3-hydroxypropionic acid-producing recombinant microorganism and method of producing 3-hydroxypropionic acid using the same

09587255 ยท 2017-03-07

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed is a method of producing 3-hydroxypropionic acid comprising the step of culturing recombinant microorganism comprising a nucleic acid sequence encoding Ilyobacter polytropus-derived glycerol dehydratase, and a nucleic acid sequence encoding dehydrogenase, which converts 3-hydroxypropionaldehyde into 3-hydroxypropionic acid, and a recombinant microorganism used therefor. According to the present invention, the production of 3-hydroxypropionic acid remarkably increases and the production amount of 1,3-propanediol (1,3-PDO), which is generated as by-products when producing 3-hydroxypropionic acid, remarkably decreases, compared to known recombinant microorganisms comprising gene expressing Klebsiella pneumonia-derived Vitamin B.sub.12-dependent glycerol dehydratase.

Claims

1. A method of producing 3-hydroxypropionic acid comprising culturing a recombinant microorganism comprising a nucleic acid encoding an Ilyobacter polytropus glycerol dehydratase, and a nucleic acid comprising a Homo sapiens gene, an S. cerevisiae gene, or an E. coli gene encoding a 3-hydroxypropionaldehyde dehydrogenase, which converts 3-hydroxypropionaldehyde into 3-hydroxypropionic acid, with a carbon source to produce 3-hydroxypropionic acid.

2. The method of producing 3-hydroxypropionic acid according to claim 1, wherein the glycerol dehydratase comprises SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6.

3. The method of producing 3-hydroxypropionic acid according to claim 2, wherein the nucleic acid encoding the glycerol dehydratase comprises SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5.

4. The method of producing 3-hydroxypropionic acid according to claim 1, wherein the nucleic acid encoding the 3-hydroxypropionaldehyde dehydrogenase comprises a Homo sapiens aldH2 gene, an S. cerevisiae ald4 gene, or an E. coli aldA, aldB, or aldH gene.

5. The method of producing 3-hydroxypropionic acid according to claim 1, wherein the 3-hydroxypropionaldehyde dehydrogenase comprises SEQ ID NO: 12.

6. The method of producing 3-hydroxypropionic acid according to claim 4, wherein the nucleic acid encoding 3-hydroxypropionaldehyde dehydrogenase comprises a Homo sapiens aldH2 gene, an S. cerevisiae ald4 gene, or SEQ ID NO: 11.

7. The method of producing 3-hydroxypropionic acid according to claim 1, wherein the recombinant microorganism further comprises a nucleic acid encoding a glycerol dehydratase reactivator, wherein the glycerol dehydratase reactivator is a polypeptide comprising the amino acid sequence of GenBank accession nos. ABI36568.1, EF077655.1, or AAC15871, or comprising SEQ ID NO: 8 and SEQ ID NO: 10.

8. The method of producing 3-hydroxypropionic acid according to claim 7, wherein the nucleic acid encoding a glycerol dehydratase reactivator comprises SEQ ID NO: 7 and SEQ ID NO: 9.

9. The method of producing 3-hydroxypropionic acid according to claim 1, wherein the recombinant microorganism is cultured at a culture temperature of 30 C. or more.

10. An expression cassette comprising a transcription promoter operably linked to a nucleic acid encoding a glycerol dehydratase, a nucleic acid encoding a glycerol dehydratase reactivator, and a transcription terminator, wherein the glycerol dehydratase comprises SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6, and the glycerol dehydratase reactivator is a polypeptide comprising SEQ ID NO: 8 and SEQ ID NO: 10.

11. The expression cassette according to claim 10, wherein the nucleic acid encoding the glycerol dehydratase comprises SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5.

12. The expression cassette according to claim 10, further comprising a nucleic acid encoding a 3-hydroxypropionaldehyde dehydrogenase, which comprises a Homo sapiens aldH2 gene, an S. cerevisiae ald4 gene, or SEQ ID NO: 11.

13. The expression cassette according to claim 10, wherein the nucleic acid encoding a glycerol dehydratase reactivator comprises SEQ ID NO: 7 and SEQ ID NO: 9.

14. A recombinant microorganism comprising the expression cassette according to claim 10.

15. The recombinant microorganism according to claim 14, wherein the nucleic acid sequence encoding glycerol dehydratase comprises SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5.

16. The recombinant microorganism according to claim 14, wherein the expression cassette further comprises a nucleic acid encoding the 3-hydroxypropionaldehyde dehydrogenase, which comprises a Homo sapiens aldH2 gene, an S. cerevisiae ald4 gene, or SEQ ID NO: 11.

