment, the specific activity is greater than about 1.0 U/mg. In yet another embodiment, the specific activity is greater than about 2.0 U/mg or greater than about 3.0 U/mg.

    [0059] The term polynucleotide is intended to encompass a singular nucleic acid as well as plural nucleic acids, and refers to a nucleic acid molecule or construct, e.g., messenger RNA (mRNA) or plasmid DNA (pDNA). A polynucleotide can contain the nucleotide sequence of the full-length cDNA sequence, or a fragment thereof, including the untranslated 5 and 3 sequences and the coding sequences. The polynucleotide can be composed of any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. For example, polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. Polynucleotide embraces chemically, enzymatically, or metabolically modified forms.

    [0060] A polynucleotide sequence may be referred to as isolated, in which it has been removed from its native environment. For example, a heterologous polynucleotide encoding a polypeptide or polypeptide fragment having dihydroxy-acid dehydratase activity contained in a vector is considered isolated for the purposes of the present invention. Further examples of an isolated polynucleotide include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) polynucleotides in solution. Isolated polynucleotides or nucleic acids according to the present invention further include such molecules produced synthetically. An isolated polynucleotide fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.

    [0061] The term gene refers to a polynucleotide that is capable of being expressed as a specific protein, optionally including regulatory sequences preceding (5 non-coding sequences) and following (3 non-coding sequences) the coding sequence. Native gene refers to a gene as found in nature with its own regulatory sequences. Chimeric gene refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.

    [0062] As used herein, a coding region is a portion of nucleic acid which consists of codons translated into amino acids. Although a stop codon (TAG, TGA, or TAA) is not translated into an amino acid, it may be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of a coding region. Two or more coding regions of the present invention can be present in a single polynucleotide construct, e.g., on a single vector, or in separate polynucleotide constructs, e.g., on separate (different) vectors. Furthermore, any vector may contain a single coding region, or may comprise two or more coding regions. In addition, a vector, polynucleotide, or nucleic acid of the invention may encode heterologous coding regions.

    [0063] The term endogenous, when used in reference to a polynucleotide, a gene, or a polypeptide refers to a native polynucleotide or gene in its natural location in the genome of an organism, or for a native polypeptide, is transcribed and translated from this location in the genome.

    [0064] The term heterologous when used in reference to a polynucleotide, a gene, or a polypeptide refers to a polynucleotide, gene, or polypeptide not normally found in the host organism. Heterologous also includes a native coding region, or portion thereof, that is reintroduced into the source organism in a form that is different from the corresponding native gene, e.g., not in its natural location in the organism's genome. The heterologous polynucleotide or gene may be introduced into the host organism by, e.g., gene transfer. A heterologous gene may include a native coding region with non-native regulatory regions that is reintroduced into the native host. A transgene is a gene that has been introduced into the genome by a transformation procedure.

    [0065] The term recombinant genetic expression element refers to a nucleic acid fragment that expresses one or more specific proteins, including regulatory sequences preceding (5 non-coding sequences) and following (3 termination sequences) coding sequences for the proteins. A chimeric gene is a recombinant genetic expression element. The coding regions of an operon may form a recombinant genetic expression element, along with an operably linked promoter and termination region.

    [0066] Regulatory sequences refers to nucleotide sequences located upstream (5 non-coding sequences), within, or downstream (3 non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, enhancers, operators, repressors, transcription termination signals, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem-loop structure.

    [0067] The term promoter refers to a nucleic acid sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3 to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleic acid segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as constitutive promoters. Inducible promoters, on the other hand, cause a gene to be expressed when the promoter is induced or turned on by a promoter-specific signal or molecule. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.

    [0068] The term operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of effecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.

    [0069] The term expression, as used herein, refers to the transcription and accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide. The process includes any manifestation of the functional presence of the expressed polynucleotide, gene, or polypeptide within the cell including, without limitation, gene knockdown as well as both transient expression and stable expression.

    [0070] The term over-expression, as used herein, refers to expression that is higher than endogenous expression of the same or related polynucleotide or gene. A heterologous polynucleotide or gene is also over-expressed if its expression is higher than that of a comparable endogenous gene, or if its expression is higher than that of the same polynucleotide or gene introduced by a means that does not overexpress the polynucleotide or gene. For example, a polynucleotide can be expressed in a host cell from a low copy number plasmid, which is present in only limited or few copies, and the same polynucleotide can be over-expressed in a host cell from a high copy number plasmid or a plasmid with a copy number that can be regulated, which is present in multiple copies. Any means can be used to over-express a polynucleotide, so long as it increases the copies of the polynucleotide in the host cell. In addition to using a high copy number plasmid, or a plasmid with a copy number that can be regulated, a polynucleotide can be over-expressed by multiple chromosomal integrations.

    [0071] Expression or over-expression of a polypeptide of the invention in a recombinant host cell can be quantified according to any number of methods known to the skilled artisan and can be represented, e.g., by a percent of total cell protein. The percent of total protein can be an amount selected from greater than about 0.001% of total cell protein; greater than about 0.01% of total cell protein; greater than about 0.1% of total cell protein; greater than about 0.5% of total cell protein; greater than about 1.0% of total cell protein; greater than about 2.0% of total cell protein; greater than about 3% of total cell protein; greater than about 4.0% of total cell protein; greater than about 5% of total cell protein; greater than about 6.0% of total cell protein; greater than about 7.0% of total cell protein; greater than about 8.0% of total cell protein; greater than about 9.0% of total cell protein; greater than about 10% of total cell protein; or greater than about 20% of total cell protein. In one embodiment, the amount of polypeptide expressed is greater that about 0.5% of total cell protein. In another embodiment, the amount of polypeptide expressed is greater than about 1.0% of total cell protein or greater than about 2.0% of total cell protein.

    [0072] As used herein the term transformation refers to the transfer of a nucleic acid fragment into a host organism, resulting in genetically stable inheritance with or without selections. Host organisms containing the transformed nucleic acid fragments are referred to as transgenic or recombinant or transformed organisms.

    [0073] The terms plasmid and vector as used herein, refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3 untranslated sequence into a cell.

    [0074] As used herein the term codon degeneracy refers to the nature in the genetic code permitting variation of the nucleotide sequence without effecting the amino acid sequence of an encoded polypeptide. The skilled artisan is well aware of the codon-bias exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a gene for improved expression in a host cell, it is desirable to design the gene such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.

    [0075] The term codon-optimized as it refers to genes or coding regions of nucleic acid molecules for transformation of various hosts, refers to the alteration of codons in the gene or coding regions of the nucleic acid molecules to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the DNA. Such optimization includes replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that organism.

    [0076] Deviations in the nucleotide sequence that comprise the codons encoding the amino acids of any polypeptide chain allow for variations in the sequence coding for the gene. Since each codon consists of three nucleotides, and the nucleotides comprising DNA are restricted to four specific bases, there are 64 possible combinations of nucleotides, 61 of which encode amino acids (the remaining three codons encode signals ending translation). The genetic code which shows which codons encode which amino acids is reproduced herein as Table 1. As a result, many amino acids are designated by more than one codon. For example, the amino acids alanine and proline are coded for by four triplets, serine and arginine by six, whereas tryptophan and methionine are coded by just one triplet. This degeneracy allows for DNA base composition to vary over a wide range without altering the amino acid sequence of the proteins encoded by the DNA.

    TABLE-US-00001 TABLE1 TheStandardGeneticCode T C A G T TTTPhe(F) TCTSer(S) TATTyr(Y) TGTCys(C) TTC TCC TAC TGC TTALeu(L) TCA TAAStop TGAStop TTG TCG TAGStop TGGTrp(W) C CTTLeu(L) CCTPro(P) CATHis(H) CGTArg(R) CTC CCC CAC CGC CTA CCA CAAGln(Q) CGA CTG CCG CAG CGG A ATTIle(I) ACTThr(T) AATAsn(N) AGTSer(S) ATC ACC AAC AGC ATA ACA AAALys(K) AGAArg(R) ATGMet ACG AAG AGG (M) G GTTVal(V) GCTAla(A) GATAsp(D) GGTGly(G) GTC GCC GAC GGC GTA GCA GAAGlu(E) GGA GTG GCG GAG GGG

    [0077] Many organisms display a bias for use of particular codons to code for insertion of a particular amino acid in a growing peptide chain. Codon preference, or codon bias, differences in codon usage between organisms, is afforded by degeneracy of the genetic code, and is well documented among many organisms. Codon bias often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, inter alia, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.

    [0078] Given the large number of gene sequences available for a wide variety of animal, plant and microbial species, it is possible to calculate the relative frequencies of codon usage. Codon usage tables are readily available, for example, at the Codon Usage Database available at the Kazusa DNA Research Institute, Japan, and these tables can be adapted in a number of ways. See Nakamura, Y., et al. Nucl. Acids Res. 28:292 (2000). Codon usage tables for yeast, calculated from GenBank Release 128.0 [15 Feb. 2002], are reproduced below as Table 2. This table uses mRNA nomenclature, and so instead of thymine (T) which is found in DNA, the tables use uracil (U) which is found in RNA. Table 2 has been adapted so that frequencies are calculated for each amino acid, rather than for all 64 codons.

    TABLE-US-00002 TABLE 2 Codon Usage Table for Saccharomyces cerevisiae Genes Frequency per Amino Acid Codon Number thousand Phe UUU 170666 26.1 Phe UUC 120510 18.4 Leu UUA 170884 26.2 Leu UUG 177573 27.2 Leu CUU 80076 12.3 Leu CUC 35545 5.4 Leu CUA 87619 13.4 Leu CUG 68494 10.5 Ile AUU 196893 30.1 Ile AUC 112176 17.2 Ile AUA 116254 17.8 Met AUG 136805 20.9 Val GUU 144243 22.1 Val GUC 76947 11.8 Val GUA 76927 11.8 Val GUG 70337 10.8 Ser UCU 153557 23.5 Ser UCC 92923 14.2 Ser UCA 122028 18.7 Ser UCG 55951 8.6 Ser AGU 92466 14.2 Ser AGC 63726 9.8 Pro CCU 88263 13.5 Pro CCC 44309 6.8 Pro CCA 119641 18.3 Pro CCG 34597 5.3 Thr ACU 132522 20.3 Thr ACC 83207 12.7 Thr ACA 116084 17.8 Thr ACG 52045 8.0 Ala GCU 138358 21.2 Ala GCC 82357 12.6 Ala GCA 105910 16.2 Ala GCG 40358 6.2 Tyr UAU 122728 18.8 Tyr UAC 96596 14.8 His CAU 89007 13.6 His CAC 50785 7.8 Gln CAA 178251 27.3 Gln CAG 79121 12.1 Asn AAU 233124 35.7 Asn AAC 162199 24.8 Lys AAA 273618 41.9 Lys AAG 201361 30.8 Asp GAU 245641 37.6 Asp GAC 132048 20.2 Glu GAA 297944 45.6 Glu GAG 125717 19.2 Cys UGU 52903 8.1 Cys UGC 31095 4.8 Trp UGG 67789 10.4 Arg CGU 41791 6.4 Arg CGC 16993 2.6 Arg CGA 19562 3.0 Arg CGG 11351 1.7 Arg AGA 139081 21.3 Arg AGG 60289 9.2 Gly GGU 156109 23.9 Gly GGC 63903 9.8 Gly GGA 71216 10.9 Gly GGG 39359 6.0 Stop UAA 6913 1.1 Stop UAG 3312 0.5 Stop UGA 4447 0.7

    [0079] By utilizing this or similar tables, one of ordinary skill in the art can apply the frequencies to any given polypeptide sequence, and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide, but which uses codons optimal for a given species.

    [0080] Randomly assigning codons at an optimized frequency to encode a given polypeptide sequence, can be done manually by calculating codon frequencies for each amino acid, and then assigning the codons to the polypeptide sequence randomly. Additionally, various algorithms and computer software programs are readily available to those of ordinary skill in the art. For example, the EditSeq function in the Lasergene Package, available from DNAstar, Inc., Madison, Wis., the backtranslation function in the VectorNTI Suite, available from InforMax, Inc., Bethesda, Md., and the backtranslate function in the GCG-Wisconsin Package, available from Accelrys, Inc., San Diego, Calif. In addition, various resources are publicly available to codon-optimize coding region sequences, e.g., the backtranslation function (Entelechon GmbH, Regensburg, Germany) and the backtranseq function (NRC Saskatoon Bioinformatics, Saskatoon, Saskatchewan, Canada). Constructing a rudimentary algorithm to assign codons based on a given frequency can also easily be accomplished with basic mathematical functions by one of ordinary skill in the art.

    [0081] Codon-optimized coding regions can be designed by various methods known to those skilled in the art including software packages such as synthetic gene designer (University of Maryland, Baltimore, Md.).

    [0082] As used herein, the term polypeptide is intended to encompass a singular polypeptide as well as plural polypeptides, and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, protein, amino acid chain, or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of polypeptide, and the term polypeptide may be used instead of, or interchangeably with any of these terms. A polypeptide may be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It may be generated in any manner, including by chemical synthesis.

    [0083] By an isolated polypeptide or a fragment, variant, or derivative thereof is intended a polypeptide that is not in its natural milieu. No particular level of purification is required. For example, an isolated polypeptide can be removed from its native or natural environment. Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposed of the invention, as are native or recombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique.

    [0084] As used herein, the term variant refers to a polypeptide differing from a specifically recited polypeptide of the invention, such as DHAD, by amino acid insertions, deletions, mutations, and substitutions, created using, e.g., recombinant DNA techniques, such as mutagenesis. Guidance in determining which amino acid residues may be replaced, added, or deleted without abolishing activities of interest, may be found by comparing the sequence of the particular polypeptide with that of homologous polypeptides, e.g., yeast or bacterial, and minimizing the number of amino acid sequence changes made in regions of high homology (conserved regions) or by replacing amino acids with consensus sequences.

    [0085] Alternatively, recombinant polynucleotide variants encoding these same or similar polypeptides may be synthesized or selected by making use of the redundancy in the genetic code. Various codon substitutions, such as silent changes which produce various restriction sites, may be introduced to optimize cloning into a plasmid or viral vector for expression. Mutations in the polynucleotide sequence may be reflected in the polypeptide or domains of other peptides added to the polypeptide to modify the properties of any part of the polypeptide. For example, mutations can be used to reduce or eliminate expression of a target protein and include, but are not limited to, deletion of the entire gene or a portion of the gene, inserting a DNA fragment into the gene (in either the promoter or coding region) so that the protein is not expressed or expressed at lower levels, introducing a mutation into the coding region which adds a stop codon or frame shift such that a functional protein is not expressed, and introducing one or more mutations into the coding region to alter amino acids so that a non-functional or a less enzymatically active protein is expressed.

    [0086] Amino acid substitutions may be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements, or they may be the result of replacing one amino acid with an amino acid having different structural and/or chemical properties, i.e., non-conservative amino acid replacements. Conservative amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Alternatively, non-conservative amino acid substitutions may be made by selecting the differences in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of any of these amino acids. Insertions or deletions may be within the range of variation as structurally or functionally tolerated by the recombinant proteins. The variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant variants for activity.

    [0087] A substantial portion of an amino acid or nucleotide sequence is that portion comprising enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to putatively identify that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer-automated sequence comparison and identification using algorithms such as BLAST (Altschul, S. F., et al., J. Mol. Biol., 215:403-410 (1993)). In general, a sequence of ten or more contiguous amino acids or thirty or more nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene. Moreover, with respect to nucleotide sequences, gene specific oligonucleotide probes comprising 20-30 contiguous nucleotides may be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques). In addition, short oligonucleotides of 12-15 bases may be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers. Accordingly, a substantial portion of a nucleotide sequence comprises enough of the sequence to specifically identify and/or isolate a nucleic acid fragment comprising the sequence. The instant specification teaches the complete amino acid and nucleotide sequence encoding particular proteins. The skilled artisan, having the benefit of the sequences as reported herein, may now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art. Accordingly, the instant invention comprises the complete sequences as reported in the accompanying Sequence Listing, as well as substantial portions of those sequences as defined above.

    [0088] The term complementary is used to describe the relationship between nucleotide bases that are capable of hybridizing to one another. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine, and with respect to RNA, adenine is complementary to uracil and cytosine is complementary to guanine.

    [0089] The term percent identity, as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. Identity and similarity can be readily calculated by known methods, including but not limited to those described in: 1.) Computational Molecular Biology (Lesk, A. M., Ed.) Oxford University: NY (1988); 2.) Biocomputing: Informatics and Genome Projects (Smith, D. W., Ed.) Academic: NY (1993); 3.) Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., Eds.) Humania: NJ (1994); 4.) Sequence Analysis in Molecular Biology (von Heinje, G., Ed.) Academic (1987); and 5.) Sequence Analysis Primer (Gribskov, M. and Devereux, J., Eds.) Stockton: NY (1991).

    [0090] Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the MegAlign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignments of the sequences is performed using the Clustal method of alignment which encompasses several varieties of the algorithm including the Clustal V method of alignment corresponding to the alignment method labeled Clustal V (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci., 8:189-191 (1992)) and found in the MegAlign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc.). For multiple alignments, the default values correspond to GAP PENALTY=10 and GAP LENGTH PENALTY=10. Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences using the Clustal V program, it is possible to obtain a percent identity by viewing the sequence distances table in the same program. Additionally the Clustal W method of alignment is available and corresponds to the alignment method labeled Clustal W (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8:189-191(1992)) and found in the MegAlign v6.1 program of the LASERGENE bioinformatics computing suite (DNASTAR Inc.). Default parameters for multiple alignment (GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergen Seqs(%)=30, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB). After alignment of the sequences using the Clustal W program, it is possible to obtain a percent identity by viewing the sequence distances table in the same program.

    [0091] It is well understood by one skilled in the art that many levels of sequence identity are useful in identifying polypeptides, from other species, wherein such polypeptides have the same or similar function or activity, or in describing the corresponding polynucleotides. Useful examples of percent identities include, but are not limited to: 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 55% to 100% may be useful in describing the present invention, such as 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Suitable polynucleotide fragments not only have the above homologies but typically comprise a polynucleotide having at least 50 nucleotides, at least 100 nucleotides, at least 150 nucleotides, at least 200 nucleotides, or at least 250 nucleotides. Further, suitable polynucleotide fragments having the above homologies encode a polypeptide having at least 50 amino acids, at least 100 amino acids, at least 150 amino acids, at least 200 amino acids, or at least 250 amino acids.

    [0092] The term sequence analysis software refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. Sequence analysis software may be commercially available or independently developed. Typical sequence analysis software will include, but is not limited to: 1.) the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.); 2.) BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol., 215:403-410 (1990)); 3.) DNASTAR (DNASTAR, Inc. Madison, Wis.); 4.) SEQUENCHER (Gene Codes Corporation, Ann Arbor, Mich.); and 5.) the FASTA program incorporating the Smith-Waterman algorithm (W. R. Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Plenum: New York, N.Y.). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the default values of the program referenced, unless otherwise specified. As used herein default values will mean any set of values or parameters that originally load with the software when first initialized.

    [0093] Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) (hereinafter Maniatis); and by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987).

    [0094] The Functions of FeS Cluster-Requiring Proteins

    [0095] The functions of proteins that contain FeS clusters are diverse. One of the more complete efforts to classify these functions is given in the following table which is adapted from Johnson, D. C., et al., Structure, function, and formation of biological iron-sulfur clusters. Annu. Rev. Biochem., 2005. 74: p. 247-281.

    TABLE-US-00003 TABLE 3 Functions of Biological [FeS] clusters.sup.a. Function Examples Cluster type Electron transfer Ferredoxins; redox [2Fe2S]; [3Fe4S]; [4Fe4S] enzymes Coupled electron/proton Rieske protein [2Fe2S] transfer Nitrogenase [8Fe7S] Substrate binding and (de)Hydratases [4Fe4S], [2Fe2S] activation Radical SAM enzymes [4Fe4S] Acetyl-CoA synthase NiNi[4Fe4S], [Ni4Fe5S] Sulfite reductase [4Fe4S]-siroheme Fe or cluster storage Ferredoxins [4Fe4S] Polyferredoxins [4Fe4S] Structural Endonuclease III [4Fe4S] MutY [4Fe4S] Regulation of gene SoxR [2Fe2S] expression FNR [4Fe4S]/[2Fe2S] IRP [4Fe4S] IscR [2Fe2S] Regulation of enzyme Glutamine PRPP [4Fe4S] activity amidotransferase Ferrochelatase [2Fe2S] Disulfide reduction Ferredoxin:thioredoxin [4Fe4S] reductase Heterodisulfide [4Fe4S] reductase Sulfur donor Biotin synthase [2Fe2S] .sup.aAbbreviations used are SAM, S-adenosylmethionine; acetyl-CoA, acetyl coenzymeA; FNR, fumarate and nitrate reduction; IRP, iron-regulatory protein; IscR, iron-sulfur cluster assembly regulatory protein; PRPP, phosphoribosylpyrophosphate.

    [0096] It is believed that an increase in the supply and the efficiency of loading FeS clusters into one or more of the members of the above classes will have commercial and/or medical benefits. Of the many possibilities that will be appreciated by the skilled artisan, three examples are given. 1) When an FeS cluster containing enzyme is used in a pathway to a fermentation product and needs to be expressed at high levels to maintain a high flux in the pathway to the product (e.g., dihydroxy-acid dehydratase in the pathway to isobutanol). 2) When an FeS cluster containing enzyme is used in a pathway to a fermentation product and the FeS cluster undergoes turnover during the catalysis (e.g., biotin synthase in the commercial fermentation of glucose to biotin). 3) In a diseased state such that the normal concentration of an FeS cluster containing protein important for good health is low (e.g., in cases of Friedreich's ataxia).

    [0097] DHAD and DHAD Assays

    [0098] DHAD is an FeS cluster requiring protein of the dehydratase (more properly hydro-lyase) class. A gene encoding a DHAD enzyme can be used to provide expression of DHAD activity in a recombinant host cell. DHAD catalyzes the conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate and of 2,3-dihydroxymethylvalerate to -ketomethylvalerate and is classified as E.C. 4.2.1.9. Coding sequences for DHADs that are suitable for use in a recombinant host cell can be derived from bacterial, fungal, or plant sources. DHADs that may be used may have a [4Fe-4S] cluster or a [2Fe-2S]. Tables 4a, 4b, 5, and 6 list SEQ ID NOs for coding regions and proteins of representative DHADs that may be used in the present invention. Proteins with at least about 95% identity to certain listed sequences have been omitted for simplification, but it is understood that proteins, including those omitted for simplification, with at least about 95% sequence identity to any of the proteins listed in Tables 4a, 4b, 5, and 6 and having DHAD activity may be used as disclosed herein. Additional DHAD proteins and their encoding sequences may be identified by BLAST searching of public databases, as well known to one skilled in the art. Typically BLAST (described above) searching of publicly available databases with known DHAD sequences, such as those provided herein, is used to identify DHADs and their encoding sequences that may be expressed in the present cells. For example, DHAD proteins having amino acid sequence identities of at least about 80-85%, at least about 85-90%, at least about 90-95%, or at least about 98% sequence identity to any of the DHAD proteins of Table 3 may be expressed in the present cells. Identities are based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix.

    TABLE-US-00004 TABLE 4a SEQ ID NOs of Representative Bacterial [2Fe2S] DHAD Proteins and Encoding Sequences. SEQ ID NO: SEQ Nucleic ID NO: Organism of derivation acid Peptide Mycobacterium sp. MCS 1 2 Mycobacterium gilvum PYR-GCK 3 4 Mycobacterium smegmatis str. MC2 155 5 6 Mycobacterium vanbaalenii PYR-1 7 8 Nocardia farcinica IFM 10152 9 10 Rhodococcus sp. RHA1 11 12 Mycobacterium ulcerans Agy99 13 14 Mycobacterium avium subsp. paratuberculosis K-10 15 16 Mycobacterium tuberculosis H37Ra 17 18 Mycobacterium leprae TN * 19 20 Kineococcus radiotolerans SRS30216 21 22 Janibacter sp. HTCC2649 23 24 Nocardioides sp. JS614 25 26 Renibacterium salmoninarum ATCC 33209 27 28 Arthrobacter aurescens TC1 29 30 Leifsonia xyli subsp. xyli str. CTCB07 31 32 marine actinobacterium PHSC20C1 33 34 Clavibacter michiganensis subsp. michiganensis 35 36 NCPPB 382 Saccharopolyspora erythraea NRRL 2338 37 38 Acidothermus cellulolyticus 11B 39 40 Corynebacterium efficiens YS-314 41 42 Brevibacterium linens BL2 43 44 Tropheryma whipplei TW08/27 45 46 Methylobacterium extorquens PA1 47 48 Methylobacterium nodulans ORS 2060 49 50 Rhodopseudomonas palustris BisB5 51 52 Rhodopseudomonas palustris BisB18 53 54 Bradyrhizobium sp. ORS278 55 56 Bradyrhizobium japonicum USDA 110 57 58 Fulvimarina pelagi HTCC2506 59 60 Aurantimonas sp. SI85-9A1 61 62 Hoeflea phototrophica DFL-43 63 64 Mesorhizobium loti MAFF303099 65 66 Mesorhizobium sp. BNC1 67 68 Parvibaculum lavamentivorans DS-1 69 70 Loktanella vestfoldensis SKA53 71 72 Roseobacter sp. CCS2 73 74 Dinoroseobacter shibae DFL 12 75 76 Roseovarius nubinhibens ISM 77 78 Sagittula stellata E-37 79 80 Roseobacter sp. AzwK-3b 81 82 Roseovarius sp. TM1035 83 84 Oceanicola batsensis HTCC2597 85 86 Oceanicola granulosus HTCC2516 87 88 Rhodobacterales bacterium HTCC2150 89 90 Paracoccus denitrificans PD1222 91 92 Oceanibulbus indolifex HEL-45 93 94 Sulfitobacter sp. EE-36 95 96 Roseobacter denitrificans OCh 114 97 98 Jannaschia sp. CCS1 99 100 Caulobacter sp. K31 101 102 Candidatus Pelagibacter ubique HTCC1062 103 104 Erythrobacter litoralis HTCC2594 105 106 Erythrobacter sp. NAP1 107 108 Comamonas testosterone KF-1 109 110 Sphingomonas wittichii RW1 111 112 Burkholderia xenovorans LB400 113 114 Burkholderia phytofirmans PsJN 115 116 Bordetella petrii DSM 12804 117 118 Bordetella bronchiseptica RB50 119 120 Bradyrhizobium sp. ORS278 121 122 Bradyrhizobium sp. BTAi1 123 124 Bradhyrhizobium japonicum 125 126 Sphingomonas wittichii RW1 127 128 Rhodobacterales bacterium HTCC2654 129 130 Solibacter usitatus Ellin6076 131 132 Roseiflexus sp. RS-1 133 134 Rubrobacter xylanophilus DSM 9941 135 136 Salinispora tropica CNB-440 137 138 Acidobacteria bacterium Ellin345 139 140 Thermus thermophilus HB27 141 142 Maricaulis maris MCS10 143 144 Parvularcula bermudensis HTCC2503 145 146 Oceanicaulis alexandrii HTCC2633 147 148 Plesiocystis pacifica SIR-1 149 150 Bacillus sp. NRRL B-14911 151 152 Oceanobacillus iheyensis HTE831 153 154 Staphylococcus saprophyticus subsp. saprophyticus 155 156 ATCC 15305 Bacillus selenitireducens MLS10 157 158 Streptococcus pneumoniae SP6-BS73 159 160 Streptococcus sanguinis SK36 161 162 Streptococcus thermophilus LMG 18311 163 164 Streptococcus suis 89/1591 165 166 Streptococcus mutans UA159 167 168 Leptospira borgpetersenii serovar Hardjo-bovis L550 169 170 Candidatus Vesicomyosocius okutanii HA 171 172 Candidatus Ruthia magnifica str. Cm (Calyptogena 173 174 magnifica) Methylococcus capsulatus str. Bath 175 176 uncultured marine bacterium EB80_02D08 177 178 uncultured marine gamma proteobacterium 179 180 EBAC31A08 uncultured marine gamma proteobacterium 181 182 EBAC20E09 uncultured gamma proteobacterium eBACHOT4E07 183 184 Alcanivorax borkumensis SK2 185 186 Chromohalobacter salexigens DSM 3043 187 188 Marinobacter algicola DG893 189 190 Marinobacter aquaeolei VT8 191 192 Marinobacter sp. ELB17 193 194 Pseudoalteromonas haloplanktis TAC125 195 196 Acinetobacter sp. ADP1 197 198 Opitutaceae bacterium TAV2 199 200 Flavobacterium sp. MED217 201 202 Cellulophaga sp. MED134 203 204 Kordia algicida OT-1 205 206 Flavobacteriales bacterium ALC-1 207 208 Psychroflexus torquis ATCC 700755 209 210 Flavobacteriales bacterium HTCC2170 211 212 unidentified eubacterium SCB49 213 214 Gramella forsetii KT0803 215 216 Robiginitalea biformata HTCC2501 217 218 Tenacibaculum sp. MED152 219 220 Polaribacter irgensii 23-P 221 222 Pedobacter sp. BAL39 223 224 Flavobacteria bacterium BAL38 225 226 Flavobacterium psychrophilum JIP02/86 227 228 Flavobacterium johnsoniae UW101 229 230 Lactococcus lactis subsp. cremoris SK11 231 232 Psychromonas ingrahamii 37 233 234 Microscilla marina ATCC 23134 235 236 Cytophaga hutchinsonii ATCC 33406 237 238 Rhodopirellula baltica SH 1 239 240 Blastopirellula marina DSM 3645 241 242 Planctomyces maris DSM 8797 243 244 Algoriphagus sp. PR1 245 246 Candidatus Sulcia muelleri str. Hc (Homalodisca 247 248 coagulata) Candidatus Carsonella ruddii PV 249 250 Synechococcus sp. RS9916 251 252 Synechococcus sp. WH 7803 253 254 Synechococcus sp. CC9311 255 256 Synechococcus sp. CC9605 257 258 Synechococcus sp. WH 8102 259 260 Synechococcus sp. BL107 261 262 Synechococcus sp. RCC307 263 264 Synechococcus sp. RS9917 265 266 Synechococcus sp. WH 5701 267 268 Prochlorococcus marinus str. MIT 9313 269 270 Prochlorococcus marinus str. NATL2A 271 272 Prochlorococcus marinus str. MIT 9215 273 274 Prochlorococcus marinus str. AS9601 275 276 Prochlorococcus marinus str. MIT 9515 277 278 Prochlorococcus marinus subsp. pastoris str. 279 280 CCMP1986 Prochlorococcus marinus str. MIT 9211 281 282 Prochlorococcus marinus subsp. marinus str. 283 284 CCMP1375 Nodularia spumigena CCY9414 285 286 Nostoc punctiforme PCC 73102 287 288 Nostoc sp. PCC 7120 289 290 Trichodesmium erythraeum IMS101 291 292 Acaryochloris marina MBIC11017 293 294 Lyngbya sp. PCC 8106 295 296 Synechocystis sp. PCC 6803 297 298 Cyanothece sp. CCY0110 299 300 Thermosynechococcus elongatus BP-1 301 302 Synechococcus sp. JA-2-3Ba(2-13) 303 304 Gloeobacter violaceus PCC 7421 305 306 Nitrosomonas eutropha C91 307 308 Nitrosomonas europaea ATCC 19718 309 310 Nitrosospira multiformis ATCC 25196 311 312 Chloroflexus aggregans DSM 9485 313 314 Leptospirillum sp. Group II UBA 315 316 Leptospirillum sp. Group II UBA 317 318 Halorhodospira halophila SL1 319 320 Nitrococcus mobilis Nb-231 321 322 Alkalilimnicola ehrlichei MLHE-1 323 324 Deinococcus geothermalis DSM 11300 325 326 Polynucleobacter sp. QLW-P1DMWA-1 327 328 Polynucleobacter necessarius STIR1 329 330 Azoarcus sp. EbN1 331 332 Burkholderia phymatum STM815 333 334 Burkholderia xenovorans LB400 335 336 Burkholderia multivorans ATCC 17616 337 338 Burkholderia cenocepacia PC184 339 340 Burkholderia mallei GB8 horse 4 341 342 Ralstonia eutropha JMP134 343 344 Ralstonia metallidurans CH34 345 346 Ralstonia solanacearum UW551 347 348 Ralstonia pickettii 12J 349 350 Limnobacter sp. MED105 351 352 Herminiimonas arsenicoxydans 353 354 Bordetella parapertussis 355 356 Bordetella petrii DSM 12804 357 358 Polaromonas sp. JS666 359 360 Polaromonas naphthalenivorans CJ2 361 362 Rhodoferax ferrireducens T118 363 364 Verminephrobacter eiseniae EF01-2 365 366 Acidovorax sp. JS42 367 368 Delftia acidovorans SPH-1 369 370 Methylibium petroleiphilum PM1 371 372 gamma proteobacterium KT 71 373 374 Tremblaya princes 375 376 Blastopirellula marina DSM 3645 377 378 Planctomyces maris DSM 8797 379 380 Microcystis aeruginosa PCC 7806 381 382 Salinibacter ruber DSM 13855 383 384 Methylobacterium chloromethanicum 385 386

