Polypeptides with Ketol-Acid Reductoisomerase Activity
20170044578 ยท 2017-02-16
Inventors
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
Y02P20/52
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N9/0008
CHEMISTRY; METALLURGY
International classification
Abstract
Polypeptides having ketol-acid reductoisomerase activity are provided. Also disclosed are recombinant host cells comprising isobutanol biosynthetic pathways employing such polypeptides. Methods for producing isobutanol employing host cells comprising the polypeptides having ketol-acid reductoisomerase activity are also disclosed.
Claims
1. A recombinant host cell comprising an isobutanol biosynthetic pathway and a. a heterologous polypeptide with ketol-acid reductoisomerase activity having at least about 85%, at least about 90% identity, at least about 95%, or at least about 98% identity to one of the following: K9JM2 (SEQ ID NO: 193), K9JM3 (SEQ ID NO: 194), K9JM4 (SEQ ID NO: 195), K9JM5 (SEQ ID NO: 196), K9JM6 (SEQ ID NO: 197), K9JM7 (SEQ ID NO: 198), K9JM8 (SEQ ID NO: 199), K9JM9 (SEQ ID NO: 200), K9JM10 (SEQ ID NO: 201), K9JM11 (SEQ ID NO: 202), K9JM12 (SEQ ID NO: 203), K9JM13 (SEQ ID NO: 204), K9JM14 (SEQ ID NO: 205), K9JM15 (SEQ ID NO: 206), K9JM16 (SEQ ID NO: 207), K9JM17 (SEQ ID NO: 208), K9JM18 (SEQ ID NO: 209), K9JM19 (SEQ ID NO: 210), K9JM20 (SEQ ID NO: 211), K9JM21 (SEQ ID NO: 212), K9JM22 (SEQ ID NO: 213), K9JM23 (SEQ ID NO: 214), K9JM24 (SEQ ID NO: 215), K9JM25 (SEQ ID NO: 216), K9JM26 (SEQ ID NO: 217), K9JM27 (SEQ ID NO: 218), K9JM28 (SEQ ID NO: 219), K9JM29 (SEQ ID NO: 220), K9JM30 (SEQ ID NO: 221), K9JM31 (SEQ ID NO: 222), JM32 (SEQ ID NO: 223), JM33 (SEQ ID NO: 224), JM34 (SEQ ID NO: 225), JM35 (SEQ ID NO: 226), JM36 (SEQ ID NO: 227), JM37 (SEQ ID NO: 228), JM38 (SEQ ID NO: 229), JM39 (SEQ ID NO: 230), JM40 (SEQ ID NO: 231), JM42 (SEQ ID NO: 232), JM43 (SEQ ID NO: 233), JM44 (SEQ ID NO: 234), K9SB2 (SEQ ID NO: 235), K9_DAVID_SH (SEQ ID NO: 236), K9ALL3 (SEQ ID NO: 237), K9_URSALA (K9SB2+A56V) (SEQ ID NO: 239), JM41 (SEQ ID NO: 240), K9ALL148 (SEQ ID NO: 241), K9JM148 (SEQ ID NO: 242), K9ALL156 (SEQ ID NO: 243), K9JM156 (SEQ ID NO: 244), K9ALL191 (SEQ ID NO: 245), K9JM191 (SEQ ID NO: 246), K9ALL254 (SEQ ID NO: 247), K9ALL278 (SEQ ID NO: 248), K9ALL37 (SEQ ID NO: 249), K9JM375 (SEQ ID NO: 250), K9ALL66 (SEQ ID NO: 66), K9JM66 (SEQ ID NO: 252), K9ALL8Q (SEQ ID NO: 253), K9JM8Q (SEQ ID NO: 254), K9ALL45 (SEQ ID NO: 255), K9_LUCY (SEQ ID NO: 300), K9_ILYA (SEQ ID NO: 301), K9ALL258 (SEQ ID NO: 302), K9YW25-T191S (SEQ ID NO: 303), F53L (SEQ ID NO: 307), F53I (SEQ ID NO: 308), F53M (SEQ ID NO: 309), F53V (SEQ ID NO: 310), F53P (SEQ ID NO: 311), F53S (SEQ ID NO: 312), F53A (SEQ ID NO: 313), F53E (SEQ ID NO: 314), F53Q (SEQ ID NO: 315), T11-1 (SEQ ID NO: 316), T11-2 (SEQ ID NO: 317), T11-3 (SEQ ID NO: 318), T11-4 (SEQ ID NO: 319), T11-5 (SEQ ID NO: 320), T11-6 (SEQ ID NO: 321), T11-7 (SEQ ID NO: 322), T11-10 (SEQ ID NO: 323), T11-12 (SEQ ID NO: 324), T11-13 (SEQ ID NO: 325), T11-14 (SEQ ID NO: 326), T11-15 (SEQ ID NO: 327), T11-16 (SEQ ID NO: 328), T11-18 (SEQ ID NO: 329), T11-19 (SEQ ID NO: 330), T11-21 (SEQ ID NO: 331), T11-22 (SEQ ID NO: 332), T11-25 (SEQ ID NO: 333), T11-27 (SEQ ID NO: 334), T11-28 (SEQ ID NO: 335), T11-29 (SEQ ID NO: 336), T11-30 (SEQ ID NO: 337), T11-32 (SEQ ID NO: 338), T11-33 (SEQ ID NO: 339), T11-35 (SEQ ID NO: 340), T11-36 (SEQ ID NO: 341), T11-37 (SEQ ID NO: 342), T11-38 (SEQ ID NO: 343), T11-39 (SEQ ID NO: 344), T11-42 (SEQ ID NO: 345), T11-43 (SEQ ID NO: 346), T11-44 (SEQ ID NO: 347), T11-45 (SEQ ID NO: 348), T11-46 (SEQ ID NO: 349), T11-47 (SEQ ID NO: 350), T11-49 (SEQ ID NO: 351), T11-50 (SEQ ID NO: 352), T11-52 (SEQ ID NO: 353), T11-54 (SEQ ID NO: 354), T11-55 (SEQ ID NO: 355), T11-56 (SEQ ID NO: 356), T11-57 (SEQ ID NO: 357), T11-58 (SEQ ID NO: 358), T11-59 (SEQ ID NO: 359), T11-60 (SEQ ID NO: 360), T11-61 (SEQ ID NO: 361), T11-62 (SEQ ID NO: 362), T11-64 (SEQ ID NO: 363), T11-66 (SEQ ID NO: 364), T11-67 (SEQ ID NO: 365), T11-69 (SEQ ID NO: 366), T11-70 (SEQ ID NO: 367), T11-72 (SEQ ID NO: 368), T11-74 (SEQ ID NO: 369), T11-75 (SEQ ID NO: 370), T11-76 (SEQ ID NO: 371), T11-79 (SEQ ID NO: 372), T11-80 (SEQ ID NO: 373), T11-81 (SEQ ID NO: 374), T11-83 (SEQ ID NO: 375), T11-84 (SEQ ID NO: 376), T11-85 (SEQ ID NO: 377), T11-86 (SEQ ID NO: 