17. The recombinant microorganism according to claim 14, wherein the nucleic acid encoding a glycerol dehydratase reactivator comprises SEQ ID NO: 7 and SEQ ID NO: 9.

18. A recombinant microorganism comprising a nucleic acid encoding an Ilyobacter polytropus glycerol dehydratase, and a nucleic acid comprising a Homo sapiens gene, an S. cerevisiae gene, or an E. coli gene encoding a 3-hydroxypropionaldehyde dehydrogenase, which converts 3-hydroxypropionaldehyde into 3-hydroxypropionic acid.

19. The recombinant microorganism of claim 18, further comprising a nucleic acid encoding a glycerol dehydratase reactivator polypeptide comprising SEQ ID NO: 8 and SEQ ID NO: 10.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a schematic drawing showing the pathway of producing 3-hydroxypropionic acid from glycerol and the main compounds synthesized using the same as a precursor.

(2) FIG. 2 is a schematic cleavage map of the recombinant vector (ET-iBAB-H) of Example 1.

(3) FIG. 3 is a schematic cleavage map of the recombinant vector (ET-BAB-H) of Comparative Example 1.

(4) FIG. 4 schematically shows a method of measuring the concentration of 3-hydroxypropionaldehyde (3-HPA) using acrolein and tryptophan.

(5) FIG. 5 shows the change in the concentration (OD) of cell culture fluid over time, in the production experiment of 3-HP using the recombinant E. coli constructed in Example 1 and Comparative Example 1, under culture condition of 35 C. according to Experimental Example 1.

(6) FIG. 6 shows the change in pH of cell culture fluid over time, in the production experiment of 3-HP using the recombinant E. coli constructed in Example 1 and Comparative Example 1, under culture condition of 35 C. according to Experimental Example 1.

(7) FIG. 7 shows the production amount of 3-HP over time, in the production experiment of 3-HP using the recombinant E. coli constructed in Example 1 and Comparative Example 1, under culture condition of 35 C. according to Experimental Example 1.

(8) FIG. 8 shows the production amount of 1,3-PDO over time, in the production experiment of 3-HP using the recombinant E. coli constructed in Example 1 and Comparative Example 1, under culture condition of 35 C. according to Experimental Example 1.

(9) FIG. 9 shows the production amount of 3-HPA over time, in the production experiment of 3-HP using the recombinant E. coli constructed in Example 1 and Comparative Example 1, under culture condition of 35 C. according to Experimental Example 1.

(10) FIG. 10 shows the change in the concentration (OD) of cell culture fluid over time, in the production experiment of 3-HP using the recombinant E. coli constructed in Example 1 and Comparative Example 1, under culture condition of 30 C. according to Experimental Example 1.

(11) FIG. 11 shows the change in pH of cell culture fluid over time, in the production experiment of 3-HP using the recombinant E. coli constructed in Example 1 and Comparative Example 1, under culture condition of 30 C. according to Experimental Example 1.

(12) FIG. 12 shows the production amount of 3-HP over time, in the production experiment of 3-HP using the recombinant E. coli constructed in Example 1 and Comparative Example 1, under culture condition of 30 C. according to Experimental Example 1.

(13) FIG. 13 shows the production amount of 1,3-PDO over time, in the production experiment of 3-HP using the recombinant E. coli constructed in Example 1 and Comparative Example 1, under culture condition of 30 C. according to Experimental Example 1.

(14) FIG. 14 shows the production amount of 3-HPA over time, in the production experiment of 3-HP using the recombinant E. coli constructed in Example 1 and Comparative Example 1, under culture condition of 30 C. according to Experimental Example 1.

MODE FOR INVENTION

(15) Before specifically describing the invention, the meanings of the terms used herein will be described.

(16) As used herein, the term polypeptide is interpreted as comprising an amino acid sequence showing substantial identity to corresponding amino acid sequence. The substantial identity means that an amino acid sequence shows at least 80%, preferably at least 90% homology, when the amino acid sequence and any other sequence are aligned so that they are corresponded to the maximum, and the aligned sequences are analyzed using algorithm commonly used in the art.

(17) For example, the polypeptide includes polypeptide that have an amino acid sequence having about 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more identity to specific amino acid sequence, and is involved in the biosynthesis of 3-hydroxypropionic acid. In general, as the identity percent is higher, it is more preferable.