    TABLE-US-00005 TABLE 4B Additional representative bacterial [2Fe2S] DHAD proteins and encoding sequences. Nucleic acid Amino acid Organism of derivation SEQ ID NO: SEQ ID NO: Burkholderia ambifaria AMMD 387 388 Bradyrhizobium sp. BTAi1 389 390 Delftia acidovorans SPH-1 391 392 Microcystis aeruginosa NIES-843 393 394 uncultured marine microorganism 395 396 HF4000_APKG8C21 Burkholderia ubonensis Bu 397 398 Gemmata obscuriglobus UQM 2246 399 400 Mycobacterium abscessus 401 402 Synechococcus sp. PCC 7002 403 404 Burkholderia graminis C4D1M 405 406 Methylobacterium radiotolerans JCM 2831 407 408 Leptothrix cholodnii SP-6 409 410 Verrucomicrobium spinosum DSM 4136 411 412 Cyanothece sp. ATCC 51142 413 414 Opitutus terrae PB90-1 415 416 Leptospira biflexa serovar Patoc strain 417 418 Patoc 1 (Paris) Methylacidiphilum infernorum V4 419 420 Cupriavidus taiwanensis 421 422 Chthoniobacter flavus Ellin428 423 424 Cyanothece sp. PCC 7822 425 426 Phenylobacterium zucineum HLK1 427 428 Leptospirillum sp. Group II 5-way CG 429 430 Arthrospira maxima CS-328 431 432 Oligotropha carboxidovorans OM5 433 434 Rhodospirillum centenum SW 435 436 Cyanothece sp. PCC 8801 437 438 Thermus aquaticus Y51MC23 439 440 Cyanothece sp. PCC 7424 441 442 Acidithiobacillus ferrooxidans ATCC 23270 443 444 Cyanothece sp. PCC 7425 445 446 Arthrobacter chlorophenolicus A6 447 448 Burkholderia multivorans CGD2M 449 450 Thermomicrobium roseum DSM 5159 451 452 bacterium Ellin514 453 454 Desulfobacterium autotrophicum HRM2 455 456 Thioalkalivibrio sp. K90mix 457 458 Flavobacteria bacterium MS024-3C 459 460 Flavobacteria bacterium MS024-2A 461 462 Nostoc azollae 0708 463 464 Acidobacterium capsulatum ATCC 51196 465 466 Gemmatimonas aurantiaca T-27 467 468 Gemmatimonas aurantiaca T-27 469 470 Rhodococcus erythropolis PR4 471 472 Deinococcus deserti VCD115 473 474 Rhodococcus opacus B4 475 476 Chryseobacterium gleum ATCC 35910 477 478 Thermobaculum terrenum ATCC BAA-798 479 480 Kribbella flavida DSM 17836 481 482 Gordonia bronchialis DSM 43247 483 484 Geodermatophilus obscurus DSM 43160 485 486 Xylanimonas cellulosilytica DSM 15894 487 488 Sphingobacterium spiritivorum ATCC 33300 489 490 Meiothermus silvanus DSM 9946 491 492 Meiothermus ruber DSM 1279 493 494 Nakamurella multipartita DSM 44233 495 496 Cellulomonas flavigena DSM 20109 497 498 Rhodothermus marinus DSM 4252 499 500 Planctomyces limnophilus DSM 3776 501 502 Beutenbergia cavernae DSM 12333 503 504 Spirosoma linguale DSM 74 505 506 Sphaerobacter thermophilus DSM 20745 507 508 Lactococcus lactis 509 510 Thermus thermophilus HB8 511 512 Anabaena variabilis ATCC 29413 513 514 Roseovarius sp. 217 515 516 uncultured Prochlorococcus marinus 517 518 clone HF10-88D1 Burkholderia xenovorans LB400 519 520 Saccharomonospora viridis DSM 43017 521 522 Pedobacter heparinus DSM 2366 523 524 Microcoleus chthonoplastes PCC 7420 525 526 Acidimicrobium ferrooxidans DSM 10331 527 528 Rhodobacterales bacterium HTCC2083 529 530 Candidatus Pelagibacter sp. HTCC7211 531 532 Chitinophaga pinensis DSM 2588 533 534 Alcanivorax sp. DG881 535 536 Micrococcus luteus NCTC 2665 537 538 Verrucomicrobiae bacterium DG1235 539 540 Synechococcus sp. PCC 7335 541 542 Brevundimonas sp. BAL3 543 544 Dyadobacter fermentans DSM 18053 545 546 gamma proteobacterium NOR5-3 547 548 gamma proteobacterium NOR51-B 549 550 Cyanobium sp. PCC 7001 551 552 Jonesia denitrificans DSM 20603 553 554 Brachybacterium faecium DSM 4810 555 556 Paenibacillus sp. JDR-2 557 558 Octadecabacter antarcticus 307 559 560 Variovorax paradoxus S110 561 562

    TABLE-US-00006 TABLE 5 SEQ ID NOs of Representative Fungal and Plant [2Fe2S] DHAD Proteins and Encoding Sequences. SEQ ID NO: SEQ ID NO: Description Nucleic acid Peptide Schizosaccharomyces pombe ILV3 563 564 Saccharomyces cerevisiae ILV3 565 566 Kluyveromyces lactis ILV3 567 568 Candida albicans SC5314 ILV3 569 570 Pichia stipitis CBS 6054 ILV3 571 572 Yarrowia lipolytica ILV3 573 574 Candida galbrata CBS 138 ILV3 575 576 Chlamydomonas reinhardtii 577 578 Ostreococcus lucimarinus CCE9901 579 580 Vitis vinifera 581 582 (Unnamed protein product: CAO71581.1) Vitis vinifera 583 584 (Hypothetical protein: CAN67446.1) Arabidopsis thaliana 585 586 Oryza sativa (indica cultivar-group) 587 588 Physcomitrella patens subsp. Patens 589 590 Chaetomium globosum CBS 148.51 591 592 Neurospora crassa OR74A 593 594 Magnaporthe grisea 70-15 595 596 Gibberella zeae PH-1 597 598 Aspergillus niger 599 600 Neosartorya fischeri NRRL 181 601 602 (XP_001266525.1) Neosartorya fischeri NRRL 181 603 604 (XP_001262996.1) Aspergillus niger 605 606 (hypothetical protein An03g04520) Aspergillus niger 607 608 (Hypothetical protein An14g03280) Aspergillus terreus NIH2624 609 610 Aspergillus clavatus NRRL 1 611 612 Aspergillus nidulans FGSC A4 613 614 Aspergillus oryzae 615 616 Ajellomyces capsulatus NAm1 617 618 Coccidioides immitis RS 619 620 Botryotinia fuckeliana B05.10 621 622 Phaeosphaeria nodorum SN15 623 624 Pichia guilliermondii ATCC 6260 625 626 Debaryomyces hansenii CBS767 627 628 Lodderomyces elongisporus NRRL YB-4239 629 630 Vanderwaltozyma polyspora DSM 70294 631 632 Ashbya gossypii ATCC 10895 633 634 Laccaria bicolor S238N-H82 635 636 Coprinopsis cinerea okayama 7#130 637 638 Cryptococcus neoformans var. 639 640 neoformans JEC21 Ustilago maydis 521 641 642 Malassezia globosa CBS 7966 643 644 Aspergillus clavatus NRRL 1 645 646 Neosartorya fischeri NRRL 181 647 648 (Putative) Aspergillus oryzae 649 650 Aspergillus niger (hypothetical 651 652 protein An18g04160) Aspergillus terreus NIH2624 653 654 Coccidioides immitis RS (hypothetical 655 656 protein CIMG_04591) Paracoccidioides brasiliensis 657 658 Phaeosphaeria nodorum SN15 659 660 Gibberella zeae PH-1 661 662 Neurospora crassa OR74A 663 664 Coprinopsis cinerea okayama 7#130 665 666 Laccaria bicolor S238N-H82 667 668 Ustilago maydis 521 669 670

    TABLE-US-00007 TABLE 6 SEQ ID NOs of Representative [4Fe4S] DHAD Proteins and Encoding Sequences. SEQ ID NO: SEQ ID NO: Organism Nucleic acid Peptide Escherichia coli str. K-12 substr. MG1655 671 672 Bacillus subtilis subsp. subtilis str. 168 673 674 Agrobacterium tumefaciens str. C58 675 676 Burkholderia cenocepacia MC0-3 677 678 Psychrobacter cryohalolentis K5 679 680 Psychromonas sp. CNPT3 681 682 Deinococcus radiodurans R1 683 684 Wolinella succinogenes DSM 1740 685 686 Zymomonas mobilis subsp. mobilis ZM4 687 688 Clostridium acetobutylicum ATCC 824 689 690 Clostridium beijerinckii NCIMB 8052 691 692 Pseudomonas fluorescens Pf-5 693 694 Methanococcus maripaludis C7 695 696 Methanococcus aeolicus Nankai-3 697 698 Vibrio fischeri ATCC 700601 (ES114) 699 700 Shewanella oneidensis MR-1 ATCC 700550 701 702

    [0099] Additional [2Fe-2S] DHADs may be identified using the analysis described in U.S. patent application Ser. No. 12/569,636, filed Sep. 29, 2009, which is herein incorporated by reference. The analysis is as follows: A Profile Hidden Markov Model (HMM) was prepared based on amino acid sequences of eight functionally verified DHADs. The application of Profile HMM has been described. See, e.g., Krogh et al., J. Mol. Biol. 235:1501-1531 (1994) and Durbin et al., Markov chains and hidden Markov models, in Biological Sequence Analysis: Probabilistic Models of Proteins and Nucleic Acids, Cambridge University Press (1998). A Profile HMM is a statistical model built of multiple sequence alignments that can be used to determine whether or not a test sequence belongs to a particular family of sequences. See id. A Profile HMM can be built by first generating an alignment of functionally verified sequences using conventional sequence alignment tools. Next, the sequence alignment is used to build the Profile HMM using publicly available software programs (e.g., HMMER) that use a position-specific scoring system to capture information about the degree of conservation at various amino acid positions in the multiple alignment of the input sequences. More specifically, the scores of amino acid residues in a match state (i.e., match state emission scores), or in an insert state (i.e., insert state emission scores) are captured which are proportional to the expression: Log_2 (p_x)/(null_x). See id. In this expression, the term p_x is the probability of an amino acid residue, at a particular position in the alignment, according to the Profile HMM, and the term null_x is the probability according to the Null model. See id. The Null model is a simple one state probabilistic model with a pre-calculated set of emission probabilities for each of the amino acids derived from the distribution of amino acids. See id. State transition scores are also calculated as log odds parameters and are proportional to Log_2 (t_x). See id. In this expression, the term t_x is the probability of transiting to an emitter or non-emitter state. See id. Further details regarding the particular statistical analyses to generate a Profile HMM are available in Krogh et al., J. Mol. Biol. 235:1501-1531 (1994) and Durbin et al., Markov chains and hidden Markov models, in Biological Sequence Analysis: Probabilistic Models of Proteins and Nucleic Acids, Cambridge University Press (1998), and U.S. patent application Ser. No. 12/569,636.

    [0100] A Profile Hidden Markov Model (HMM) was prepared based on amino acid sequences of eight functionally verified DHADs are from Nitrosomonas europaea (DNA SEQ ID NO:309; protein SEQ ID NO:310), Synechocystis sp. PCC6803 (DNA SEQ ID:297; protein SEQ ID NO:298), Streptococcus mutans (DNA SEQ ID NO:167; protein SEQ ID NO:168), Streptococcus thermophilus (DNA SEQ ID NO:163; SEQ ID No:164), Ralstonia metallidurans (DNA SEQ ID NO:345; protein SEQ ID NO:346), Ralstonia eutropha (DNA SEQ ID NO:343; protein SEQ ID NO:344), and Lactococcus lactis (DNA SEQ ID NO:231; protein SEQ ID NO:232). In addition the DHAD from Flavobacterium johnsoniae (DNA SEQ ID NO:229; protein SEQ ID NO:230) was found to have dihydroxy-acid dehydratase activity when expressed in E. coli and was used in making the Profile. The Profile HMM is prepared using the HMMER software package (The theory behind profile HMMs is described in R. Durbin, S. Eddy, A. Krogh, and G. Mitchison, Biological sequence analysis: probabilistic models of proteins and nucleic acids, Cambridge University Press, 1998; Krogh et al., 1994; J. Mol. Biol. 235:1501-1531), following the user guide which is available from HMMER (Janelia Farm Research Campus, Ashburn, Va.). The output of the HMMER software program is a Profile Hidden Markov Model (HMM) that characterizes the input sequences. The Profile HMM prepared for the eight DHAD proteins is given in U.S. application Ser. No. 12/569,636, filed Sep. 29, 2009 and in Table 12.

    [0101] The first line in Table 12 for each position reports the probability for each amino acid to be in that state (match state emission scores). The second line reports the insert state emission scores, and the third line reports the state transition scores. The highest probability is highlighted for each position. These scores can be converted into E values (expectation values), which are the number of hits or matches to the Profile HMM one would expect to obtain just by chance. A protein having an E value of <10.sup.5 match to the Profile HMM, indicates that the protein shares significant sequence similarity with the seed proteins used to construct the Profile HMM and that the protein belongs to the family represented by the profile HMM.

    [0102] Any protein that matches the Profile HMM with an E value of <10.sup.5 is a DHAD related protein, which includes [4Fe-4S] DHADs, [2Fe-2S] DHADs, arabonate dehydratases, and phosphogluconate dehydratases. In embodiments, sequences matching the Profile HMM are then analyzed for the presence of the three conserved cysteines, corresponding to positions 56, 129, and 201 in the Streptococcus mutans DHAD. The presence of all three conserved cysteines is characteristic of proteins having a [2Fe-2S] cluster. Proteins having the three conserved cysteines include arabonate dehydratases and [2Fe-2S] DHADs. The [2Fe-2S] DHADs may be distinguished from the arabonate dehydratases by analyzing for signature conserved amino acids found to be present in the [2Fe-2S] DHADs or in the arabonate dehydratases at positions corresponding to the following positions in the Streptococcus mutans DHAD amino acid sequence. These signature amino acids are in [2Fe-2S] DHADs or in arabonate dehydratases, respectively, at the following positions (with greater than 90% occurrence): 88 asparagine vs. glutamic acid; 113 not conserved vs. glutamic acid; 142 arginine or asparagine vs. not conserved; 165 not conserved vs. glycine; 208 asparagine vs. not conserved; 454 leucine vs. not conserved; 477 phenylalanine or tyrosine vs. not conserved; and 487 glycine vs. not conserved.

    [0103] Additionally, the sequences of DHAD coding regions provided herein may be used to identify other homologs in nature. Such methods are well-known in the art, and various methods that may be used to isolate genes encoding homologous proteins are described in U.S. application Ser. No. 12/569,636, filed Sep. 29, 2009, which such methods are incorporated by reference herein.

    [0104] The presence of DHAD activity in a cell engineered to express a heterologous DHAD can be confirmed using methods known in the art. As one example, and as demonstrated in the Examples herein, crude extracts from cells engineered to express a bacterial DHAD may be used in a DHAD assay as described by Flint and Emptage (J. Biol. Chem. (1988) 263(8): 3558-64) using dinitrophenylhydrazine. In another example, DHAD activity may be assayed by expressing a heterologous DHAD identifiable by the methods disclosed herein in a yeast strain that lacks endogenous DHAD activity. If DHAD activity is present, the yeast strain will grow in the absence of branched-chain amino acids. DHAD activity may also be confirmed by more indirect methods, such as by assaying for a downstream product in a pathway requiring DHAD activity. Any product that has -ketoisovalerate or -ketomethylvalerate as a pathway intermediate may be measured in an assay for DHAD activity. A list of such products includes, but is not limited to, valine, isoleucine, leucine, pantothenic acid, 2-methyl-1-butanol, 3-methyl-1-butanol, and isobutanol.

    [0105] Over-Expression of DHAD Activity

    [0106] Applicants have found that expression of a heterologous DHAD can provide DHAD activity when expressed in a host cell. Expression of a DHAD which may be identified as described herein can provide DHAD activity for a biosynthetic pathway that includes conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate or 2,3-dihydroxymethylvalerate to -ketomethylvalerate. In addition, the S. mutans [2Fe-2S] DHAD was shown in related U.S. application Ser. No. 12/569,636, filed Sep. 29, 2009, incorporated by reference herein, to have higher stability in air as compared to the sensitivity in air of the E. coli [4Fe-4S] DHAD, which is desirable for obtaining better activity in a heterologous host cell.

    [0107] Furthermore, as described herein, it has been found that expressing a heterologous DHAD protein at higher levels can provide increased DHAD activity when expressed in a host cell. High expression of a recombinant polynucleotide can be accomplished in at least two ways: 1) by increasing the copy number of a plasmid comprising the recombinant polynucleotide; or 2) by integrating multiple copies of the gene of interest into the host cell's chromosome. As exemplified herein, expression of multiple copies of the heterologous DHAD, provides an increase in specific activity of heterologous DHAD

    [0108] Recombinant polynucleotides are typically cloned for expression using the coding sequence as part of a chimeric gene used for transformation, which includes a promoter operably linked to the coding sequence as well as a ribosome binding site and a termination control region. The coding region may be from the host cell for transformation and combined with regulatory sequences that are not native to the natural gene encoding DHAD. Alternatively, the coding region may be from another host cell.

    [0109] Vectors useful for the transformation of a variety of host cells are common and described in the literature. Typically the vector contains a selectable marker and sequences allowing autonomous replication or chromosomal integration in the desired host. In addition, suitable vectors may comprise a promoter region which harbors transcriptional initiation controls and a transcriptional termination control region, between which a coding region DNA fragment may be inserted, to provide expression of the inserted coding region. Both control regions may be derived from genes homologous to the transformed host cell, although it is to be understood that such control regions may also be derived from genes that are not native to the specific species chosen as a production host.

    [0110] Yeast cells that can be hosts for expression or over-expression of a heterologous bacterial DHAD are any yeast cells that are amenable to genetic manipulation and include, but are not limited to, Saccharomyces, Schizosaccharomyces, Hansenula, Candida, Kluyveromyces, Yarrowia, Issatchenkia, and Pichia. Suitable strains include, but are not limited to, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces thermotolerans, Candida glabrata, Candida albicans, Pichia stipitis and Yarrowia lipolytica. In one embodiment, the host is Saccharomyces cerevisiae.

    [0111] Expression is achieved by transforming a host cell with a gene comprising a sequence encoding DHAD, for example, a DHAD listed in Tables 4a, 4b, 5 or 6, or identified using the screening methods in related U.S. application Ser. No. 12/569,636, filed Sep. 29, 2009, incorporated by reference herein. The coding region for the DHAD to be expressed may be codon optimized for the target host cell, as well known to one skilled in the art. Methods for gene expression in yeast are known in the art (see, e.g., Methods in Enzymology, Volume 194, Guide to Yeast Genetics and Molecular and Cell Biology (Part A, 2004, Christine Guthrie and Gerald R. Fink (Eds.), Elsevier Academic Press, San Diego, Calif.). Expression of genes in yeast typically requires a promoter, operably linked to a coding region of interest, and a transcriptional terminator. A number of yeast promoters can be used in constructing expression cassettes for genes in yeast, including, but not limited to, promoters derived from the following genes: CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI, CUP1, FBA, GPD, GPM, and AOX1. Suitable transcriptional terminators include, but are not limited to, FBAt, GPDt, GPMt, ERG10t, GAL1t, CYC1, and ADH1.

    [0112] Suitable promoters, transcriptional terminators, and DHAD coding regions may be cloned into E. coli-yeast shuttle vectors, and transformed into yeast cells. These vectors allow strain propagation in both E. coli and yeast strains. In one embodiment, the vector used contains a selectable marker and sequences allowing autonomous replication or chromosomal integration in the desired host. Examples of plasmids used in yeast are shuttle vectors pRS423, pRS424, pRS425, and pRS426 (American Type Culture Collection, Manassas, Va.), which contain an E. coli replication origin (e.g., pMB1), a yeast 2-micron origin of replication, and a marker for nutritional selection. The selection markers for these four vectors are His3 (vector pRS423), Trp1 (vector pRS424), Leu2 (vector pRS425) and Ura3 (vector pRS426). Construction of expression vectors with a chimeric gene encoding the described DHADs can be performed by either standard molecular cloning techniques in E. coli or by the gap repair recombination method in yeast.

    [0113] The gap repair cloning approach takes advantage of the highly efficient homologous recombination in yeast. For example, a yeast vector DNA is digested (e.g., in its multiple cloning site) to create a gap in its sequence. A number of insert DNAs of interest are generated that contain a 21 bp sequence at both the 5 and the 3 ends that sequentially overlap with each other, and with the 5 and 3 terminus of the vector DNA. For example, to construct a yeast expression vector for Gene X, a yeast promoter and a yeast terminator are selected for the expression cassette. The promoter and terminator are amplified from the yeast genomic DNA, and Gene X is either PCR amplified from its source organism or obtained from a cloning vector comprising Gene X sequence. There is at least a 21 bp overlapping sequence between the 5 end of the linearized vector and the promoter sequence, between the promoter and Gene X, between Gene X and the terminator sequence, and between the terminator and the 3 end of the linearized vector. The gapped vector and the insert DNAs are then co-transformed into a yeast strain and plated on the medium containing the appropriate compound mixtures that allow complementation of the nutritional selection markers on the plasmids. The presence of correct insert combinations can be confirmed by PCR mapping using plasmid DNA prepared from the selected cells. The plasmid DNA isolated from yeast (usually low in concentration) can then be transformed into an E. coli strain, e.g. TOP10, followed by mini preps and restriction mapping to further verify the plasmid construct. Finally, the construct can be verified by sequence analysis.

    [0114] Like the gap repair technique, integration into the yeast genome also takes advantage of the homologous recombination system in yeast. For example, a cassette containing a coding region plus control elements (promoter and terminator) and auxotrophic marker is PCR-amplified with a high-fidelity DNA polymerase using primers that hybridize to the cassette and contain 40-70 base pairs of sequence homology to the regions 5 and 3 of the genomic area where insertion is desired. The PCR product is then transformed into yeast and plated on medium containing the appropriate compound mixtures that allow selection for the integrated auxotrophic marker. For example, to integrate Gene X into chromosomal location Y, the promoter-coding regionX-terminator construct is PCR amplified from a plasmid DNA construct and joined to an autotrophic marker (such as URA3) by either SOE PCR or by common restriction digests and cloning. The full cassette, containing the promoter-coding regionX-terminator-URA3 region, is PCR amplified with primer sequences that contain 40-70 bp of homology to the regions 5 and 3 of location Y on the yeast chromosome. The PCR product is transformed into yeast and selected on growth media lacking uracil. Transformants can be verified either by colony PCR or by direct sequencing of chromosomal DNA.

    [0115] In addition to the above materials and methods that may be used to express a heterologous DHAD, these same, or similar, materials and methods may be used to over-express a heterologous DHAD using modifications known to one of skill in the art. For example, when using a plasmid-based system to over-express the recombinant polynucleotide, a high-copy number vector, or a vector with a copy number that can be regulated, may be constructed. Such a regulatable or inducible system is described herein in Example 1; however, other systems are known to one of skill in the art and may be used to construct other high-copy number or copy number regulatable vectors. Alternatively, when using an integration-based system to over-express the recombinant polypeptide, an integration vector is required for targeting at multiple integration sites. A multiple integration-based system is described herein in Example 2; however, other multiple integration-based systems are known to one of skill in the art and may be used to target multiple integrations of a recombinant polypeptide, for example integration into rDNA regions.

    [0116] Expression of the heterologous DHAD in the recombinant host cell can be quantified, e.g., by a percent of total cell protein. Such over-expression can be quantified in an amount selected from the group consisting of: (a) greater than about 0.001% of total cell protein; (b) greater than about 0.01% of total cell protein; (c) greater than about 0.1% of total cell protein; (d) greater than about 0.5% of total cell protein; (e) greater than about 1.0% of total cell protein; (f) greater than about 2.0% of total cell protein; (g) greater than about 5% of total cell protein; (h) greater than about 10% of total cell protein; and (i) greater than about 20% of total cell protein.

    [0117] The specific activity of the heterologous DHAD produced in a recombinant host cell can be quantified, e.g., as U/mg. The heterologous DHAD specific activity can be selected from the group consisting of: (a) greater than about 0.25 U/mg; (b) greater than about 0.3 U/mg; (c) greater than about 0.5 U/mg; (d) greater than about 1.0 U/mg; (e) greater than about 1.5 U/mg; (f) greater than about 2.0 U/mg; (g) greater than about 3.0 U/mg; (h) greater than about 4.0 U/mg; (i) greater than about 5.0 U/mg; (j) greater than about 6.0 U/mg; (k) greater than about 7.0 U/mg; (l) greater than about 8.0 U/mg; (m) greater than about 9.0 U/mg; (n) greater than about 10.0 U/mg; (o) greater than about 20.0 U/mg; and (p) greater than about 50.0 U/mg.

    [0118] The heterologous DHAD specific activity can also be quantified, e.g., as a percent comparison to an endogenous DHAD specific activity or to some other control DHAD specific activity. An example of a control DHAD specific activity is that from a heterologous DHAD expressed in a recombinant host cell using a low copy number plasmid or a plasmid that is not otherwise inducible or regulatable. Such a control establishes a baseline from which to compare the specific activity of the same heterologous DHAD expressed in a recombinant host cell using a high copy number plasmid or a plasmid with copy number that can be regulated, or co-expressed with polynucleotides encoding polypeptides affecting FeS cluster biosynthesis or Fe uptake and utilization, as described below. Thus, the increase in specific activity of the heterologous DHAD when compared to the control DHAD specific activity can be in an amount selected from the group consisting of: greater than an about 10% increase; greater than an about 20% increase; greater than an about 30% increase; greater than an about 40% increase; greater than an about 50% increase; greater than an about 60% increase; greater than an about 70% increase; greater than an about 80% increase; greater than an about 90% increase; greater than an about 95% increase; greater than an about 98% increase; and greater than an about 99% increase. The heterologous DHAD specific activity can also be expressed by fold increase over control. Thus, the increase in specific activity can be selected from the group consisting of: (a) greater than about 2-fold higher, (b) greater than about 5-fold higher, (c) greater than about 8-fold higher, or (d) greater than about 10-fold higher than control.

    [0119] FeS Cluster Forming Proteins and Fe Regulation, Utilization, and Homeostasis

    [0120] As described above, DHAD enzymes require FeS clusters for functioning, therefore, they must be expressed in a host having the genetic machinery to produce and load FeS clusters into the apo-protein if they are going to be expressed in functional form. As described elsewhere herein, in normal yeast, the mitochondria play an important role in FeS cluster biosynthesis. The flux in the formation and movement of FeS cluster precursors from mitochondria to FeS cluster requiring proteins in the cytosol of normal yeast is believed to be limited. For example, after a point a further increase in the expression of the protein of heterologous DHADs in the cytosol does not result in a corresponding increase in DHAD activity. While not wishing to be bound by theory, it is believed that this is because the increased amounts of the heterologous DHAD are not getting loaded with the FeS cluster requisite for activity because the cell is not able to supply the increased demand for FeS clusters that arises in the conditions described above. Demonstrated herein is that yeast cells can be genetically modified in 2 ways (separately or contemporaneously) that will result in an increased fraction of the heterologous DHAD expressed in the cytosol being loaded with its requisite FeS cluster. One way is to modify the expression of yeast genes involved in the FeS cluster formation, such as FeS cluster biosynthesis pathway genes or Fe uptake and utilization genes. The other way is to express heterologous genes involved in FeS cluster biosynthesis or Fe uptake and utilization in the cytoplasm of yeast.

    [0121] Yeast genes that encode polypeptides that are involved in Fe uptake and utilization and FeS cluster biosynthesis are candidates for modification of expression. In embodiments, the modification results in increased function of a selected FeS cluster requiring protein.

    [0122] As an example, Aft1 has been found to act as a transcriptional activator for genes into the iron regulon (Kumanovics, et al. J. Biol. Chem., 2008. 283, p. 10276-10286; Li, H., et al., The Yeast Iron Regulatory Proteins Grx3/4 and Fra2 form Heterodimeric Complexes Containing a [2Fe-2S] Cluster with Cysteinyl and Histidyl Ligation. Biochemistry, 2009. 48(40): p. 9569-9581. As exemplified herein, the deletion of known inhibitors of Aft1 translocation, results in an increase in specific activity of an FeS cluster requiring protein because it leads to an increase FeS cluster loading of the protein. While not wishing to be bound by theory, it is thus believed that altering expression of certain genes of the Fe regulon, whether directly or through deletion or upregulation of inhibitors, will likewise increase the loading and function of FeS cluster requiring proteins. For example, genes that play a role in, or are part of, Fe utilization and homeostasis in yeast, such as Fe Regulon genes, may be targeted for altered expression. Such genes are known in the art, and examples of these genes are listed in Table 7. (The list in Table 7 is taken from Rutherford, J. C., et al., Activation of the Iron Regulon by the Yeast Aft1/Aft2 Transcription Factors Depends on Mitochondrial but Not Cytosolic Iron-Sulfur Protein Biogenesis., J. Biol. Chem., 2005. 280(11): p. 10135-10140; Foury, F. and D. Talibi, Mitochondrial control of iron homeostasis. A genome wide analysis of gene expression in a yeast frataxin-deficient strain. J. Biol. Chem., 2001. 276(11): p. 7762-7768; and Shakoury-Elizeh, M., et al., Transcriptional remodeling in response to iron deprivation in Saccharomyces cerevisiae. Mol. Biol. Cell, 2004. 15(3): p. 1233-1243.)

    TABLE-US-00008 TABLE 7 Examples of yeast genes associated with Fe uptake and utilization. Nucleic Amino Acid Acid Gene SEQ ID SEQ Name Putative Function NO: ID NO: ARN1 Transporter, member of the ARN family of transporters that 805 738 specifically recognize siderophore-iron chelates; responsible for uptake of iron bound to ferrirubin, ferrirhodin, and related siderophores ARN2 Transporter, member of the ARN family of transporters that 806 739 specifically recognize siderophore-iron chelates; responsible for uptake of iron bound to the siderophore triacetylfusarinine C ATX1 Cytosolic copper metallochaperone that transports copper to 802 735 the secretory vesicle copper transporter Ccc2p for eventual insertion into Fet3p, which is a multicopper oxidase required for high-affinity iron uptake CCC2 Cu(+2)-transporting P-type ATPase, required for export of 803 736 copper from the cytosol into an extracytosolic compartment; has similarity to human proteins involved in Menkes and Wilsons diseases COT1 Vacuolar transporter that mediates zinc transport into the 816 749 vacuole; overexpression confers resistance to cobalt and rhodium ENB1 Endosomal ferric enterobactin transporter, expressed under 808 741 (ARN4) conditions of iron deprivation; member of the major facilitator superfamily; expression is regulated by Rcs1p and affected by chloroquine treatment FET3 Ferro-O2-oxidoreductase required for high-affinity iron 800 733 uptake and involved in mediating resistance to copper ion toxicity, belongs to class of integral membrane multicopper oxidases FET5 Multicopper oxidase, integral membrane protein with 814 747 similarity to Fet3p; may have a role in iron transport FIT1 Mannoprotein that is incorporated into the cell wall via a 792 725 glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore-iron in the cell wall FIT2 Mannoprotein that is incorporated into the cell wall via a 793 726 glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore-iron in the cell wall FIT3 Mannoprotein that is incorporated into the cell wall via a 794 727 glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore-iron in the cell wall FRE1 Ferric reductase and cupric reductase, reduces siderophore- 795 728 bound iron and oxidized copper prior to uptake by transporters; expression induced by low copper and iron levels FRE2 Ferric reductase and cupric reductase, reduces siderophore- 796 729 bound iron and oxidized copper prior to uptake by transporters; expression induced by low copper and iron levels FRE3 Ferric reductase, reduces siderophore-bound iron prior to 797 730 uptake by transporters; expression induced by low iron levels FRE4 Ferric reductase, reduces a specific subset of siderophore- 798 731 bound iron prior to uptake by transporters; expression induced by low iron levels FRE5 Putative ferric reductase with similarity to Fre2p; expression 799 732 induced by low iron levels; the authentic, non-tagged protein is detected in highly purified mitochondria in high- throughput studies FRE6 Putative ferric reductase with similarity to Fre2p; expression 817 750 induced by low iron levels FTH1 Putative high affinity iron transporter involved in transport of 813 746 intravacuolar stores of iron; forms complex with Fet5p; expression is regulated by iron; proposed to play indirect role in endocytosis FTR1 High affinity iron permease involved in the transport of iron 801 734 across the plasma membrane; forms complex with Fet3p; expression is regulated by iron HMX1 ER localized, heme-binding peroxidase involved in the 823 756 degradation of heme; does not exhibit heme oxygenase activity despite similarity to heme oxygenases; expression regulated by AFT1 SIT1 Ferrioxamine B transporter, member of the ARN family of 807 740 (ARN3) transporters that specifically recognize siderophore-iron chelates; transcription is induced during iron deprivation and diauxic shift; potentially phosphorylated by Cdc28p SMF3 Putative divalent metal ion transporter involved in iron 815 741 homeostasis; transcriptionally regulated by metal ions; member of the Nramp family of metal transport proteins TIS11 mRNA-binding protein expressed during iron starvation; 824 757 (CTH2) binds to a sequence element in the 3-untranslated regions of specific mRNAs to mediate their degradation; involved in iron homeostasis VHT1 High-affinity plasma membrane H+-biotin (vitamin H) 822 755 symporter; mutation results in fatty acid auxotrophy; 12 transmembrane domain containing major facilitator subfamily member; mRNA levels negatively regulated by iron deprivation and biotin

    [0123] Based on their functions and association with Fe uptake and utilization, the proteins encoded by the genes disclosed in Table 7 are candidates for affecting FeS cluster biosynthesis. Additional yeast genes associated with Fe uptake and utilization or FeS cluster biosynthesis include those listed in Table 8.