378), T11-87 (SEQ ID NO: 379), T11-88 (SEQ ID NO: 380), T11-91 (SEQ ID NO: 381), T11-94 (SEQ ID NO: 382), T11-95 (SEQ ID NO: 383), T11-96 (SEQ ID NO: 384), T11-97 (SEQ ID NO: 385), T11-99 (SEQ ID NO: 386), T11-103 (SEQ ID NO: 387), T11-104 (SEQ ID NO: 388), T11-109 (SEQ ID NO: 389), T11-110 (SEQ ID NO: 390), T11-111 (SEQ ID NO: 391), T11-114 (SEQ ID NO: 392), T11-116 (SEQ ID NO: 393), T11-117 (SEQ ID NO: 394), T11-119 (SEQ ID NO: 395), T11-121 (SEQ ID NO: 396), T11-122 (SEQ ID NO: 397), T11-124 (SEQ ID NO: 398), T11-125 (SEQ ID NO: 399), T11-128 (SEQ ID NO: 400), T11-130 (SEQ ID NO: 401), T11-131 (SEQ ID NO: 402), T11-134 (SEQ ID NO: 403), E147V (SEQ ID NO: 552), G164D (SEQ ID NO: 404), G304V (SEQ ID NO: 405), N258S (SEQ ID NO: 406), T71S (SEQ ID NO: 407), V184I (SEQ ID NO: 408), A279D (SEQ ID NO: 409), D98V (SEQ ID NO: 410), M169F (SEQ ID NO: 411), M169K (SEQ ID NO: 412), M169L (SEQ ID NO: 413), E100Q_M312K (SEQ ID NO: 414), ECB11 (SEQ ID NO: 534), EC2A2 (SEQ ID NO: 535), EC2B12 (SEQ ID NO: 536), EGC10 (SEQ ID NO: 537), EGD9 (SEQ ID NO: 538), EGG8 (SEQ ID NO: 539), EHG1 (SEQ ID NO: 540), EHG2 (SEQ ID NO: 541), EHH6 (SEQ ID NO: 520), EHH9 (SEQ ID NO: 521), EHH10 (SEQ ID NO: 522), EHH12 (SEQ ID NO: 523), EKC5 (SEQ ID NO: 546), EKG4 (SEQ ID NO: 547), EJF5 (SEQ ID NO: 548), EJB8 (SEQ ID NO: 549), EJA1 (SEQ ID NO: 550), EJB10 (SEQ ID NO: 551), K9_Lucy_SH (SEQ ID NO: 553), or K9JM1 (SEQ ID NO: 192) or an active fragment thereof; or b. a heterologous polynucleotide encoding the heterologous polypeptide of a).
2. (canceled)
3. The recombinant host cell of claim 1, wherein the host cell is a yeast host cell.
4. The recombinant host cell of claim 3 wherein the yeast is selected from the group consisting of yeast cell is a member of a genus of Saccharomyces, Schizosaccharomyces, Hansenula, Candida, Kluyveromyces, Yarrowia, Issatchenkia, or Pichia.
5. (canceled)
6. The recombinant host cell of claim 1, wherein the isobutanol production pathway comprises the following substrate to product conversions: a. pyruvate to acetolactate b. acetolactate to 2,3-dihydroxyisovalerate c. 2,3-dihydroxyisovalerate to 2-ketoisovalerate d. 2-ketoisovalerate to isobutyraldehyde; and e. isobutyraldehyde to isobutanol wherein more than one of the substrate to product conversions is catalyzed by an enzyme that is heterologous to the host cell.
7. The recombinant host cell of claim 6 wherein all of the substrate to product conversions are catalyzed by enzymes heterologous to the host cell.
8. The recombinant host cell of claim 6 wherein the substrate to product conversion for isobutyraldehyde to isobutanol is catalyzed by an alcohol dehydrogenase enzyme which utilizes NADH as a cofactor.
9. The recombinant host cell of claim 1, wherein the host cell has reduced or eliminated acetolactate reductase activity.
10. The recombinant host cell of claim 1, wherein the host cell has reduced or eliminated aldehyde dehydrogenase activity.
11. The recombinant host cell of claim 1, wherein the host cell is yeast and has reduced or eliminated pyruvate decarboxylase activity.
12. The recombinant host cell of claim 1, comprising an isobutanol production pathway comprising the following substrate to product conversions: a. pyruvate to acetolactate b. acetolactate to 2,3-dihydroxyisovalerate c. 2,3-dihydroxyisovalerate to 2-ketoisovalerate d. 2-ketoisovalerate to isobutyraldehyde; and e. isobutyraldehyde to isobutanol wherein the substrate to product conversions are catalyzed by enzymes substantially localized to the cytosol.
13. (canceled)
14. A method for producing isobutanol comprising: a. providing a recombinant host cell of claim 1; b. contacting the host cell of a) with a carbon substrate under conditions whereby isobutanol is produced.
15. The method of claim 14 wherein at least a portion of the contacting occurs under anaerobic conditions.
16. The method of claim 14 wherein the molar ratio of isobutanol to glycerol is greater than 1.
17. A method for producing isobutanol comprising: a. providing a recombinant host cell which produces isobutanol b. contacting the host cell of a) with a carbon substrate under conditions whereby isobutanol is produced; wherein at least a portion of the contacting occurs under anaerobic conditions; and wherein the ratio of isobutanol to glycerol produced is greater than 1.