(18) And, the polypeptide having identity includes polypeptide that comprises an amino acid sequence having the deletion, substitution, insertion, and/or addition of an amino acid residue in the polypeptide of specific amino acid sequence, and is involved in the biosynthesis of 3-hydroxypropionic acid. In general, as the number of deletion, substitution, insertion, and/or addition is smaller, it is more preferable.

(19) As used herein, the term polynucleotide means to comprehensively include DNA (gDNA and cDNA) and RNA molecules, and nucleotide, which is the basic unit of a nucleic acid molecule, also includes sugar or base-modified analogues, as well as natural nucleotide.

(20) It is interpreted that the polynucleotide of the present invention is not limited to a nucleic acid molecule encoding the above described specific amino acid sequence (polypeptide), and includes nucleic acid molecules encoding amino acid sequences showing substantial identity to the amino acid sequence or polypeptide having a function corresponding thereto. The substantial identity means that an amino acid sequence shows at least 80%, preferably at least 90% identity, when the amino acid sequence of the present invention and any other sequence are aligned so that they are corresponded to the maximum, and the aligned sequences are analyzed using algorithm commonly used in the art.

(21) The polypeptide having a corresponding function includes, for example, polypeptides with an amino acid sequence having the deletion, substitution, insertion, and/or addition of at least one amino acid residue. Such polypeptides include polypeptides that consist of an amino acid sequence having the deletion, substitution, insertion, and/or addition of at least one amino acid residue, and are involved in the synthesis of 3-hydroxypropioni acid.

(22) The identity between amino acid sequences or nucleotide sequences may be measured using the BLAST algorithm by Karlin and Altschul, according to BLASTN and BLASTX programs based on a BLAST algorithm. When a nucleotide sequence is sequenced using BLASTN, the parameters of, for example, score=100 and word length=12 can be used. If an amino acid sequence is sequenced using BLASTX, the parameters of, for example, score=50 and word length=3 can be used. In case BLAST and Gapped BLAST programs are used, default parameters are applied for each program.

(23) The present invention provides a method of producing 3-hydroxypropionic acid comprising the step of culturing recombinant microorganism comprising a nucleic acid sequence encoding Ilyobacter polytropus-derived glycerol dehydratase and a nucleic acid sequence encoding dehydrogenase, which converts 3-hydroxypropionaldehyde into 3-hydroxypropionic acid, and microorganism used therefor. Hereinafter, the present invention will be explained in detail with reference to the attached drawings.

(24) The Ilyobacter polytropus-derived glycerol dehydratase of the present invention refers to a polypeptide having the enzymatic activity of converting glycerol into 3-hydroxypropionaldehyde (3HPA)

(25) The glycerol dehydratase of the present invention may allow a microorganism to use glycerol as a substrate, and it has superior activity of converting glycerol into 3-HPA, compared to the known vitamin B.sub.12-dependent Klebsiella pneumonia-derived glycerol dehydratase. And, it has appropriate balance with dehydrogenase for converting 3HPA into 3-HP, and thus, may minimize the production pathway of 1,3-PDO to decrease the production amount of 1,3-PDO.

(26) The Ilyobacter polytropus-derived glycerol dehydratase consists of 3 structural subunits of SEQ ID NO. 2, SEQ ID NO. 4, and SEQ ID NO. 6, which respectively correspond to DhaB1, DhaB2 and DhaB3 making up the , and subunits of a glycerol dehydratase enzyme.

(27) More specifically, the amino acid sequence of SEQ ID NO. 2 corresponds to Ilyobacter polytropus-derived DhaB1, the amino acid sequence of SEQ ID NO. 4 corresponds to Ilyobacter polytropus-derived DhaB2, and the amino acid sequence of SEQ ID NO. 6 corresponds to Ilyobacter polytropus-derived DhaB3.

(28) Meanwhile, the nucleic acid sequence of SEQ ID NO. 1 corresponds to Ilyobacter polytropus-derived dhaB1, the nucleic acid sequence of SEQ ID NO. 3 corresponds to Ilyobacter polytropus-derived dhaB2, and the nucleic acid sequence of SEQ ID NO. 5 corresponds to Ilyobacter polytropus-derived dhaB3.

(29) Thus, the nucleic acid sequence encoding glycerol dehydratase that can be used in the present invention may be a nucleic acid sequence encoding a polypeptide comprising the amino acid sequences of SEQ ID NO. 2, SEQ ID NO. 4, and SEQ ID NO. 6. Preferably, the nucleic acid sequence encoding glycerol dehydratase may be a nucleic acid sequence comprising all the , and subunits of a glycerol dehydratase enzyme, DhaB1, DhaB2 and DhaB3.