    TABLE-US-00009 TABLE 8 Genes Associated With Yeast Fe Uptake and Utilization or FeS Cluster Biosynthesis Nucleic Amino Acid Acid Gene SEQ ID SEQ ID Name NO: NO: Putative Function AFT1 770 703 Transcription factor involved in iron utilization and homeostasis; binds the consensus site PyPuCACCCPu and activates the expression of target genes in response to changes in iron availability AFT2 771 704 Iron-regulated transcriptional activator; activates genes involved in intracellular iron use and required for iron homeostasis and resistance to oxidative stress; similar to Aft1p AIM1 779 712 Interacts with Grx3/4 ARH1 855 837 Oxidoreductase of the mitochondrial inner membrane, involved in cytoplasmic and mitochondrial iron homeostasis and required for activity of FeS cluster-containing enzymes; one of the few mitochondrial proteins essential for viability (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) ATM1 830 763 Mitochondrial inner membrane ATP-binding cassette (ABC) transporter, exports mitochondrially synthesized precursors of iron-sulfur (Fe/S) clusters to the cytosol (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) BUD32 778 711 Interacts with Grx3/4 and Aft1p CAD1 791 724 Stress responses including Fe deprivation; also regulates CTI6 and MRS4 (YAP2) genes CCC1 811 744 Putative vacuolar Fe2+/Mn2+ transporter; suppresses respiratory deficit of yfh1 mutants, which lack the ortholog of mammalian frataxin, by preventing mitochondrial iron accumulation CFD1 834 767 Highly conserved, iron-sulfur cluster binding protein localized in the cytoplasm; forms a complex with Nbp35p that is involved in iron-sulfur protein assembly in the cytosol (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) CIA1 836 769 WD40 repeat protein involved in assembly of cytosolic and nuclear iron- sulfur proteins; similar to the human Ciaol protein; YDR267C is an essential gene (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) CMK1 784 717 Interacts with Grx4p CTH1 825 758 mRNA binding and degradation under Fe depletion conditions CTI6 786 719 Growth in low iron conditions CYC8 787 720 General transcriptional co-repressor, acts together with Tup1p; also acts as (SSN6) part of a transcriptional co-activator complex that recruits the SWI/SNF and SAGA complexes to promoters; can form the prion [OCT+] DAP1 820 753 DRE2 781 714 Interacts with Grx3p ERV1 856 838 Flavin-linked sulfhydryl oxidase of the mitochondrial intermembrane space (IMS), oxidizes Mia40p as part of a disulfide relay system that promotes IMS retention of imported proteins; ortholog of human hepatopoietin (ALR) (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) Central players of the export pathway are the ABC transporter Atm1p of the mitochondrial inner membrane, the sulfhydryl oxidase Erv1p of the intermembrane space, and the tripeptide glutathione (23, 27, 50) (see Gerber, J., et al., Mol. Cell. Biol. 24(11): 4848-57 (2004)) ESA1 782 715 Interacts with Grx4p/Aft1p FET4 809 742 Low-affinity Fe(II) transporter of the plasma membrane FRA1 772 705 Protein involved in negative regulation of transcription of iron regulon; forms an iron independent complex with Fra2p, Grx3p, and Grx4p; cytosolic; mutant fails to repress transcription of iron regulon and is defective in spore formation FRA2 773 706 Protein involved in negative regulation of transcription of iron regulon; forms an iron independent complex with Fra2p, Grx3p, and Grx4p; null mutant fails to repress iron regulon and is sensitive to nickel GEF1 804 737 Copper transporter/loading for Fet3p GGC1 857 839 Mitochondrial GTP/GDP transporter, essential for mitochondrial genome (YHM1) maintenance; has a role in mitochondrial iron transport; member of the mitochondrial carrier family GRX1 858 840 Hydroperoxide and superoxide-radical responsive heat-stable glutathione- dependent disulfide oxidoreductase with active site cysteine pair; protects cells from oxidative damage GRX2 832 765 Cytoplasmic glutaredoxin, thioltransferase, glutathione-dependent disulfide oxidoreductase involved in maintaining redox state of target proteins, also exhibits glutathione peroxidase activity, expression induced in response to stress GRX3 774 707 Hydroperoxide and superoxide-radical responsive glutathione-dependent oxidoreductase; monothiol glutaredoxin subfamily member along with Grx4p and Grx5p; protects cells from oxidative damage GRX4 775 708 Hydroperoxide and superoxide-radical responsive glutathione-dependent oxidoreductase; monothiol glutaredoxin subfamily member along with Grx3p and Grx5p; protects cells from oxidative damage. GRX5 831 764 Hydroperoxide and superoxide-radical responsive glutathione-dependent oxidoreductase; mitochondrial matrix protein involved in the synthesis/assembly of iron-sulfur centers; monothiol glutaredoxin subfamily member along with Grx3p and Grx4p (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) HDA1 790 723 Interacts with Tup1p, Ssn6p for Aft1/2p regulation in the absence of heme IBA57 859 841 Mitochondrial matrix protein involved in the incorporation of iron-sulfur clusters into mitochondrial aconitase-type proteins; activates the radical-SAM family members Bio2p and Lip5p; interacts with Ccr4p in the two-hybrid system (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) ISA1 860 842 Mitochondrial matrix protein involved in biogenesis of the iron-sulfur (Fe/S) cluster of Fe/S proteins, isa1 deletion causes loss of mitochondrial DNA and respiratory deficiency; depletion reduces growth on nonfermentable carbon sources (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) ISA2 861 843 Protein required for maturation of mitochondrial and cytosolic Fe/S proteins, localizes to the mitochondrial intermembrane space, overexpression of ISA2 suppresses grx5 mutations (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) ISU1 828 761 Conserved protein of the mitochondrial matrix, performs a scaffolding function during assembly of iron-sulfur clusters, interacts physically and functionally with yeast frataxin (Yfh1p); isu1 isu2 double mutant is inviable (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) ISU2 829 762 Conserved protein of the mitochondrial matrix, required for synthesis of mitochondrial and cytosolic iron-sulfur proteins, performs a scaffolding function in mitochondria during Fe/S cluster assembly; isu1 isu2 double mutant is inviable (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) JAC1 862 844 Specialized J-protein that functions with Hsp70 in FeS cluster biogenesis in mitochondria, involved in iron utilization; contains a J domain typical to J- type chaperones; localizes to the mitochondrial matrix (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) MGE1 863 845 Mitochondrial matrix cochaperone, acts as a nucleotide release factor for Ssc1p in protein translocation and folding; also acts as cochaperone for Ssq1p in folding of FeS cluster proteins; homolog of E. coli GrpE (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) MRS3 819 752 Iron transporter that mediates Fe2+ transport across the inner mitochondrial membrane; mitochondrial carrier family member, similar to and functionally redundant with Mrs4p; active under low-iron conditions; may transport other cations (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) MRS4 818 751 Iron transporter that mediates Fe2+ transport across the inner mitochondrial membrane; mitochondrial carrier family member, similar to and functionally redundant with Mrs3p; active under low-iron conditions; may transport other cations (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) MSN5 776 709 Exporting Aft1p and other proteins from the nucleus NAR1 833 766 Component of the cytosolic iron-sulfur (FeS) protein assembly machinery, required for maturation of cytosolic and nuclear FeS proteins and for normal resistance to oxidative stress; homologous to human Narf (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) NBP35 835 768 Essential iron-sulfur cluster binding protein localized in the cytoplasm; forms a complex with Cfd1p that is involved in iron-sulfur protein assembly in the cytosol; similar to P-loop NTPases (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) NFS1 864 846 Cysteine desulfurase involved in iron-sulfur cluster (Fe/S) biogenesis; required for the post-transcriptional thio-modification of mitochondrial and cytoplasmic tRNAs; essential protein located predominantly in mitochondria (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) NFU1 865 847 Protein involved in iron utilization in mitochondria; similar to NifU, which is a protein required for the maturation of the Fe/S clusters of nitrogenase in nitrogen-fixing bacteria (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) NHP6a 788, 789 721, 722 Both are high-mobility group non-histone chromatin protein, functionally and b redundant with Nhp6Bp; homologous to mammalian high mobility group proteins 1 and 2; acts to recruit transcription factor Rcs1p to certain promoters PSE1 777 710 Importing Aft1p and other proteins to the nucleus SMF1 810 743 Low affinity Fe(II) transporter of the plasma membrane SNF1 866 848 AMP-activated serine/threonine protein kinase found in a complex containing Snf4p and members of the Sip1p/Sip2p/Gal83p family; required for transcription of glucose-repressed genes, thermotolerance, sporulation, and peroxisome biogenesis SNF2 867 849 Catalytic subunit of the SWI/SNF chromatin remodeling complex involved in transcriptional regulation; contains DNA-stimulated ATPase activity; functions interdependently in transcriptional activation with Snf5p and Snf6p SNF3 868 850 Plasma membrane glucose sensor that regulates glucose transport; has 12 predicted transmembrane segments; long cytoplasmic C-terminal tail is required for low glucose induction of hexose transporter genes HXT2 and HXT4 SNF4 869 851 Activating gamma subunit of the AMP-activated Snf1p kinase complex (contains Snf1p and a Sip1p/Sip2p/Gal83p family member); activates glucose-repressed genes, represses glucose-induced genes; role in sporulation, and peroxisome biogenesis SSQ1 827 760 Mitochondrial hsp70-type molecular chaperone, required for assembly of iron/sulfur clusters into proteins at a step after cluster synthesis, and for maturation of Yfh1p, which is a homolog of human frataxin implicated in Friedreich's ataxia (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) TIM12 871 853 Essential protein of the inner mitochondrial membrane, peripherally (MRS5) localized; component of the TIM22 complex, which is a twin-pore translocase that mediates insertion of numerous multispanning inner membrane protein. TUP1 785 718 General repressor of transcription NP_011911.1 821 754 VPS41 872 854 Vacuolar membrane protein that is a subunit of the homotypic vacuole fusion (FET2) and vacuole protein sorting (HOPS) complex; essential for membrane docking and fusion at the Golgi-to-endosome and endosome-to-vacuole stages of protein transport YAH1 870 852 Ferredoxin of the mitochondrial matrix required for formation of cellular iron-sulfur proteins; involved in heme A biosynthesis; homologous to human adrenodoxin (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) YAP5 812 745 Regulation (CCC1) YFH1 826 759 Mitochondrial matrix iron chaperone; oxidizes and stores iron; interacts with (Frataxin) Isu1p to promote FeS cluster assembly; mutation results in multiple Fe/S- dependent enzyme deficiencies; human frataxin homolog is mutated in Friedrich's ataxia (see, e.g., Lill, R. and U. Muehlenhoff, Ann. Rev. Biochem. 77: 669-700 (2008)) YRA1 783 716 Interacts with Grx4p ZPR1 780 713 Interacts with Aft1p

    [0124] Additional genes encoding polypeptides affecting FeS cluster biosynthesis from other host cells have been identified and include, but are not limited to, those genes listed in Table 9.

    TABLE-US-00010 TABLE 9 Genes Directly Involved in FeS Cluster Biosynthesis from Various Cells Gene Name SEQ ID NOs(Amino Acid, Nucleic Function Acid) (Accession; CDS) Azotobacter vinelandii nif genes (FIGS. 6A and 6B; see Johnson, D. C., et al., Ann. Rev. Biochem. 74: 247-81 (2005)) iscA.sup.nif [FeS] cluster scaffold protein (see Johnson, D. C., et al., Ann. Rev. (873, 894) Biochem. 74: 247-81 (2005)) (YP_002797399.1; nucleotides 153037 to 153360 of NC_012560.1) nifU NifU is a scaffold protein for assembly and transfer of iron-sulfur (875, 896) clusters (see Johnson, D. C., et al., Ann. Rev. Biochem. 74: 247-81 (2005)). (YP_002797400.1; nucleotides 153425 to 154363 of NC_012560.1) nifS Cysteine desulfurase involved in the mobilization of S for nitrogenase (874, 895) maturation (see Johnson, D. C., et al., Ann. Rev. Biochem. 74: 247-81 (2005)). (YP_002797401.1; nucleotides 154365 to 155573 of NC_012560.1) cysE1 Involved in cysteine biosynthesis (see Johnson, D. C., et al., Ann. Rev. (876, 897) Biochem. 74: 247-81 (2005)) (YP_002797403.1; nucleotides 156797 to 157594 of NC_012560.1) cysE2 Involved in cysteine biosynthesis (see Johnson, D. C., et al., Ann. Rev. (929, 947) Biochem. 74: 247-81 (2005)) (YP_002801153.1; reverse complement of nucleotides 4092159 to 4092938 of NC_012560.1) iscS Cysteine desulfurase involved in the mobilization of S (see Johnson, D. C., (930, 948) et al., Ann. Rev. Biochem. 74: 247-81 (2005)) (YP_002801151.1; reverse complement of nucleotides of 4090290 to 4091504 of NC_012560.1) iscU [FeS] cluster scaffold protein (see Johnson, D. C., et al., Ann. Rev. (931, 949) Biochem. 74: 247-81 (2005)) (YP_002801150.1; reverse complement of nucleotides 4089860 to 4090246 of NC_012560.1) iscA [FeS] cluster scaffold protein (see Johnson, D. C., et al., Ann. Rev. (932, 950) Biochem. 74: 247-81 (2005)) (YP_002801149.1; reverse complement of nucleotides 4089511 to 4089834 of NC_012560.1) hscB HscB heat shock cognate protein associated with Isc-directed [FeS] (933, 951) protein maturation (see Johnson, D. C., et al., Ann. Rev. Biochem. 74: 247-81 (2005)) (YP_002801148.1; reverse complement of nucleotides 4088980 to 4089501 of NC_012560.1) hscA HscA heat shock cognate protein associated with Isc-directed [FeS] (934, 952) protein maturation (see Johnson, D. C., et al., Ann. Rev. Biochem. 74: 247-81 (2005)) (YP_002801147.1; reverse complement of nucleotides 4087072 to 4088937 of NC_012560.1) Fdx Ferredoxin (935, 953) (YP_002801146.1; reverse complement of nucleotides 4086730 to 4087071 of NC_012560.1) sufS Cysteine desulfurase involved in the mobilization of S (see Johnson, D. C., (936, 954) et al., Ann. Rev. Biochem. 74: 247-81 (2005)) (YP_002801025.1; nucleotides 3961166 to 3962515 of NC_012560.1) sufE (YP_002801026.1; nucleotides 3962512 to 3962916 of NC_012560.1) (937, 955) cysE3 Involved in cysteine biosynthesis (see Johnson, D. C., et al., Ann. Rev. (938, 956) Biochem. 74: 247-81 (2005)) (YP_002799274.1; nucleotides 2093069 to 2094052 of NC_012560.1) sufS2 Cysteine desulfurase involved in the mobilization of S (see Johnson, D. C., (939, 957) et al., Ann. Rev. Biochem. 74: 247-81 (2005)) (YP_002799276.1; nucleotides 2095267 to 2097081 of NC_012560.1) iscA2 also [FeS] cluster scaffold protein (see Johnson, D. C., et al., Ann. Rev. known as Biochem. 74: 247-81 (2005)) eprA (YP_002801687.1; reverse complement of nucleotides 4681573 to (877, 898) 4681923 of NC_012560.1) Nfu also Human nfu appears to be a persulfide reductase according to the known as equation shown in FIG. 6C. (see Liu, Y., W. Qi, and J. A. Cowan, NfuA Biochem. 48(5): 973-80 (2009)) (878, 899) (YP_002800022.1; reverse complement of nucleotides 2961161 to 2961745 of NC_012560.1) nfuA also Spectroscopic and analytical studies indicate that one known as [4Fe4S] cluster can be assembled in vitro within a dimeric form AnfU of NfuA. The resultant [4Fe4S] cluster-loaded form of NfuA is (879, 900) competent for rapid in vitro activation of apo-aconitase. Based on these results a model is proposed where NfuA could represent a class of intermediate [FeS] cluster carriers involved in [FeS] protein maturation. (see Bandyopadhyay, S., et al., J Biol. Chem. 283(20): 14092-99 (2008)) (YP_002801977.1; nucleotides 4963727 to 4964017 of NC_012560.1) nfuV also Could have specialized functions related to the maturation, protection, known as or repair of specific [FeS] proteins (see Johnson, D. C., et al., Ann. Rev. VnfU Biochem. 74: 247-81 (2005)). (880, 901) (YP_002797514.1; reverse complement of nucleotides 263828 to 264118 of NC_012560.1) Helicobacter pylori nif genes (FIG. 7; see Johnson, D. C., et al., Ann. Rev. Biochem. 74: 247-81 (2005)) nifS NifS is a cysteine desulfurase. (881, 902) (YP_003057033.1; nucleotides 218891 to 220054 of NC_012973.1) nifU NifU is a scaffold protein for assembly and transfer of iron-sulfur (882, 903) clusters. (YP_003057034.1; nucleotides 220076 to 221056 of NC_012973.1) nfu (YP_003058109.1; nucleotides 1448886 to 1449155 of NC_012973.1) (927, 945) iscS (YP_003057709.1; reverse complement of nucleotides 1012615 to (928, 946) 1013937 of NC_012973.1) E. coli isc genes (FIG. 8; see Johnson, D. C., et al., Ann. Rev. Biochem. 74: 247-81 (2005)) iscS EcoCyc: IscS is a cysteine desulfurase that catalyzes the conversion of (883, 904) cysteine into alanine and sulfur via intermediate formation of a cysteine persulfide. (YP_026169.1; reverse complement of nucleotides 2658339 to 2659553 of NC_000913.2) iscU EcoCyc: IscU is a scaffold protein for assembly and transfer of iron- (884, 905) sulfur clusters. IscU is able to form 2Fe2S clusters and transfer them to apo-ferredoxin, acting catalytically. The chaperones HscA and HscB and ATP hydrolysis by HscA accelerate cluster transfer. (NP_417024.1; reverse complement of nucleotides 2657925 to 2658311 of NC_000913.2) iscA EcoCyc: IscA is an iron-sulfur cluster assembly protein that forms the (885, 906) [2Fe2S] cluster of ferredoxin. It has been shown to bind iron with an apparent association constant of 3 1019M.sup.1. In vitro in the presence of IscS and cysteine, IscA can provide iron to iscU. Native [2Fe2S] SufA can transfer its FeS cluster to both [2Fe2S] and [4Fe4S] apoproteins. (see Gupta, V., et al., J. Am. Chem. Soc. 131(17): 6149-53 (2009)) The results suggest that the biogenesis of the [4Fe4S] clusters and the [2Fe2S] clusters may have distinct pathways and that IscA/SufA paralogues are essential for the [4Fe4S] cluster assembly, but are dispensable for the [2Fe2S] cluster assembly in E. coli under aerobic conditions. (Tan, G., et al., Biochem. J., 420(3): 463-72 (2009)) (NP_417023.1; reverse complement of nucleotides 2657585 to 2657908 of NC_000913.2) hscB EcoCyc: HscB is a co-chaperone that stimulates HscA (Hsc66) ATPase (886, 907) activity. HscB does not exhibit its own chaperone activity. HscB is required for wild-type stimulation of HscA ATPase activity by the substrate, IscU, and for wild-type interaction between HscA and IscU. This system is involved in iron-sulfur cluster assembly. (NP_417022.1; reverse complement of nucleotides 2656974 to 2657489 of NC_000913.2) hscA EcoCyc: Hsc66 together with Hsc20 may comprise a chaperone system (887, 908) similar to DnaK/DnaJ. Hsc66 is required for the assembly of iron-sulfur clusters. IscU may be a substrate for Hsc66. In the presence of Hsc20, IscU stimulates the ATPase activity of Hsc66 up to 480-fold; the in vivo turnover rate of the chaperone cycle may be determined by the availability of the IscU-Hsc20 complex. Hsc66 directly interacts with IscU, IscA, and Fdx. (NP_417021.1; reverse complement of nucleotides 2655107 to 2656957 of NC_000913.2) Fdx EcoCyc: [2Fe2S] ferridoxin (888, 909) (NP_417020.1; reverse complement of nucleotides 2654770 to 2655105 of NC_000913.2) E. coli suf genes (FIG. 9; see Johnson, D. C., et al., Ann. Rev. Biochem. 74: 247-81 (2005)) sufA EcoCyc: SufA is part of the protein machinery that is involved in the (889, 910) biosynthesis of iron-sulfur clusters. In vitro, purified apoSufA can chelate iron-sulfur clusters by treatment with iron and sulfide under anaerobic conditions. HoloSufA then can form a fast and tight association with the target apoprotein biotin synthase (BioB) and transfers a [4Fe4S] cluster to BioB in a slow reaction. (NP_416199.1; reverse complement of nucleotides 1762042 to 1762410 of NC_000913.2) sufB EcoCyc: The SufB-SufC-SufD complex activates the cysteine (890, 911) desulfurase activity SufS in conjunction with the SufE sulfur acceptor protein. (NP_416198.2; reverse complement of nucleotides 1760546 to 1762033 of NC_000913.2) sufC EcoCyc: SufC is part of the protein machinery that is involved in the (891, 912) biosynthesis of iron-sulfur clusters. The SufB-SufC-SufD complex activates the cysteine desulfurase activity of SufS in conjunction with the SufE sulfur acceptor protein. (NP_416197.1; reverse complement of nucleotides 1759790 to 1760536 of NC_000913.2) sufD EcoCyc: The SufB-SufC-SufD complex activates the cysteine (892, 913) desulfurase activity SufS in conjunction with the SufE sulfur acceptor protein (NP_416196.1; reverse complement of nucleotides 1758544 to 1759815 of NC_000913.2) sufS EcoCyc: SufS is a member of the NifS protein family. SufS exhibits (893, 914) activity with respect to assembly of the ferredoxin iron-sulfur cluster in an in vitro assay. (NP_416195.1; reverse complement of nucleotides 1757327 to 1758547 of NC_000913.2) sufE1 also (NP_416194.1; reverse complement of nucleotides 1756898 to 1757314 known as suf E of NC_000913.2) (925, 943) sufS2 also (NP_417290.1; NC_000913.2 nucleotides 2941359 to 2942564) known as csdA (924, 942) sufE2 also (NP_417291.1; nucleotides 2942564 to 2943007 of NC_000913.2) known as csdE (926, 944) iscA2 also (NP_414698.1; nucleotides 176610 to 176954 of NC_000913.2) known as erpA (922, 940) nfu also known (NP_417873.1; nucleotides 3543646 to 3544221 of NC_000913.2) as nfuA (923, 941)

    [0125] Fe uptake and metabolism and/or FeS cluster biosynthesis genes, including, but not limited to, those listed in Tables 7, 8 or 9 can potentially be deleted, mutated, expressed, up-regulated, or down-regulated to increase the flux in an FeS cluster biosynthesis pathway and improve specific activity of FeS cluster requiring proteins such as DHAD. In addition, co-factors can be added to change the activity of polypeptides having FeS cluster regulatory activity to increase the flux in an FeS cluster biosynthesis pathway and improve DHAD specific activity.

    [0126] For example, the genes that increase the flux in an FeS cluster biosynthesis pathway can be expressed to improve the activity of DHAD by providing an adequate amount of FeS clusters for the apo-enzyme. Any gene, or a combination of them, such as one or more genes listed in Tables 7, 8, or 9, can be cloned and expressed in a pRS411 plasmid as described in Example 4. The resulting constructs, along with the DHAD expression vector pHR81 FBA ilvD(Sm), can then be transformed into wild-type BY4741. As a control, pRS411 without any gene of interest and vector pHR81 FBA ilvD(Sm) are transformed into a wild-type strain. The transformants are selected on agar plates with SD medium without uracil and methionine to maintain both plasmids as described in Example 4. Enzymatic activity for DHAD in the crude extract of different strains from the transformation can be measured. The results can be compared with the specific activity obtained from the control pRS411 without any gene of interest and vector pHR81 FBA ilvD(Sm) transformed into a wild-type strain. An increase in specific activity indicates a gene that can be used to increase the flux in an FeS cluster biosynthesis pathway.

    [0127] In addition, strains with deletions in more than one of the genes involved in FeS cluster regulatory activity can be created to provide additive effects in improving the enzymes or proteins containing FeS cluster(s). For example, double mutants with deletions in both FRA2 and GXR3 genes can be used to transform vector pHR81 FBA-IlvD(sm), and the DHAD activity in the crude extract from the transformants can be measured.

    [0128] Another alternative is to alter the expression of, e.g., the PSE1 (SEQ ID NO:777) gene, which encodes a protein involved in the import of Aft1p into the nucleus (Fukunaka, et al, 2003, J. Biological Chem., vol. 278, pp. 50120-50127). Expression of this gene can be accomplished by cloning it in vector pRS411 as described above.

    [0129] Thus, provided herein are recombinant host cells that comprise an alteration in the expression of any polypeptide encoded by an Fe uptake and utilization or an FeS cluster biosynthesis gene. Encompassed are recombinant host cells that comprise at least one heterologous polynucleotide of any one of the above-referenced FeS cluster biosynthesis genes. Also encompassed are recombinant host cells, wherein the host cell comprises at least one deletion, mutation, and/or substitution in an endogenous gene of any one of the above-referenced Fe uptake and utilization or FeS cluster biosynthesis genes. Also provided are recombinant host cells that comprise at least one heterologous polynucleotide of any one of the above-referenced Fe uptake and utilization or FeS cluster biosynthesis genes, wherein the host cell comprises at least one deletion, mutation, and/or substitution in an endogenous gene of any one of the above-referenced Fe uptake and utilization or FeS cluster biosynthesis genes.

    [0130] These recombinant host cells can also comprise at least one heterologous FeS cluster requiring protein. For example, provided herein is a recombinant host cell comprising at least one heterologous DHAD and at least one heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis. Also provided is a recombinant host cell comprising at least one heterologous DHAD, wherein the host cell comprises at least one deletion, mutation, and/or substitution in an endogenous gene encoding a polypeptide affecting FeS cluster biosynthesis. Also provided is a recombinant host cell comprising at least one heterologous DHAD and at least one heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis, wherein the host cell comprises at least one deletion, mutation, and/or substitution in an endogenous gene encoding a polypeptide affecting FeS cluster biosynthesis.

    [0131] Host cells that can be used in the present invention include yeast host cells including, but not limited to, Saccharomyces, Schizosaccharomyces, Hansenula, Candida, Kluyveromyces, Yarrowia, Issatchenkia, and Pichia. Bacterial host cells can also be used to create recombinant host cells that comprise at least one heterologous polynucleotide encoding a polypeptide having DHAD activity and at least one heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis. For example, lactic acid bacteria comprising recombinant DHAD and at least one recombinant genetic expression element encoding FeS cluster forming proteins are the subject of U.S. application Ser. No. 12/569,103, filed Sep. 29, 2009, which is incorporated by reference herein. The present recombinant host cells comprising at least one heterologous polynucleotide encoding a polypeptide having DHAD activity and at least one heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis do not include those lactic acid bacteria described in U.S. application Ser. No. 12/569,103, filed Sep. 29, 2009, which is incorporated by reference herein.

    [0132] The polypeptide affecting FeS cluster biosynthesis can be selected from the group consisting of the Fe uptake and utilization or FeS cluster biosynthesis pathway genes in Tables 7, 8 and 9. In one embodiment, the polypeptide affecting FeS cluster biosynthesis is encoded by ARN1, ARN2, ATX1, CCC2, COT1, ENB1, FET3, FET5, FIT1, FIT2, FIT3, FRE1, FRE2, FRE3, FRE4, FRE5, FREE, FTH1, FTR1, HMX1, SIT1, SMF3, TIS11, VHT1, AFT1, AFT2, AIM1, ARH1, ATM1, BUD32, CAD1, CCC1, CFD1, CIA1, CMK1, CTH1, CTI6, CYC8, DAP1, DRE2, ERV1, ESA1, FET4, FRA1, FRA2, GEF1, GGC1, GRX1, GRX2, GRX4, GRX5, HDA1, IBA57, ISA1, ISA2, ISU1, ISU2, JAC1, MGE1, MRS3, MRS4, MSN5, NAR1, NFS1, NFU1, NHP6a, NHP6b, PSE1, SMF1, SNF1, SNF2, SNF3, SNF4, SSQ1, TIM12, TUP1, NP_011911.1, VPS41, YAP5, YFH1, YRA1, ZPR1, iscA.sup.nif, nifU, nifS, cysE1, cysE2, iscS, iscU, iscA, hscB, hscA, Fdx, sufS, sufE, cysE3, sufS2, iscA2, Nfu, nfuA, nfuV, nfu, sufA, sufB, sufC, sufD, sufE1, sufS2, or sufE2. In one embodiment, the polypeptide affecting FeS cluster biosynthesis is AFT1, AFT2, PSE1, FRA2, GRX3, or MSN5. In one embodiment, the polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of AFT1, AFT2, PSE1, FRA2, GRX3, MSN5, and combinations thereof. In one embodiment, the polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of AFT1, AFT2, PSE1, FRA2, MSN5, and combinations thereof. In another embodiment, the polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of AFT1, AFT2, PSE1, FRA2, GRX3, MSN5, and combinations thereof, and the polypeptide affecting FeS cluster biosynthesis is encoded by a polynucleotide comprising a plasmid. In some embodiments, DHAD is co-expressed with AFT1, AFT2, PSE1, and combinations thereof. The polypeptide affecting FeS cluster biosynthesis may be a constitutive mutant, such as, but not limited to, AFT1 L99A, AFT1 L102A, AFT1 C291F, AFT1 C293F, and combinations thereof. The deletion, mutation, and/or substitution in the endogenous gene encoding a polypeptide affecting FeS cluster biosynthesis can be selected from the group consisting of FRA2, GRX3, MSN5, and combinations thereof.

    [0133] The present invention also provides a method for increasing the activity of an FeS cluster requiring protein in a recombinant host cell comprising providing a recombinant host cell comprising an FeS cluster requiring protein, changing the expression or activity of a polypeptide affecting FeS cluster biosynthesis in the host cell, and growing the recombinant host cell with the changed expression or activity under conditions whereby the activity of the FeS cluster requiring protein is increased. Such a method can be used to increase the activity of an endogenous FeS cluster requiring protein, or a heterologous FeS cluster requiring protein. Such a method can be used to increase the specific activity of a DHAD described herein, or identified by the methods described herein. The increase in the activity of the FeS cluster requiring protein can be in an amount selected from greater than about 10%; greater than about 15%; greater than about 20%; greater than about 25%; greater than about 30%; greater than about 35%; greater than about 40%; greater than about 45%; greater than about 50%; greater than about 55%; greater than about 60%; greater than about 65%; greater than about 70%; greater than about 75%; greater than about 80%; greater than about 85%; greater than about 90%; and greater than about 95%. The increase in activity may be greater than about 3 fold, greater than about 5 fold, greater than about 8 fold, or greater than about 10 fold. In embodiments, the activity of the FeS cluster requiring protein can be in an amount that is at least about 60% of theoretical, at least about 70% of theoretical, at least about 80% theoretical, or at least about 90% theoretical.

    [0134] The present invention can also be used to increase the flux in the FeS cluster biosynthesis pathway in a host cell and to identify polypeptides that increase the flux in an FeS cluster biosynthesis pathway in a host cell. In one embodiment a method is provided for increasing the flux in an FeS cluster biosynthesis pathway in a host cell comprising providing a recombinant host cell comprising an FeS cluster requiring protein and either at least one polypeptide affecting FeS cluster biosynthesis, at least one deletion, mutation, and/or substitution in an endogenous gene encoding a polypeptide affecting FeS cluster biosynthesis, or a combination of both, and growing the recombinant host cell under conditions whereby the flux in the FeS cluster biosynthesis pathway in the host cell is increased. In another embodiment, a method is provided for identifying polypeptides that increase the flux in an FeS cluster biosynthesis pathway in a host cell comprising: (a) changing the expression or activity of a polypeptide affecting FeS cluster biosynthesis; (b) measuring the activity of a FeS cluster requiring protein; and (c) comparing the activity of the FeS cluster requiring protein measured in the presence of the change in expression or activity polypeptide of step (a) to the activity of the FeS cluster requiring protein measured in the absence of the change in expression or activity polypeptide of step (a), wherein an increase in the activity of the heterologous FeS cluster requiring protein indicates an increase in the flux in said FeS cluster biosynthesis pathway. In such methods, the FeS cluster requiring protein may be endogenous or heterologous to the host cell.

    [0135] The expression or activity of the polypeptide affecting FeS cluster biosynthesis can be changed by methods well known in the art, including, but not limited to, deleting, mutating, substituting, expressing, up-regulating, down-regulating, altering the cellular location, altering the state of the protein, and/or adding a cofactor, and combinations thereof. Altering the state of the protein can include, but are not limited to, such alterations as phosphorylation or ubiquitination. Any number of methods described herein or known in the art can be used to measure the activity of the FeS cluster requiring protein, depending upon the FeS cluster requiring protein chosen. For example, if DHAD is the FeS cluster requiring protein, the assay described in the Example 7 can be used to measure the activity of the DHAD to determine if there is an increase in the flux in the FeS cluster biosynthesis pathway of the host cell.

    [0136] Isobutanol and Other Products

    [0137] Expression of a DHAD in a recombinant host cell, as described herein, provides the transformed, recombinant host cell with dihydroxy-acid dehydratase activity for conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate or 2,3-dihydroxymethylvalerate to -ketomethylvalerate. A product that has -ketoisovalerate or -ketomethylvalerate as a pathway intermediate may be produced with greater effectiveness in a host cell disclosed herein having the described heterologous DHAD. A list of such products includes, but is not limited to, valine, isoleucine, leucine, pantothenic acid, 2-methyl-1-butanol, 3-methyl-1-butanol, and isobutanol.

    [0138] For example, biosynthesis of valine in yeast includes steps of acetolactate conversion to 2,3-dihydroxy-isovalerate by acetohydroxyacid reductoisomerase (ILV5), conversion of 2,3-dihydroxy-isovalerate to -ketoisovalerate (also called 2-ketoisovalerate) by dihydroxy-acid dehydratase, and conversion of -ketoisovalerate to valine by branched-chain amino acid transaminase (BAT2) and branched-chain amino acid aminotransferase (BAT1). Biosynthesis of leucine includes the same steps to -ketoisovalerate, followed by conversion of -ketoisovalerate to alpha-isopropylmalate by alpha-isopropylmalate synthase (LEU9, LEU4), conversion of alpha-isopropylmalate to beta-isopropylmalate by isopropylmalate isomerase (LEU1), conversion of beta-isopropylmalate to alpha-ketoisocaproate by beta-IPM dehydrogenase (LEU2), and finally conversion of alpha-ketoisocaproate to leucine by branched-chain amino acid transaminase (BAT2) and branched-chain amino acid aminotransferase (BAT1). The bacterial pathway is similar, involving differently named proteins and genes. Increased conversion of 2,3-dihydroxy-isovalerate to -ketoisovalerate will increase flow in these pathways, particularly if one or more additional enzymes of a pathway is overexpressed. Thus, it is desired for production of valine or leucine to use a strain disclosed herein.

    [0139] Biosynthesis of pantothenic acid includes a step performed by DHAD, as well as steps performed by ketopantoate hydroxymethyltransferase and pantothenate synthase. Engineering of expression of these enzymes for enhanced production of pantothenic acid biosynthesis in microorganisms is described in U.S. Pat. No. 6,177,264.