18. A composition comprising isobutanol and a recombinant host cell of claim 1.
19. A polypeptide comprising at least about 90% identity or at least about 95% identity or at least about 99% identity to K9JM2 (SEQ ID NO: 193), K9JM3 (SEQ ID NO: 194), K9JM4 (SEQ ID NO: 195), K9JM5 (SEQ ID NO: 196), K9JM6 (SEQ ID NO: 197), K9JM7 (SEQ ID NO: 198), K9JM8 (SEQ ID NO: 199), K9JM9 (SEQ ID NO: 200), K9JM10 (SEQ ID NO: 201), K9JM11 (SEQ ID NO: 202), K9JM12 (SEQ ID NO: 203), K9JM13 (SEQ ID NO: 204), K9JM14 (SEQ ID NO: 205), K9JM15 (SEQ ID NO: 206), K9JM16 (SEQ ID NO: 207), K9JM17 (SEQ ID NO: 208), K9JM18 (SEQ ID NO: 209), K9JM19 (SEQ ID NO: 210), K9JM20 (SEQ ID NO: 211), K9JM21 (SEQ ID NO: 212), K9JM22 (SEQ ID NO: 213), K9JM23 (SEQ ID NO: 214), K9JM24 (SEQ ID NO: 215), K9JM25 (SEQ ID NO: 216), K9JM26 (SEQ ID NO: 217), K9JM27 (SEQ ID NO: 218), K9JM28 (SEQ ID NO: 219), K9JM29 (SEQ ID NO: 220), K9JM30 (SEQ ID NO: 221), K9JM31 (SEQ ID NO: 222), JM32 (SEQ ID NO: 223), JM33 (SEQ ID NO: 224), JM34 (SEQ ID NO: 225), JM35 (SEQ ID NO: 226), JM36 (SEQ ID NO: 227), JM37 (SEQ ID NO: 228), JM38 (SEQ ID NO: 229), JM39 (SEQ ID NO: 230), JM40 (SEQ ID NO: 231), JM42 (SEQ ID NO: 232), JM43 (SEQ ID NO: 233), JM44 (SEQ ID NO: 234), K9SB2 (SEQ ID NO: 235), K9_DAVID_SH (SEQ ID NO: 236), K9ALL3 (SEQ ID NO: 237), K9_URSALA (K9SB2+A56V) (SEQ ID NO: 239), JM41 (SEQ ID NO: 240), K9ALL148 (SEQ ID NO: 241), K9JM148 (SEQ ID NO: 242), K9ALL156 (SEQ ID NO: 243), K9JM156 (SEQ ID NO: 244), K9ALL191 (SEQ ID NO: 245), K9JM191 (SEQ ID NO: 246), K9ALL254 (SEQ ID NO: 247), K9ALL278 (SEQ ID NO: 248), K9ALL37 (SEQ ID NO: 249), K9JM375 (SEQ ID NO: 250), K9ALL66 (SEQ ID NO: 66), K9JM66 (SEQ ID NO: 252), K9ALL8Q (SEQ ID NO: 253), K9JM8Q (SEQ ID NO: 254), K9ALL45 (SEQ ID NO: 255), K9 LUCY (SEQ ID NO: 300), K9 ILYA (SEQ ID NO: 301), K9ALL258 (SEQ ID NO: 302), K9YW25-T191S (SEQ ID NO: 303), F53L (SEQ ID NO: 307), F53I (SEQ ID NO: 308), F53M (SEQ ID NO: 309), F53V (SEQ ID NO: 310), F53P (SEQ ID NO: 311), F53S (SEQ ID NO: 312), F53A (SEQ ID NO: 313), F53E (SEQ ID NO: 314), F53Q (SEQ ID NO: 315), T11-1 (SEQ ID NO: 316), T11-2 (SEQ ID NO: 317), T11-3 (SEQ ID NO: 318), T11-4 (SEQ ID NO: 319), T11-5 (SEQ ID NO: 320), T11-6 (SEQ ID NO: 321), T11-7 (SEQ ID NO: 322), T11-10 (SEQ ID NO: 323), T11-12 (SEQ ID NO: 324), T11-13 (SEQ ID NO: 325), T11-14 (SEQ ID NO: 326), T11-15 (SEQ ID NO: 327), T11-16 (SEQ ID NO: 328), T11-18 (SEQ ID NO: 329), T11-19 (SEQ ID NO: 330), T11-21 (SEQ ID NO: 331), T11-22 (SEQ ID NO: 332), T11-25 (SEQ ID NO: 333), T11-27 (SEQ ID NO: 334), T11-28 (SEQ ID NO: 335), T11-29 (SEQ ID NO: 336), T11-30 (SEQ ID NO: 337), T11-32 (SEQ ID NO: 338), T11-33 (SEQ ID NO: 339), T11-35 (SEQ ID NO: 340), T11-36 (SEQ ID NO: 341), T11-37 (SEQ ID NO: 342), T11-38 (SEQ ID NO: 343), T11-39 (SEQ ID NO: 344), T11-42 (SEQ ID NO: 345), T11-43 (SEQ ID NO: 346), T11-44 (SEQ ID NO: 347), T11-45 (SEQ ID NO: 348), T11-46 (SEQ ID NO: 349), T11-47 (SEQ ID NO: 350), T11-49 (SEQ ID NO: 351), T11-50 (SEQ ID NO: 352), T11-52 (SEQ ID NO: 353), T11-54 (SEQ ID NO: 354), T11-55 (SEQ ID NO: 355), T11-56 (SEQ ID NO: 356), T11-57 (SEQ ID NO: 357), T11-58 (SEQ ID NO: 358), T11-59 (SEQ ID NO: 359), T11-60 (SEQ ID NO: 360), T11-61 (SEQ ID NO: 361), T11-62 (SEQ ID NO: 362), T11-64 (SEQ ID NO: 363), T11-66 (SEQ ID NO: 364), T11-67 (SEQ ID NO: 365), T11-69 (SEQ ID NO: 366), T11-70 (SEQ ID NO: 367), T11-72 (SEQ ID NO: 368), T11-74 (SEQ ID NO: 369), T11-75 (SEQ ID NO: 370), T11-76 (SEQ ID NO: 371), T11-79 (SEQ ID NO: 372), T11-80 (SEQ ID NO: 373), T11-81 (SEQ ID NO: 374), T11-83 (SEQ ID NO: 375), T11-84 (SEQ ID NO: 376), T11-85 (SEQ ID NO: 377), T11-86 (SEQ ID NO: 378), T11-87 (SEQ ID NO: 379), T11-88 (SEQ ID NO: 380), T11-91 (SEQ ID NO: 381), T11-94 (SEQ ID NO: 382), T11-95 (SEQ ID NO: 383), T11-96 (SEQ ID NO: 384), T11-97 (SEQ ID NO: 385), T11-99 (SEQ ID NO: 386), T11-103 (SEQ ID NO: 387), T11-104 (SEQ ID NO: 388), T11-109 (SEQ ID NO: 389), T11-110 (SEQ ID NO: 390), T11-111 (SEQ ID NO: 391), T11-114 (SEQ ID NO: 392), T11-116 (SEQ ID NO: 393), T11-117 (SEQ ID NO: 394), T11-119 (SEQ ID NO: 395), T11-121 (SEQ ID NO: 396), T11-122 (SEQ ID NO: 397), T11-124 (SEQ ID NO: 398), T11-125 (SEQ ID NO: 399), T11-128 (SEQ ID NO: 400), T11-130 (SEQ ID NO: 401), T11-131 (SEQ ID NO: 402), T11-134 (SEQ ID NO: 403), E147V (SEQ ID NO: 552), G164D (SEQ ID NO: 404), G304V (SEQ ID NO: 405), N258S (SEQ ID NO: 406), T71S (SEQ ID NO: 407), V184I (SEQ ID NO: 408), A279D (SEQ ID NO: 409), D98V (SEQ ID NO: 410), M169F (SEQ ID NO: 411), M169K (SEQ ID NO: 412), M169L (SEQ ID NO: 413), E100Q_M312K (SEQ ID NO: 414), ECB11 (SEQ ID NO: 534), EC2A2 (SEQ ID NO: 535), EC2B12 (SEQ ID NO: 536), EGC10 (SEQ ID NO: 537), EGD9 (SEQ ID NO: 538), EGG8 (SEQ ID NO: 539), EHG1 (SEQ ID NO: 540), EHG2 (SEQ ID NO: 541), EHH6 (SEQ ID NO: 520), EHH9 (SEQ ID NO: 521), EHH10 (SEQ ID NO: 522), EHH12 (SEQ ID NO: 523), EKC5 (SEQ ID NO: 546), EKG4 (SEQ ID NO: 547), EJF5 (SEQ ID NO: 548), EJB8 (SEQ ID NO: 549), EJA1 (SEQ ID NO: 550), EJB10 (SEQ ID NO: 551), K9_Lucy_SH (SEQ ID NO: 553), or K9JM1 (SEQ ID NO: 192), or an active fragment thereof wherein said polypeptide has ketol-acid reductoisomerase activity.