(30) The nucleic acid sequence encoding glycerol dehydratase may comprise nucleic acid sequences of SEQ ID NO. 1, SEQ ID NO. 3, and SEQ ID NO. 5. Preferably, the nucleic acid sequence encoding glycerol dehydratase may comprise nucleic acid sequences comprising all the , and subunits of a glycerol dehydratase enzyme, namely, SEQ ID NO. 1, SEQ ID NO. 3 and SEQ ID NO. 5.

(31) The dehydrogenase which converts 3-hydroxypropionaldehyde into 3-hydroxypropionic acid of the present invention is named as 3-hydroxypropionaldehyde dehydrogenase (3-HP dehydrogenase), which is an enzyme capable of converting 3-HPA into 3-HP through a dehydrogenation reaction, and uses NAD+/NADH or NADP+/NADPH as a coenzyme.

(32) The nucleic acid sequence encoding dehydrogenase which converts 3-hydroxypropionaldehyde into 3-hydroxypropionic acid may be selected from Homo Sapiens-derived aldH2 gene (NM _000690.3 (SEQ ID NO: 23), NM _001204889.1 (SEQ ID NO: 24)), S. cerevisiae-derived ald4 gene (NM _001183794.1 (SEQ ID NO: 25)), E. coli-derived aldA, aldB, aldH genes (SEQ ID NO. 11), and the like, but is not limited thereto. The nucleic acid sequence encoding dehydrogenase may be a nucleic acid sequence encoding polypeptide comprising the amino acid sequence as described SEQ ID NO. 12, which corresponds to E. coli K-12 derived AldH, and preferably, may be a nucleic acid sequence of SEQ ID NO. 11.

(33) The glycerol dehydratase is irreversibly inactivated by glycerol or by the interaction with 1,3-propanediol while it performs a catalytic function. Thus, the recombinant microorganism for producing 3-HP of the present invention may further comprise a nucleic acid sequence encoding a glycerol dehydratase reactivator for activating dehydratase. As the glycerol dehydratase reactivator, those commonly known in the art may be used, and it is known in WO 98/21341 (U.S. Pat. No. 6,013,494), document [R. Daniel et Eur. J. Biochem., 268 (2001), pp. 2369-2378], document [Toraya and Mori, J. Biol. Chem. 274:3372 (1999)] and document [Tobimatsu et al., J. Bacteriol. 181:4110 (1999)]. The nucleic acid sequence encoding a dehydratase reactivator may be selected from Citrobacter freundii-derived gene dhaFG (ABI36568.1), Klebsiella pneumonia-derived gdrAB (EF077655.1), Klebsiella oxytoca ddrAB (AAC15871), Ilyobacter polytropus-derived GdrA (SEQ ID NO. 7) and GdrB (SEQ ID NO. 9), and the like.

(34) Preferably, the nucleic acid sequence encoding a glycerol dehydratase reactivator may comprise a nucleic acid sequence encoding polypeptide comprising the amino acid sequences of SEQ ID NO. 8 and SEQ ID NO. 10, and preferably, it may comprise a nucleic acid sequence of SEQ ID NO. 7 and a nucleic acid sequence of SEQ ID NO. 9.

(35) Another embodiment of the invention provides an expression cassette operably comprising a transcription promoter, a nucleic acid sequence encoding glycerol dehydratase, a nucleic acid sequence encoding a glycerol dehydratase reactivator, and a transcription terminator.

(36) The expression cassette of the present invention refers to a nucleic acid fragment comprising a nucleic acid sequence encoding gene and a regulatory sequence existing before and after the nucleic acid sequence, and it typically is in a vector. The expression cassette generally comprises a promoter sequence, a sequence-encoding gene, and a transcription terminator sequence.

(37) The transcription promoter of the present invention refers to a DNA sequence controlling the expression of coding sequence, including enhancers. The promoter may be a gene's natural promoter or derived from another promoter. As used herein, the description that a promoter is operably linked means that the promoter is linked to a coding sequence so that the coding sequence may be expressed. The transcription terminator sequence of the present invention means a DNA sequence existing downstream of a sequence encoding gene(s).

(38) The promoter that can be used in the present invention may include CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, and lac, ara, tet, trp, T7, tac, trc, amy, apr, npr, and the like.

(39) Still another embodiment of the invention provides a microorganism comprising the expression cassette and involved in the biosynthesis of 3-hydroxypropionic acid.