    [0140] The -ketoisovalerate product of DHAD is an intermediate in isobutanol biosynthetic pathways disclosed in U.S. Patent Appl. Pub. No. 20070092957 A1, which is incorporated by reference herein. A diagram of disclosed isobutanol biosynthetic pathways is provided in FIG. 5. Production of isobutanol in a strain disclosed herein may benefit from increased DHAD activity. As disclosed herein, increased DHAD activity is provided by expression of a DHAD in a host cell, for example, by over-expressing the DHAD, by modulating the expression or activity of a polypeptide having FeS cluster regulatory activity, or a combination of both expression of a DHAD and modulation of the expression or activity of a polypeptide having FeS cluster regulatory activity. As described in U.S. Patent Appl. Pub. No. 20070092957 A1, which is incorporated by reference herein, steps in an example isobutanol biosynthetic pathway include conversion of: [0141] pyruvate to acetolactate (see FIG. 5, pathway step a therein), as catalyzed for example by acetolactate synthase, [0142] acetolactate to 2,3-dihydroxyisovalerate (see FIG. 5, pathway step b therein) as catalyzed for example by acetohydroxy acid isomeroreductase; [0143] 2,3-dihydroxyisovalerate to -ketoisovalerate (see FIG. 5, pathway step c therein) as catalyzed for example by acetohydroxy acid dehydratase, also called dihydroxy-acid dehydratase (DHAD); [0144] -ketoisovalerate to isobutyraldehyde (see FIG. 5, pathway step d therein) as catalyzed for example by branched-chain -keto acid decarboxylase; and [0145] isobutyraldehyde to isobutanol (see FIG. 5, pathway step e therein) as catalyzed for example by branched-chain alcohol dehydrogenase.

    [0146] The substrate to product conversions, and enzymes involved in these reactions, for steps f, g, h, I, j, and k of alternative pathways are described in U.S. Patent Appl. Pub. No. 20070092957 A1, which is incorporated by reference herein.

    [0147] Genes that can be used for expression of the pathway step enzymes named above other than the DHADs disclosed herein, as well as those for additional isobutanol pathways, are described in U.S. Patent Appl. Pub. No. 20070092957 A1, which is incorporated by reference herein. Additional genes that may be used can be identified by one skilled in the art through bioinformatics or using methods well-known in the art, such as the various methods described in U.S. application Ser. No. 12/569,636, filed Sep. 29, 2009, which is incorporated by reference herein, to isolate homologs. Suitable ketol-acid reductoisomerase (KARI) enzymes are described in U.S. Patent Appl. Pub. Nos. 20080261230 A1, 20090163376, 20100197519, and U.S. application Ser. No. 12/893,077, all incorporated by reference herein. Examples of KARIs disclosed therein are those from Vibrio cholerae, Pseudomonas aeruginosa PAO1, and Pseudomonas fluorescens PF5. U.S. Patent Appl. Publ. No. 2009/0269823 and U.S. Prov. Patent Appl. No. 61/290,636, incorporated by reference herein, describe suitable alcohol dehydrogenases.

    [0148] Additionally described in U.S. Patent Appl. Pub. No. 20070092957 A1, which is incorporated by reference herein, are construction of chimeric genes and genetic engineering of bacteria and yeast for isobutanol production using the disclosed biosynthetic pathways.

    [0149] Additional Modifications

    [0150] Examples of additional modifications that may be useful in cells provided herein include modifications to reduce glycerol-3-phosphate dehydrogenase activity and/or disruption in at least one gene encoding a polypeptide having pyruvate decarboxylase activity or a disruption in at least one gene encoding a regulatory element controlling pyruvate decarboxylase gene expression as described in U.S. Patent Appl. Pub. No. 20090305363 (incorporated herein by reference), modifications to a host cell that provide for increased carbon flux through an Entner-Doudoroff Pathway or reducing equivalents balance as described in U.S. Patent Appl. Pub. No. 20100120105 (incorporated herein by reference). Other modifications include integration of at least one polynucleotide encoding a polypeptide that catalyzes a step in a pyruvate-utilizing biosynthetic pathway described in U.S. Prov. Appl. No. 61/380,563 (incorporated herein by reference). Additional modifications that may be suitable are described in U.S. application. Ser. No. 12/893,089. Additionally, host cells comprising a heterologous polynucleotide encoding a polypeptide with phosphoketolase activity and host cells comprising a heterologous polynucleotide encoding a polypeptide with phosphotransacetylase activity are described in U.S. Provisional Patent Application No. 61/356,379.

    Growth for Production

    [0151] Recombinant host cells disclosed herein are grown in fermentation media which contains suitable carbon substrates. Suitable carbon substrates may include, but are not limited to, monosaccharides such as glucose, fructose, oligosaccharides such as lactose maltose, galactose, or sucrose, polysaccharides such as starch or cellulose or mixtures thereof and unpurified mixtures from renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt. Other carbon substrates may include ethanol, lactate, succinate, or glycerol.

    [0152] Additionally the carbon substrate may also be one-carbon substrates such as carbon dioxide, or methanol for which metabolic conversion into key biochemical intermediates has been demonstrated. Two-carbon substrates such as ethanol may also suitable. In addition to one and two carbon substrates, methylotrophic organisms are also known to utilize a number of other carbon containing compounds such as methylamine, glucosamine and a variety of amino acids for metabolic activity. For example, methylotrophic yeasts are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth C1 Compd., [Int. Symp.], 7th (1993), 415-32, Editor(s): Murrell, J. Collin; Kelly, Don P. Publisher: Intercept, Andover, UK). Similarly, various species of Candida will metabolize alanine or oleic acid (Sulter et al., Arch. Microbiol. 153:485-489 (1990)). Hence it is contemplated that the source of carbon utilized in the present invention may encompass a wide variety of carbon containing substrates and will only be limited by the choice of organism.

    [0153] Although it is contemplated that all of the above mentioned carbon substrates and mixtures thereof are suitable in the present invention, in some embodiments, the carbon substrates are glucose, fructose, and sucrose, or mixtures of these with C5 sugars such as xylose and/or arabinose for yeasts cells modified to use C5 sugars. Sucrose may be derived from renewable sugar sources such as sugar cane, sugar beets, cassava, sweet sorghum, and mixtures thereof. Glucose and dextrose may be derived from renewable grain sources through saccharification of starch based feedstocks including grains such as corn, wheat, rye, barley, oats, and mixtures thereof. In addition, fermentable sugars may be derived from renewable cellulosic or lignocellulosic biomass through processes of pretreatment and saccharification, as described, for example, in co-owned and co-pending U.S. Patent Appl. Pub. No. 20070031918 A1, which is herein incorporated by reference. Biomass refers to any cellulosic or lignocellulosic material and includes materials comprising cellulose, and optionally further comprising hemicellulose, lignin, starch, oligosaccharides and/or monosaccharides. Biomass may also comprise additional components, such as protein and/or lipid. Biomass may be derived from a single source, or biomass can comprise a mixture derived from more than one source; for example, biomass may comprise a mixture of corn cobs and corn stover, or a mixture of grass and leaves. Biomass includes, but is not limited to, bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood and forestry waste. Examples of biomass include, but are not limited to, corn grain, corn cobs, crop residues such as corn husks, corn stover, grasses, wheat, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, flowers, animal manure, and mixtures thereof.

    [0154] In addition to an appropriate carbon source, growth media must contain suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art, suitable for the growth of the cultures and promotion of an enzymatic pathway comprising a FeS cluster requiring protein such as, for example, DHAD.

    Culture Conditions

    [0155] Typically cells are grown at a temperature in the range of about 20 C. to about 40 C. in an appropriate medium. Suitable growth media in the present invention are common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth, Yeast Medium (YM) broth, or broth that includes yeast nitrogen base, ammonium sulfate, and dextrose (as the carbon/energy source) or YPD Medium, a blend of peptone, yeast extract, and dextrose in optimal proportions for growing most Saccharomyces cerevisiae strains. Other defined or synthetic growth media may also be used, and the appropriate medium for growth of the particular microorganism will be known by one skilled in the art of microbiology or fermentation science. The use of agents known to modulate catabolite repression directly or indirectly, e.g., cyclic adenosine 2:3-monophosphate, may also be incorporated into the growth medium.

    [0156] Suitable pH ranges for the growth are between about pH 5.0 to about pH 9.0. In one embodiment, about pH 6.0 to about pH 8.0 is used for the initial condition. Suitable pH ranges for the fermentation of yeast are typically between about pH 3.0 to about pH 9.0. In one embodiment, about pH 5.0 to about pH 8.0 is used for the initial condition. Suitable pH ranges for the fermentation of other microorganisms are between about pH 3.0 to about pH 7.5. In one embodiment, about pH 4.5 to about pH 6.5 is used for the initial condition.

    [0157] Growth may be performed under aerobic or anaerobic conditions. In one embodiment, anaerobic or microaerobic conditions are used for growth.

    [0158] Industrial Batch and Continuous Fermentations

    [0159] Isobutanol, or other products, may be produced using a batch method of fermentation. A classical batch fermentation is a closed system where the composition of the medium is set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. A variation on the standard batch system is the fed-batch system. Fed-batch fermentation processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Batch and fed-batch fermentations are common and well known in the art and examples may be found in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass., or Deshpande, Mukund V., Appl. Biochem. Biotechnol., 36:227, (1992), herein incorporated by reference.

    [0160] Isobutanol, or other products, may also be produced using continuous fermentation methods. Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth. Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.

    [0161] It is contemplated that the production of isobutanol, or other products, may be practiced using batch, fed-batch or continuous processes and that any known mode of fermentation would be suitable. Additionally, it is contemplated that cells may be immobilized on a substrate as whole cell catalysts and subjected to fermentation conditions for isobutanol production.

    [0162] Methods for Isobutanol Isolation from the Fermentation Medium

    [0163] Bioproduced isobutanol may be isolated from the fermentation medium using methods known in the art for ABE fermentations (see, e.g., Dune, Appl. Microbiol. Biotechnol. 49:639-648 (1998), Groot et al., Process. Biochem. 27:61-75 (1992), and references therein). For example, solids may be removed from the fermentation medium by centrifugation, filtration, decantation, or the like. Then, the isobutanol may be isolated from the fermentation medium using methods such as distillation, azeotropic distillation, liquid-liquid extraction, adsorption, gas stripping, membrane evaporation, or pervaporation.

    [0164] Because isobutanol forms a low boiling point, azeotropic mixture with water, distillation can be used to separate the mixture up to its azeotropic composition. Distillation may be used in combination with another separation method to obtain separation around the azeotrope. Methods that may be used in combination with distillation to isolate and purify butanol include, but are not limited to, decantation, liquid-liquid extraction, adsorption, and membrane-based techniques. Additionally, butanol may be isolated using azeotropic distillation using an entrainer (see, e.g., Doherty and Malone, Conceptual Design of Distillation Systems, McGraw Hill, New York, 2001).

    [0165] The butanol-water mixture forms a heterogeneous azeotrope so that distillation may be used in combination with decantation to isolate and purify the isobutanol. In this method, the isobutanol containing fermentation broth is distilled to near the azeotropic composition. Then, the azeotropic mixture is condensed, and the isobutanol is separated from the fermentation medium by decantation. The decanted aqueous phase may be returned to the first distillation column as reflux. The isobutanol-rich decanted organic phase may be further purified by distillation in a second distillation column.

    [0166] The isobutanol may also be isolated from the fermentation medium using liquid-liquid extraction in combination with distillation. In this method, the isobutanol is extracted from the fermentation broth using liquid-liquid extraction with a suitable solvent. The isobutanol-containing organic phase is then distilled to separate the butanol from the solvent.

    [0167] Distillation in combination with adsorption may also be used to isolate isobutanol from the fermentation medium. In this method, the fermentation broth containing the isobutanol is distilled to near the azeotropic composition and then the remaining water is removed by use of an adsorbent, such as molecular sieves (Aden et al. Lignocellulosic Biomass to Ethanol Process Design and Economics Utilizing Co-Current Dilute Acid Prehydrolysis and Enzymatic Hydrolysis for Corn Stover, Report NREL/TP-510-32438, National Renewable Energy Laboratory, June 2002).

    [0168] Additionally, distillation in combination with pervaporation may be used to isolate and purify the isobutanol from the fermentation medium. In this method, the fermentation broth containing the isobutanol is distilled to near the azeotropic composition, and then the remaining water is removed by pervaporation through a hydrophilic membrane (Guo et al., J. Membr. Sci. 245, 199-210 (2004)).

    Embodiments of the Inventions

    Embodiment 1 (E1)

    [0169] A recombinant host cell comprising at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity wherein said at least one heterologous polynucleotide comprises a high copy number plasmid or a plasmid with a copy number that can be regulated.

    E2

    [0170] A recombinant host cell comprising at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity wherein said at least one heterologous polynucleotide is integrated at least once in the recombinant host cell DNA.

    E3

    [0171] A recombinant host cell comprising at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity, wherein said host cell comprises at least one deletion, mutation, and/or substitution in an endogenous gene encoding a polypeptide affecting FeS cluster biosynthesis.

    E4

    [0172] A recombinant host cell comprising at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity and at least one heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis.

    E5

    [0173] The recombinant host cell of any one of embodiments E3-E4, wherein said heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of the genes in Tables 8 and 9.

    E6

    [0174] The recombinant host cell of any one of embodiments E3-E4, wherein said heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of the genes in Table 7.

    E7

    [0175] The recombinant host cell of embodiment E5 or E6, wherein said heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of AFT1, AFT2, PSE1, FRA2, GRX3, MSN5, and combinations thereof.

    E8

    [0176] The recombinant host cell of embodiment E7, wherein said polypeptide is encoded by a polynucleotide that is constitutive mutant.

    E9

    [0177] The recombinant host cell of embodiment E8, wherein said constitutive mutant is selected from the group consisting of AFT1 L99A, AFT1 L102A, AFT1 C291F, AFT1 C293F, and combinations thereof.

    E10

    [0178] The recombinant host cell of embodiment E7, wherein said polypeptide affecting FeS cluster biosynthesis is encoded by a polynucleotide comprising a high copy number plasmid or a plasmid with a copy number that can be regulated.

    E11

    [0179] The recombinant host cell of embodiment E7, wherein said polypeptide affecting FeS cluster biosynthesis is encoded by a polynucleotide integrated at least once in the recombinant host cell DNA.

    E12

    [0180] The recombinant host cell of embodiment E3, wherein the at least one deletion, mutation, and/or substitution in an endogenous gene encoding a polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of FRA2, GRX3, MSN5, and combinations thereof.

    E13

    [0181] The recombinant host cell of embodiment E4, wherein the at least one heterologous polynucleotide encoding a polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of AFT1, AFT2, PSE1, and combinations thereof.

    E14

    [0182] The recombinant host cell of any one of embodiments E3-E13, wherein said at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity is expressed in multiple copies.

    E15

    [0183] The recombinant host cell of embodiment E14, wherein said at least one heterologous polynucleotide comprises a high copy number plasmid or a plasmid with a copy number that can be regulated.

    E16

    [0184] The recombinant host cell of embodiment E14, wherein said at least one heterologous polynucleotide is integrated at least once in the recombinant host cell DNA.

    E17

    [0185] The recombinant host cell of any one of embodiments E3-E16, wherein said FeS cluster biosynthesis is increased compared to a recombinant host cell having endogenous FeS cluster biosynthesis.

    E18

    [0186] The recombinant host cell of any one of embodiments E1-E17, wherein said host cell is a yeast host cell.

    E19

    [0187] The recombinant host cell of embodiment E18, wherein said yeast host cell is selected from the group consisting of Saccharomyces, Schizosaccharomyces, Hansenula, Candida, Kluyveromyces, Yarrowia, Issatchenkia and Pichia.

    E20

    [0188] The recombinant host cell of any one of embodiments E1-E19, wherein said heterologous polypeptide having dihydroxy-acid dehydratase activity is expressed in the cytosol of the host cell.

    E21

    [0189] The recombinant host cell of any one of embodiments E1-E20, wherein said heterologous polypeptide having dihydroxy-acid dehydratase activity has an amino acid sequence that matches the Profile HMM of Table 12 with an E value of <10.sup.5 wherein the polypeptide further comprises all three conserved cysteines, corresponding to positions 56, 129, and 201 in the amino acids sequences of the Streptococcus mutans DHAD enzyme corresponding to SEQ ID NO:168.

    E22

    [0190] The recombinant host cell of any one of embodiments E1-E21, wherein said heterologous polypeptide having dihydroxy-acid dehydratase activity has an amino acid sequence with at least about 90% identity to SEQ ID NO: 168 or SEQ ID NO: 232.

    E23

    [0191] The recombinant host cell of any one of embodiments E1-E22, wherein said polypeptide having dihydroxy-acid dehydratase activity has a specific activity selected from the group consisting of: [0192] a. greater than about 5-fold with respect to the control host cell comprising at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity; [0193] b. greater than about 8-fold with respect to the control host cell comprising at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity; and [0194] c. greater than about 10-fold with respect to the control host cell comprising at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity.

    E24

    [0195] The recombinant host cell of any one of embodiments E1-E22, wherein said polypeptide having dihydroxy-acid dehydratase activity has a specific activity selected from the group consisting of:

    [0196] a. greater than about 0.25 U/mg;

    [0197] b. greater than about 0.3 U/mg;

    [0198] c. greater than about 0.5 U/mg;

    [0199] d. greater than about 1.0 U/mg;

    [0200] e. greater than about 1.5 U/mg;

    [0201] f. greater than about 2.0 U/mg;

    [0202] g. greater than about 3.0 U/mg;

    [0203] h. greater than about 4.0 U/mg;

    [0204] i. greater than about 5.0 U/mg;

    [0205] j. greater than about 6.0 U/mg;

    [0206] k. greater than about 7.0 U/mg;

    [0207] l. greater than about 8.0 U/mg;

    [0208] m. greater than about 9.0 U/mg;

    [0209] n. greater than about 10.0 U/mg;

    [0210] o. greater than about 20.0 U/mg; and

    [0211] p. greater than about 50.0 U/mg.

    E25

    [0212] The recombinant host cell of any one of embodiments E1-E24, wherein said recombinant host cell produces isobutanol.

    E26

    [0213] The recombinant host cell of embodiment E25, wherein said recombinant host cell comprises an isobutanol biosynthetic pathway.

    E27

    [0214] A method of making a product comprising: [0215] a. providing the recombinant host cell of any one of embodiments E1-E24; and [0216] b. contacting the recombinant host cell of (a) with a fermentable carbon substrate in a fermentation medium under conditions wherein said product is produced; wherein the product is selected from the group consisting of branched chain amino acids, pantothenic acid, 2-methyl-1-butanol, 3-methyl-1-butanol, isobutanol, and combinations thereof.

    E28

    [0217] A method of making isobutanol comprising: [0218] a. providing the recombinant host cell of any one of embodiments E1-E24; [0219] b. contacting the recombinant host cell of (a) with a fermentable carbon substrate in a fermentation medium under conditions wherein isobutanol is produced.

    E29

    [0220] A method for the conversion of 2,3-dihydroxyisovalerate to -ketoisovalerate comprising: [0221] a. providing the recombinant host of any one of embodiments E1-E24; [0222] b. growing the recombinant host cell of (a) under conditions where the 2,3-dihydroxyisovalerate is converted to -ketoisovalerate, wherein 2,3-dihydroxyisovalerate is converted to -ketoisovalerate.

    E30

    [0223] A method for increasing the specific activity of a heterologous polypeptide having dihydroxy-acid dehydratase activity in a recombinant host cell comprising: [0224] a. providing a recombinant host cell of any one of embodiments E1-E24; and [0225] b. growing the recombinant host cell of (a) under conditions whereby the heterologous polypeptide having dihydroxy-acid dehydratase activity is expressed in functional form having a specific activity greater than the same host cell lacking said heterologous polypeptide.

    E31

    [0226] A method for increasing the flux in an FeS cluster biosynthesis pathway in a host cell comprising: [0227] a. providing a recombinant host cell of any one of embodiments E3-E24; and [0228] b. growing the recombinant host cell of (a) under conditions whereby the flux in the FeS cluster biosynthesis pathway in the host cell is increased.

    E32

    [0229] A method of increasing the activity of an FeS cluster requiring protein in a recombinant host cell comprising: [0230] a. providing a recombinant host cell comprising an FeS cluster requiring protein; [0231] b. changing the expression or activity of a polypeptide affecting FeS cluster biosynthesis in said host cell; and [0232] c. growing the recombinant host cell of (b) under conditions whereby the activity of the FeS cluster requiring protein is increased.

    E33

    [0233] The method of embodiment E32, wherein said increase in activity is an amount selected from the group consisting of:

    [0234] a. greater than about 10%;

    [0235] b. greater than about 20%;

    [0236] c. greater than about 30%;

    [0237] d. greater than about 40%;

    [0238] e. greater than about 50%;

    [0239] f. greater than about 60%;

    [0240] g. greater than about 70%;

    [0241] h. greater than about 80%;

    [0242] i. greater than about 90%; and

    [0243] j. greater than about 95%.

    E34

    [0244] The method of embodiment E32, wherein said increase in activity is an amount selected from the group consisting of:

    [0245] a. greater than about 5 fold;

    [0246] b. greater than about 8 fold;

    [0247] c. greater than about 10 fold.

    E35

    [0248] A method for identifying polypeptides that increase the flux in an FeS cluster biosynthesis pathway in a host cell comprising: [0249] a. changing the expression or activity of a polypeptide affecting FeS cluster biosynthesis; [0250] b. measuring the activity of a heterologous FeS cluster requiring protein; and [0251] c. comparing the activity of the heterologous FeS cluster requiring protein measured in the presence of the changed expression or activity of a polypeptide of step (a) to the activity of the heterologous FeS cluster requiring protein measured in the absence of the changed expression or activity of a polypeptide of step (a), [0252] wherein an increase in the activity of the heterologous FeS cluster requiring protein indicates an increase in the flux in said FeS cluster biosynthesis pathway.

    E36

    [0253] A method for identifying polypeptides that increase the flux in an FeS cluster biosynthesis pathway in a host cell comprising: [0254] a. changing the expression or activity of a polypeptide affecting FeS cluster biosynthesis; [0255] b. measuring the activity of a polypeptide having dihydroxy-acid dehydratase activity; and [0256] c. comparing the activity of the polypeptide having dihydroxy-acid dehydratase activity measured in the presence of the change in expression or activity of a polypeptide of step (a) to the activity of the polypeptide having dihydroxy-acid dehydratase activity measured in the absence of the change in expression or activity of a polypeptide of step (a), [0257] wherein an increase in the activity of the polypeptide having dihydroxy-acid dehydratase activity indicates an increase in the flux in said FeS cluster biosynthesis pathway.

    E37

    [0258] The method of any one of embodiments E30-E36, wherein said changing the expression or activity of a polypeptide affecting FeS cluster biosynthesis comprises deleting, mutating, substituting, expressing, up-regulating, down-regulating, altering the cellular location, altering the state of the protein, and/or adding a cofactor.

    E38

    [0259] The method of any one of embodiments E32-E37, wherein the FeS cluster requiring protein has dihydroxy-acid dehydratase activity and wherein said FeS cluster requiring protein having dihydroxy-acid dehydratase activity has an amino acid sequence that matches the Profile HMM of Table 12 with an E value of <10.sup.5 wherein the polypeptide further comprises all three conserved cysteines, corresponding to positions 56, 129, and 201 in the amino acids sequences of the Streptococcus mutans DHAD enzyme corresponding to SEQ ID NO:168.

    E39

    [0260] The method of any one of embodiments E32-E38, wherein said polypeptide affecting FeS cluster biosynthesis is selected from the group consisting of the genes in Tables 7, 8 and 9.

    E40

    [0261] A recombinant host cell comprising at least one polynucleotide encoding a polypeptide identified by the methods of any one of embodiments E35-E37.

    E41

    [0262] The recombinant host cell of embodiment E40, wherein said host cell further comprises at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity.

    E42

    [0263] The recombinant host cell of embodiment E41, wherein said heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity is expressed in multiple copies.

    E43

    [0264] The recombinant host cell of embodiment E41, wherein said heterologous polynucleotide comprises a high copy number plasmid or a plasmid with a copy number that can be regulated.

    E44

    [0265] The recombinant host cell of embodiment E41, wherein said heterologous polynucleotide is integrated at least once in the recombinant host cell DNA.

    E45

    [0266] The method of embodiment E35 or E36, wherein said host cell is a yeast host cell.

    E46

    [0267] The method of embodiment E45, wherein said yeast host cell is selected from the group consisting of Saccharomyces, Schizosaccharomyces, Hansenula, Candida, Kluyveromyces, Yarrowia, Issatchenkia, and Pichia.

    E47

    [0268] The method of any one of embodiments E28-E39, wherein said host cell is a yeast host cell.

    E48

    [0269] The method of embodiment E47, wherein said yeast host cell is selected from the group consisting of Saccharomyces, Schizosaccharomyces, Hansenula, Candida, Kluyveromyces, Yarrowia, Issatchenkia, and Pichia.

    E49

    [0270] The recombinant host cell of any one of embodiments E40-E44, wherein said recombinant host cell is a yeast host cell.

    E50

    [0271] The recombinant host cell of embodiment E49, wherein said yeast host cell is selected from the group consisting of Saccharomyces, Schizosaccharomyces, Hansenula, Candida, Kluyveromyces, Yarrowia, Issatchenkia, and Pichia.

    E51

    [0272] The recombinant host cell of any one of embodiments E40-E44 or E49-E50, wherein said heterologous polypeptide having dihydroxy-acid dehydratase activity is expressed in the cytosol of the host cell.

    E52

    [0273] The recombinant host cell of any one of embodiments E40-E44 or E49-E50, wherein said heterologous polypeptide having dihydroxy-acid dehydratase activity has an amino acid sequence that matches the Profile HMM of Table 12 with an E value of <10.sup.5 wherein the polypeptide further comprises all three conserved cysteines, corresponding to positions 56, 129, and 201 in the amino acids sequences of the Streptococcus mutans DHAD enzyme corresponding to SEQ ID NO:168.

    E53

    [0274] The recombinant host cell of any one of embodiments E40-E44 or E49-E50, wherein said recombinant host cell produces a product selected from the group consisting of branched chain amino acids, pantothenic acid, 2-methyl-1-butanol, 3-methyl-1-butanol, isobutanol, and combinations thereof.

    E54

    [0275] The recombinant host cell of embodiment E53, wherein said recombinant host cell produces isobutanol.

    E55

    [0276] The recombinant host cell of embodiment E54, wherein said recombinant host cell comprises an isobutanol biosynthetic pathway.

    Examples

    [0277] The meaning of abbreviations used is as follows: min means minute(s), h means hour(s), sec means second(s), l means microliter(s), ml means milliliter(s), L means liter(s), nm means nanometer(s), mm means millimeter(s), cm means centimeter(s), m means micrometer(s), mM means millimolar, M means molar, mmol means millimole(s), mole means micromole(s), g means gram(s), g means microgram(s), mg means milligram(s), rpm means revolutions per minute, w/v means weight/volume, OD means optical density, and OD.sub.600 means optical density measured at a wavelength of 600 nm.

    [0278] General Methods:

    [0279] Standard recombinant DNA and molecular cloning techniques used in the Examples are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, by T. J. Silhavy, M. L. Bennan, and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1984, and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience, N.Y., 1987.

    [0280] Materials and methods suitable for the maintenance and growth of bacterial cultures are also well known in the art. Techniques suitable for use in the following Examples may be found in Manual of Methods for General Bacteriology, Phillipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips, eds., American Society for Microbiology, Washington, D.C., 1994, or by Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition, Sinauer Associates, Inc., Sunderland, Mass., 1989. All reagents, restriction enzymes and materials used for the growth and maintenance of bacterial cells were obtained from Aldrich Chemicals (Milwaukee, Wis.), BD Diagnostic Systems (Sparks, Md.), Life Technologies (Rockville, Md.), or Sigma Chemical Company (St. Louis, Mo.), unless otherwise specified.

    Example 1. Over-Expression of DHAD Protein Encoded by the ilvD Gene from S. mutans Using a Plasmid-Based System in Yeast Cytosol

    [0281] Over-expression of a recombinant polynucleotide can be accomplished by increasing the copy number of a plasmid comprising the recombinant polynucleotide. To over-express the DHAD protein in yeast, an inducible vector was constructed. The pHR81 vector contains a Ura3 marker as well as a LEU marker with a defective promoter (see U.S. Patent Appl. Pub. No. 2007/0092957, which is incorporated by reference herein). When the yeast synthetic dropout (SD; also known as complete minimal media; Teknova) growth medium is switched from SD minus uracil to SD minus leucine, the copy number of the pHR81 plasmid increases, resulting in much higher level of expression of the recombinant polynucleotide. The pHR81 vector backbone was derived from pLH472 JEG4y (SEQ ID NO: 921) and was prepared by digesting the pLH472 JEG4y vector with SpeI and SacII.

    [0282] For over-expression of a DHAD protein, the DHAD gene ilvD from S. mutans (SEQ ID NO:167) was used (see U.S. Published Patent Appl. No. US2009-0305363A1, which is incorporated by reference herein). This gene has been cloned under the control of the FBA promoter in vector pRS423 FBA ilvD Strep-lumio (see U.S. Published Patent Appl. No. US2009-0305363A1, which is incorporated by reference herein). The region containing the FBA promoter, the ilvD gene, and FBA terminator cassette was amplified with primer set FBAp-F(NheI) and FBAt-R(SacII) (SEQ ID NOs: 915 and 916) and cloned into the pHR81 vector. The resulting expression vector was designated as pHR81 FBA-IlvD(Sm) (SEQ ID NO: 917; FIG. 1A).

    [0283] To over express the S. mutans DHAD protein, the expression vector pHR81 FBA-IlvD(Sm) was transformed into wild-type yeast strain BY4741. Transformants were selected on agar plates with SD minus uracil. For over-expression, yeast strains containing the plasmid were initially grown at 30 C. in SD liquid medium minus uracil. A fresh overnight culture (5 ml) was then transferred to a 125 ml flask containing 75 ml of SD medium minus leucine. As a control, another 5 ml of fresh overnight culture was transferred into a flask containing 75 ml of SD minus uracil. The cultures were incubated overnight before harvesting by centrifugation. The DHAD activity was measured in crude extracts of these samples using the assay described in Example 7.

    [0284] The DHAD specific activity obtained in the crude extract in the control samples grown in SD minus uracil was in the range of 0.2 to 0.3 U mg.sup.1. The average specific activity obtained from strains grown in the SD medium minus leucine, however, was 1.6 U mg.sup.1, much higher (5 to 8-fold higher) than the activity from the control samples. DHAD requires FeS cluster for its function, and it was not previously known if the native yeast FeS cluster biosynthesis pathway could accommodate an over-expressed FeS cluster requiring protein in yeast cytosol. In a previous screening experiment using a non-inducible, low-copy number vector, the DHAD from S. mutans could be recombinantly expressed in yeast cytosol with a specific activity in the range of 0.1 to 0.2 U mg.sup.1 in the crude extract (see U.S. patent application Ser. No. 12/569,636, filed on Sep. 29, 2009, which is incorporated by reference herein). Thus, in one embodiment, over-expression of a FeS cluster requiring protein, such as DHAD, in yeast using a high-copy number vector provides increased specific activity, wherein the specific activity is increased by at least about 5-fold to at least about 8-fold.

    Example 2. Over-Expression of DHAD Protein Encoded by the ilvD Gene from S. mutans Through Chromosomal Integration

    [0285] An alternate way to increase the expression of a gene in yeast is to integrate multiple copies of the gene of interest into the host cell's chromosome. To integrate the ilvD gene from S. mutans (SEQ ID NO:167) into a yeast chromosome, integration vector pZK-Delta(s)-Leu2-FBA-ilvD(Sm)-FBAt (SEQ ID NO: 918; FIG. 1B) was constructed. The integration vector backbone was derived from pSuperscript (Stratagene, La Jolla, Calif.). The S. mutans ilvD gene (nucleotides 1306-3018 of the complement strand) was cloned into the integration vector under the control of the FBA promoter (nucleotides 3026-4023 of the complement strand) so that the ilvD gene would be flanked by a yeast delta sequence (nucleotides 118-267 and 5061-5760 of the complement strand). S. cerevisiae contains more than 200 yeast delta sequences (Kim J M et al. Genome Res. 1998; 8:464-478). These delta sequences are targets for multiple integrations. The integration vector was also engineered to contain the defective LEU2 marker (nucleotides 4100-5191 of the complement strand) for selection of transformed strains with multiple integration events.

    [0286] For integration, the vector DNA was linearized with AscI and AatII digestion to generate delta sequence flanked strands of vector DNA comprising the ilvD gene, which were then transformed into the yeast strain BY4741. Transformants were selected on SD agar medium minus leucine. These transformants were then grown on SD liquid medium minus leucine at 30 C., and the cultures were harvested and analyzed for DHAD activity. The specific activity of DHAD obtained in the crude extract ranged from 0.7 to 1.2 U mg.sup.1. This specific activity was about 3- to 6-fold higher than that found in BY4741 strains transformed with an ilvD gene-containing plasmid without over-expression

    Example 3. Improvement of Specific Activity of DHAD in Yeast Deletion Strains

    [0287] Although the over-expression strains described in Examples 1 and 2 had a high level of activity, not all of the DHAD protein expressed was active. For example, the over-expressed DHAD protein accounted for approximately 5 to 10% of the total cell protein, while yielding a specific activity of from about 0.7 to 1.6 U mg.sup.1. Given that the specific activity of the purified DHAD enzyme from S. mutans is 100 U mg.sup.1, expression of DHAD at 10% of total cell protein would be expected to yield a specific activity upwards of 5 to 10 U mg.sup.1. Although not wishing to be bound by one theory, the difference between the expected and observed specific activity was likely a result of insufficient FeS cluster loading. Thus, increasing FeS cluster loading by further manipulating the over-expression strains could be used to increase the specific activity of DHAD.

    [0288] In order to improve the specific activity, yeast strains with deletions in genes involved in iron metabolism and FeS cluster sensing were used to investigate their effects on DHAD specific activity. These strains (BY4741 background) were purchased from Open Biosystem (Huntsville, Ala.) and are listed in Table 10. As described in Example 1, the high copy number plasmid pHR81 FBA-IlvD(Sm) was transformed into these strains, and DHAD over-expression was induced by changing the growth medium to SD minus leucine. Crude extracts from cultures were prepared and assayed for DHAD activity. Results are shown in Table 10.