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
Description
BRIEF DESCRIPTION OF THE FIGURES AND SEQUENCE DESCRIPTIONS
[0018] The invention can be more fully understood from the following detailed description, the Figures, and the accompanying sequence descriptions, which form part of this application.
[0019]
[0020]
[0021] Table Zis a table of the Profile HMM of experimentally verified KARI enzymes listed in Table A and as described in US App. Pub. Nos. 20100197519 and 20090163376.
TABLE-US-00001 TABLE A Experimentally verified KARI enzymes. GI Number Accession Microorganism 70732562 YP_262325.1 Pseudomonas fluorescens Pf-5 15897495 NP_342100.1 Sulfolobus solfataricus P2 18313972 NP_560639.1 Pyrobaculum aerophilum str. IM2 76801743 YP_326751.1 Natronomonas pharaonis DSM 2160 16079881 NP_390707.1 Bacillus subtilis subsp. subtilis str. 168 19552493 NP_600495.1 Corynebacterium glutamicum ATCC 13032 6225553 O32414 Phaeospririlum molischianum 17546794 NP_520196.1 Ralstonia solanacearum GMI1000 56552037 YP_162876.1 Zymomonas mobilis subsp. mobilis ZM4 114319705 YP_741388.1 Alkalilimnicola ehrlichei MLHE-1 57240359 ZP_00368308.1 Campylobacter lari RM2100 120553816 YP_958167.1 Marinobacter aquaeolei VT8 71065099 YP_263826.1 Psychrobacter arcticus 273-4 83648555 YP_436990.1 Hahella chejuensis KCTC 2396 74318007 YP_315747.1 Thiobacillus denitrificans ATCC 25259 67159493 ZP_00420011.1 Azotobacter vinelandii AvOP 66044103 YP_233944.1 Pseudomonas syringae pv. syringae B728a 28868203 NP_790822.1 Pseudomonas syringae pv. tomato str. DC3000 26991362 NP_746787.1 Pseudomonas putida KT2440 104783656 YP_610154.1 Pseudomonas entomophila L48 146306044 YP_001186509.1 Pseudomonas mendocina ymp 15599888 NP_253382.1 Pseudomonas aeruginosa PAO1 42780593 NP_977840.1 Bacillus cereus ATCC 10987 42781005 NP_978252.1 Bacillus cereus ATCC 10987 266346 Q01292 Spinacia oleracea
[0022] The eleven positions in the profile HMM representing the columns in the alignment which correspond to the eleven cofactor switching positions in Pseudomonas fluorescens Pf-5 KARI are identified as positions 24, 33, 47, 50, 52, 53, 61, 80, 115, 156, and 170. Table Z is submitted herewith electronically and is incorporated herein by reference.
[0023] The sequences provided in the sequence listing filed electronically herewith are herein incorporated by reference. Consistent with the Standard, certain primers given in the sequence listing and in the Table of Sequences herein may use N to represent nucleotides a or g or c or t; K is used to represent g or t; M is used to represent a or c.
DETAILED DESCRIPTION OF THE INVENTION
[0024] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present application including the definitions will control. Also, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. All publications, patents and other references mentioned herein are incorporated by reference in their entireties for all purposes.
[0025] It will be understood that derived from with reference to polypeptides disclosed herein encompasses sequences synthesized based on the amino acid sequences of the KARIs present in the indicated organisms as well as those cloned directly from the organism's genetic material.
[0026] Engineered polypeptide as used herein refers to a polypeptide that is synthetic, i.e., differing in some manner from a polypeptide found in nature.
[0027] In order to further define this invention, the following terms and definitions are herein provided.
[0028] As used herein, the terms comprises, comprising, includes, including, has, having, contains or containing, or any other variation thereof, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. For example, a composition, a mixture, a process, a method, an article, or an apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus. Further, unless expressly stated to the contrary, or refers to an inclusive or and not to an exclusive or. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).
[0029] As used herein, the term consists of, or variations such as consist of or consisting of, as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, but that no additional integer or group of integers may be added to the specified method, structure, or composition.
[0030] As used herein, the term consists essentially of, or variations such as consist essentially of or consisting essentially of, as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, and the optional inclusion of any recited integer or group of integers that do not materially change the basic or novel properties of the specified method, structure or composition. See M.P.E.P. 2111.03.
[0031] Also, the indefinite articles a and an preceding an element or component of the invention are intended to be nonrestrictive regarding the number of instances, i.e., occurrences of the element or component. Therefore a or an should be read to include one or at least one, and the singular word form of the element or component also includes the plural unless the number is obviously meant to be singular.
[0032] The term invention or present invention as used herein is a non-limiting term and is not intended to refer to any single embodiment of the particular invention but encompasses all possible embodiments as described in the application.
[0033] As used herein, the term about modifying the quantity of an ingredient or reactant of the invention employed refers to variation in the numerical quantity that can occur, for example, through typical measuring and liquid handling procedures used for making concentrates or solutions in the real world; through inadvertent error in these procedures; through differences in the manufacture, source, or purity of the ingredients employed to make the compositions or to carry out the methods; and the like. The term about also encompasses amounts that differ due to different equilibrium conditions for a composition resulting from a particular initial mixture. Whether or not modified by the term about, the claims include equivalents to the quantities. In one embodiment, the term about means within 10% of the reported numerical value, preferably within 5% of the reported numerical value.
[0034] The term invention or present invention as used herein is meant to apply generally to all embodiments of the invention as described in the claims as presented or as later amended and supplemented, or in the specification.
[0035] The term isobutanol biosynthetic pathway refers to the enzymatic pathway to produce isobutanol. Certain isobutanol biosynthetic pathways are illustrated in
[0036] A recombinant host cell comprising an engineered alcohol production pathway (such as an engineered butanol or isobutanol production pathway) refers to a host cell containing a modified pathway that produces alcohol in a manner different than that normally present in the host cell. Such differences include production of an alcohol not typically produced by the host cell, or increased or more efficient production.
[0037] The term effective isobutanol productivity as used herein refers to the total amount in grams of isobutanol produced per gram of cells.