(40) In the microorganism according to the present invention, the nucleic acid sequence encoding a glycerol dehydratase reactivator and the nucleic acid sequence encoding glycerol dehydratase may be derived from identical microorganism species, and it is most preferable in terms of the synthesis efficiency of 3-hydroxypropionic acid that both are derived from Ilyobacter polytropus.

(41) Thus, the recombinant microorganism according to the present invention may be preferably indicated as comprising nucleotides encoding polypeptides of SEQ ID NO. 2 (DhaB1), SEQ ID NO. 4 (DhaB1) and SEQ ID NO. 6 (DhaB1), SEQ ID NO. 8 (GdrA), SEQ ID NO. 10 (GdrB) and SEQ ID NO. 12 (AldH), and more preferably, it may be indicated as comprising nucleotides of SEQ ID NO. 1 (dhaB1), SEQ ID NO. 3 (dhaB1), SEQ ID NO. 5 (dhaB1), SEQ ID NO. 7 (gdrA), SEQ ID NO. 9 (gdrB) and SEQ ID NO. 11 (aldh).

(42) The microorganism that can be used to obtain the recombinant microorganism of the present invention is not specifically limited as long as it may express the corresponding gene, and it may be selected from the group consisting of bacteria, yeast and mold. Preferably, it is selected from the genus group consisting of Escherichia, Citrobacter, Enterobacter, Clostridium, Klebsiella, Lactobacillus, Aspergillus, Saccharomyces, Schizosaccharomyces, Zygosaccharomyces, Pichia, Kluyveromyces, Candida, Hansenula, Salmonella, Bacillus, Streptomyces and Pseudomonas. More preferably, it is E. coli.

(43) In the present invention, any known method can be used to construct the expression cassette and recombinant microorganism that can be used in the dehydration reaction of glycerol. The constructed expression cassette is introduced into a suitable host cell using any known method. Specifically, transformation by heat shock or electroporation and the like, transfection using a recombinant phage, and the like may be used. The introduced expression cassette may be maintained extrachromosomally, or it may be integrated into chromosome by homologous recombination or random recombination using a vector using known technology.

(44) The method of producing 3-hydroxypropionic acid of the present invention or the culture of recombinant microorganism used in the biosynthesis of 3-hydroxypropionic acid may be conducted in the presence of at least one carbon source selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, or glycerol. Among them, it is preferable in terms of the production efficiency of 3-HP and economical feasibility that glycerol is included as carbon source, and glucose is further included to facilitate cell growth. In the case of a microorganism that cannot naturally convert glucose into glycerol, foreign genes required for the conversion may be introduced by any known method to allow the production of 3-HP from glucose. To the medium used for the culture, vitamin B.sub.12 may be added.

(45) The culture conditions may be appropriately controlled according to the used host cell, and for example, the culture of E. coli may be conducted under aerobic conditions, pH 67.6, at a temperature of 30 C. or more, preferably at a temperature of 3337 C., for 14 days. In this case, cell growth may be active and 3-hydroxypropionic acid may be efficiently produced. As to the culture temperature, since enzymes and microorganisms stable at high temperature are used, cooling is not required to maintain the culture temperature, thus reducing additional facility for cooling and the like and the resulting cost. In the process of producing 3-HP using a microorganism, the culture temperature increases due to culture heat generated by microorganism culture, and if enzymes or microorganisms having high stability even under increased culture temperature condition are used, 3-HP may be continuously produced with high efficiency under stabilized condition.

(46) The present invention may be conducted batchwise, pad-batchwise, or continuously, and any known fermentation method may be appropriate. And, the cell may be fixed on a substrate and fermented.

(47) It was confirmed that since the Ilyobacter polytropus-derived glycerol dehydratase according to the present invention exhibits superior productivity of 3-hydroxypropionic acid, and decreases the production of 1,3-propanediol, compared to the previously reported Klebsiella pneumonia-derived glycerol dehydratase, it may be effectively used in the production of 3-hydroxypropionic acid instead of the existing Klebsiella pneumonia-derived glycerol dehydratase.

(48) The present invention will be explained in detail with reference to the following examples. However, these examples are only to illustrate the invention, and it is not to be understood that the scope of the invention is limited thereto.

EXAMPLE 1

Construction of Recombinant Microorganism Comprising Genes Encoding Ilyobacter polytropus-Derived Glycerol Dehydratase

(49) <Step 1> Construction of a Recombinant Vector Comprising Genes Expressing Ilyobacter polytropus-Derived Glycerol Dehydratase

(50) Genome DNA was extracted from Ilyobacter polytropus DSM 2926, and dhaB123-gdrA and gdrB genes were PCR amplified from the genome DNA respectively using the following primers and inserted respectively at the locations of NcoI-EcoRI and EcoRI-SacI of a pET-Duet (Novagen) vector to construct an ET-iBAB vector.