    TABLE-US-00011 TABLE 10 Effects of deletions of genes involved in Fe metabolism. Specific Genes Function Activity (U/mg) WT 1.69 0.02 isu1 scaffold protein for FeS cluster assembling 1.31 0.56 fra2 repressor component for Aft1p 3.41 0.24 sin4 regulatory protein 1.65 0.20 mtm1 protein involved in metal metabolism 0.54 0.12 fra1 regulatory protein 0.97 0.05 grx3 glutaredoxins 5.45 0.14 aft1 global Fe regulator 0.23 0.05 aft2 paralogue to Aft1p 1.11 0.38 msn5 nuclear protein exporter 1.59 0.10 fet3 ferrous iron uptake; multi-copper oxidase 0.54 0.09 ftr1 ferrous iron uptake; permease 0.76 0.03 ccc2 copper transporter (for Fet3p) 1.23 0.17 gef1 copper transporter/loading for Fet3p 1.70 0.10 fet4 Low-affinity Fe(II) transporter 1.07 0.02 smf1 Low-affinity Fe(II) transporter 1.78 0.12 mrs3 mitochondrial iron transporter 1.51 0.13 mrs4 mitochondrial iron transporter 0.85 0.16 cth2 targeted mRNA binding and degradation 1.28 0.40 cth1 targeted mRNA binding and degradation 1.44 0.30

    [0289] Surprisingly, DHAD specific activity in the crude extract in strains with a deletion in either the FRA2 or the GRX3 gene increased by 2- to 3-fold, which was unexpected as many of the deletions tested did not increase DHAD specific activity. It has been shown that cytosolic iron sulfur assembly (CIA) machinery in yeast is responsible for assembly of FeS clusters for cytosolic proteins such as isopropylmalate isomerase (Leu1). Previous results indicate that this CIA machinery is independent from the iron sensing system involving Aft1 and a Grx3/Grx4-Fra2 heterodimer as the repressor (Rutherford et al, J Biol Chem. 280:10135-10140 (2005)).

    [0290] Another unexpected finding is the effect of a Grx3 deletion on DHAD activity. It has been shown that Grx3 and Grx4 are equivalent in function. While double mutations in both GRX3 and GRX4 genes resulted in drastic activation of the Fe regulon, mutation in Grx4 alone confers minimal phenotype (Pujol-Carrion, et al, J Cell Sci. 119:4554-4564 (2006); Ojeda, et al, J Biol Chem. 281:17661-17669 (2006).). As shown in Table 10 above, GRX3 deletion alone leads to significant improvement in DHAD specific activity.

    [0291] Thus, these results demonstrate that modulating genes involved in iron metabolism can increase the activity of an FeS cluster requiring protein such as DHAD when expressed in yeast cytosol. As outlined in FIG. 10, the effect of deletions of the FRA2 and GRX3 genes on DHAD specific activity could result from, e.g., activation of transcription of one or more of the genes in the iron regulon via the global regulator Aft1p. Although not wishing to be bound by any one theory, activation of such genes could lead to an increase in iron uptake and an increase in cytoplasmic FeS cluster biosynthesis, leading to higher FeS cluster loading of the protein (FIG. 10). Demonstration of increased FeS cluster loading is described in Example 11.

    Example 4. Effect of Expression of Aft1p and its Mutants on DHAD Specific Activity

    [0292] As described in Example 3 and outlined in FIG. 10, Fra2, Grx3, and Grx4 are repressors that regulate the function of Aft1p (Kumnovics, et al., J. Biol. Chem. 283:10276-10286 (2008)). Aft1p is a global regulator of iron. Activation of genes involved in iron uptake and metabolism requires the nuclear localization of Aft1p. Expression of Aft1 constitutive mutants or an increase in the expression of wild-type Aft1p, could lead to the activation of the Fe regulon in a wild-type strain or in an AFT1 deletion strain (Yamaguchi-Iwai, et al, EMBO J. 14:1231-1239 (1995); Yamaguchi-Iwai, et al, J. Biol. Chem. 277:18914-18918 (2002); Kaplan, et al, Chem. Rev. 109:4536-4552(2009)). Based on the novel findings described in Example 3, it is possible that expression of Aft1p protein and its constitutive mutants may improve the active fraction of the DHAD enzyme which requires FeS clusters for its activity.

    [0293] To examine this possibility, the wild-type AFT1 gene and its constitutive mutants were cloned using a centromere vector pRS411 (ATCC Number: 87538; SEQ ID NO: 919). This vector has an ampicillin selection marker for growth in E. coli and a methionine nutritional marker for selection in yeast. The wild-type AFT1 gene, including its own promoter and terminator, can be cloned between the KpnI and SacI sites, resulting in the construct pRS411-Aft1+flanking (SEQ ID NO: 920; FIG. 2). A similar strategy can be used to clone genes that encode Aft1 constitutive mutants. The Aft1 constitutive mutants with substitutions at amino acids L99 to A and C291 to F (with respect to SEQ ID NO: 703) were first examined. The pRS411 constructs with genes encoding the wild-type AFT1 gene or constitutive mutants were transformed, along with the expression vector pHR81 FBA IlvD(Sm), into the wild-type yeast strain BY4741 or a yeast strain with a deletion in AFT1, GRX3, or FRA2. Transformants were selected on agar plates with SD medium minus methionine and uracil. Transformed strains were grown in SD medium minus methionine and leucine to over-express the DHAD protein in the presence of these genes or mutants. The DHAD activity in the crude extract of these cultures were measured.

    [0294] Results of expression of wild-type Aft1p, Aft1p(C291F), and Aft1p(L99A) are shown in Table 11. A moderate increase in DHAD specific activity was observed with Aft1p (C291F) as compared to wild-type Aft1p. A much higher increase in DHAD activity was observed with Aft1p(L99A). The specific activity of DHAD in yeast expressing Aft1p(L99A) was similar to the specific activity obtained in the GRX3 deletion strain (see Table 10).

    TABLE-US-00012 TABLE 11 Effects of expression of Aft1p and its mutants on the activity of DHAD from S. mutans in aft1 strain. Plasmids Specific Activity (U/mg) pHR81-FBA-ilvD(Sm) + pRS411-Aft1 2.60 0.52 pHR81-FBA-ilvD(Sm) + pRS411-Aft1(C291L) 3.79 0.23 pHR81-FBA-ilvD(Sm) + pRS411-Aft1(L99A) 5.41 0.41

    Example 5. Increase in Cytosolic DHAD Specific Activity in a CCC1 Deletion Strain

    [0295] The exact mechanism of increasing FeS cluster biosynthesis capability for cytosolic DHAD protein is unknown. Based on the findings with FRA2 and GRX3 deletion strains (Example 3) and with expression of Aft1p mutants (Example 4), increasing the availability of the Fe content in the cytosol may also improve the DHAD specific activity. CCC1 deletion has been shown to increase the Fe content of the cytosol (Li L, et al, J Biol Chem. 276:29515-29519 (2001)). To test this hypothesis, the CCC1 deletion strain of BY4741 was transformed with plasmid pHR81 FBA-IlvD(Sm) as described in Example 1. The crude extracts of cells with the plasmid were assayed for DHAD activity. Table 13 shows the results of the experiment. When the CCC1 deletion strain with the DHAD plasmid was grown in SD medium lacking uracil, an increase in DHAD specific activity was found as compared to the wild-type cells with the same plasmid. When extra Fe was added, a further increase in DHAD was observed in the CCC1 deletion strain. Addition of Fe showed no effect on DHAD specific activity in the wild-type cells. To achieve an over expression of the DHAD protein, strains were grown in SD medium lacking leucine (Example 1). Under these conditions, an increase in DHAD specific activity was detected.

    TABLE-US-00013 TABLE 13 Expression of DHAD from S. mutans in the BY4741(ccc1) strain. Strains Growth conditions No extra Fe 100 uM Fe Wild-type -Ura 0.37 0.03 0.46 0.04 ccc1 -Ura 0.83 0.04 1.24 0.03 Wild-type -Leu 1.60 0.17 1.83 0.31 ccc1 -Leu 2.53 0.29 2.7 1.07

    Example 6. Improvement of Specific Activity of DHAD from L. lactis Expressed in Yeast

    [0296] Examples 1-5 used the DHAD enzyme from S. mutans to identify novel ways to increase the specific activity of DHAD when expressed in yeast. In this example, we investigated the application of these methods to improve the specific activity of the DHAD enzyme from L. lactis (SEQ ID NO: 958). The IlvD gene from L. lactis (SEQ ID NO: 959) was cloned into the pHR81 vector under the control of the FBA promoter (FIG. 11). The resulting construct pHR81 FBA-IlvD(L1)-ADHt (FIG. 11; SEQ ID NO: 960) was transformed into strains with a deletion in either the FRA2 or GRX3 gene. To study the effect of the constitutive mutant Aft1p(L99A) on DHAD from L. lactis, pHR81 FBA-IlvD(L1)-ADHt was co-transformed into yeast host along with vector pRS411-Aft1(L99A) (see Example 4). To over-express the IlvD gene, transformants were grown in yeast synthetic drop-out medium lacking leucine or lacking both leucine and methionine, depending on the strains. Enzymatic assay results are summarized in Table 14. Deletions in FRA2 and GRX3 genes increased the specific activity of the DHAD from L. lactis when expressed in yeast. In addition, expression of the Aft1 constitutive mutant L99A similarly increased the specific activity of the DHAD from L. lactis.

    TABLE-US-00014 TABLE 14 Over-expression of bacterial DHAD from L. lactis in S. cerevisiae. Strains Specific Activity (U/mg) Wild-type 0.23 0.04 aft1 + Aft1(L99A) 0.95 0.31 fra2 0.72 0.04 grx3 0.96 0.05

    Example 7. Determining the Specific Activity of DHAD. (Assay Method)

    [0297] Quantitation of the activity of proteins requiring FeS clusters can be done in an assay format. If the protein is an enzyme, such as DHAD, the activity is typically expressed in terms of units of activity. A unit of enzyme activity has been defined by the Enzyme Commission of the International Union of Biochemistry as the amount of enzyme that will catalyze the transformation of 1 micromole of the substrate per minute under standard conditions (International Union of Biochemistry, Report of the Commission on Enzymes, Oxford: Pergamon Press, 1961). Further, the term specific activity is defined as the units of activity in a given amount of enzyme. Thus, the specific activity is not directly measured but is calculated by dividing 1) the activity in units/ml of the enzyme sample by 2) the concentration of protein in that sample, so the specific activity is expressed as units/mg. The specific activity of a sample of pure, fully active enzyme is a characteristic of that enzyme. The specific activity of a sample of a mixture of proteins is a measure of the relative fraction of protein in that sample that is composed of the active enzyme of interest. DHAD activity can be measured spectrophotometrically in an end point assay using the 2,4-dinitrophenylhydrazine (2,4-DNPH) method as described in Flint, D. H. and M. H. Emptage, J. Biol. Chem. 263:3558-64 (1988). In this assay, the 2,4-DNPH reacts with the keto group of the 2-ketoisovaleric acid product to form a hydrazone, which is detected by its absorbance at 550 nm. The assay buffer contains 50 mM Tris-HCl, 10 mM MgCl.sub.2, pH 8.0 (TM8 buffer). Sufficient 2,3-dihydroxyisovaleric acid is added to the assay buffer so that its final concentration in the assay mix is 10 mM. In each assay, an enzyme containing solution and sufficient substrate containing buffer are mixed so that the final volume is 1 ml. The assay mixture is normally incubated at 37 C. for 30 minutes.

    [0298] The assay is stopped by adding 250 l of 10% (W/V) trichloroacetic acid. A few minutes later, 500 l of a saturated solution of 2,4-DNPH in 1 N HCl is added. The mixture is incubated at room temperature for at least 10 min to allow formation of the hydrazone. Next, 1.75 ml of NaOH is added to solubilize the hydrazone and to precipitate unreacted 2,4-DNPH. A few minutes after the NaOH is added, the assay tubes are placed in a sonicator bath for 10 min to degas. The tubes are then centrifuged in a desk top centrifuge at top speed for 2 min to sediment the precipitate.

    [0299] The absorbance of the supernatant is then read at 550 nm within 1 hour. The absorbance of the sample assays minus the control assays are divided by 2600 (determined from an -ketoisovaleric acid standard curve) to find the units of enzyme activity in the assay. This assay was used in the Examples described herein in which DHAD specific activity was determined.

    Example 8. Purification and Characterization of DHAD from S. mutans Expressed in E. coli

    [0300] DHAD from S. mutans was purified and characterized as follows. Six liters of culture of the E. coli Turner strain harboring the pET28a plasmid containing the S. mutans ilvD gene were grown and induced with IPTG. The S. mutans DHAD was purified by breaking the cells with a sonicator in TM8 buffer (see Example 7), centrifuging the crude extract to remove cell debris, then loading the supernatant of the crude extract on a Q Sepharose (GE Healthcare) column and eluting the DHAD with an increasing concentration of NaCl in TM8 buffer. The fractions containing DHAD were pooled, brought to 1 M (NH.sub.4).sub.2SO.sub.4, and loaded onto a Phenyl-Sepharose column (GE Healthcare) equilibrated with 1 M (NH.sub.4).sub.2SO.sub.4. The DHAD was eluted with a decreasing concentration of (NH.sub.4).sub.2SO.sub.4. The fractions containing DHAD were pooled, concentrated to 10 ml, loaded onto a 35600 cm Superdex-200 column (577 ml bed volume) (GE Healthcare) column, and eluted with TM8 buffer. As judged by SDS gels, the purity of the S. mutans DHAD eluted from the Superdex column was estimated to be 90%.

    [0301] The UV-visible spectrum of the purified S. mutans DHAD is shown in FIG. 3. The number of peaks above 300 nm is typical of proteins with [2Fe-2S] clusters. The S. mutans DHAD was reduced with sodium dithionite, and its EPR spectra was measured at various temperatures. FIG. 4 shows the EPR spectra measured at temperatures between 20 K and 70 K. The EPR spectrum of the S. mutans DHAD is measureable up to 70 K, which indicates that it contains a [2Fe-2S] cluster and not a [4Fe-4S] cluster because the EPR spectra of proteins containing [4Fe-4S] clusters are not observable at temperatures much above 10 K.

    [0302] The exact protein content of the batch of purified S. mutans DHAD with the highest specific activity using the Bradford protein assay was determined by quantitative amino acid analysis. Combining the activity with the protein content gave a specific activity of 100 units/mg for this batch. The iron content of this batch determined by ICP-MS using methodology known in the art was 2 molecules of iron per molecule of DHAD. This is consistent with this batch of S. mutans DHAD containing a full complement of [2Fe-2S] clusters.

    Example 9. Separating the Forms of DHAD in Yeast Crude Extract from Other Proteins in the Cell and from Each Other to Measure the Amount of DHAD Present

    [0303] DHAD protein in yeast cells exists in the forms of dimers with two FeS clusters/dimer, one FeS cluster/dimer, and zero FeS clusters/dimer. A method to measure the concentration of these three forms of DHAD protein in yeast crude extracts was developed using a Mono Q column and a Source 15 PHE PE 4.6/100 column (both columns obtained from GE Healthcare), and is described below.

    [0304] Frozen yeast cells were thawed, suspended in 50 mM Tris-HCl, 10 mM MgCl.sub.2, pH 8.0 (TM8), then broken by bead beating. The broken cells are centrifuged to remove the cell debris and generate the yeast crude extract.

    [0305] The crude extract was loaded onto a 4 ml Mono Q column attached to an AKTA chromatographic system (GE Healthcare) with the A buffer being TM8 and B buffer being TM8 containing 0.5 M NaCl. The column was equilibrated with A buffer before the sample was loaded. The S. mutans DHAD bound to the Mono Q column under these conditions. After the sample was loaded onto the column, the column was washed with 10 mL of TM8 buffer, then the concentration of NaCl in the eluant was increased to 0.22 M NaCl. This was followed by a 30 mL linear gradient from 0.22 M to 0.35 M NaCl. During chromatography, the A.sub.215 of the column eluate was monitored, and 1 mL fractions were collected. The fractions were assayed for DHAD activity. The sum of the activity of the DHAD in the fractions off the Mono Q column was close to that in the crude extract. Good separations using this column were obtained with as much as 5 mL of crude extract representing up to 1 g of yeast cell paste. The DHAD containing fractions were pooled and made 1.35 M in (NH.sub.4).sub.2SO.sub.4 in preparation for chromatography on the PHE column.

    [0306] The Source 15 PHE PE 4.6/100 column was also attached to an AKTA chromatographic system with the A buffer being TM8 containing 1.5 M (NH.sub.4).sub.2SO.sub.4 and the B buffer being TM8. Before each run the column was equilibrated with 90% A. The pooled fractions from the Mono Q column made 1.35 M in (NH.sub.4).sub.2SO.sub.4 were loaded onto the PHE column, and at this (NH.sub.4).sub.2SO.sub.4 concentration, the DHAD bound to the column. During chromatography, the A.sub.215 of the column eluate was monitored, and 1 mL fractions were collected. The DHAD eluted from the column in three peaks when the column was developed with a 30 mL decreasing linear gradient of (NH.sub.4).sub.2SO.sub.4 from 1.35 M to 0 M. The area of each of the DHAD peaks was determined by integration. This elution scheme was found to be ideal for separating S. mutans DHAD from other yeast proteins that co-eluted with it off the Mono Q column. SDS gels run on fractions where the peaks eluted showed that well over 90% of the protein present in these peaks was DHAD when it was expressed at 1% of the soluble protein in yeast cells. The fractions containing each of the three DHAD peaks were pooled separately. Based on the UV-visible absorbent spectrum and the iron and sulfide contents of the DHAD in these peaks, it was determined that the first peak contained DHAD with two [2Fe-2S] clusters/dimers, the second peak contained DHAD with one [2Fe-2S] cluster/dimer, and the third peak contained DHAD with zero [2Fe-2S] clusters/dimers. Thus, in its native state, the S. mutans DHAD enzyme appears to exist as a dimer of two monomeric DHAD proteins.

    [0307] A standard curve relating the amount of DHAD present in a sample to the sum of the area of the three DHAD peaks off the PHE column was obtained as follows. Crude extract from yeast cells containing no S. mutans DHAD was spiked with various amounts of purified S. mutans DHAD. These extracts were subjected to chromatography on the Mono Q and PHE columns as described above. The area under each of the three DHAD peaks was integrated. The sum of these areas was plotted against the amount of pure DHAD spiked into the yeast crude extracts. The plot was used to derive the following equation:


    #g DHAD in sample of crude extract=0.507(summed area counts of the three DHAD peaks)

    [0308] The DHAD activity in a crude extract of yeast can be readily determined by the method described in Example 7. The amount of DHAD protein in yeast crude extracts can be determined by the procedure outlined in this Example. With this data, one can calculate the specific activity of the S. mutans DHAD protein per se in crude extracts according to the procedure in Example 10.

    Example 10. Methods to Determine the Fraction of DHAD in Yeast Crude Extract Loaded with FeS Clusters

    [0309] When a purified FeS cluster requiring protein contains a full complement of clusters, it will have a characteristic specific activity. As previously mentioned, for S. mutans DHAD this specific activity is 100 units/mg when it has a full complement of clusters.

    [0310] A DHAD sample that has on average one FeS cluster/per dimer could contain some dimers with two clusters, some dimers with one cluster, and some dimers with no clusters. Alternatively, if cluster addition to a dimer is all or none and on average there is one FeS cluster/dimer in a sample, half of the DHAD dimers would have a full complement of clusters and half would be without clusters. From the results in Example 9, we know that all or none behavior is not followed by S. mutans DHAD because a species with one cluster per dimer can be isolated. We have found that dimers of S. mutans DHAD that have one FeS cluster have 1/2 the activity of dimers with two FeS clusters/dimer, i.e., the specific activity of S. mutans DHAD with 1/2 of a full complement of FeS clusters is 50 units/mg. This means the absence of an FeS cluster in one of the monomers of a dimer does not influence the activity of the other monomer should it contain an FeS cluster.

    [0311] With the information obtained with the procedures described in Example 9 and the information described so far in this Example, one can determine the degree of FeS cluster loading in a DHAD sample in two different ways.

    [0312] First, one can compare the ratio of the amounts of the three DHAD peaks to determine the relative amount that has two clusters per dimer, one cluster per dimer, and zero clusters per dimer. This gives the degree of cluster loading. For example, if the area of peak 1 off the PHE column was 25%, peak 2 was 50%, and peak 3 was 25% of the sum of the areas of peak 1, peak 2, and peak 3, the percent of the monomers loaded with clusters can be calculated to be 50% according to the following equation:


    100*[2*(area of peak 1)+1*(area of peak 2)+0*(area of peak 3)]/[2*(total peak area)]=% DHAD monomers with FeS clusters.

    [0313] Second, one can use the specific activity of the DHAD present to calculate the degree of cluster loading. One determines the specific activity by dividing the activity determined as described in Example 7 with the amount of DHAD protein determined as described in Example 9. The specific activity is then divided by 100 U/mg to determine the fraction of monomers loaded with clusters. This fraction is multiplied by 100 to determine the percent DHAD monomers with FeS clusters.

    [0314] For example if the specific activity is found to be 50 U/mg, the fraction loaded with clusters is 0.5 and the percent DHAD monomers with FeS clusters is 50%.

    [0315] To make such a calculation, the specific activity must be based on the concentration of the DHAD protein in the crude extract (not the total protein). Determining the concentration of S. mutans DHAD in the presence of other proteins can be accomplished using methods described in Example 9.

    Example 11. Specific Activities and Inferred Fraction of the DHAD-Loaded Proteins

    [0316] To determine the fraction of DHAD monomers loaded with FeS clusters in several yeast strains grown under different conditions, the methods described above were used. Results are shown in Table 15.

    TABLE-US-00015 TABLE 15 Specific Activities and Inferred Fraction of the DHAD Loaded Proteins. BY DHAD SA in % DHAD is of % Cluster Yeast Growth Crude Extracts Crude Extract Occupancy of Strain Conditions (U/mg) Protein DHAD WT -Ura 0.46 2.3 10 FRA2 -Ura 0.8 2.5 14 GRX3 -Ura 0.99 2.4 23 WT -Leu 0.82 11 7 FRA2 -Leu 2.2 11 19 GRX3 -Leu 3.5 9.5 31

    [0317] These results indicate that under these growth conditions, the level of FeS cluster loading in the DHAD in strains lacking FRA2 and GRX3 is higher than in strains containing functional copies of these genes. Thus, a higher fraction of the DHAD protein is in the active form in the deletion strains because the content of FeS clusters (which are required for activity) is higher.

    Example 12. Construction of Saccharomyces cerevisiae Strains PNY1505, PNY1541, and PNY1542

    [0318] The purpose of this Example was to construct Saccharomyces cerevisiae strains PNY1505, PNY1541, and PNY1542. These strains were derived from PNY1503 (BP1064). PNY1503 was derived from CEN.PK 113-7D (CBS 8340; Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversiry Centre, Netherlands). The construction of PNY1503 (BP1064) is described in U.S. Appl. No. 61/368,436, incorporated by reference herein, and in Example 13 below. PNY1505 contains a deletion of the FRA2 gene. PNY1541 and PNY1542 contain an integration of the AFT/gene with the L99A mutation (AFT1-L99A) at the YPRC15 locus.

    [0319] Deletions/integrations were created by homologous recombination with PCR fragments containing regions of homology upstream and downstream of the target gene and the URA3 gene for selection of transformants. The URA3 gene was removed by homologous recombination to create a scarless deletion/integration.

    [0320] The scarless deletion/integration procedure was adapted from Akada et al., Yeast, 23(5):399-405 (2006). The PCR cassette for each deletion/integration was made by combining four fragments, A-B-U-C, either by overlapping PCR or by cloning the individual fragments, and gene to be integrated, into a plasmid prior to amplifying the entire cassette by PCR for the deletion/integration procedure. The PCR cassette contained a selectable/counter-selectable marker, URA3 (Fragment U), consisting of the native CEN.PK 113-7D URA3 gene, along with the promoter (250 bp upstream of the URA3 gene) and terminator (150 bp downstream of the URA3 gene) regions. Fragments A (150 bp to 500 bp long) and C (250 bp long) corresponded to the sequence immediately upstream of the target gene (Fragment A) and the 3 sequence of the target gene (Fragment C). Fragments A and C were used for integration of the cassette into the chromosome by homologous recombination. Fragment B (500 bp long) corresponded to the 500 bp immediately downstream of the target gene and was used for excision of the URA3 marker and Fragment C from the chromosome by homologous recombination, as a direct repeat of the sequence corresponding to Fragment B was created upon integration of the cassette into the chromosome.

    [0321] Using the PCR product ABUC cassette, the URA3 marker was first integrated into and then excised from the chromosome by homologous recombination. The initial integration deleted the gene, excluding the 3 sequence. Upon excision, the 3 region of the gene was also deleted. For integration of genes using this method, the gene to be integrated was included in the cassette between fragments A and B.

    FRA2 Deletion

    [0322] The FRA2 deletion (also described in U.S. Appl. No. 61/380,563, incorporated by reference herein) was designed to delete 250 nucleotides from the 3 end of the coding sequence, leaving the first 113 nucleotides of the FRA2 coding sequence intact. An in-frame stop codon was present 7 nucleotides downstream of the deletion. The four fragments for the PCR cassette for the scarless FRA2 deletion were amplified using Phusion High Fidelity PCR Master Mix (New England BioLabs; Ipswich, Mass.) and CEN.PK 113-7D genomic DNA as template, prepared with a Gentra Puregene Yeast/Bact kit (Qiagen; Valencia, Calif.). FRA2 Fragment A was amplified with primer oBP594 (SEQ ID NO: 961) and primer oBP595 (SEQ ID NO: 962), containing a 5 tail with homology to the 5 end of FRA2 Fragment B. FRA2 Fragment B was amplified with primer oBP596 (SEQ ID NO: 963), containing a 5 tail with homology to the 3 end of FRA2 Fragment A, and primer oBP597 (SEQ ID NO: 964), containing a 5 tail with homology to the 5 end of FRA2 Fragment U. FRA2 Fragment U was amplified with primer oBP598 (SEQ ID NO: 965), containing a 5 tail with homology to the 3 end of FRA2 Fragment B, and primer oBP599 (SEQ ID NO: 966), containing a 5 tail with homology to the 5 end of FRA2 Fragment C. FRA2 Fragment C was amplified with primer oBP600 (SEQ ID NO: 967), containing a 5 tail with homology to the 3 end of FRA2 Fragment U, and primer oBP601 (SEQ ID NO: 968). PCR products were purified with a PCR Purification kit (Qiagen). FRA2 Fragment AB was created by overlapping PCR by mixing FRA2 Fragment A and FRA2 Fragment B and amplifying with primers oBP594 (SEQ ID NO: 961) and oBP597 (SEQ ID NO: 964). FRA2 Fragment UC was created by overlapping PCR by mixing FRA2 Fragment U and FRA2 Fragment C and amplifying with primers oBP598 (SEQ ID NO: 965) and oBP601 (SEQ ID NO: 968). The resulting PCR products were purified on an agarose gel followed by a Gel Extraction kit (Qiagen). The FRA2 ABUC cassette was created by overlapping PCR by mixing FRA2 Fragment AB and FRA2 Fragment UC and amplifying with primers oBP594 (SEQ ID NO: 961) and oBP601 (SEQ ID NO: 968). The PCR product was purified with a PCR Purification kit (Qiagen).

    [0323] Competent cells of PNY1503 were made and transformed with the FRA2 ABUC PCR cassette using a Frozen-EZ Yeast Transformation II kit (Zymo Research; Orange, Calif.). Transformation mixtures were plated on synthetic complete media lacking uracil supplemented with 1% ethanol at 30 C. Transformants with a fra2 knockout were screened for by PCR with primers oBP602 (SEQ ID NO: 969) and oBP603 (SEQ ID NO: 970) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). A correct transformant was grown in YPE (yeast extract, peptone, 1% ethanol) and plated on synthetic complete medium supplemented with 1% ethanol and containing 5-fluoro-orotic acid (0.1%) at 30 C. to select for isolates that lost the URA3 marker. The deletion and marker removal were confirmed by PCR with primers oBP602 (SEQ ID NO: 969) and oBP603 (SEQ ID NO: 970) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). The absence of the FRA2 gene from the isolate was demonstrated by a negative PCR result using primers specific for the deleted coding sequence of FRA2, oBP605 (SEQ ID NO: 971) and oBP606 (SEQ ID NO: 972). The correct isolate was selected as strain CEN.PK 113-7D MATa ura3A::loxP his3 pdc6 pdc1::P[PDC1]-DHAD|ilvD_Sm-PDC1t pdc5::P[PDC5]-ADH|sadB_Ax-PDC5t gpd2::loxP fra2 and designated as PNY1505 (BP1135).

    TABLE-US-00016 TABLE16 PrimersusedintheFRA2Deletion SEQ Primer ID Name NO PrimerSequence oBP594 961 agctgtctcgtgttgtgggttt oBP595 962 cttaataatagaacaatatcatcct ttacgggcatcttatagtgtcgtt oBP596 963 gcgccaacgacactataagatgccc gtaaaggatgatattgttctatta oBP597 964 tatggaccctgaaaccacagccaca ttgcaacgacgacaatgccaaacc oBP598 965 tccttggtttggcattgtcgtcgtt gcaatgtggctgtggtttcagggt oBP599 966 atcctctcgcggagtccctgttcag taaaggccatgaagctttttcttt oBP600 967 attggaaagaaaaagcttcatggcc tttactgaacagggactccgcgag oBP601 968 tcataccacaatcttagaccat oBP602 969 tgttcaaacccctaaccaacc oBP603 970 tgttcccacaatctattaccta oBP605 971 tactgaacagggactccgcga oBP606 972 tcataccacaatcttagacca

    [0324] YPRC15 Deletion and AFT1-L99A Integration

    [0325] The YPRC15 locus was deleted and replaced with AFT1-L99A along with the native promoter region (800 bp) and terminator region (800 bp) from AFT1. The scarless cassette for the YPRC15 deletion-AFT1L99A integration was first cloned into plasmid pUC19-URA3MCS (described in U.S. Appl. No. 61/356,379, incorporated by reference herein). The vector is pUC19 based and contains the sequence of the URA3 gene from S. cerevisiae CEN.PK 113-7D situated within a multiple cloning site (MCS). pUC19 (American Type Culture Collection, Manassas, Va.; ATCC #37254) contains the pMB1 replicon and a gene coding for beta-lactamase for replication and selection in Escherichia coli. In addition to the coding sequence for URA3, the sequences from upstream (250 bp) and downstream (150 bp) of this gene are present for expression of the URA3 gene in yeast. The vector can be used for cloning purposes and can be used as a yeast integration vector.

    [0326] The DNA encompassing the URA3 coding region along with 250 bp upstream and 150 bp downstream of the URA3 coding region from Saccharomyces cerevisiae CEN.PK 113-7D (CBS 8340; Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversity Centre, Netherlands) genomic DNA was amplified with primers oBP438 (SEQ ID NO: 1033), containing BamHI, AscI, PmeI, and FseI restriction sites, and oBP439 (SEQ ID NO: 1034), containing XbaI, Pad, and Nod restriction sites. Genomic DNA was prepared using a Gentra Puregene Yeast/Bact kit (Qiagen). The PCR product and pUC19 were ligated with T4 DNA ligase after digestion with BamHI and XbaI to create vector pUC19-URA3MCS. The vector was confirmed by PCR and sequencing with primers oBP264 (SEQ ID NO:1031) and oBP265 (SEQ ID NO: 1032).

    [0327] YPRC15 Fragment A was amplified from genomic DNA, prepared as above, with primer oBP622 (SEQ ID NO: 973), containing a KpnI restriction site, and primer oBP623 (SEQ ID NO: 974), containing a 5 tail with homology to the 5 end of YPRC15 Fragment B. YPRC15 Fragment B was amplified from genomic DNA with primer oBP624 (SEQ ID NO: 975), containing a 5 tail with homology to the 3 end of YPRC15 Fragment A, and primer oBP625 (SEQ ID NO: 976), containing a FseI restriction site. PCR products were purified with a PCR Purification kit (Qiagen). YPRC15 Fragment A-YPRC15 Fragment B was created by overlapping PCR by mixing the YPRC15 Fragment A and YPRC15 Fragment B PCR products and amplifying with primers oBP622 (SEQ ID NO: 973) and oBP625 (SEQ ID NO: 976). The resulting PCR product was digested with KpnI and FseI and ligated with T4 DNA ligase into the corresponding sites of pUC19-URA3MCS after digestion with the appropriate enzymes. YPRC15 Fragment C was amplified from genomic DNA with primer oBP626 (SEQ ID NO: 977), containing a NotI restriction site, and primer oBP627 (SEQ ID NO: 978), containing a PacI restriction site. The YPRC15 Fragment C PCR product was digested with NotI and PacI and ligated with T4 DNA ligase into the corresponding sites of the plasmid containing YPRC15 Fragments AB. AFT1-L99A, along with the native promoter region (800 bp) and terminator region (800 bp) from AFT1, was amplified using pRS411-AFT1(L99A) (described in Example 4 above) as template with primer oBP744 (SEQ ID NO: 979), containing an AscI restriction site, and primer oBP745 (SEQ ID NO: 980), containing a PmeI restriction site. The PCR product was digested with AscI and PmeI and ligated with T4 DNA ligase into the corresponding sites of the plasmid containing YPRC15 Fragments ABC. The entire integration cassette was amplified from the resulting plasmid with primers oBP622 (SEQ ID NO: 973) and oBP627 (SEQ ID NO: 978).