[0038] The term effective titer as used herein, refers to the total amount of butanol produced by fermentation per liter of fermentation medium. The total amount of butanol includes: (i) the amount of butanol in the fermentation medium; (ii) the amount of butanol recovered from the organic extractant, and (iii) the amount of butanol recovered from the gas phase, if gas stripping is used.
[0039] The term effective rate as used herein, refers to the total amount of butanol produced by fermentation per liter of fermentation medium per hour of fermentation.
[0040] The term effective yield as used herein, refers to the amount of butanol produced per unit of fermentable carbon substrate consumed by the biocatalyst.
[0041] The term NADPH consumption assay refers to an enzyme assay for the determination of the specific activity of the KARI enzyme, involving measuring the disappearance of the KARI cofactor, NADPH, from the enzyme reaction.
[0042] KARI is the abbreviation for the enzyme ketol-acid reducto-isomerase.
[0043] The term close proximity when referring to the position of various amino acid residues of a KARI enzyme with respect to the adenosyl 2-phosphate of NADPH means amino acids in the three-dimensional model for the structure of the enzyme that are within about 4.5 of the phosphorus atom of the adenosyl 2-phosphate of NADPH bound to the enzyme.
[0044] The term ketol-acid reductoisomerase (abbreviated KARI), and acetohydroxy acid isomeroreductase will be used interchangeably and refer to enzymes capable of catalyzing the reaction of (S)-acetolactate to 2,3-dihydroxyisovalerate, classified as EC number EC 1.1.1.86 (Enzyme Nomenclature 1992, Academic Press, San Diego). As used herein the term Class I ketol-acid reductoisomerase enzyme means the short form that typically has between 330 and 340 amino acid residues, and is distinct from the long form, called class II, that typically has approximately 490 residues.
[0045] The terms ketol-acid reductoisomerase activity and KARI activity refers to the ability to catalyze the substrate to product conversion (5)-acetolactate to 2,3-dihydroxyisovalerate.
[0046] The term acetolactate synthase (ALS) refers to an enzyme that catalyzes the conversion of pyruvate to acetolactate and CO.sub.2. Acetolactate has two stereoisomers ((R) and (S)); the enzyme prefers the (S)-isomer, which is made by biological systems. Example acetolactate synthases are known by the EC number 2.2.1.6 (Enzyme Nomenclature 1992, Academic Press, San Diego). These enzymes are available from a number of sources, including, but not limited to, Bacillus subtilis (GenBank Nos: CAB15618, Z99122, NCBI (National Center for Biotechnology Information) amino acid sequence, NCBI nucleotide sequence, respectively), Klebsiella pneumoniae (GenBank Nos: AAA25079, M73842 and Lactococcus lactis (GenBank Nos: AAA25161, L16975).
[0047] The term acetohydroxy acid dehydratase or dihydroxyacid dehydratase (DHAD) refers to an enzyme that catalyzes the conversion of 2,3-dihydroxyisovalerate to -ketoiso-valerate. Example acetohydroxy acid dehydratases are known by the EC number 4.2.1.9. These enzymes are available from a vast array of microorganisms, including, but not limited to, E. coli (GenBank Nos: YP_026248, NC_000913, S. cerevisiae (GenBank Nos: NP_012550, NC_001142), M. maripaludis (GenBank Nos: CAF29874, BX957219), and B. subtilis (GenBank Nos: CAB14105, Z99115). Suitable DHAD sequences are known in the art and/or provided herein.
[0048] The term branched-chain -keto acid decarboxylase (also referred to herein as ketoisovalerate decarboxylase or kivD) refers to an enzyme that catalyzes the conversion of -ketoisovalerate to isobutyraldehyde and CO.sub.2. Example branched-chain -keto acid decarboxylases are known by the EC number 4.1.1.72 and are available from a number of sources, including, but not limited to, Lactococcus lactis (GenBank Nos: AA549166, AY548760, CAG34226, AJ746364, Salmonella typhimurium (GenBank Nos: NP-461346, NC-003197), and Clostridium acetobutylicum (GenBank Nos: NP-149189, NC-001988).
[0049] The term branched-chain alcohol dehydrogenase (also referred to herein as alcohol dehydrogenase or ADH) refers to an enzyme that catalyzes the conversion of isobutyraldehyde to isobutanol. Example branched-chain alcohol dehydrogenases are known by the EC number 1.1.1.265, but may also be classified under other alcohol dehydrogenases (specifically, EC 1.1.1.1 or 1.1.1.2). These enzymes may utilize NADH (reduced nicotinamide adenine dinucleotide) and/or NADPH as electron donor and are available from a number of sources, including, but not limited to, S. cerevisiae (GenBank Nos: NP-010656, NC-001136; NP-014051, NC-001145), E. coli (GenBank Nos: NP-417484, and C. acetobutylicum (GenBank Nos: NP-349892, NC_003030).
[0050] The term branched-chain keto acid dehydrogenase refers to an enzyme that catalyzes the conversion of -ketoisovalerate to isobutyryl-CoA (isobutyryl-cofactor A). Such enzymes may use NAD.sup.+ (nicotinamide adenine dinucleotide) as electron acceptor. Example branched-chain keto acid dehydrogenases are known by the EC number 1.2.4.4. These branched-chain keto acid dehydrogenases comprise four subunits, and sequences from all subunits are available from a vast array of microorganisms, including, but not limited to, B. subtilis (GenBank Nos: CAB14336, Z99116; CAB14335, Z99116; CAB14334, Z99116; and CAB14337, Z99116) and Pseudomonas putida (GenBank Nos: AAA65614, M57613; AAA65615, M57613; AAA65617, M57613; and AAA65618, M57613).
[0051] The term carbon substrate or fermentable carbon substrate refers to a carbon source capable of being metabolized by host organisms of the present invention and particularly carbon sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and one-carbon substrates or mixtures thereof.
[0052] The term specific activity as used herein is defined as the units of activity in a given amount of protein. Thus, the specific activity is not directly measured but is calculated by dividing 1) the activity in units/ml of the enzyme sample by 2) the concentration of protein in that sample, so the specific activity is expressed as units/mg. The specific activity of a sample of pure, fully active enzyme is a characteristic of that enzyme. The specific activity of a sample of a mixture of proteins is a measure of the relative fraction of protein in that sample that is composed of the active enzyme of interest.
[0053] The terms k.sub.cat and K.sub.M are known to those skilled in the art and are described in Enzyme Structure and Mechanism, 2.sup.nd ed. (Ferst, W.H. Freeman Press, N Y, 1985; pp 98-120). K.sub.M, the Michaelis constant, is the concentration of substrate that leads to half-maximal velocity. The term k.sub.cat, often called the turnover number, is defined as the maximum number of substrate molecules converted to products per active site per unit time, or the number of times the enzyme turns over per unit time. k.sub.cat=V.sub.max/[E], where [E] is the enzyme concentration (Ferst, supra). The terms total turnover and total turnover number are used herein to refer to the amount of product formed by the reaction of a KARI enzyme with substrate.