(51) 1) Primers Used for dhaB1, dhaB2 and dhaB3 Gene Amplification

(52) TABLE-US-00001 Forwarddirectionprimer (SEQIDNO.13:TCATGAAATCAAAAAGATTTGAAGT ATTGAAG(BspHI)) Reversedirectionprimer (SEQIDNO.14:GGATCCCTAATCTTTTCTAAGTTGA CCTCTTTGTTC(BamHI)) 2)PrimersusedforgdrAandgdrBgene amplification Forwarddirectionprimer (SEQIDNO.15:GGATCCAAAGGTTCGGGGATAGTTA TGAAG(BamHI)) Reversedirectionprimer (SEQIDNO.16:GAGCTCTTATCTAAGTGGCAGACCC TTTACAAG(SacI))

(53) After PCR was completed, dhaB1, dhaB2 and dhaB3 were cleaved with BspHI and BamHI, and gdrA and gdrB were cleaved with BamHI and SacI.

(54) PCR conditions are as follows: Use of Phusion high fidelity DNA polymerase (Thermo scientific), Cycle I (98 C., 30 sec), Cycle II (30 cycles/98 C., 10 sec/55 C., 1 min, 72 C., 2 min), Cycle III (72 C., 5 min).

(55) Both amplified DNA fragments were inserted respectively at the locations of NcoI-EcoRI and EcoRI-SacI of a pET-Duet (Novagen) vector to construct ET-iBAB.

(56) <Step 2> Construction of a Recombinant Vector Comprising Gene Encoding Aldehyde Dehydrogenase

(57) Genome DNA was extracted from E. coli K-12, and the aldH gene was amplified using the following primer, and cleaved with NdeI and Bgl II.

(58) TABLE-US-00002 Forwarddirectionprimer (SEQIDNO.17:TTTCATATGAATTTTCATCATCTGG CTTAC(NdeI)) Reversedirectionprimer (SEQIDNO.18:TTTAGATCTTTCGGTCATTTCAGGC CTCCA(BglII))

(59) PCR conditions were as follows: Use of LA taq polymerase (Takara, Japan), Cycle I (97 C., 5 min), Cycle II (31 cycles/97 C., 1 min/55 C., 1 min, 72 C., 3 min), Cycle III (72 C., 10 min). The amplified DNA was introduced into a pETDuet vector (Novagen) cleaved with the same enzyme to construct an ET-H vector.

(60) <Step 3> Construction of a Recombinant Vector Comprising Genes for the Production of 3-HP

(61) The ET-H vector of the <Step 2> was treated with restriction enzymes SalI-HF and Avr II to obtain an aldH containing DNA fragment, which was introduced into the ET-iBAB vector of the <Step 1> treated with the same enzyme to construct an ET-iBAB-H vector (See FIG. 2).

(62) FIG. 2 schematically shows the cleavage map of the recombination vector (ET-iBAB-H) of Example 1. 1) dhaB1, dhaB2 and dhaB3 genes are genes encoding Ilyobacter polytropus-derived glycerol dehydratase, 2) gdrA, gdrB are genes encoding Ilyobacter polytropus-derived glycerol dehydratase reactivator, and 3) aldH is gene encoding E. coli K-12-derived aldehyde dehydrogenase.

(63) <Step 4> Construction of E. coli Transformed with a Recombination Vector

(64) E. coli was transformed with the recombination vector ET-iBAB-H constructed in the <Step 3> to construct a recombinant strain.

COMPARATIVE EXAMPLE 1

Construction of Recombinant Microorganism Comprising Genes Encoding Klebsiella pneumonia-Derived Glycerol Dehydratase

(65) The genome DNA of Klebsiella pneumonia DSM 2026 was extracted, and dhaB123-gdrA and gdrB genes were PCR amplified using the following primers and inserted respectively into the locations of NcoI-EcoRI and EcoRI-SalI of a Pet-Duet (Novagen) vector to construct an ET-BAB vector.