    [0328] Competent cells of PNY1503 were made and transformed with the YPRC15 deletion/AFT1-L99A integration cassette PCR product using a Frozen-EZ Yeast Transformation II kit (Zymo Research). Transformation mixtures were plated on synthetic complete media lacking uracil supplemented with 1% ethanol at 30 C. Transformants were grown in YPE (1% ethanol) and plated on synthetic complete medium supplemented with 1% EtOH and containing 5-fluoro-orotic acid (0.1%) at 30 C. to select for isolates that lost the URA3 marker. The deletion of YPRC15 and integration of AFT1L99A were confirmed by PCR with external primers oBP636 (SEQ ID NO: 981) and oBP637 (SEQ ID NO: 982) and with AFT1-L99A specific primer HY840 (SEQ ID NO: 983) and external primer oBP637 (SEQ ID NO: 982) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen) and by colony PCR. Correct independent isolates of CEN.PK 113-7D MATa ura3::loxP his3 pdc6 pdc1::P[PDC1]-DHAD|ilvD_Sm-PDC1t pdc5::P[PDC5]-ADH|sadB_Ax-PDC5t gpd2::loxP yprc15::AFT1L99A were designated as strains PNY1541 and PNY1542.

    TABLE-US-00017 TABLE17 PrimersusedintheYPRC15Deletionand AFT1-L99AIntegration SEQ Primer ID Name NO PrimerSequence oBP622 973 aattggtaccccaaaaggaatattgggtcaga oBP623 974 ccattgtttaaacggcgcgccggatcctttgc gaaaccctatgctctgt oBP624 975 gcaaaggatccggcgcgccgtttaaacaatgg aaggtcgggatgagcat oBP625 976 aattggccggcctacgtaacattctgtcaaccaa oBP626 977 aattgcggccgcttcatatatgacgtaataaaat oBP627 978 aattttaattaattttttttcttggaatcagtac oBP744 979 aattggcgcgccagagtacaacgatcaccgcctg oBP745 980 aattgtttaaacgaacgaaagttacaaaatctag oBP636 981 catttttttccctctaagaagc oBP637 982 tttttgcacagttaaactaccc HY840 983 CCAAAATCAGCCCCACGACGGCCATA

    Example 13. Construction of Saccharomyces cerevisiae Strain BP1064 (PNY1503)

    [0329] The strain BP1064 was derived from CEN.PK 113-7D (CBS 8340; Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversity Centre, Netherlands) and contains deletions of the following genes: URA3, HIS3, PDC1, PDC5, PDC6, and GPD2.

    [0330] Deletions, which completely removed the entire coding sequence, were created by homologous recombination with PCR fragments containing regions of homology upstream and downstream of the target gene and either a G418 resistance marker or URA3 gene for selection of transformants. The G418 resistance marker, flanked by loxP sites, was removed using Cre recombinase. The URA3 gene was removed by homologous recombination to create a scarless deletion, or if flanked by loxP sites was removed using Cre recombinase.

    [0331] The scarless deletion procedure was adapted from Akada et al. 2006 Yeast v23 p399. In general, the PCR cassette for each scarless deletion was made by combining four fragments, A-B-U-C, by overlapping PCR. The PCR cassette contained a selectable/counter-selectable marker, URA3 (Fragment U), consisting of the native CEN.PK 113-7D URA3 gene, along with the promoter (250 bp upstream of the URA3 gene) and terminator (150 bp downstream of the URA3 gene). Fragments A and C, each 500 bp long, corresponded to the 500 bp immediately upstream of the target gene (Fragment A) and the 3 500 bp of the target gene (Fragment C). Fragments A and C were used for integration of the cassette into the chromosome by homologous recombination. Fragment B (500 bp long) corresponded to the 500 bp immediately downstream of the target gene and was used for excision of the URA3 marker and Fragment C from the chromosome by homologous recombination, as a direct repeat of the sequence corresponding to Fragment B was created upon integration of the cassette into the chromosome. Using the PCR product ABUC cassette, the URA3 marker was first integrated into and then excised from the chromosome by homologous recombination. The initial integration deleted the gene, excluding the 3 500 bp. Upon excision, the 3 500 bp region of the gene was also deleted. For integration of genes using this method, the gene to be integrated was included in the PCR cassette between fragments A and B.

    URA3 Deletion

    [0332] To delete the endogenous URA3 coding region, a ura3::loxP-kanMX-loxP cassette was PCR-amplified from pLA54 template DNA (SEQ ID NO: 986). pLA54 contains the K. lactis TEF1 promoter and kanMX marker, and is flanked by loxP sites to allow recombination with Cre recombinase and removal of the marker. PCR was done using Phusion DNA polymerase and primers BK505 and BK506 (SEQ ID NOs: 987 and 988, respectively). The URA3 portion of each primer was derived from the 5 region upstream of the URA3 promoter and 3 region downstream of the coding region such that integration of the loxP-kanMX-loxP marker resulted in replacement of the URA3 coding region. The PCR product was transformed into CEN.PK 113-7D using standard genetic techniques (Methods in Yeast Genetics, 2005, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pp. 201-202) and transformants were selected on YPD containing G418 (100 g/ml) at 30 C. Transformants were screened to verify correct integration by PCR using primers LA468 and LA492 (SEQ ID NOs: 989 and 990, respectively) and designated CEN.PK 113-7D ura3::kanMX.

    HIS3 Deletion

    [0333] The four fragments for the PCR cassette for the scarless HIS3 deletion were amplified using Phusion High Fidelity PCR Master Mix (New England BioLabs; Ipswich, Mass.) and CEN.PK 113-7D genomic DNA as template, prepared with a Gentra Puregene Yeast/Bact kit (Qiagen; Valencia, Calif.). HIS3 Fragment A was amplified with primer oBP452 (SEQ ID NO: 991) and primer oBP453 (SEQ ID NO: 992), containing a 5 tail with homology to the 5 end of HIS3 Fragment B. HIS3 Fragment B was amplified with primer oBP454 (SEQ ID NO: 993), containing a 5 tail with homology to the 3 end of HIS3 Fragment A, and primer oBP455 (SEQ ID NO: 994), containing a 5 tail with homology to the 5 end of HIS3 Fragment U. HIS3 Fragment U was amplified with primer oBP456 (SEQ ID NO: 995), containing a 5 tail with homology to the 3 end of HIS3 Fragment B, and primer oBP457 (SEQ ID NO: 996), containing a 5 tail with homology to the 5 end of HIS3 Fragment C. HIS3 Fragment C was amplified with primer oBP458 (SEQ ID NO: 997), containing a 5 tail with homology to the 3 end of HIS3 Fragment U, and primer oBP459 (SEQ ID NO: 998). PCR products were purified with a PCR Purification kit (Qiagen). HIS3 Fragment AB was created by overlapping PCR by mixing HIS3 Fragment A and HIS3 Fragment B and amplifying with primers oBP452 (SEQ ID NO: 991) and oBP455 (SEQ ID NO: 994). HIS3 Fragment UC was created by overlapping PCR by mixing HIS3 Fragment U and HIS3 Fragment C and amplifying with primers oBP456 (SEQ ID NO: 995) and oBP459 (SEQ ID NO: 998). The resulting PCR products were purified on an agarose gel followed by a Gel Extraction kit (Qiagen). The HIS3 ABUC cassette was created by overlapping PCR by mixing HIS3 Fragment AB and HIS3 Fragment UC and amplifying with primers oBP452 (SEQ ID NO: 991) and oBP459 (SEQ ID NO: 998). The PCR product was purified with a PCR Purification kit (Qiagen).

    [0334] Competent cells of CEN.PK 113-7D ura3::kanMX were made and transformed with the HIS3 ABUC PCR cassette using a Frozen-EZ Yeast Transformation II kit (Zymo Research; Orange, Calif.). Transformation mixtures were plated on synthetic complete media lacking uracil supplemented with 2% glucose at 30 C. Transformants with a his3 knockout were screened for by PCR with primers oBP460 (SEQ ID NO: 999) and oBP461 (SEQ ID NO: 1000) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). A correct transformant was selected as strain CEN.PK 113-7D ura3::kanMX his3::URA3.

    KanMX Marker Removal from the Ura3 Site and URA3 Marker Removal from the his3 Site

    [0335] The KanMX marker was removed by transforming CEN.PK 113-7D ura3::kanMX his3::URA3 with pRS423::PGAL1-cre (SEQ ID NO: 1011, described in U.S. Provisional Application No. 61/290,639) using a Frozen-EZ Yeast Transformation II kit (Zymo Research) and plating on synthetic complete medium lacking histidine and uracil supplemented with 2% glucose at 30 C. Transformants were grown in YP supplemented with 1% galactose at 30 C. for 6 hours to induce the Cre recombinase and KanMX marker excision and plated onto YPD (2% glucose) plates at 30 C. for recovery. An isolate was grown overnight in YPD and plated on synthetic complete medium containing 5-fluoro-orotic acid (0.1%) at 30 C. to select for isolates that lost the URA3 marker. 5-FOA resistant isolates were grown in and plated on YPD for removal of the pRS423::P.sub.GAL1-cre plasmid. Isolates were checked for loss of the KanMX marker, URA3 marker, and pRS423::P.sub.GAL1-cre plasmid by assaying growth on YPD+G418 plates, synthetic complete medium lacking uracil plates, and synthetic complete medium lacking histidine plates. A correct isolate that was sensitive to G418 and auxotrophic for uracil and histidine was selected as strain CEN.PK 113-7D ura3::loxP his3 and designated as BP857. The deletions and marker removal were confirmed by PCR and sequencing with primers oBP450 (SEQ ID NO: 1001) and oBP451 (SEQ ID NO: 1002) for ura3 and primers oBP460 (SEQ ID NO: 999) and oBP461 (SEQ ID NO: 1000) for his3 using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen).

    PDC6 Deletion

    [0336] The four fragments for the PCR cassette for the scarless PDC6 deletion were amplified using Phusion High Fidelity PCR Master Mix (New England BioLabs) and CEN.PK 113-7D genomic DNA as template, prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). PDC6 Fragment A was amplified with primer oBP440 (SEQ ID NO: 1003) and primer oBP441 (SEQ ID NO: 1004), containing a 5 tail with homology to the 5 end of PDC6 Fragment B. PDC6 Fragment B was amplified with primer oBP442 (SEQ ID NO: 1005), containing a 5 tail with homology to the 3 end of PDC6 Fragment A, and primer oBP443 (SEQ ID NO: 1006), containing a 5 tail with homology to the 5 end of PDC6 Fragment U. PDC6 Fragment U was amplified with primer oBP444 (SEQ ID NO: 1007), containing a 5 tail with homology to the 3 end of PDC6 Fragment B, and primer oBP445 (SEQ ID NO: 1008), containing a 5 tail with homology to the 5 end of PDC6 Fragment C. PDC6 Fragment C was amplified with primer oBP446 (SEQ ID NO: 1009), containing a 5 tail with homology to the 3 end of PDC6 Fragment U, and primer oBP447 (SEQ ID NO: 1010). PCR products were purified with a PCR Purification kit (Qiagen). PDC6 Fragment AB was created by overlapping PCR by mixing PDC6 Fragment A and PDC6 Fragment B and amplifying with primers oBP440 (SEQ ID NO: 1003) and oBP443 (SEQ ID NO: 1006). PDC6 Fragment UC was created by overlapping PCR by mixing PDC6 Fragment U and PDC6 Fragment C and amplifying with primers oBP444 (SEQ ID NO: 1007) and oBP447 (SEQ ID NO: 1010). The resulting PCR products were purified on an agarose gel followed by a Gel Extraction kit (Qiagen). The PDC6 ABUC cassette was created by overlapping PCR by mixing PDC6 Fragment AB and PDC6 Fragment UC and amplifying with primers oBP440 (SEQ ID NO: 1003) and oBP447 (SEQ ID NO: 1010). The PCR product was purified with a PCR Purification kit (Qiagen).

    [0337] Competent cells of CEN.PK 113-7D ura3::loxP his3 were made and transformed with the PDC6 ABUC PCR cassette using a Frozen-EZ Yeast Transformation II kit (Zymo Research). Transformation mixtures were plated on synthetic complete media lacking uracil supplemented with 2% glucose at 30 C. Transformants with a pdc6 knockout were screened for by PCR with primers oBP448 (SEQ ID NO: 1012) and oBP449 (SEQ ID NO: 1013) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). A correct transformant was selected as strain CEN.PK 113-7D ura3::loxP his3 pdc6::URA3.

    [0338] CEN.PK 113-7D ura3::loxP his3 pdc6::URA3 was grown overnight in YPD and plated on synthetic complete medium containing 5-fluoro-orotic acid (0.1%) at 30 C. to select for isolates that lost the URA3 marker. The deletion and marker removal were confirmed by PCR and sequencing with primers oBP448 (SEQ ID NO: 1012) and oBP449 (SEQ ID NO: 1013) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). The absence of the PDC6 gene from the isolate was demonstrated by a negative PCR result using primers specific for the coding sequence of PDC6, oBP554 (SEQ ID NO: 1014) and oBP555 (SEQ ID NO: 1015). The correct isolate was selected as strain CEN.PK 113-7D ura3::loxP his3 pdc6 and designated as BP891.

    [0339] PDC1 Deletion ilvDSm Integration

    [0340] The PDC1 gene was deleted and replaced with the ilvD coding region from Streptococcus mutans ATCC #700610. The A fragment followed by the ilvD coding region from Streptococcus mutans for the PCR cassette for the PDC1 deletion-ilvDSm integration was amplified using Phusion High Fidelity PCR Master Mix (New England BioLabs) and NYLA83 (described in U.S. Provisional Application No. 61/246,709) genomic DNA as template, prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). PDC1 Fragment A-ilvDSm (SEQ ID NO: 1053) was amplified with primer oBP513 (SEQ ID NO: 1016) and primer oBP515 (SEQ ID NO: 1017), containing a 5 tail with homology to the 5 end of PDC1 Fragment B. The B, U, and C fragments for the PCR cassette for the PDC1 deletion-ilvDSm integration were amplified using Phusion High Fidelity PCR Master Mix (New England BioLabs) and CEN.PK 113-7D genomic DNA as template, prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). PDC1 Fragment B was amplified with primer oBP516 (SEQ ID NO: 1018) containing a 5 tail with homology to the 3 end of PDC1 Fragment A-ilvDSm, and primer oBP517 (SEQ ID NO: 1019), containing a 5 tail with homology to the 5 end of PDC1 Fragment U. PDC1 Fragment U was amplified with primer oBP518 (SEQ ID NO: 1020), containing a 5 tail with homology to the 3 end of PDC1 Fragment B, and primer oBP519 (SEQ ID NO: 1021), containing a 5 tail with homology to the 5 end of PDC1 Fragment C. PDC1 Fragment C was amplified with primer oBP520 (SEQ ID NO: 1022), containing a 5 tail with homology to the 3 end of PDC1 Fragment U, and primer oBP521 (SEQ ID NO: 1023). PCR products were purified with a PCR Purification kit (Qiagen). PDC1 Fragment A-ilvDSm-B was created by overlapping PCR by mixing PDC1 Fragment A-ilvDSm and PDC1 Fragment B and amplifying with primers oBP513 (SEQ ID NO: 1016) and oBP517 (SEQ ID NO: 1019). PDC1 Fragment UC was created by overlapping PCR by mixing PDC1 Fragment U and PDC1 Fragment C and amplifying with primers oBP518 (SEQ ID NO: 1020) and oBP521 (SEQ ID NO: 1023). The resulting PCR products were purified on an agarose gel followed by a Gel Extraction kit (Qiagen). The PDC1 A-ilvDSm-BUC cassette (SEQ ID NO: 1054) was created by overlapping PCR by mixing PDC1 Fragment A-ilvDSm-B and PDC1 Fragment UC and amplifying with primers oBP513 (SEQ ID NO: 1016) and oBP521 (SEQ ID NO: 1023). The PCR product was purified with a PCR Purification kit (Qiagen).

    [0341] Competent cells of CEN.PK 113-7D ura3::loxP his3 pdc6 were made and transformed with the PDC1 A-ilvDSm-BUC PCR cassette using a Frozen-EZ Yeast Transformation II kit (Zymo Research). Transformation mixtures were plated on synthetic complete media lacking uracil supplemented with 2% glucose at 30 C. Transformants with a pdc1 knockout ilvDSm integration were screened for by PCR with primers oBP511 (SEQ ID NO: 1024) and oBP512 (SEQ ID NO: 1025) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). The absence of the PDC1 gene from the isolate was demonstrated by a negative PCR result using primers specific for the coding sequence of PDC1, oBP550 (SEQ ID NO: 1026) and oBP551 (SEQ ID NO: 1027). A correct transformant was selected as strain CEN.PK 113-7D ura3::loxP his3 pdc6 pdc1::ilvDSm-URA3.

    [0342] CEN.PK 113-7D ura3::loxP his3 pdc6 pdc1::ilvDSm-URA3 was grown overnight in YPD and plated on synthetic complete medium containing 5-fluoro-orotic acid (0.1%) at 30 C. to select for isolates that lost the URA3 marker. The deletion of PDC1, integration of ilvDSm, and marker removal were confirmed by PCR and sequencing with primers oBP511 (SEQ ID NO: 1024) and oBP512 (SEQ ID NO: 1025) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). The correct isolate was selected as strain CEN.PK 113-7D ura3::loxP his3 pdc6 pdc1::ilvDSm and designated as BP907.

    [0343] PDC5 Deletion sadB Integration

    [0344] The PDC5 gene was deleted and replaced with the sadB coding region from Achromobacter xylosoxidans. A segment of the PCR cassette for the PDC5 deletion-sadB integration was first cloned into plasmid pUC19-URA3MCS.

    [0345] pUC19-URA3MCS is pUC19 based and contains the sequence of the URA3 gene from Saccharomyces cerevisiae situated within a multiple cloning site (MCS). pUC19 contains the pMB1 replicon and a gene coding for beta-lactamase for replication and selection in Escherichia coli. In addition to the coding sequence for URA3, the sequences from upstream and downstream of this gene were included for expression of the URA3 gene in yeast. The vector can be used for cloning purposes and can be used as a yeast integration vector.

    [0346] The DNA encompassing the URA3 coding region along with 250 bp upstream and 150 bp downstream of the URA3 coding region from Saccharomyces cerevisiae CEN.PK 113-7D genomic DNA was amplified with primers oBP438 (SEQ ID NO: 1033), containing BamHI, AscI, PmeI, and FseI restriction sites, and oBP439 (SEQ ID NO: 1034), containing XbaI, Pad, and NotI restriction sites, using Phusion High-Fidelity PCR Master Mix (New England BioLabs). Genomic DNA was prepared using a Gentra Puregene Yeast/Bact kit (Qiagen). The PCR product and pUC19 (SEQ ID NO: 1056) were ligated with T4 DNA ligase after digestion with BamHI and XbaI to create vector pUC19-URA3MCS. The vector was confirmed by PCR and sequencing with primers oBP264 (SEQ ID NO: 1031) and oBP265 (SEQ ID NO: 1032).

    [0347] The coding sequence of sadB and PDC5 Fragment B were cloned into pUC19-URA3MCS to create the sadB-BU portion of the PDC5 A-sadB-BUC PCR cassette. The coding sequence of sadB was amplified using pLH468-sadB (SEQ ID NO: 1051) as template with primer oBP530 (SEQ ID NO: 1035), containing an AscI restriction site, and primer oBP531 (SEQ ID NO: 1036), containing a 5 tail with homology to the 5 end of PDC5 Fragment B. PDC5 Fragment B was amplified with primer oBP532 (SEQ ID NO: 1037), containing a 5 tail with homology to the 3 end of sadB, and primer oBP533 (SEQ ID NO: 1038), containing a PmeI restriction site. PCR products were purified with a PCR Purification kit (Qiagen). sadB-PDC5 Fragment B was created by overlapping PCR by mixing the sadB and PDC5 Fragment B PCR products and amplifying with primers oBP530 (SEQ ID NO: 1035) and oBP533 (SEQ ID NO: 1038). The resulting PCR product was digested with AscI and PmeI and ligated with T4 DNA ligase into the corresponding sites of pUC19-URA3MCS after digestion with the appropriate enzymes. The resulting plasmid was used as a template for amplification of sadB-Fragment B-Fragment U using primers oBP536 (SEQ ID NO: 1039) and oBP546 (SEQ ID NO: 1040), containing a 5 tail with homology to the 5 end of PDC5 Fragment C. PDC5 Fragment C was amplified with primer oBP547 (SEQ ID NO: 1041) containing a 5 tail with homology to the 3 end of PDC5 sadB-Fragment B-Fragment U, and primer oBP539 (SEQ ID NO: 1042). PCR products were purified with a PCR Purification kit (Qiagen). PDC5 sadB-Fragment B-Fragment U-Fragment C was created by overlapping PCR by mixing PDC5 sadB-Fragment B-Fragment U and PDC5 Fragment C and amplifying with primers oBP536 (SEQ ID NO: 1039) and oBP539 (SEQ ID NO: 1042). The resulting PCR product was purified on an agarose gel followed by a Gel Extraction kit (Qiagen). The PDC5 A-sadB-BUC cassette (SEQ ID NO: 1055) was created by amplifying PDC5 sadB-Fragment B-Fragment U-Fragment C with primers oBP542 (SEQ ID NO: 1043), containing a 5 tail with homology to the 50 nucleotides immediately upstream of the native PDC5 coding sequence, and oBP539 (SEQ ID NO: 1042). The PCR product was purified with a PCR Purification kit (Qiagen).

    [0348] Competent cells of CEN.PK 113-7D ura3::loxP his3 pdc6 pdc1::ilvDSm were made and transformed with the PDC5 A-sadB-BUC PCR cassette using a Frozen-EZ Yeast Transformation II kit (Zymo Research). Transformation mixtures were plated on synthetic complete media lacking uracil supplemented with 1% ethanol (no glucose) at 30 C. Transformants with a pdc5 knockout sadB integration were screened for by PCR with primers oBP540 (SEQ ID NO: 1044) and oBP541 (SEQ ID NO: 1045) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). The absence of the PDC5 gene from the isolate was demonstrated by a negative PCR result using primers specific for the coding sequence of PDC5, oBP552 (SEQ ID NO: 1046) and oBP553 (SEQ ID NO: 1047). A correct transformant was selected as strain CEN.PK 113-7D ura3::loxP his3 pdc6 pdc1::ilvDSm pdc5::sadB-URA3.

    [0349] CEN.PK 113-7D ura3::loxP his3 pdc6 pdc1::ilvDSm pdc5::sadB-URA3 was grown overnight in YPE (1% ethanol) and plated on synthetic complete medium supplemented with ethanol (no glucose) and containing 5-fluoro-orotic acid (0.1%) at 30 C. to select for isolates that lost the URA3 marker. The deletion of PDC5, integration of sadB, and marker removal were confirmed by PCR with primers oBP540 (SEQ ID NO: 1044) and oBP541 (SEQ ID NO: 1045) using genomic DNA prepared with a Gentra Puregene Yeast/Bact kit (Qiagen). The correct isolate was selected as strain CEN.PK 113-7D ura3::loxP his3 pdc6 pdc1::ilvDSm pdc5::sadB and designated as BP913.

    [0350] GPD2 Deletion

    [0351] To delete the endogenous GPD2 coding region, a gpd2::loxP-URA3-loxP cassette (SEQ ID NO: 1057) was PCR-amplified using loxP-URA3-loxP PCR (SEQ ID NO: 1052) as template DNA. loxP-URA3-loxP contains the URA3 marker from (ATCC #77107) flanked by loxP recombinase sites. PCR was done using Phusion DNA polymerase and primers LA512 and LA513 (SEQ ID NOs: 1029 and 1030, respectively). The GPD2 portion of each primer was derived from the 5 region upstream of the GPD2 coding region and 3 region downstream of the coding region such that integration of the loxP-URA3-loxP marker resulted in replacement of the GPD2 coding region. The PCR product was transformed into BP913 and transformants were selected on synthetic complete media lacking uracil supplemented with 1% ethanol (no glucose). Transformants were screened to verify correct integration by PCR using primers oBP582 and AA270 (SEQ ID NOs: 1048 and 1049, respectively).

    [0352] The URA3 marker was recycled by transformation with pRS423::P.sub.GAL1-cre (SEQ ID NO: 1011) and plating on synthetic complete media lacking histidine supplemented with 1% ethanol at 30 C. Transformants were streaked on synthetic complete medium supplemented with 1% ethanol and containing 5-fluoro-orotic acid (0.1%) and incubated at 30 C to select for isolates that lost the URA3 marker. 5-FOA resistant isolates were grown in YPE (1% ethanol) for removal of the pRS423::P.sub.GAL1-cre plasmid. The deletion and marker removal were confirmed by PCR with primers oBP582 (SEQ ID NO: 1048) and oBP591 (SEQ ID NO: 1050). The correct isolate was selected as strain CEN.PK 113-7D ura3::loxP his3 pdc6 pdc1::ilvDSm pdc5::sadB gpd2::loxP and designated as BP1064.

    Example 14. Shake Flask Experiment to Measure 2,3-Dihydroxyisovalerate Accumulation and Isobutanol Production

    [0353] The purpose of this Example was to show the effect on accumulation of the isobutanol pathway intermediate 2,3-dihydroxyisovalerate (DHIV) and show isobutanol production in isobutanologen strains with an integrated copy of the AFT1-L99A gene or a FRA2 deletion compared to the parent strain. Strains were transformed with isobutanol pathway plasmids pYZ090 (SEQ ID NO: 984; described in U.S. Appl. No. 61/368,436, incorporated by reference herein) and pLH468 (SEQ ID NO: 985; described in U.S. Application No. 61/246,844, incorporated by reference herein). These plasmids are also described briefly, as follows.

    [0354] pYZ090 (SEQ ID NO: 984) was constructed to contain a chimeric gene having the coding region of the alsS gene from Bacillus subtilis (nt position 457-2172) expressed from the yeast CUP1 promoter (nt 2-449) and followed by the CYC1 terminator (nt 2181-2430) for expression of ALS, and a chimeric gene having the coding region of the ilvC gene from Lactococcus lactis (nt 3634-4656) expressed from the yeast ILV5 promoter (2433-3626) and followed by the ILV5 terminator (nt 4682-5304) for expression of KARI.

    [0355] pLH468 (SEQ ID NO: 985) was constructed to contain: a chimeric gene having the coding region of the ilvD gene from Streptococcus mutans (nt position 3313-4849) expressed from the S. cerevisiae FBA1 promoter (nt 2109-3105) followed by the FBA1 terminator (nt 4858-5857) for expression of DHAD; a chimeric gene having the coding region of codon optimized horse liver alcohol dehydrogenase (nt 6286-7413) expressed from the S. cerevisiae GPM1 promoter (nt 7425-8181) followed by the ADH1 terminator (nt 5962-6277) for expression of ADH; and a chimeric gene having the coding region of the codon-optimized kivD gene from Lactococcus lactis (nt 9249-10895) expressed from the TDH3 promoter (nt 10896-11918) followed by the TDH3 terminator (nt 8237-9235) for expression of KivD.

    [0356] A transformant of PNY1503 (parent strain) was designated PNY1504. A transformant of PNY1505 (fra2 deletion strain) was designated PNY1506. Transformants of PNY1541 and PNY1542 (AFT1-L99A integration strains) were designated PNY1543 and PNY1544, for PNY1541, and PNY1545 and PNY1546, for PNY1542.

    [0357] Strains were grown in synthetic medium (Yeast Nitrogen Base without Amino Acids (Sigma-Aldrich, St. Louis, Mo.) and Yeast Synthetic Drop-Out Media Supplement without uracil and histidine (Clontech, Mountain View, Calif.)) supplemented with 100 mM MES pH5.5, 0.2% glucose, and 0.2% ethanol. Overnight cultures were grown in 15 mL of medium in 125 mL vented Erlenmeyer flasks at 30 C., 225 RPM in a New Brunswick Scientific I24 shaker. 18 ml of medium in 125 mL tightly-capped Erlenmeyer flasks was inoculated with overnight culture to an OD.sub.600 0.5 and grown for six hours at 30 C., 225 RPM in a New Brunswick Scientific 124 shaker. After six hours, glucose was added to 2.5%, yeast extract was added to 5 g/L, and peptone was added to 10 g/L (time 0 hours). After 24 and 48 hours, culture supernatants (collected using Spin-X centrifuge tube filter units, Costar Cat. No. 8169) were analyzed by HPLC (method described in U.S. Patent Appl. Pub. No. US 2007/0092957, incorporated by reference herein) and LC/MS. Glucose and isobutanol concentrations were determined by HPLC. DHIV was separated and quantified by LC/MS on a Waters (Milford, Mass.) AcquityTQD system, using an Atlantis T3 (part #186003539) column. The column was maintained at 30 C. and the flow rate was 0.5 mL/min. The A mobile phase was 0.1% formic acid in water, and the B mobile phase was 0.1% formic acid in acetonitrile. Each run consisted of 1 min at 99% A, a linear gradient over 1 min to 25% B, followed by 1 min at 99% A. The column effluent was monitored for peaks at m/z=133 (negative ESI), with cone voltage 32.5V, by Waters ACQ_TQD (s/n QBA688) mass spectometry detector. DHIV typically emerged at 1.2 min. Baseline separation was obtained and peak areas for DHIV were converted to M DHIV concentrations by reference to analyses of standards solutions made from a 1 M aqueous stock.

    [0358] Table 18 shows the DHIV molar yield (moles of DHIV per moles of glucose consumed) and isobutanol titer of the AFT1-L99A strains (PNY1543, PNY1544, PNY1545, and PNY1546) and the FRA2 deletion strain (PNY1506) compared to the parent strain background (PNY1504) at 24 and 48 hours. AFT1-L99A expression or the FRA2 deletion both led to approximately a 50% decrease in the accumulation of DHIV.

    TABLE-US-00018 TABLE 18 DHIV molar yield and isobutanol titer. 24 Hr 48 Hr 24 Hr 48 Hr DHIV Yield DHIV Yield Isobutanol Isobutanol Strain (mol/mol) (mol/mol) Titer (g/L) Titer (g/L) PNY1504 0.044 0.035 3.7 4.2 PNY1543- 0.017 0.015 4.1 5.8 PNY1544 PNY1545- 0.019 0.018 4.6 5.5 PNY1546 PNY1506 0.022 0.020 3.8 4.7 [0359] Data are the average of two independent flasks, for PNY1504 and PNY1506, and two independent transformants for the AFT1-L99A strains (PNY1543-PNY1544 and PNY1545-PNY1546).

    [0360] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art, readily modify and/or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present invention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance.