[0054] The term catalytic efficiency is defined as the k.sub.cat/K.sub.M of an enzyme. Catalytic efficiency is used to quantify the specificity of an enzyme for a substrate.
[0055] The term isolated nucleic acid molecule, isolated nucleic acid fragment and genetic construct will be used interchangeably and will mean a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
[0056] The term amino acid refers to the basic chemical structural unit of a protein or polypeptide. The following abbreviations are used herein to identify specific amino acids:
TABLE-US-00002 Three-Letter One-Letter Amino Acid Abbreviation Abbreviation Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Cysteine Cys C Glutamine Gln Q Glutamic acid Glu E Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V
[0057] The term gene refers to a nucleic acid fragment that is capable of being expressed as a specific protein, optionally including regulatory sequences preceding (5 non-coding sequences) and following (3 non-coding sequences) the coding sequence. Native gene refers to a gene as found in nature with its own regulatory sequences. Chimeric gene refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. Endogenous gene refers to a native gene in its natural location in the genome of a microorganism. A foreign gene refers to a gene not normally found in the host microorganism, but that is introduced into the host microorganism by gene transfer. Foreign genes can comprise native genes inserted into a non-native microorganism, or chimeric genes. A transgene is a gene that has been introduced into the genome by a transformation procedure.
[0058] As used herein the term coding sequence refers to a DNA sequence that encodes for a specific amino acid sequence. Suitable regulatory sequences refer to nucleotide sequences located upstream (5 non-coding sequences), within, or downstream (3 non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem-loop structure.
[0059] The term endogenous, when used in reference to a polynucleotide, a gene, or a polypeptide refers to a native polynucleotide or gene in its natural location in the genome of an organism, or for a native polypeptide, is transcribed and translated from this location in the genome.
[0060] The term heterologous when used in reference to a polynucleotide, a gene, or a polypeptide refers to a polynucleotide, gene, or polypeptide not normally found in the host organism. Heterologous also includes a native coding region, or portion thereof, that is reintroduced into the source organism in a form that is different from the corresponding native gene, e.g., not in its natural location in the organism's genome. The heterologous polynucleotide or gene may be introduced into the host organism by, e.g., gene transfer. A heterologous gene may include a native coding region with non-native regulatory regions that is reintroduced into the native host. A transgene is a gene that has been introduced into the genome by a transformation procedure.
[0061] The term recombinant genetic expression element refers to a nucleic acid fragment that expresses one or more specific proteins, including regulatory sequences preceding (5 non-coding sequences) and following (3 termination sequences) coding sequences for the proteins. A chimeric gene is a recombinant genetic expression element. The coding regions of an operon may form a recombinant genetic expression element, along with an operably linked promoter and termination region.
[0062] Regulatory sequences refers to nucleotide sequences located upstream (5 non-coding sequences), within, or downstream (3 non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, enhancers, operators, repressors, transcription termination signals, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem-loop structure.
[0063] The term promoter refers to a nucleic acid sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3 to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleic acid segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as constitutive promoters. Inducible promoters, on the other hand, cause a gene to be expressed when the promoter is induced or turned on by a promoter-specific signal or molecule. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity. For example, it will be understood that FBA1 promoter can be used to refer to a fragment derived from the promoter region of the FBA1 gene.
[0064] The term terminator as used herein refers to DNA sequences located downstream of a coding sequence. This includes polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3 end of the mRNA precursor. The 3 region can influence the transcription, RNA processing or stability, or translation of the associated coding sequence. It is recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical terminator activity. For example, it will be understood that CYC1 terminator can be used to refer to a fragment derived from the terminator region of the CYC1 gene.
[0065] The term operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of effecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
[0066] The term expression, as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide.
[0067] As used herein the term transformation refers to the transfer of a nucleic acid fragment into the genome of a host microorganism, resulting in genetically stable inheritance. Host microorganisms containing the transformed nucleic acid fragments are referred to as transgenic or recombinant or transformed microorganisms.
[0068] The terms plasmid, vector and cassette refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA fragments. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3 untranslated sequence into a cell. Transformation cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitates transformation of a particular host cell. Expression cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host.
[0069] The term site-saturation library refers to a library which contains random substitutions at a specific amino acid position with all 20 possible amino acids at once.
[0070] The term error-prone FOR refers to adding random copying errors by imposing imperfect or sloppy FOR reaction conditions which generate randomized libraries of mutations in a specific nucleotide sequence.
[0071] As used herein the term codon degeneracy refers to the nature in the genetic code permitting variation of the nucleotide sequence without affecting the amino acid sequence of an encoded polypeptide. The skilled artisan is well aware of the codon-bias exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a gene for improved expression in a host cell, it is desirable to design the gene such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.
[0072] The term codon-optimized as it refers to genes or coding regions of nucleic acid molecules for transformation of various hosts, refers to the alteration of codons in the gene or coding regions of the nucleic acid molecules to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the DNA. Such optimization includes replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that organism.
[0073] Deviations in the nucleotide sequence that comprise the codons encoding the amino acids of any polypeptide chain allow for variations in the sequence coding for the gene. Since each codon consists of three nucleotides, and the nucleotides comprising DNA are restricted to four specific bases, there are 64 possible combinations of nucleotides, 61 of which encode amino acids (the remaining three codons encode signals ending translation). The genetic code which shows which codons encode which amino acids is reproduced herein as Table 1A. As a result, many amino acids are designated by more than one codon. For example, the amino acids alanine and proline are coded for by four triplets, serine and arginine by six, whereas tryptophan and methionine are coded by just one triplet. This degeneracy allows for DNA base composition to vary over a wide range without altering the amino acid sequence of the proteins encoded by the DNA.
TABLE-US-00003 TABLE 1A The Standard Genetic Code T C A G T TTT Phe (F) TCT Ser (S) TAT Tyr (Y) TGT Cys (C) TTC Phe (F) TCC Ser (S) TAC Tyr (Y) TGC TTA Leu (L) TCA Ser (S) TAA Stop TGA Stop TTG Leu (L) TCG Ser (S) TAG Stop TGG Trp (W) C CTT Leu (L) CCT Pro (P) CAT His (H) CGT Arg (R) CTC Leu (L) CCC Pro (P) CAC His (H) CGC Arg (R) CTA Leu (L) CCA Pro (P) CAA Gln (Q) CGA Arg (R) CTG Leu (L) CCG Pro (P) CAG Gln (Q) CGG Arg (R) A ATT Ile (I) ACT Thr (T) AAT Asn (N) AGT Ser (S) ATC Ile (I) ACC Thr (T) AAC Asn (N) AGC Ser (S) ATA Ile (I) ACA Thr (T) AAA Lys (K) AGA Arg (R) ATG Met (M) ACG Thr (T) AAG Lys (K) AGG Arg (R) G GTT Val (V) GCT Ala (A) GAT Asp (D) GGT Gly (G) GTC Val (V) GCC Ala (A) GAC Asp (D) GGC Gly (G) GTA Val (V) GCA Ala (A) GAA Glu (E) GGA Gly (G) GTG Val (V) GCG Ala (A) GAG Glu (E) GGG Gly (G)
[0074] Many organisms display a bias for use of particular codons to code for insertion of a particular amino acid in a growing peptide chain. Codon preference, or codon bias, differences in codon usage between organisms, is afforded by degeneracy of the genetic code, and is well documented among many organisms. Codon bias often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, inter alia, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.