(66) 1) Primers Used for dhaB123-gdrA Gene Amplification

(67) TABLE-US-00003 Forwarddirectionprimer (SEQIDNO.19:ATATCATGAAAAGATCAAAACGATT T(BspHI)) Reversedirectionprimer (SEQIDNO.20:AAAGAATTCCGCGAGCGCCCGTTTA ATTC(EcoRI)) 2)PrimerusedforgdrBgeneamplification Forwarddirectionprimer (SEQIDNO.21:TTTGAATTCTAACGAGGGGACCGTC ATGTC(EcoRI)) Reversedirectionprimer (SEQIDNO.22:ATAGTCGACTCAGTTTCTCTCACTT AACGG(SalI))

(68) The PCR was conducted as a process of Cycle I (95 C., 5 minutes), Cycle II (30 cycles/95 C., 30 seconds/55 C., 30 seconds/72 C., 5 minutes (dhaB123-gdrA) or 30 seconds (gdrB)), and Cycle III (72 C., 5 minutes).

(69) Genome DNA was extracted from E. coli K-12 to obtain aldH gene, the aldH gene was amplified using the following primer and cleaved with NdeI and BglII.

(70) TABLE-US-00004 Forwarddirectionprimer (SEQIDNO.17:TTTCATATGAATTTTCATCATCTGG CTTAC(NdeI)) Reversedirectionprimer (SEQIDNO.18:TTTAGATCTTTCGGTCATTTCAGGC CTCCA(BglII))

(71) PCR conditions were as follows: Use of LA taq polymerase (Takara, Japan), Cycle I (97 C., 5 min), Cycle II (31 cycles/97 C., 1 min/55 C., 1 min, 72 C., 3 min), Cycle III (72 C., 10 min).

(72) The amplified DNA was introduced into a pET-BAB cleaved with the same enzyme to construct an ET-BAB-H vector. E. coli was transformed with the constructed recombination vector ET-BAB-H to construct a recombinant strain (See FIG. 3).

(73) FIG. 3 schematically shows the cleavage map of the recombination vector of Comparative Example 1 (ET-BAB-H). 1) dhaB1, dhaB2 and dhaB3 genes are Klebsiella pneumonia-derived glycerol dehydratase genes, 2) gdrA, gdrB are Klebsiella pneumonia-derived glycerol dehydratase reactivator genes, and 3) aldH is a gene encoding E. coli K-12-derived aldehyde dehydrogenase.

EXPERIMENTAL EXAMPLE 1

Synthesis of 3-Hydroxypropionic Acid (3-HP)

(74) To culture the recombinant E. coli constructed in Example 1 and Comparative Example 1, 50 ml of LB medium was put in each 250 ml flask, and pre-culture was conducted in a 37 C. rotating culture apparatus for 12 hours. Thereafter, 50 ml of M9 medium was put in the 250 ml flask, and cultured in a 35 C. culture apparatus to induce the expression with 0.03 mM isopropyl -D-thiogalactopyranoside (IPTG) at the optical density (OD) of 0.8. At 24 and 48 hours, a part of the culture liquid was extracted to measure the optical density (OD) and pH, and the production of 3-HP was confirmed by high performance liquid chromatography (HPLC).

(75) For 3-HP analysis, an Aminex HPX-87H (300 mm*7.8 mm) column was used, and a solution containing 9% acetonitrile in a 0.5 mM sulfuric acid solution was used as a mobile phase and flowed at a flow rate of 0.4 ml/min. The temperature of the column was 35 C., and RI and UV/VIS (210 nm) dual mode was used as a detector. 3-HP was detected at 17.5 minute during the total analysis time of 35 minutes, and the production of 3-HP was also confirmed by Liquid chromatography/mass spectrometry (LC/MS).

(76) As shown in FIG. 5 and FIG. 6, although OD values were similar up to 10 hours in both strains, the strain of Example 1 showed a little higher value than the strain of Comparative Example 1 after 10 hours, and the pH of the culture liquid showed a similar aspect.

(77) Meanwhile, as to the production amount of 3-HP, the strain of Comparative Example 1 showed 48.9 mM at 24 hours and 61.1 mM at 48 hours, while the strain of Example 1 according to the present invention showed high 3-HP production amount of 83.3 mM at 24 hours, and 121 Mm at 48 hours (FIG. 7)

(78) And, as to the production amount of by-product 1,3-PDO, the strain of Comparative Example 1 showed 35.0 Mm at 24 hours and 50.0 mM at 48 hours, while the strain of Example 1 according to the present invention showed remarkably decreased by-product generation of 11.6 mM at 24 hours and 18.0 mM at 48 hours. (See FIG. 8)

(79) The total activity of glycerol dehydratase may be indirectly confirmed by adding the production of 3-HP and the production of 1,3-PDO, and calculating the amount of 3-HPA (FIG. 9). Comparative Example 1 was measured as 83.8 mM at 24 hours and 111.0 mM at 48 hours, while the strain of Example 1 according to the present invention produced 94.9 mM of 3-HPA at 24 hours, and 139.0 mM of 3-HPA at 48 hours.