    TABLE-US-00019 TABLE 12 HMMER2.0 [2.2g] Program name and version NAME dhad_for_hmm Name of the input sequence alignment file LENG 564 Length of the alignment: include indels ALPH Amino Type of residues MAP yes Map of the match states to the columns of the alignment COM/app/public/hmmer/current/bin/hmmbuild -F dhad-exp_hmm dhad_for_hmm.aln Commands used to generate the file: this one means that hmmbuild (default patrameters) was applied to the alignment file COM/app/public/hmmer/current/bin/hmmcalibrate dhad-exp_hmm Commands used to generate the file: this one means that hmmcalibrate (default parametrs) was applied to the hmm profile NSEQ 8 Number of sequences in the alignment file DATE Tue Jun 3 10:48:24 2008 When was the file generated XT 8455 4 1000 1000 8455 4 8455 4 NULT 4 8455 The transition probability distribution for the null model (single G state). NULE 595 1558 85 338 294 453 1158 197 249 902 1085 142 21 313 45 531 201 The symbol emission probability distribution for the null model (G state); consists of K (e.g. 4 or 20) integers. The null 384 1998 644 probability used to convert these back to model probabilities is 1/K. EVD 499.650970 0.086142 The extreme value distribution parameters and lambda respectively; both floating point values. Lambda is positive and nonzero. These values are set when the model is calibrated with hmmcalibrate. A C D E F G H I K Position in HMM m->m m->i m->d i->m i->i d->m d->d b->m m->e L M N P Q R S T V W Y alignment 538 * 1684 1(M) 233 1296 99 1223 1477 1132 89 1122 420 1248 1757 1553 1296 464 24 190 188 838 1578 985 6 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 538 * 2(E) 220 1288 232 1356 1807 1016 70 1474 190 1584 775 132 1298 300 282 183 1140 1092 1872 1262 7 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 * * 3(K) 448 1932 1558 658 2220 1048 40 1983 1569 1938 1091 1558 1319 450 193 278 419 1552 2121 1397 8 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 * * 4(V) 404 498 1497 939 588 1810 640 1591 914 127 335 962 1866 562 767 868 357 1720 1169 763 9 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 * * 5(E) 265 1340 52 1376 1572 1189 113 1125 1345 1287 496 99 1321 505 198 218 205 597 1598 1032 10 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 * * 6(S) 256 397 1014 830 1841 646 862 1443 767 1740 963 568 1249 651 1007 2267 1586 862 2080 1672 11 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 29 6203 7245 894 1115 701 1378 * * 7(M) 990 889 2630 157 513 2514 1346 1309 1767 820 3683 1898 2491 1496 1799 1589 925 150 1336 1041 12 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 8(E) 588 1875 194 1536 2188 1373 59 1931 957 1890 977 904 292 393 162 483 372 1495 2070 1391 13 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 9(N) 514 1116 1207 315 447 1650 304 778 224 825 277 1457 1738 123 618 627 454 603 1186 763 14 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 10(N) 815 1190 1360 922 904 1967 797 442 670 381 1700 3009 2099 654 934 1051 791 445 1490 979 15 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 11(K) 1530 2498 1722 855 3141 2246 428 2627 2828 2404 1656 927 662 2 2047 1421 1337 2324 2357 2081 16 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 12(Y) 872 1887 861 290 1369 1801 1662 1797 325 1793 1031 893 1876 56 2219 812 780 1514 1565 2287 17 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 13(S) 830 1586 1471 1099 2717 1642 1010 2479 266 2518 1746 1065 2069 676 1822 2748 1000 1950 2597 2189 18 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 14(Q) 851 2131 775 153 2554 1735 211 2205 1908 2094 1244 386 1802 2254 974 1001 747 1819 2181 1667 19 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 15(T) 405 1258 618 100 1490 1466 1158 1121 1 1299 514 578 1607 65 433 960 1849 343 1677 1143 20 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 16(I) 1772 1325 4307 3877 1405 3993 3383 2935 3705 820 217 3632 3761 3400 3682 3260 1742 2033 2838 2525 21 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 17(T) 1018 1329 2004 1771 409 1993 1000 1256 1512 1464 966 1543 2367 1428 1638 1257 3050 1090 1012 2448 22 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 18(Q) 1509 3056 1970 44 3310 1666 896 3242 877 3158 2439 322 2123 3562 1493 1259 1550 2779 3260 2446 23 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 19(D) 1006 2199 2178 88 3159 1997 936 2974 948 2977 2174 382 1960 589 1571 1295 1157 2369 3178 2430 24 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 20(M) 445 796 1082 521 841 1643 412 403 370 692 2213 646 536 1166 698 630 660 831 1204 767 25 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 21(Q) 741 990 1025 507 1249 1551 519 720 357 1062 345 635 1739 1770 713 589 1576 1129 1559 1097 26 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 22(R) 1753 2648 2072 1047 3365 2405 452 2782 1989 2495 1773 1062 2379 2402 2643 1629 1506 2504 2397 2190 27 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 23(S) 330 1010 1820 1628 2778 1229 1652 2481 1592 2691 1841 1273 2130 1426 1834 2449 1034 1716 2961 2594 28 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 24(P) 1882 1119 2231 2302 3062 1360 2209 2710 2339 3013 2243 1676 3304 2117 2409 742 918 1916 3263 3022 29 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 25(N) 969 1230 1066 915 2593 1313 1196 2242 1033 2447 1626 3197 1850 898 1392 582 1155 1644 2736 2256 30 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 26(R) 1847 2640 2014 1161 3282 2428 579 2818 687 2553 1869 1165 2462 2447 3181 1746 1630 2555 2447 2228 31 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 27(A) 3048 932 2480 2533 3075 1200 2274 2765 2501 3071 2221 1658 1948 2205 2512 1225 739 1842 3322 3078 32 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 28(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 33 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 29(Y) 1674 1506 2863 2464 596 2872 2251 972 2024 2197 552 1986 2876 1739 1988 1987 1601 1002 95 2332 34 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 30(Y) 2013 2305 2428 1781 328 2709 654 2240 258 2064 1626 1631 2788 899 2789 2017 1896 2130 857 3434 35 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 31(A) 2822 1031 2418 2539 3226 1898 2364 2941 2626 3229 2379 1722 2026 2302 2634 654 848 1983 3415 3226 36 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 32(I) 1247 941 3569 3039 1082 3101 2185 2227 2763 766 76 2700 3050 2469 2697 2253 1322 1974 1988 1633 37 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 33(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 38 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 34(F) 1511 1236 3511 3017 2747 2982 1069 260 2651 992 2737 2407 2904 2088 2418 2099 1434 489 537 2056 39 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 35(Q) 576 1869 401 92 2232 831 173 1930 1505 1913 1042 186 1620 1653 51 482 1346 1534 2098 1490 40 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 36(D) 1352 3066 3028 1349 3303 1566 724 3141 1155 3043 2267 165 1991 354 1350 1086 1368 2659 3221 2356 41 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 37(E) 1507 3288 2042 2762 3520 515 853 3401 981 3296 2566 182 2064 503 1753 1209 1553 2895 3486 2547 42 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 38(D) 1445 2778 3529 53 3524 1590 1129 3476 1367 3459 2774 396 2156 825 2122 554 1609 2880 3582 2717 43 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 39(F) 2658 2176 4213 4000 3815 3933 1352 531 3638 1121 19 3184 3709 2820 3296 3219 2579 1037 601 403 44 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 40(D) 684 2193 1738 1460 2494 1437 249 2257 1694 2199 1308 62 1637 185 450 531 633 1808 2374 1657 45 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 41(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 46 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 42(P) 1882 1119 2231 2302 3062 1360 2209 2710 2339 3013 2243 1676 3304 2117 2409 742 918 1916 3263 3022 47 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 43(I) 1006 992 2347 1784 650 2452 1256 2372 1386 77 2213 1720 2455 2030 1490 1528 946 106 1441 1111 48 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 44(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 49 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 45(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 50 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 46(I) 1759 1303 4330 3968 1751 4051 3743 3027 3837 597 528 3729 3875 3688 3910 3369 1751 2438 3259 2819 51 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 47(V) 1736 1012 3546 3078 1377 3073 2434 2052 2843 608 331 2754 3122 2619 2855 2270 1277 2193 2333 1941 52 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 48(N) 686 1511 702 806 2927 1386 1339 2841 1264 2950 2137 2702 1979 1062 1648 2444 971 2105 3054 2475 53 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 49(M) 411 857 1800 1434 1528 1914 1202 1029 1247 1347 2989 1217 1912 1119 1444 676 1550 767 1922 1539 54 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 50(W) 782 1258 793 683 1193 346 2051 932 556 1092 441 798 1993 426 909 904 720 779 3163 1546 55 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 51(W) 1009 798 1470 935 463 1773 545 460 751 736 66 943 1904 606 1002 1604 507 322 2535 1521 56 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 52(D) 1137 2711 2125 1647 2995 1523 617 2786 528 2743 1933 150 1897 234 1165 924 2117 2331 2948 2141 57 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 53(I) 599 1102 1031 829 1522 1429 927 2119 880 1369 699 1692 1938 759 1188 799 698 689 1887 1419 58 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 54(T) 666 1412 954 984 2702 1428 1357 2418 1208 2650 1886 2293 2000 1101 1519 787 2967 1835 2866 2360 59 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 55(P) 632 1230 2074 2144 2996 1453 2116 2631 2128 2928 2213 1658 3610 2006 2221 852 1302 1931 3185 2917 60 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 56(C) 2476 5735 4102 4358 3712 2763 3545 3518 4167 3859 3569 3631 3363 4030 3832 2793 2860 3158 3464 3718 61 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 57(N) 2171 2655 1458 1748 3334 2364 2267 3943 2365 3936 3437 4205 2932 2205 2608 2224 2439 3392 3253 2909 62 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 58(M) 672 918 3119 2578 742 2668 1734 1807 2263 16 3713 2271 2704 1960 2216 1806 1058 493 1612 1306 63 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 59(H) 1525 2164 1235 1346 2509 2296 4235 3172 1516 3178 2523 1448 2541 1520 1760 1591 1741 2656 2681 2065 64 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 60(L) 2478 2009 4717 4196 568 4424 3262 1334 3887 2824 604 4085 3872 3088 3590 3717 2380 199 2217 2207 65 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 61(H) 682 2191 1015 275 2485 396 2379 2251 62 2197 1307 1826 1636 1527 480 529 641 1803 2375 1654 66 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 62(D) 575 1920 1979 184 2299 94 242 2029 114 2023 1144 120 1608 186 1063 469 1413 1605 2229 1561 67 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 63(L) 2618 2139 4597 4163 2144 4285 2334 83 3854 2690 538 3771 3806 2950 3488 3563 2505 751 1442 808 68 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 64(A) 2657 1033 2408 2532 3233 2193 2364 2950 2626 3237 2386 1719 2027 2301 2635 655 850 1988 3420 3231 69 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 65(K) 443 1857 958 270 2158 1393 66 1890 1839 442 957 36 1499 1204 132 616 382 1469 2048 1383 70 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 66(C) 605 1553 739 17 1374 1488 182 260 969 203 397 263 1573 159 691 426 331 761 1567 1032 71 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 67(A) 2327 956 3193 2728 1289 2677 2114 1664 2485 601 288 2403 2839 2263 2523 1871 1126 1617 2143 1765 72 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 68(K) 532 1656 490 1321 1891 1527 172 124 2206 1591 782 223 1619 237 106 482 464 98 1904 1326 73 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 69(H) 384 1854 936 889 2165 1363 1498 1909 1111 1866 948 1091 1464 421 131 284 342 69 2043 1364 74 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 70(G) 1823 932 2330 2313 3120 2511 2158 2865 2331 3098 2209 1563 1912 2032 2419 1138 706 1883 3328 3077 75 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 71(V) 1760 1333 4244 3789 1262 3902 3190 1495 3588 1270 96 3536 3677 3238 3534 3148 1725 2865 2654 2373 76 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 72(W) 1054 2172 1112 403 2566 1917 286 2196 2516 2095 1292 1183 1958 140 1333 959 922 1867 2591 1720 77 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 73(D) 611 1995 1525 937 2295 1400 148 2043 211 2006 1106 37 1553 1420 312 408 1235 1609 2193 1499 78 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 74(A) 2716 902 2380 2205 2799 1197 1975 2459 2081 2736 1895 1520 1895 1844 2201 1191 1299 1669 3045 2758 79 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 75(G) 1709 2833 2424 409 3781 2819 1457 3777 1728 3733 3076 739 2389 1180 2441 1557 1893 3158 3660 3038 80 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 212 2909 8150 273 2534 701 1378 * * 76(A) 2529 1119 2614 2330 1245 1983 1829 377 2042 1435 341 1937 2411 1873 2088 1266 1059 397 2063 1713 82 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 77(W) 472 361 2421 1812 298 1979 826 1164 1486 143 2485 873 2028 1185 1426 1048 412 1116 2999 454 83 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 78(P) 1198 1737 2187 2394 3665 2006 2550 3630 2743 3756 3008 2052 3474 2495 2835 1401 1593 2736 3511 3519 84 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 79(Q) 999 1075 2106 1568 726 2370 1175 83 1185 1373 218 1566 2400 2445 1340 1445 946 1441 1501 1146 85 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 80(Q) 885 779 2609 2018 481 2414 1253 1645 1736 799 1924 1827 2405 2262 1752 1484 821 802 1240 935 86 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 81(F) 3342 2776 4026 4232 4354 3545 1431 2315 4038 1801 1900 3299 3780 3350 3645 3490 3420 2566 739 349 87 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 82(G) 998 2100 120 175 2567 2528 2174 2558 587 2583 1806 1422 1966 461 1038 925 1088 2095 2657 1948 88 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 83(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 89 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 84(I) 1286 1279 2907 2683 1446 2549 2198 3290 2407 726 534 2386 1172 2299 2437 1895 1392 283 2302 1913 90 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 85(T) 493 1105 2189 2267 3101 1880 2196 2791 2334 3081 2269 1649 2058 2099 2410 719 3135 1948 3282 3046 91 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 86(V) 1750 1296 4319 3957 1765 4038 3733 2364 3826 619 543 3716 3869 3685 3902 3354 1743 3012 3265 2817 92 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 87(S) 923 962 2348 2422 3132 1207 2248 2850 2440 3140 2285 1624 1954 2158 2477 3171 758 1896 3362 3103 93 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 88(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 94 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 89(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 95 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 90(I) 1880 1493 4193 3724 953 3837 2980 3251 3420 257 2372 3485 3608 3005 3310 3087 1840 617 2373 2155 96 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 91(S) 2150 939 2407 2415 3075 1197 2205 2781 2384 3065 2205 1613 1936 2105 2436 2652 729 1850 3306 3049 97 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 92(M) 979 1455 1242 1122 1434 1860 1131 1171 974 1285 4091 2176 2226 1017 1187 1166 1086 1063 1929 1345 98 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 93(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 99 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 94(T) 959 1691 1249 949 2563 1747 929 2093 1282 2263 1554 995 2115 600 354 1037 3152 1726 2494 2098 100 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 95(E) 572 1860 208 2213 2107 1461 191 1808 199 116 983 127 318 1199 269 475 517 1448 2078 1441 101 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 96(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 102 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 97(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 103 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 98(R) 2097 2786 2688 1415 3622 2625 555 2964 2585 2627 1957 1318 2577 137 3015 1979 1791 2732 2469 2363 104 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 99(Y) 3615 2706 4169 4413 2626 4044 396 2535 3993 1939 1985 2747 3930 2852 3446 3296 3494 2686 347 4252 105 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 100(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 106 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 101(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 107 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 102(V) 1381 1065 3714 3252 1453 3300 2646 1872 3023 615 373 2949 3287 2816 3039 2506 1346 2750 2489 2087 108 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 103(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 109 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 104(R) 2957 3022 3318 2735 3796 2998 1968 3912 846 3631 3157 2611 3280 1724 4056 3026 2913 3650 3096 3185 110 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 105(E) 1719 3572 2596 2779 3767 1632 993 3700 1241 3578 2920 234 2167 666 2090 1380 1789 3182 3742 2756 111 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 106(V) 1746 1296 4308 3946 1757 4020 3712 2190 3811 614 539 3702 3858 3667 3884 3336 1740 3098 3250 2803 112 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 107(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 113 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 108(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 114 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 109(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 115 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 110(S) 352 2942 2955 2957 2876 1254 2382 2573 2692 2927 2128 1827 2001 2405 2607 3103 778 1757 3171 2911 116 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 111(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 117 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 112(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 118 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 113(T) 1556 936 2493 2457 2805 1256 2159 2210 2319 2681 1932 1656 1974 2089 2352 598 3235 1547 3111 2847 119 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 114(C) 1784 2119 2013 1532 1093 1580 1089 436 1322 937 273 1093 1932 1127 1472 748 515 1585 1536 1163 120 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 115(M) 1831 2019 2596 2038 605 1979 1126 244 1727 359 2501 1655 2145 1435 1683 1106 557 1087 1153 804 121 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 116(Q) 987 2211 43 62 2833 2229 691 2616 407 2604 1797 1197 1917 2260 858 880 1045 2139 2772 2099 122 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 117(G) 2313 1042 2391 2526 3250 2601 2372 2972 2637 3257 2407 1721 2032 2310 2646 662 859 2003 3434 3247 123 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 118(Q) 914 2350 48 1661 2621 1571 2504 2400 68 2331 1486 201 1796 2646 351 754 865 1984 2463 1787 124 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 119(W) 517 1294 733 183 1062 1605 234 1037 19 1207 456 1435 1690 33 756 411 454 819 3340 1286 125 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 120(M) 410 469 2417 1828 341 2041 897 195 1513 156 3130 1534 2102 1230 1484 1117 507 954 894 2253 126 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 121(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 127 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 122(G) 2142 930 2334 2298 3100 2237 2139 2842 2302 3074 2187 1557 1909 2010 2397 1136 701 1871 3308 3053 128 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 123(V) 1514 1144 3950 3459 1821 3487 2577 2274 3208 209 87 3112 3362 2864 3118 2680 1476 2426 2194 1786 129 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 124(V) 1743 1294 4292 3873 1511 3988 3433 2287 3712 598 319 3626 3774 3456 3716 3260 1717 2790 2931 2577 130 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 125(A) 2911 954 2808 2665 2115 1577 2196 575 2445 1646 1202 1906 2208 2218 2451 901 876 1294 2727 2394 131 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 126(I) 1764 1323 4298 3936 1668 3994 3655 3337 3783 508 462 3689 3838 3608 3835 3311 1759 1847 3164 2747 132 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 127(G) 1157 1705 2169 2375 3654 3021 2534 3611 2730 3741 2984 2024 2418 2475 2826 1361 1555 2705 3513 3509 133 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 128(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 134 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 129(C) 2476 5735 4102 4358 3712 2763 3545 3518 4167 3859 3569 3631 3363 4030 3832 2793 2860 3158 3464 3718 135 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 130(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 136 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 131(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 137 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 132(N) 2171 2655 1458 1748 3334 2364 2267 3943 2365 3936 3437 4205 2932 2205 2608 2224 2439 3392 3253 2909 138 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 133(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 139 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 134(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 140 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 135(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 141 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 136(A) 2180 935 2286 2196 3057 1098 2058 2796 2174 3021 2134 1516 1898 1906 2302 2146 689 1849 3256 2983 142 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 137(M) 1799 1433 4142 3579 669 3668 2608 1558 3293 1235 3799 3296 3401 2717 3088 2843 1726 1156 2002 1868 143 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 138(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 144 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 139(A) 3103 1036 2445 2572 3222 1051 2380 2930 2650 3226 2381 1739 2034 2327 2648 664 857 1981 3412 3228 145 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 140(M) 2325 1891 4598 4012 498 4222 3013 1242 3722 1864 3929 3855 3711 2910 3414 3439 2215 299 2076 2098 146 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 141(A) 3103 1036 2445 2572 3222 1051 2380 2930 2650 3226 2381 1739 2034 2327 2648 664 857 1981 3412 3228 147 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 142(R) 1588 2442 1399 953 3069 2171 708 2795 373 2625 1916 1858 2357 324 3294 1520 1505 2453 2523 2186 148 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 143(M) 1448 1256 3396 2819 474 3024 1923 175 2473 2225 2756 2574 2922 2063 2375 2153 952 151 1599 1410 149 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 144(N) 1662 3306 2055 78 3621 1643 1040 3622 1272 3531 2870 3477 2182 724 2071 1371 1757 3092 3633 2700 150 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 145(I) 1066 921 2828 2239 1041 2675 1601 2235 1668 455 92 2067 2692 1688 1701 1795 1024 1960 1771 1396 151 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 146(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 152 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 147(S) 1568 940 2267 2192 3082 1101 2068 2826 2185 3049 2159 1515 1901 1915 2313 2603 694 1866 3279 3006 153 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 148(I) 1880 1492 4195 3728 963 3841 2991 3272 3425 246 2277 3490 3613 3014 3317 3092 1841 628 2385 2163 154 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 149(F) 2204 1797 3724 3473 3206 3383 628 1077 3092 746 3167 2502 3309 2372 2792 2535 2120 1245 28 2460 155 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 150(V) 1265 1028 3200 2994 1833 2150 2480 417 2771 1122 818 2349 2640 2559 2766 1464 1118 3028 2700 2325 156 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 151(Y) 3482 2868 3701 3919 238 3552 1112 3000 3638 2516 2526 3027 3772 3101 3341 3418 3527 3071 441 4711 157 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 152(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 158 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 153(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 159 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 154(T) 359 976 2225 2229 2900 1242 2074 2560 2170 2875 2064 1561 1958 1969 2247 1110 3375 1760 3152 2850 160 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 155(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 161 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 156(H) 861 1924 384 1010 2260 1477 1787 1974 1769 1918 1022 120 1566 362 697 417 459 1557 2073 1446 162 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 157(P) 655 1502 711 557 2204 1463 2143 2122 586 2233 1445 688 2941 560 941 855 805 1657 2369 1763 163 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 158(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 164 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 159(H) 744 2193 114 1118 2513 1512 2486 2252 1178 2183 1308 2230 1689 180 233 598 687 1823 2335 1670 165 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 160(W) 2672 2139 3850 3748 941 3611 469 1691 3306 1047 1217 2551 3534 2514 2960 2788 2577 1799 4205 3466 166 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 161(K) 386 1981 779 279 2295 1403 114 2043 2059 1991 1082 941 1536 1263 211 384 457 1602 2161 1476 167 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 162(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 168 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 163(K) 1144 2365 912 2048 2856 1912 326 2459 2267 2295 1482 556 1989 108 1334 1013 1014 2093 2324 1881 169 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 164(D) 1091 2610 2941 174 2957 1527 595 2750 1084 2696 1877 176 1885 206 1006 740 1098 2288 2880 2105 170 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 165(L) 2387 1922 4674 4155 617 4366 3250 1889 3865 2650 558 4023 3847 3098 3586 3647 2296 38 2247 2224 171 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 166(N) 1021 2427 1806 133 2870 1499 635 2647 521 2640 1825 2171 1874 255 1124 860 2122 2184 2853 2090 172 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 167(I) 1830 1390 4327 3873 1210 3994 3274 2967 3678 1259 30 3633 3730 3283 3604 3249 1791 1570 2661 2417 173 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 168(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 174 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 169(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 175 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 170(A) 2440 824 2371 2082 1993 1344 1704 1264 1899 1832 1137 1517 1946 1674 2005 1075 641 1474 2390 2055 176 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 171(F) 3342 2776 4026 4232 4354 3545 1431 2315 4038 1801 1900 3299 3780 3350 3645 3490 3420 2566 739 349 177 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 172(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 178 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 173(A) 2966 1031 2429 2551 3222 1544 2368 2934 2633 3225 2377 1727 2028 2309 2637 656 850 1980 3412 3224 179 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 174(V) 1769 1342 4255 3793 1216 3901 3162 1633 3589 1486 51 3537 3667 3214 3518 3143 1731 2692 2609 2345 180 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 175(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 181 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 176(Q) 729 2116 413 1096 2484 1587 1599 2186 1695 2094 1219 223 1698 2418 90 599 649 1770 2213 1615 182 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 177(W) 1652 1707 2340 1879 1996 2733 2013 1398 1758 1386 938 1641 2751 1364 1762 1780 1577 1325 3577 2136 183 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 178(T) 421 753 1251 704 846 1670 535 894 548 690 1 1376 1791 421 846 373 1461 858 1236 812 184 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 179(H) 1498 1593 504 15 1895 1484 2279 1559 1119 1640 810 242 1611 194 171 462 815 1231 1914 1340 185 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 180(G) 1515 2130 1298 1450 2658 3285 2212 3276 1691 3291 2638 1524 2562 1662 1925 1600 1764 2713 2804 2234 186 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 181(K) 528 2010 1346 1082 2329 1408 118 2080 1475 2018 1108 1161 1543 331 1052 394 471 1632 2181 1494 187 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 182(M) 1894 1521 4170 3679 840 3793 2866 2827 3360 375 3445 3437 3555 2902 3223 3028 1846 470 2249 2059 188 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 183(T) 670 1758 1731 141 2591 1399 691 2319 499 2384 1543 387 1786 316 1016 1576 2044 1811 2624 1981 189 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 184(E) 345 2074 925 1994 2378 1408 177 2135 922 2084 1183 38 641 264 356 444 536 1690 2261 1556 190 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 185(E) 1493 2900 93 3174 2903 1743 1987 3042 646 2957 2238 411 2146 506 1121 1272 1503 2629 2905 2134 191 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 186(D) 1293 2959 2673 2121 3219 1546 713 3043 707 2974 2191 158 1967 342 1394 1043 701 2567 3172 2311 192 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 187(F) 1137 905 3250 2707 2365 2647 1016 34 2336 1239 267 2150 2626 1861 2133 1752 1069 1461 599 1844 193 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 188(K) 479 1713 409 1031 1925 1467 1755 1650 1844 349 827 140 1556 319 75 403 411 1301 1900 843 194 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 189(G) 433 2144 52 1047 2717 2303 615 2467 442 2482 1655 1123 1828 233 995 763 923 2000 2710 2005 195 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 190(V) 1752 1320 4254 3806 1311 3916 3232 1701 3614 1188 140 3551 3693 3280 3568 3166 1718 2833 2703 2409 196 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 191(E) 1199 1750 734 2668 1820 2038 1068 1892 867 1273 897 922 2295 797 1238 1340 1197 426 2325 1789 197 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 192(C) 1182 3528 1398 620 2541 2038 358 2093 1181 2037 1272 747 2070 1553 2213 1123 1038 1817 2142 1774 198 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 193(N) 1478 2527 261 403 2011 1837 2032 2925 735 2845 2195 3635 2259 721 1085 1352 1546 2522 2307 1431 199 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 194(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 200 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 195(C) 1220 4911 3609 3314 1440 2525 2482 1565 2922 706 544 2678 2896 2710 2836 1869 1375 379 2371 1957 201 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 196(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 202 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 197(G) 477 1115 1983 2189 3315 3154 2272 3172 2506 3387 2522 1599 2042 2177 2583 1217 905 2130 3477 3225 203 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 198(A) 1653 1347 705 249 1969 1385 477 1629 159 1759 935 434 1285 1404 586 450 1019 1243 2070 1522 204 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 199(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 205 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 200(S) 1870 938 2270 2183 3068 1488 2056 2810 2168 3032 2144 1511 1898 1901 2300 2236 690 1857 3265 2990 206 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 201(C) 2476 5735 4102 4358 3712 2763 3545 3518 4167 3859 3569 3631 3363 4030 3832 2793 2860 3158 3464 3718 207 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 202(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 208 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 203(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 209 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 204(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 210 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 205(Y) 3590 2700 4146 4379 2092 4028 404 2517 3963 1928 1973 2744 3921 2845 3431 3284 3474 2669 336 4423 211 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 206(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 212 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 207(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 213 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 208(N) 2171 2655 1458 1748 3334 2364 2267 3943 2365 3936 3437 4205 2932 2205 2608 2224 2439 3392 3253 2909 214 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 209(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 215 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 210(M) 2355 1988 4343 3834 504 4051 2868 105 3385 1451 4460 3680 3671 2806 3171 3327 2274 474 2039 1925 216 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 211(S) 2150 939 2407 2415 3075 1197 2205 2781 2384 3065 2205 1613 1936 2105 2436 2652 729 1850 3306 3049 217 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 212(S) 344 979 2190 2162 2959 1227 2042 2651 2116 2934 2100 1526 1941 1909 2222 2940 1775 1804 3187 2882 218 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 213(A) 3048 932 2480 2533 3075 1200 2274 2765 2501 3071 2221 1658 1948 2205 2512 1225 739 1842 3322 3078 219 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 214(I) 1924 1546 4067 3658 2312 3663 2081 3030 3367 150 99 3197 3492 2821 3179 2894 1877 293 1445 692 220 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 215(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 221 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 216(A) 2389 814 2506 2162 1696 1545 1698 499 1942 1398 813 1640 2076 1723 2027 806 1148 1559 2200 1856 222 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 217(M) 2576 2118 4725 4165 461 4430 3165 99 3811 2513 3454 4075 3839 2978 3488 3704 2457 591 2111 2145 223 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 218(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 224 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 219(M) 2313 1968 4258 3765 518 3966 2806 98 3289 1292 4523 3599 3636 2769 3097 3249 2243 457 2026 1874 225 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 220(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 226 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 221(L) 2631 2159 4786 4228 462 4506 3231 96 3878 2828 2482 4157 3880 3016 3541 3793 2509 608 2134 2182 227 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 222(P) 1501 1778 2473 2371 1710 2311 2045 1321 2060 827 1068 2173 3594 2082 2130 1799 1699 1373 2373 1942 228 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 223(Y) 1068 1670 865 836 631 1198 767 1828 1059 1914 1304 692 2203 906 1387 1136 1163 1566 1185 3670 229 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 224(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 230 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 225(S) 1172 954 2367 2422 3120 1204 2237 2835 2426 3122 2265 1621 1948 2145 2467 3107 749 1884 3349 3092 231 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 226(S) 342 975 2176 2124 2912 1229 2003 2594 2067 2878 2048 1510 1936 1866 2184 2553 2492 1773 3143 2833 232 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 227(M) 720 1440 710 343 1228 1693 2436 1209 132 1364 3099 1904 1852 183 458 776 680 1004 1540 890 233 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 228(P) 2240 1100 2241 2293 3037 1346 2188 2683 2317 2986 2210 1663 3041 2093 2391 722 895 1893 3243 2998 234 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 229(A) 2958 1235 1299 1377 2868 1345 1673 2580 1661 2843 2054 1555 1995 1468 1921 715 888 1871 3064 2630 235 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 230(E) 509 1046 884 1564 1116 1669 441 485 283 250 206 577 689 200 656 670 459 1290 1467 995 236 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 231(D) 1203 2412 2595 117 3286 1536 1057 3176 1165 3186 2436 428 2068 736 1824 2377 1366 2578 3334 2552 237 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 232(Q) 954 1983 100 971 2337 177 267 2067 81 2060 1189 125 1637 2600 418 514 597 1649 2268 1597 238 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 233(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 239 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 234(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 240 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 235(R) 377 1802 415 988 2095 1474 95 1786 1452 1785 911 135 1560 343 1555 409 431 376 1986 1375 241 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 236(D) 1083 1565 2662 244 1941 1573 679 612 527 1651 980 490 1869 358 1003 771 766 903 2208 1633 242 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 237(E) 1225 2868 1894 1948 3149 1532 671 2975 630 2902 2101 150 1935 293 1299 1884 1241 2496 3093 2248 243 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 238(C) 1375 3262 2620 2108 827 1866 1267 1631 1811 599 10 1674 2137 1531 1786 1034 790 249 1361 1010 244 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 239(E) 635 1796 1055 1761 2018 1464 263 1191 28 1767 946 148 1637 135 481 520 553 1300 2077 1441 245 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 240(E) 593 2044 252 2548 2437 1542 329 2133 151 2120 1274 244 1738 89 946 646 717 1734 2305 1686 246 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 241(S) 1884 835 1962 1576 1634 1436 1320 1041 1409 1453 781 1293 1922 1241 1606 1973 597 669 2036 1656 247 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 242(G) 2267 1043 2388 2526 3253 2642 2373 2975 2639 3260 2410 1722 2033 2311 2648 663 860 2005 3436 3250 248 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 243(R) 876 2087 829 1490 2474 1766 229 2106 1269 44 1198 424 1829 205 2225 775 768 1753 2143 1647 249 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 244(V) 2339 967 2970 2766 1878 1847 2252 32 2541 1299 918 2087 2399 2316 2545 1157 971 2345 2605 2251 250 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 245(I) 1827 1398 4307 3831 1099 3939 3142 2286 3619 1835 69 3579 3671 3177 3511 3178 1781 1918 2524 2310 251 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 246(V) 1178 1448 1943 1452 1776 2261 1140 227 1866 1260 816 1444 2448 902 540 1496 1176 2697 2161 1764 252 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 247(E) 508 1976 840 1547 2280 1393 117 2029 1400 1984 1077 1158 1531 330 253 378 454 262 2163 1471 253 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 248(M) 1703 991 2901 2342 528 2567 1550 166 2031 1544 2668 2104 2591 1715 2010 1685 1052 12 1442 1177 254 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 249(I) 1947 1516 4385 3885 916 4013 3118 2193 3656 2186 257 3656 3687 3109 3494 3250 1889 1383 2397 2258 255 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 250(E) 1322 2647 272 2491 3071 1811 576 2759 2306 2633 1854 464 2066 175 177 1144 1256 2368 2692 2140 256 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 251(K) 1395 2059 1711 1014 2215 2218 641 1709 3021 1652 2578 1075 2303 282 287 1423 1283 1603 2159 1803 257 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 252(D) 1285 2888 2677 176 3210 1189 737 3047 715 2977 2195 190 1979 2106 1379 1050 1315 2564 3161 2320 258 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 253(I) 2073 1632 4434 3975 911 4130 3238 3164 3706 1451 244 3779 3785 3187 3557 3413 2021 546 2449 2273 259 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 254(K) 1570 2144 1887 1191 2098 2363 750 1603 3034 938 1112 1231 2436 408 215 1616 1443 1580 2166 1804 260 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 255(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 261 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 256(R) 928 1705 1507 1055 2761 1730 896 2490 44 2489 1723 1042 2102 543 2614 2258 1053 1998 2546 2158 262 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 257(D) 1280 2865 3154 175 3194 1547 743 3034 728 2971 2194 190 1979 1342 1391 553 1316 2552 3161 2317 263 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 258(I) 1997 1562 4355 3927 1042 4066 3261 3343 3654 937 97 3718 3783 3239 3555 3364 1959 702 2549 2295 264 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 259(M) 2252 1821 4572 3991 530 4164 2990 2068 3709 1993 3197 3808 3685 2916 3406 3378 2149 172 2084 2091 265 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 260(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 266 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 261(R) 2131 2786 2704 1460 3618 2638 587 2976 1735 2645 1985 1353 2603 173 3492 2020 1828 2748 2484 2384 267 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 262(K) 1349 2635 381 2083 3083 1857 565 2750 2690 2612 1837 514 2090 161 61 1178 1271 2369 2655 2138 268 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 263(A) 2821 932 2451 2472 3065 1198 2233 2763 2434 3056 2201 1633 1940 2147 2468 1831 730 1840 3305 3055 269 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 264(F) 2063 1686 4037 3677 3437 3644 1706 2063 3359 135 67 3095 3486 2739 3127 2876 2012 83 1038 158 270 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 265(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 271 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 266(N) 1662 3306 2055 78 3621 1643 1040 3622 1272 3531 2870 3477 2182 724 2071 1371 1757 3092 3633 2700 272 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 267(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 273 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 268(I) 1760 1307 4325 3962 1735 4042 3726 3135 3828 579 515 3722 3869 3673 3896 3359 1752 2276 3240 2806 274 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 269(T) 1428 904 2334 2158 2747 1206 1940 2392 2037 2678 1846 1504 1896 1809 2163 902 3001 1635 2999 2705 275 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 270(V) 1745 1300 4286 3858 1446 3967 3370 2358 3688 852 261 3606 3749 3403 3673 3232 1717 2643 2856 2524 276 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 271(V) 1404 1072 3766 3305 1464 3356 2696 2276 3080 616 379 3001 3325 2870 3091 2563 1344 2521 2516 2113 277 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 272(M) 866 1113 2656 2412 1322 1920 1883 487 2061 587 4451 1950 2387 1928 2078 1220 1053 498 2134 1803 278 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 273(A) 2601 957 2898 2711 1943 1740 2211 165 2487 1406 1001 2008 2320 2260 2494 1053 929 1990 2626 2279 279 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 274(L) 1171 983 3266 2733 796 2795 1888 590 2418 2001 198 2418 2816 2106 2362 1944 965 1777 1724 1426 280 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 275(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 281 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 276(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 282 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 277(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 283 