[0075] Given the large number of gene sequences available for a wide variety of animal, plant and microbial species, it is possible to calculate the relative frequencies of codon usage. Codon usage tables are readily available, for example, at the Codon Usage Database available at http://www.kazusa.or.jp/codon/(visited Mar. 20, 2008), and these tables can be adapted in a number of ways. See Nakamura, Y., et al. Nucl. Acids Res. 28:292 (2000). Codon usage tables for yeast, calculated from GenBank Release 128.0 [15 Feb. 2002], are reproduced below as Table 1B. This table uses mRNA nomenclature, and so instead of thymine (T) which is found in DNA, the tables use uracil (U) which is found in RNA. Table 1B has been adapted so that frequencies are calculated for each amino acid, rather than for all 64 codons.
TABLE-US-00004 TABLE 1B Codon Usage Table for Saccharomyces cerevisiae Frequency per Amino Acid Codon Number thousand Phe UUU 170666 26.1 Phe UUC 120510 18.4 Leu UUA 170884 26.2 Leu UUG 177573 27.2 Leu CUU 80076 12.3 Leu CUC 35545 5.4 Leu CUA 87619 13.4 Leu CUG 68494 10.5 Ile AUU 196893 30.1 Ile AUC 112176 17.2 Ile AUA 116254 17.8 Met AUG 136805 20.9 Val GUU 144243 22.1 Val GUC 76947 11.8 Val GUA 76927 11.8 Val GUG 70337 10.8 Ser UCU 153557 23.5 Ser UCC 92923 14.2 Ser UCA 122028 18.7 Ser UCG 55951 8.6 Ser AGU 92466 14.2 Ser AGC 63726 9.8 Pro CCU 88263 13.5 Pro CCC 44309 6.8 Pro CCA 119641 18.3 Pro CCG 34597 5.3 Thr ACU 132522 20.3 Thr ACC 83207 12.7 Thr ACA 116084 17.8 Thr ACG 52045 8.0 Ala GCU 138358 21.2 Ala GCC 82357 12.6 Ala GCA 105910 16.2 Ala GCG 40358 6.2 Tyr UAU 122728 18.8 Tyr UAC 96596 14.8 His CAU 89007 13.6 His CAC 50785 7.8 Gln CAA 178251 27.3 Gln CAG 79121 12.1 Asn AAU 233124 35.7 Asn AAC 162199 24.8 Lys AAA 273618 41.9 Lys AAG 201361 30.8 Asp GAU 245641 37.6 Asp GAC 132048 20.2 Glu GAA 297944 45.6 Glu GAG 125717 19.2 Cys UGU 52903 8.1 Cys UGC 31095 4.8 Trp UGG 67789 10.4 Arg CGU 41791 6.4 Arg CGC 16993 2.6 Arg CGA 19562 3.0 Arg CGG 11351 1.7 Arg AGA 139081 21.3 Arg AGG 60289 9.2 Gly GGU 156109 23.9 Gly GGC 63903 9.8 Gly GGA 71216 10.9 Gly GGG 39359 6.0 Stop UAA 6913 1.1 Stop UAG 3312 0.5 Stop UGA 4447 0.7
[0076] By utilizing this or similar tables, one of ordinary skill in the art can apply the frequencies to any given polypeptide sequence, and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide, but which uses codons optimal for a given species.
[0077] Randomly assigning codons at an optimized frequency to encode a given polypeptide sequence, can be done manually by calculating codon frequencies for each amino acid, and then assigning the codons to the polypeptide sequence randomly. Additionally, various algorithms and computer software programs are readily available to those of ordinary skill in the art. For example, the EditSeq function in the Lasergene Package, available from DNAstar, Inc., Madison, Wis., the backtranslation function in the VectorNTI Suite, available from InforMax, Inc., Bethesda, Md., and the backtranslate function in the GCG-Wisconsin Package, available from Accelrys, Inc., San Diego, Calif. In addition, various resources are publicly available to codon-optimize coding region sequences, e.g., the backtranslation function at http://www.entelechon.com/bioinformatics/backtranslation.php?lang=eng (visited Apr. 15, 2008) and the backtranseq function available at http://bioinfo.pbi.nrc.ca:8090/EMBOSS/index.html (visited Jul. 9, 2002). Constructing a rudimentary algorithm to assign codons based on a given frequency can also easily be accomplished with basic mathematical functions by one of ordinary skill in the art.
[0078] Codon-optimized coding regions can be designed by various methods known to those skilled in the art including software packages such as synthetic gene designer (http://phenotype.biosci.umbc.edu/codon/sgd/index.php).
[0079] As used herein, the term polypeptide is intended to encompass a singular polypeptide as well as plural polypeptides, and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, protein, amino acid chain, or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of polypeptide, and the term polypeptide may be used instead of, or interchangeably with any of these terms. A polypeptide may be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It may be generated in any manner, including by chemical synthesis.
[0080] By an isolated polypeptide or a fragment, variant, or derivative thereof is intended a polypeptide that is not in its natural milieu. No particular level of purification is required. For example, an isolated polypeptide can be removed from its native or natural environment. Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposed of the invention, as are native or recombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique.
[0081] As used herein, the terms variant and mutant are synonymous and refer to a polypeptide differing from a specifically recited polypeptide by one or more amino acid insertions, deletions, mutations, and substitutions, created using, e.g., recombinant DNA techniques, such as mutagenesis. Guidance in determining which amino acid residues may be replaced, added, or deleted without abolishing activities of interest, may be found by comparing the sequence of the particular polypeptide with that of homologous polypeptides, e.g., yeast or bacterial, and minimizing the number of amino acid sequence changes made in regions of high homology (conserved regions) or by replacing amino acids with consensus sequences.
[0082] Engineered polypeptide as used herein refers to a polypeptide that is synthetic, i.e., differing in some manner from a polypeptide found in nature.
[0083] Alternatively, recombinant polynucleotide variants encoding these same or similar polypeptides may be synthesized or selected by making use of the redundancy in the genetic code. Various codon substitutions, such as silent changes which produce various restriction sites, may be introduced to optimize cloning into a plasmid or viral vector for expression. Mutations in the polynucleotide sequence may be reflected in the polypeptide or domains of other peptides added to the polypeptide to modify the properties of any part of the polypeptide. For example, mutations can be used to reduce or eliminate expression of a target protein and include, but are not limited to, deletion of the entire gene or a portion of the gene, inserting a DNA fragment into the gene (in either the promoter or coding region) so that the protein is not expressed or expressed at lower levels, introducing a mutation into the coding region which adds a stop codon or frame shift such that a functional protein is not expressed, and introducing one or more mutations into the coding region to alter amino acids so that a non-functional or a less enzymatically active protein is expressed.