(80) Thus, it was confirmed that in case Ilyobacter polytropus-derived glycerol dehydratase was used according to the present invention, the production amount of 3-HPA increased 25% and thus the production amount of 3-HP increased 96%, compared to the case of using the existing klebsiella pneumonia-derived glycerol dehydratase. Furthermore, the production amount of by-product 1,3-PDO decreased 64%, and thus, it can be seen that according to the present invention, the production of 3-HP increases, and the generation of 1,3-PDO decreases, thereby maximizing the production of 3-HP.

EXPERIMENTAL EXAMPLE 2

Synthesis of 3-Hydroxypropionic Acid (3-HP)

(81) To culture the recombinant E. coli constructed in Example 1 and Comparative Example 1, 50 ml of LB medium was put in each 250 ml flask, and pre-culture was conducted in a 37 C. rotating culture apparatus for 12 hours. Thereafter, 50 ml of M9 medium was put in the 250 ml flask, and cultured in a 30 C. culture apparatus to induce the expression with 0.03 mM isopropyl -D-thiogalactopyranoside (IPTG) at the optical density (OD) of 0.8. At 24 and 48 hours, a part of the culture liquid was extracted to measure the optical density (OD) and pH, and the production of 3-HP was confirmed by high performance liquid chromatography (HPLC).

(82) For 3-HP analysis, an Aminex HPX-87H (300 mm*7.8 mm) column was used, and a solution containing 9% acetonitrile in a 0.5 mM sulfuric acid solution was used as a mobile phase and flowed at a flow rate of 0.4 ml/min. The temperature of the column was 35 C., and RI and UV/VIS (210 nm) dual mode was used as a detector. 3-HP was detected at 17.5 minute during the total analysis time of 35 minutes, and the production of 3-HP was also confirmed by Liquid chromatography/mass spectrometry (LC/MS).

(83) As shown in FIG. 10 and FIG. 11, although OD values were similar in both strains, the strain of Example 1 showed a little lower value than the strain of Comparative Example 1, and the pH of the culture liquid showed a similar aspect.

(84) As to the production amount of 3-HP, the strain of Comparative Example 1 showed 83.72 mM at 24 hours and 109.36 mM at 48 hours at 30 C., while the strain of Example 1 according to the present invention showed 58.27 mM at 24 hours and 83.34 Mm at 48 hours at 30 C. (FIG. 12). As to the production amount of 1,3-PDO, the strain of Comparative Example 1 showed 31.65 Mm at 24 hours and 61.47 mM at 48 hours at 30 C., while strain of Example 1 according to the present invention showed 16.34 mM at 24 hours and 48.89 mM at 48 hours at 30 C. (See FIG. 13).

(85) As to the production amount of 3-HPA that can be confirmed by adding 3-HP and 1,3-PDO, the strain of Comparative Example 1 showed 116.37 mM at 24 hours and 170.83 mm at 48 hours at 30 C., while the strain of Example 1 according to the present invention showed 74.61 Mm at 24 hours and 132.23 mM at 48 hours at 30 C. (FIG. 14).

(86) As shown in the above experimental results, although the activity of K. pneumoniae-derived glycerol dehydratase is superior at a culture temperature of 30 C., it rapidly loses the activity as the temperature increases. To the contrary, Ilyobacter polytropus-derived glycerol dehydratase maintains the activity though the temperature increases. Thus, it can be seen that Ilyobacter polytropus-derived glycerol dehydratase has superior heat stability to K. pneumoniae-derived glycerol dehydratase.

(87) Therefore, it was confirmed that in case Ilyobacter polytropus-derived glycerol dehydratase is used according to the present invention, the production amount of 3-HPA increases and thus the production amount of 3-HP increases, compared to the case of using the existing klebsiella pneumonia-derived glycerol dehydratase. Furthermore, the generation of by-product 1,3-PDo decreases, and thus, it can be seen that the present invention may increase the production of 3-HP and decrease the generation of 1,3-PDO thus maximizing the production of 3-HP.

(88) Although specific embodiments of the invention have been described in detail, it would be obvious to one of ordinary knowledge in the art that these are no more than preferable embodiments, and the scope of the invention is not limited thereto. Thus, the substantial scope of the invention is defined by the attached claims and equivalents thereof.