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 278(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 284 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 279(N) 2171 2655 1458 1748 3334 2364 2267 3943 2365 3936 3437 4205 2932 2205 2608 2224 2439 3392 3253 2909 285 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 280(A) 3134 934 2491 2567 3083 1203 2300 2766 2540 3082 2237 1672 1954 2240 2537 874 747 1844 3333 3093 286 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 281(V) 984 1045 3169 2909 1709 2304 2404 531 2643 988 697 2378 2722 2480 2661 1601 1504 3014 2588 2201 287 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 282(L) 2631 2159 4786 4228 462 4506 3231 96 3878 2828 2482 4157 3880 3016 3541 3793 2509 608 2134 2182 288 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 283(H) 3205 3079 2723 2890 2110 3046 5295 4135 2617 3813 3561 2886 3482 2833 2620 3291 3356 3895 2397 1681 289 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 284(L) 1623 1338 3726 3164 251 3255 1820 1373 2808 2371 514 2785 3086 2281 2613 2389 1543 161 1311 1782 290 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 285(L) 2333 1873 4640 4127 650 4326 3241 2176 3843 2519 523 3982 3833 3105 3579 3604 2247 56 2268 2230 291 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 286(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 292 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 287(M) 1886 1507 4178 3693 877 3806 2901 3008 3380 335 3109 3451 3570 2934 3251 3044 1840 524 2288 2089 293 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 288(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 294 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 289(H) 1490 2484 362 476 1816 1880 4320 2854 684 2770 2133 2185 2285 728 1000 1377 1550 2475 2146 1255 295 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 290(A) 2439 911 2326 2131 2811 1197 1934 2480 2011 2745 1898 1490 1888 1785 2153 1898 1073 1682 3044 2749 296 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 291(I) 2038 985 3388 2919 1320 2893 2277 2155 2677 587 297 2593 2992 2450 2697 2087 1208 1681 2229 1846 297 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 292(G) 1243 2769 311 1902 3172 1980 744 2992 697 2936 2152 1923 1974 377 1331 1030 1284 2506 3125 2308 298 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 293(V) 1738 1298 4281 3921 1737 3979 3665 1917 3774 601 528 3671 3834 3628 3843 3293 1735 3205 3215 2770 299 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 294(E) 833 2344 1092 2412 2643 1464 386 2413 146 2369 1505 96 562 29 717 666 862 1966 2562 1818 300 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 295(W) 1380 1116 3614 3026 1322 2981 1582 1966 2661 1775 556 2562 2865 2117 2424 2098 1302 187 2908 629 301 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 296(T) 350 973 2204 2178 2893 1236 2035 2561 2117 2862 2043 1536 1946 1916 2214 1618 3198 1758 3137 2831 302 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 297(L) 1443 1269 3144 2576 528 3014 1816 1945 2155 2102 508 2422 2899 1193 2133 2129 1369 50 1616 1384 303 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 298(D) 1826 3682 3559 1199 3883 1662 1073 3846 1391 3720 3110 272 2222 760 2283 1471 1913 3321 3864 2864 304 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 299(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 305 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 300(F) 3342 2776 4026 4232 4354 3545 1431 2315 4038 1801 1900 3299 3780 3350 3645 3490 3420 2566 739 349 306 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 301(Q) 1048 2608 205 2170 2893 1535 505 2680 255 2604 1769 1814 1849 2272 789 848 1028 2228 2770 2013 307 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 302(R) 1083 1687 691 135 2058 1406 178 1755 214 1793 924 145 1553 247 1670 383 1217 1367 2031 1404 308 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 303(I) 1915 1536 4077 3667 2027 3678 2155 3137 3381 144 94 3225 3506 2848 3202 2914 1871 345 1522 791 309 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 304(R) 689 2015 494 24 2395 1582 184 2087 444 2020 1151 1161 1687 1832 2131 626 614 1684 2156 1573 310 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 305(D) 387 1967 1600 1359 2275 1391 1561 2025 282 1976 1067 25 1525 342 1024 369 443 1584 2152 1462 311 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 306(R) 1460 2315 1793 887 2832 2237 431 2288 2193 2199 1473 946 2245 20 2706 1394 1275 591 2248 1961 312 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 307(V) 941 1027 3099 2832 1692 2234 2324 470 2565 1003 695 2305 2663 2399 2587 1527 1858 2876 2536 2152 313 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 308(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 314 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 309(V) 1090 1215 2097 1824 819 2221 2699 287 1392 1027 591 1674 2482 1446 1482 1482 1143 2879 1420 707 315 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 310(L) 2439 1972 4702 4181 588 4401 3258 1582 3881 2757 587 4061 3862 3093 3590 3689 2344 130 2230 2217 316 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 311(C) 2157 4166 3012 2973 2780 1022 2337 2398 2724 2744 1930 1786 1943 2372 2623 540 692 1624 3091 2881 317 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 312(D) 1732 3453 3468 99 3733 1645 1066 3747 1356 3641 3008 1690 2201 755 2209 1416 1833 3208 3752 2776 318 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 313(L) 2477 2023 4713 4122 1592 4329 2920 72 3835 2593 2472 3948 3754 2914 3466 3550 2350 634 1927 1830 319 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 314(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 320 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 315(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 321 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 316(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 322 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 317(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 323 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 318(K) 2 2257 1073 374 2740 1908 278 2339 2328 2192 1373 562 1953 2273 1344 952 933 1980 2234 1799 324 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 319(Y) 3482 2868 3701 3919 238 3552 1112 3000 3638 2516 2526 3027 3772 3101 3341 3418 3527 3071 441 4711 325 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 320(M) 1559 1267 3829 3380 1103 3357 2655 805 3067 64 3046 3065 3326 2779 3011 2591 1556 2855 2312 1998 326 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 321(M) 1225 469 2256 1679 1656 1926 870 90 1396 210 2763 1424 2028 1129 1411 1008 712 154 951 586 327 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 322(T) 738 2094 84 1704 2416 1495 317 2135 61 2127 1275 163 1704 1857 405 613 1930 1734 2331 1668 328 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 323(D) 1746 3458 3540 90 3744 1650 1081 3767 1381 3662 3036 1386 2211 772 2239 1429 1850 3226 3765 2789 329 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 324(L) 2451 1983 4707 4186 582 4409 3259 1510 3884 2778 592 4069 3865 3091 3590 3698 2355 150 2226 2214 330 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 325(H) 2923 2573 2959 2926 826 3449 4553 2508 2463 2054 1948 2279 3499 2191 2397 2761 2855 2540 123 2920 331 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 326(K) 373 1957 342 1025 2297 1472 98 2018 2111 1954 1056 906 1570 352 685 424 473 1592 2105 1469 332 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 327(V) 1739 1008 3509 3043 1376 3028 2406 1765 2807 615 334 2718 3093 2585 2823 2226 1263 2376 2322 1931 333 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 328(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 334 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 329(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 335 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 330(I) 1758 1302 4331 3970 1756 4054 3748 2976 3840 603 533 3731 3877 3693 3914 3372 1750 2505 3265 2824 336 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 331(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 337 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 332(Q) 1795 1440 730 492 2453 682 812 2151 508 2256 1426 624 1796 2666 901 590 689 1636 2510 1971 338 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 333(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 339 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 334(M) 2355 1988 4343 3834 504 4051 2868 105 3385 1451 4460 3680 3671 2806 3171 3327 2274 474 2039 1925 340 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 335(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 341 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 336(Y) 1187 974 3186 2638 117 2732 1255 1905 2270 73 1977 2217 2699 1882 2144 1841 1124 71 907 3254 342 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 337(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 343 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 338(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 344 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 339(K) 864 1785 860 366 2128 1763 407 1612 2624 1800 1045 629 1900 28 62 851 805 1127 2064 1581 345 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 340(N) 602 1686 275 1008 1926 1415 1528 1618 244 1673 815 1897 1530 299 244 371 391 322 1934 1306 346 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 341(G) 1709 2639 1362 690 3785 3257 1671 3805 1946 3792 3137 980 2480 1424 2576 1630 1936 3150 3628 3155 347 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 342(F) 942 799 2828 2226 1797 2476 1269 1109 581 1793 516 1952 2453 1557 1815 1558 875 52 1138 794 348 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 343(L) 2451 1983 4707 4186 582 4409 3259 1510 3884 2778 592 4069 3865 3091 3590 3698 2355 150 2226 2214 349 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 344(H) 3205 3079 2723 2890 2110 3046 5295 4135 2617 3813 3561 2886 3482 2833 2620 3291 3356 3895 2397 1681 350 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 345(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 351 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 346(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 352 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 347(C) 774 4452 2162 1688 1962 1478 1302 1474 944 1796 1088 1351 1979 1147 1684 732 719 1116 2225 1881 353 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 348(L) 2387 1922 4674 4155 617 4366 3250 1889 3865 2650 558 4023 3847 3098 3586 3647 2296 38 2247 2224 354 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 349(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 355 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 350(C) 1489 2972 4007 3563 1524 3541 2939 2612 3350 617 413 3224 3470 3129 3335 2770 1475 2269 2657 2248 356 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 351(T) 364 979 2232 2250 2904 1245 2090 2559 2191 2881 2075 1571 1964 1991 2260 905 3428 1762 3159 2858 357 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 352(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 358 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 353(K) 1716 2632 2004 1008 3336 2379 444 2764 2775 2484 1756 1035 2357 2151 1811 1592 1477 2481 2391 2172 359 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 354(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 360 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 355(V) 1771 1339 4275 3816 1235 3919 3194 2139 3617 1520 66 3558 3681 3244 3547 3164 1733 2390 2634 2369 361 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 356(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 362 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 357(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 363 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 358(N) 823 1917 96 1188 2187 1547 506 1711 265 1955 1191 2711 1815 144 747 757 815 1140 2297 1666 364 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 359(L) 2153 1779 4360 3884 675 3965 3012 392 3561 2726 467 3673 3662 2955 3355 3239 2102 1281 2207 2099 365 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 360(E) 1136 2084 175 2027 2436 1510 274 2147 1525 2118 1254 175 1692 152 251 593 670 1736 2296 1650 366 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 361(H) 893 1761 1357 214 2092 1387 1862 1810 229 1825 942 83 1527 293 273 640 793 1409 2050 1397 367 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 362(I) 608 458 2776 2176 1666 2202 1113 1712 1836 222 338 1782 2245 1512 1731 1292 867 1366 1036 684 368 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 363(P) 922 1912 1681 141 2123 1604 687 1787 550 187 1245 427 2677 363 1049 882 947 1524 2338 1711 369 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 364(D) 1692 3605 3364 1256 3770 1599 957 3700 1216 3569 2909 1025 2138 628 2083 1346 1761 3174 3765 2738 370 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 365(Q) 877 1646 633 499 1610 1781 505 1210 63 1648 649 558 1931 2241 360 907 814 1097 1882 1385 371 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 366(P) 648 2019 1139 203 2354 1436 285 2089 29 2086 1217 114 1965 1445 492 529 1244 1672 2300 1616 372 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 571 7108 1646 894 1115 701 1378 * * 367(R) 422 1009 851 304 1406 1496 183 740 147 894 230 440 775 21 2009 539 381 568 1136 521 373 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 23 6560 7602 894 1115 341 2249 * * 368(D) 1472 1668 1835 70 2356 1385 511 2062 246 2128 1275 318 1353 118 746 526 425 1602 2380 1752 374 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 369(G) 1044 2230 2141 100 3222 2291 982 3045 1033 3050 2258 395 1985 644 1669 858 1207 2428 3250 2493 375 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 370(Q) 2562 2904 1886 1971 3251 2661 2079 3690 1565 3469 3081 2107 3091 4371 1665 2585 2674 3411 3077 2821 376 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 371(D) 1275 2955 2862 1330 3205 1556 670 3029 1509 2936 2141 158 1955 290 1213 1025 1281 2554 3111 2272 377 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 372(V) 1738 1298 4281 3921 1737 3979 3665 1917 3774 601 528 3671 3834 3628 3843 3293 1735 3205 3215 2770 378 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 373(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 379 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 374(M) 584 1354 847 246 1467 1659 2505 1087 212 374 2571 449 1729 1171 1074 634 507 876 1617 1128 380 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 375(P) 910 2031 73 1195 2792 1488 794 2539 629 2588 1788 401 3005 439 1131 612 1014 2050 2815 2151 381 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 376(W) 1588 1300 3783 3197 329 3245 1926 2071 2827 1901 558 2822 3072 2297 2616 2381 1508 111 3483 1042 382 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 377(E) 1024 2640 1844 2310 2908 1498 505 2711 344 2636 1791 107 1824 1521 957 207 1011 2243 2817 2021 383 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 378(N) 826 2349 1089 227 2651 1487 341 2416 1494 2346 1475 2601 1724 1005 522 657 787 1968 2511 1791 384 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 379(P) 1932 1116 2232 2301 3058 1358 2206 2706 2336 3009 2238 1674 3274 2114 2406 739 914 1913 3260 3019 385 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 380(V) 914 773 2713 2129 712 2505 1388 1452 1084 1324 204 1926 2507 1580 1808 1591 859 1713 1424 1081 386 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 381(Y) 1484 2331 1762 887 2436 2254 420 2325 2137 2195 1475 949 2258 39 1983 1411 1295 2075 2087 2868 387 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 382(E) 1256 1890 206 1353 2196 1401 89 1930 812 1898 996 45 547 1252 162 356 414 1507 2083 1416 388 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 383(Q) 752 2272 1586 1407 2561 1448 308 2329 23 2276 1396 71 1677 1749 577 590 1569 1881 2459 1727 389 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 384(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 390 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 385(H) 964 2089 200 136 2264 1600 3833 2320 296 2338 1558 1362 1479 276 699 881 992 1924 2364 1652 391 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 386(L) 2451 1983 4707 4186 582 4409 3259 1510 3884 2778 592 4069 3865 3091 3590 3698 2355 150 2226 2214 392 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 387(Q) 1643 1017 1196 721 1189 1714 668 1336 497 907 297 823 1893 2044 794 784 569 339 1579 1135 393 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 388(I) 1760 1308 4323 3961 1730 4039 3721 3156 3825 575 512 3720 3867 3669 3893 3356 1753 2241 3236 2802 394 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 389(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 395 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 390(K) 1259 2115 1267 676 970 2105 1794 2040 2549 1955 1282 808 2165 167 114 1192 1140 1801 1301 2517 396 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 391(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 397 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 392(N) 2171 2655 1458 1748 3334 2364 2267 3943 2365 3936 3437 4205 2932 2205 2608 2224 2439 3392 3253 2909 398 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 393(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 399 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 394(A) 3121 934 2489 2561 3081 1203 2295 2766 2533 3080 2234 1669 1953 2234 2533 936 746 1844 3331 3090 400 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 395(E) 522 1773 240 1676 2248 1396 289 1968 50 1989 1115 174 1198 131 448 1226 677 1538 2214 1565 401 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 396(E) 1481 3230 1425 2936 3481 751 843 3354 954 3256 2520 187 2057 492 1711 1193 1527 2852 3445 2523 402 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 397(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 403 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 398(A) 2847 932 2454 2477 3066 1198 2236 2763 2439 3057 2202 1635 1940 2152 2471 1777 731 1840 3306 3056 404 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 399(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 405 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 400(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 406 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 401(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 407 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 402(I) 1761 1312 4317 3954 1713 4027 3703 3225 3814 556 498 3712 3859 3653 3877 3344 1754 2110 3216 2787 408 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 403(S) 348 981 2200 2194 2989 1227 2073 2686 2157 2970 2136 1541 1946 1946 2253 3060 1398 1824 3217 2916 409 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 404(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 410 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 405(V) 917 809 2556 1976 827 2491 1367 1339 1455 721 94 1841 2501 1487 1710 1570 863 2038 1514 1151 411 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 406(K) 1386 2643 447 1824 3108 1893 570 2762 2860 2616 1848 552 2117 166 3 1217 1300 2388 2647 2154 412 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 407(N) 537 1563 449 36 1889 1143 307 1529 932 1655 844 1794 1658 73 356 518 516 924 1962 1392 413 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 408(P) 894 2181 369 1705 2576 1650 357 2268 243 2210 1375 330 2093 63 1619 774 835 1876 2347 1769 414 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 409(V) 419 634 1376 807 1053 1737 499 198 623 505 178 600 1807 475 475 313 360 1389 1016 1303 415 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 410(I) 1282 1082 3022 2555 2426 2683 1767 2555 2191 443 88 2038 2692 1794 2075 1793 1220 317 361 552 416 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 411(T) 499 1595 431 966 1830 1487 185 1449 1092 1574 754 207 1601 213 206 458 2067 159 1877 1296 417 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 412(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 418 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 413(P) 632 1230 2074 2144 2996 1453 2116 2631 2128 2928 2213 1658 3610 2006 2221 852 1302 1931 3185 2917 419 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 414(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 420 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 415(R) 1454 2316 1780 878 2834 2232 428 2292 2281 2200 1473 940 2240 17 2627 1386 1270 588 2249 1960 421 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 416(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 422 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 417(F) 3342 2776 4026 4232 4354 3545 1431 2315 4038 1801 1900 3299 3780 3350 3645 3490 3420 2566 739 349 423 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 418(D) 1572 3426 2573 2447 3613 1583 879 3513 1050 3393 2684 1292 2085 535 1855 1253 1623 3000 3585 2609 424 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 419(S) 879 1989 1498 177 3045 1600 939 2843 904 2867 2046 438 1922 591 1483 2171 1044 2226 3072 2372 425 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 420(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 426 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 421(Q) 705 1925 199 2112 917 1534 288 1824 42 1842 1054 210 1709 2163 420 611 656 1502 1997 1291 427 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 422(H) 569 2048 1450 1526 2349 1405 1830 2103 181 2058 1157 37 1569 272 349 713 620 1662 2240 1537 428 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 423(C) 1626 2878 2671 2107 1264 1968 1091 233 1777 334 250 1672 2128 1459 1691 1096 529 1209 1066 704 429 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 424(M) 2042 1634 4379 3826 659 3976 2899 2765 3546 1204 3085 3605 3604 2896 3318 3183 1961 195 2135 2058 430 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 425(E) 412 2447 1356 2379 2747 1477 445 2527 243 2477 1622 107 855 36 831 730 894 2073 2668 1906 431 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 426(A) 2822 1031 2418 2539 3226 1898 2364 2941 2626 3229 2379 1722 2026 2302 2634 654 848 1983 3415 3226 432 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 427(I) 1772 1325 4307 3877 1405 3993 3383 2935 3705 820 217 3632 3761 3400 3682 3260 1742 2033 2838 2525 433 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 428(L) 875 1634 575 959 1581 1769 525 1179 135 1884 625 547 1931 1405 450 909 816 1074 1883 1383 434 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 429(A) 1705 1826 180 949 2318 1410 359 2041 53 2067 1204 1001 1652 52 561 1232 595 1609 2298 1643 435 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 430(D) 1074 2458 2381 60 2921 1927 658 2710 463 2675 1860 271 1918 276 866 915 1100 2245 2845 2124 436 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 431(K) 688 2117 785 888 2469 1529 187 2189 2380 2106 1221 162 1661 256 1134 553 619 1760 2240 1607 437 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 432(I) 2019 1582 4380 3941 1000 4086 3253 3295 3671 1100 145 3736 3783 3222 3556 3378 1976 657 2517 2289 438 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 433(Q) 490 1797 369 171 2078 1457 1762 1779 1157 1780 905 1165 1550 1798 48 396 422 725 1986 1366 439 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 434(A) 1954 1836 1733 180 2714 1429 806 2438 679 2518 1698 430 1775 448 1211 736 894 1923 2765 2117 440 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 435(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 441 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 436(D) 1736 3455 3490 97 3737 1646 1070 3753 1363 3647 3016 1602 2204 760 2218 1420 1838 3213 3756 2780 442 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 437(V) 1721 1302 4229 3874 1705 3894 3582 1607 3706 582 513 3610 3786 3559 3767 3209 1725 3294 3158 2712 443 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 438(V) 594 988 3391 2911 1164 2888 2187 845 2637 765 154 2576 2962 2387 2622 2074 1205 2800 2084 1724 444 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 439(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 445 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 440(I) 1754 1308 4295 3867 1434 3978 3377 2661 3697 862 247 3617 3754 3406 3679 3243 1725 2373 2852 2526 446 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 441(R) 2957 3022 3318 2735 3796 2998 1968 3912 846 3631 3157 2611 3280 1724 4056 3026 2913 3650 3096 3185 447 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 442(Y) 1321 1438 1994 1608 2186 527 450 1117 1481 1211 693 1178 2522 1217 1665 1518 1275 1021 198 3178 448 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 443(C) 675 2205 2544 972 572 2236 1121 1373 1671 679 261 1700 2270 1403 1668 1311 621 1601 1150 790 449 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 444(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 450 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 445(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 451 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 446(K) 1060 2058 1088 460 2432 1917 357 1970 2801 1978 1220 632 1990 1339 367 999 946 536 2145 1717 452 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 447(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 453 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 448(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 454 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 449(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 455 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 450(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 456 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 451(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 457 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 452(P) 1659 2241 2022 1646 3185 2242 1373 3000 450 2936 2274 1624 3435 1065 2095 1730 1750 2593 2816 2613 458 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 453(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 459 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 454(M) 2406 2296 3638 3594 1525 3105 2824 1047 3121 596 5043 3293 3425 3046 2996 2911 2552 1398 2513 2207 460 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 455(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 461 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 456(K) 1368 1491 763 332 2319 1417 551 1998 1786 2068 1221 500 1721 160 470 1631 587 1532 2299 1754 462 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 457(P) 1500 1738 2514 2380 1555 2358 2022 1126 2063 1224 841 2189 3436 2061 2129 1822 1674 1231 2290 1878 463 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 458(T) 351 974 2208 2185 2894 1237 2041 2561 2125 2863 2046 1539 1948 1923 2218 1543 3230 1758 3139 2834 464 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 459(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 465 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 460(M) 2706 986 2433 2144 1502 1684 1706 700 1858 968 2744 1705 2188 1713 1932 963 862 592 2145 1794 466 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 461(I) 2103 1659 4461 3992 869 4152 3233 3082 3723 1619 290 3801 3788 3171 3557 3432 2046 487 2418 2265 467 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 462(I) 1761 1312 4317 3954 1713 4027 3703 3225 3814 556 498 3712 3859 3653 3877 3344 1754 2110 3216 2787 468 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 463(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 469 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 464(K) 1641 2033 323 914 2415 1565 296 2097 2052 2080 1233 257 1736 125 133 646 702 1707 2258 1657 470 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 465(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 471 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 466(L) 1699 1807 2268 1925 830 2795 1551 455 1225 2510 90 1958 2845 1927 1308 2067 1651 846 1841 1454 472 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 467(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 473 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 468(D) 853 2415 2115 1717 2702 1468 378 2484 1085 2417 1546 84 1732 41 699 696 824 2025 2594 1839 474 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 469(S) 892 1780 931 688 2757 1643 830 2472 1671 2492 1708 799 2018 468 365 2676 1004 1981 2598 2130 475 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 470(C) 1135 3503 3700 3406 1670 2549 2675 653 3101 916 667 2727 2925 2870 3030 1868 1288 2927 2619 2222 476 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 471(A) 2590 1035 2404 2530 3236 2290 2365 2954 2627 3240 2389 1719 2027 2302 2637 656 851 1991 3423 3234 477 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 472(L) 2632 2152 4630 4185 1767 4324 2442 61 3879 2789 563 3833 3823 2970 3513 3609 2518 738 1527 945 478 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 473(I) 2073 1632 4434 3975 911 4130 3238 3164 3706 1451 244 3779 3785 3187 3557 3413 2021 546 2449 2273 479 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 474(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 480 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 475(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 481 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 476(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 482 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 477(R) 2957 3022 3318 2735 3796 2998 1968 3912 846 3631 3157 2611 3280 1724 4056 3026 2913 3650 3096 3185 483 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 478(F) 3342 2776 4026 4232 4354 3545 1431 2315 4038 1801 1900 3299 3780 3350 3645 3490 3420 2566 739 349 484 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 479(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 485 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 480(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 486 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 481(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 487 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 482(T) 359 976 2225 2229 2900 1242 2074 2560 2170 2875 2064 1561 1958 1969 2247 1110 3375 1760 3152 2850 488 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 483(Y) 3402 2632 3941 4011 1064 3924 3388 2526 3541 1996 1973 2625 3821 2664 3170 3135 3280 2619 3420 3756 489 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 484(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 490 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 485(M) 2322 1904 4536 3951 2387 4112 2676 67 3649 2034 3156 3710 3633 2803 3311 3309 2204 588 1794 1586 491 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 486(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 492 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 487(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 493 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 488(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 494 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 489(H) 3205 3079 2723 2890 2110 3046 5295 4135 2617 3813 3561 2886 3482 2833 2620 3291 3356 3895 2397 1681 495 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 490(V) 1754 1297 4329 3968 1770 4053 3752 2604 3840 621 545 3728 3878 3699 3917 3370 1746 2859 3276 2829 496 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 491(A) 2587 828 2477 2155 1837 1468 1728 743 1941 1564 954 1607 2033 1725 2034 738 1178 1108 2310 1972 497 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 492(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 498 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 493(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 499 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 494(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 500 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 495(Y) 866 976 1863 1331 1353 2145 1318 556 1116 777 173 1242 2197 1714 1301 1173 802 888 445 2749 501 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 496(D) 417 1831 1647 1094 2065 1488 353 1618 107 1820 1019 189 1698 30 623 603 643 1629 2154 1520 502 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 497(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 503 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 498(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 504 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 499(T) 492 1190 706 181 1475 311 333 1099 81 71 509 570 1113 6 509 450 1123 835 1680 1161 505 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 500(I) 2091 1746 3971 3840 1676 3532 3289 3684 3581 659 693 3562 3674 3445 3521 3194 2146 449 2877 2493 506 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 501(A) 3103 1036 2445 2572 3222 1051 2380 2930 2650 3226 2381 1739 2034 2327 2648 664 857 1981 3412 3228 507 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 502(L) 2239 1892 3711 3400 301 3520 1210 542 2948 2564 35 2786 3395 2438 2750 2747 2165 945 573 2562 508 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 503(V) 1757 1387 4101 3681 1174 3714 3031 880 3410 1254 60 3407 3585 3094 3354 2984 1743 3014 2536 2219 509 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 504(Q) 982 2251 866 971 2711 1822 252 2340 1444 2194 1356 464 1885 2646 1632 858 863 1958 2245 1765 510 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 505(E) 1162 2771 2137 2239 3046 1526 626 2849 546 2792 1983 145 1905 242 1192 940 1396 2385 2990 2169 511 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 506(G) 1707 2684 1591 614 3783 3190 1613 3795 1887 3775 3119 915 2456 1358 2539 1610 1924 3150 3636 3124 512 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 507(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 513 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 508(M) 473 522 1819 1236 468 1879 687 1519 996 566 1677 1154 1937 836 1131 1079 413 102 957 585 514 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 509(I) 1761 1312 4317 3954 1713 4027 3703 3225 3814 556 498 3712 3859 3653 3877 3344 1754 2110 3216 2787 515 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 510(T) 782 1467 550 1029 2202 1425 709 1791 472 1993 1203 528 1787 368 902 617 2685 1400 2333 1783 516 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 511(I) 1766 1333 4283 3923 1635 3967 3619 3388 3759 473 437 3672 3822 3576 3804 3285 1764 1695 3126 2717 517 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 512(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 518 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 513(A) 2705 1451 1036 913 2506 1504 1143 2174 794 2337 1613 946 1993 2040 1061 809 910 1703 2633 2156 519 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 514(H) 615 1680 1444 66 1883 168 2650 1558 86 1691 891 223 1680 31 577 571 585 1267 2007 1397 520 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 515(K) 654 2006 546 42 2376 1581 133 2066 1935 1987 1107 1132 1658 1043 1058 540 1180 1660 2113 1532 521 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 516(N) 933 2085 946 284 2472 1822 253 2090 1711 76 1204 1918 1876 175 1799 841 817 1755 2132 1663 522 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 517(E) 416 987 843 1107 1070 1583 338 623 183 879 172 489 1679 94 565 544 813 265 1379 905 523 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 518(I) 2258 1804 4588 4084 706 4269 3231 2527 3807 2292 465 3923 3814 3118 3570 3544 2181 190 2303 2237 524 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 519(Q) 477 1909 958 282 2211 1389 1484 1953 285 1921 1018 32 1517 2318 225 630 559 1525 2110 1430 525 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 520(L) 2127 1743 4402 3796 1257 3918 2674 149 3492 2527 2164 3553 3509 2714 3181 3095 2019 570 1870 1818 526 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 521(N) 723 2217 958 236 2518 1466 1611 2279 1719 2217 1334 2285 1666 166 401 570 677 1837 2382 1678 527 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 522(V) 1754 1297 4330 3968 1770 4053 3752 2623 3841 620 545 3729 3878 3699 3918 3371 1746 2846 3277 2830 528 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 523(S) 1545 974 2003 1825 2867 1206 1790 2580 1788 2795 1932 1362 1826 1586 1999 2362 672 1755 3057 2721 529 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 524(D) 1776 3649 3326 1869 3838 1642 1031 3788 1322 3660 3029 245 2192 711 2201 1425 1855 3264 3821 2816 530 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 525(E) 423 2950 1944 2696 3223 1545 718 3047 715 2979 2196 161 1968 347 1403 1043 1314 2569 3177 2316 531 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 526(E) 2641 3308 896 3732 3966 2458 2043 4105 2128 4016 3555 1531 2959 1842 2560 2479 2750 3722 3563 3385 532 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 527(L) 2339 1899 4618 4042 1570 4204 2849 1440 3758 2558 676 3825 3700 2902 3418 3418 2226 382 1924 1778 533 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 528(A) 2338 1990 241 938 2395 1557 423 2061 954 2103 1286 301 1791 26 375 717 784 1691 2330 1728 534 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 529(R) 524 2098 789 146 2504 1729 1632 2153 1229 2054 1204 379 1789 1328 2313 719 724 1774 2150 1637 535 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 530(R) 2957 3022 3318 2735 3796 2998 1968 3912 846 3631 3157 2611 3280 1724 4056 3026 2913 3650 3096 3185 536 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 531(R) 1895 2713 2327 1192 3484 2502 481 2856 2144 2544 1842 1161 2458 1393 3023 1770 1619 2599 2421 2259 537 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 532(A) 2935 1714 553 857 2769 1546 1218 2333 1106 2591 1873 809 2065 934 1502 954 1103 1872 2898 2374 538 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 533(A) 1291 1874 176 1227 2177 1392 109 1909 277 1891 995 1134 1522 1248 228 361 562 1492 2090 1419 539 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 534(W) 805 687 2581 2028 138 2236 697 897 1681 421 141 1645 2282 1369 1627 1315 636 90 4479 1809 540 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 535(H) 408 1801 274 1284 2096 1385 1500 1822 1168 1802 899 33 1479 1381 102 303 595 221 1996 1339 541 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 536(Q) 650 1737 627 72 1981 1615 209 1625 1223 392 866 318 1222 2120 50 598 572 1326 1932 1394 542 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 537(P) 2931 2878 3420 3706 4181 2925 3468 4621 3859 4490 4165 3491 4225 3781 3695 3182 3279 4087 3594 4064 543 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 324 7108 2368 894 1115 701 1378 * * 538(A) 2195 924 968 546 1397 1356 583 812 365 1167 487 618 1660 1324 684 483 404 462 1703 1242 544 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 19 6804 7846 894 1115 428 1961 * * 539(P) 411 1017 1886 1616 1600 1588 1411 962 1408 495 755 1384 3156 1323 1577 847 785 783 2111 1716 545 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 540(R) 1612 2397 2037 1033 2897 2352 458 2365 2184 665 1520 1051 2334 51 2602 1545 1395 2143 2262 2014 546 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 541(Y) 712 796 2334 1883 370 2028 986 143 1607 663 131 1587 2243 1383 1656 1178 771 1114 965 3479 547 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 542(T) 527 1669 1091 27 2315 1379 443 2033 151 2081 1218 282 557 41 650 1128 2077 1576 2321 1690 548 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 543(R) 2957 3022 3318 2735 3796 2998 1968 3912 846 3631 3157 2611 3280 1724 4056 3026 2913 3650 3096 3185 549 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 544(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 550 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 545(V) 1747 1296 4310 3948 1758 4023 3716 2215 3813 615 540 3705 3860 3670 3887 3339 1741 3087 3252 2806 551 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 546(L) 2871 2457 4231 4103 1033 3803 3165 541 3734 3130 31 3935 3797 3286 3484 3713 2869 1136 2394 2220 552 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 547(A) 2404 890 1926 1629 1803 1275 1415 1282 1490 392 963 1316 1930 1328 1674 654 644 952 2187 1810 553 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 548(K) 2620 2961 2461 2046 3743 2791 1570 3603 3784 3387 2839 2048 3039 1260 465 2604 2536 3331 3001 2988 554 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 549(Y) 3621 2707 4176 4424 2950 4049 394 2539 4002 1942 1987 2749 3933 2854 3451 3299 3499 2690 349 4094 555 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 550(A) 3438 1472 2846 3040 3287 1726 2735 2840 3028 3257 2662 2236 2447 2798 2944 1216 1387 2183 3405 3320 556 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 551(H) 1741 2627 2070 1046 3303 2401 2713 2751 2478 2476 1755 1061 2375 27 2379 1621 1497 2477 2379 2161 557 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 552(L) 1014 876 2956 2408 582 2550 1529 1721 2079 2042 345 2114 2581 1775 2028 454 980 286 1414 1096 558 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 553(V) 933 842 2818 2467 1542 1870 1890 154 2226 1095 617 1932 2326 1995 2259 1126 1070 2769 2180 1826 559 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 554(S) 787 1522 1486 1172 2714 1599 1112 2500 433 2563 1791 1110 2067 796 1351 2916 989 1943 2648 2234 560 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 555(S) 326 1010 1779 1541 2691 1234 1566 2386 1486 2594 1749 1228 1196 1330 1747 2396 1967 1662 2876 2496 561 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 556(A) 3121 934 2489 2561 3081 1203 2295 2766 2533 3080 2234 1669 1953 2234 2533 936 746 1844 3331 3090 562 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 557(S) 897 1462 2333 2543 3185 1640 2474 3294 2686 3497 2780 1973 2360 2483 2703 3465 1316 2413 3310 3025 563 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 558(R) 586 1873 516 979 2188 1543 123 1869 1290 353 980 202 1622 314 1886 491 782 1495 2024 1439 564 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 559(G) 2594 2690 3304 3623 4328 3747 3462 4761 3953 4671 4212 3320 3352 3748 3779 2839 2981 4004 3668 4222 565 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 560(C) 2804 3772 3185 3198 2739 1303 2462 2065 2882 2628 1924 1927 2044 2547 2727 661 799 1463 3099 2886 566 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 561(V) 1771 1603 3750 3689 2037 3050 3231 403 3479 1154 1076 3246 3399 3383 3437 2628 1917 3536 3074 2677 567 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 562(T) 1213 1674 2755 2906 3163 1922 2659 2698 2788 3105 2612 2311 2600 2708 2753 1463 3819 2197 3286 3156 568 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 16 7108 8150 894 1115 701 1378 * * 563(D) 2784 3432 4016 1200 4140 2466 2197 4505 2621 4365 3956 1551 3014 2039 3232 2593 2938 4046 3710 3552 569 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 21 6715 7757 894 1115 701 1378 * * 564(F) 525 445 2202 1627 1946 2001 744 1247 1346 952 561 1079 2030 1067 1362 1067 465 338 714 230 570 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 0