[0084] Amino acid substitutions may be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements, or they may be the result of replacing one amino acid with an amino acid having different structural and/or chemical properties, i.e., non-conservative amino acid replacements. Conservative amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine, polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Alternatively, non-conservative amino acid substitutions may be made by selecting the differences in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of any of these amino acids. Insertions or deletions may be within the range of variation as structurally or functionally tolerated by the recombinant proteins. The variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant variants for activity.
[0085] A substantial portion of an amino acid or nucleotide sequence is that portion comprising enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to putatively identify that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer-automated sequence comparison and identification using algorithms such as BLAST (Altschul, S. F., et al., J. Mol. Biol., 215:403-410 (1993)). In general, a sequence of ten or more contiguous amino acids or thirty or more nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene. Moreover, with respect to nucleotide sequences, gene specific oligonucleotide probes comprising 20-30 contiguous nucleotides may be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques). In addition, short oligonucleotides of 12-15 bases may be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers. Accordingly, a substantial portion of a nucleotide sequence comprises enough of the sequence to specifically identify and/or isolate a nucleic acid fragment comprising the sequence. The instant specification teaches the complete amino acid and nucleotide sequence encoding particular proteins. The skilled artisan, having the benefit of the sequences as reported herein, may now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art. Accordingly, the instant invention comprises the complete sequences as reported in the accompanying Sequence Listing, as well as substantial portions of those sequences as defined above.
[0086] The term complementary is used to describe the relationship between nucleotide bases that are capable of hybridizing to one another. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine, and with respect to RNA, adenine is complementary to uracil and cytosine is complementary to guanine.
[0087] The term percent identity, as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. Identity and similarity can be readily calculated by known methods, including but not limited to those described in: 1.) Computational Molecular Biology (Lesk, A. M., Ed.) Oxford University: NY (1988); 2.) Biocomputing: Informatics and Genome Projects (Smith, D. W., Ed.) Academic: NY (1993); 3.) Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., Eds.) Humania: NJ (1994); 4.) Sequence Analysis in Molecular Biology (von Heinje, G., Ed.) Academic (1987); and 5.) Sequence Analysis Primer (Gribskov, M. and Devereux, J., Eds.) Stockton: NY (1991).
[0088] Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the MegAlign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignments of the sequences is performed using the Clustal method of alignment which encompasses several varieties of the algorithm including the Clustal V method of alignment corresponding to the alignment method labeled Clustal V (described by Higgins and Sharp, CAB/OS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci., 8:189-191 (1992)) and found in the MegAlign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc.). For multiple alignments, the default values correspond to GAP PENALTY=10 and GAP LENGTH PENALTY=10. Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVE D=4. After alignment of the sequences using the Clustal V program, it is possible to obtain a percent identity by viewing the sequence distances table in the same program. Additionally the Clustal W method of alignment is available and corresponds to the alignment method labeled Clustal W (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8:189-191(1992)) and found in the MegAlign v6.1 program of the LASERGENE bioinformatics computing suite (DNASTAR Inc.). Default parameters for multiple alignment (GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergen Seqs (%)=30, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB). After alignment of the sequences using the Clustal W program, it is possible to obtain a percent identity by viewing the sequence distances table in the same program.
[0089] It is well understood by one skilled in the art that many levels of sequence identity are useful in identifying polypeptides, such as from other species, wherein such polypeptides have the same or similar function or activity, or in describing the corresponding polynucleotides. Useful examples of percent identities include, but are not limited to: 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 55% to 100% may be useful in describing the present invention, such as 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Suitable polynucleotide fragments not only have the above homologies but typically comprise a polynucleotide having at least 50 nucleotides, at least 100 nucleotides, at least 150 nucleotides, at least 200 nucleotides, or at least 250 nucleotides. Further, suitable polynucleotide fragments having the above homologies encode a polypeptide having at least 50 amino acids, at least 100 amino acids, at least 150 amino acids, at least 200 amino acids, or at least 250 amino acids.
[0090] The term sequence analysis software refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. Sequence analysis software may be commercially available or independently developed. Typical sequence analysis software will include, but is not limited to: 1.) the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.); 2.) BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol., 215:403-410 (1990)); 3.) DNASTAR (DNASTAR, Inc. Madison, Wis.); 4.) Sequencher (Gene Codes Corporation, Ann Arbor, Mich.); and 5.) the FASTA program incorporating the Smith-Waterman algorithm (W. R. Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Plenum: New York, N.Y.). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the default values of the program referenced, unless otherwise specified. As used herein default values will mean any set of values or parameters that originally load with the software when first initialized.
[0091] Standard recombinant DNA and molecular cloning techniques are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) (hereinafter Maniatis), and by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987). Additional methods are in Methods in Enzymology, Volume 194, Guide to Yeast Genetics and Molecular and Cell Biology (Part A, 2004, Christine Guthrie and Gerald R. Fink (Eds.), Elsevier Academic Press, San Diego, Calif.). Other molecular tools and techniques are known in the art and include splicing by overlapping extension polymerase chain reaction (PCR) (Yu, et al. (2004) Fungal Genet. Biol. 41:973-981), positive selection for mutations at the URA3 locus of Saccharomyces cerevisiae (Boeke, J. D. et al. (1984) Mol. Gen. Genet. 197, 345-346; MA Romanos, et al. Nucleic Acids Res. 1991 Jan. 11; 19(1): 187), the cre-lox site-specific recombination system as well as mutant lox sites and FLP substrate mutations (Sauer, B. (1987) Mol Cell Biol 7: 2087-2096; Senecoff, et al. (1988) Journal of Molecular Biology, Volume 201, Issue 2, Pages 405-421; Albert, et al. (1995) The Plant Journal. Volume 7, Issue 4, pages 649-659), seamless gene deletion (Akada, et al. (2006) Yeast, 23(5):399-405), and gap repair methodology (Ma et al., Genetics 58:201-216; 1981).
[0092] The recombinant host cells and methods provided herein address a need that arises in the microbial production of isobutanol where the KARI enzyme performs a vital role. In the isobutanol biosynthetic pathway shown in
[0093] Production of isobutanol typically utilizes the glycolysis pathway present in the host microorganism. During the production of two molecules of pyruvate from glucose during glycolysis, there is net production of two molecules of NADH from NAD.sup.+ by the glyceraldehyde-3-phosphate dehydrogenase reaction. During the further production of one molecule of isobutanol from two molecules of pyruvate, there is net consumption of one molecule of NAD(P)H, by the KARI reaction, and one molecule of NAD(P)H by the isobutanol dehydrogenase reaction. The interconversion of NADH with NADPH is generally slow and inefficient in yeast; thus, NADPH to be consumed is generated by metabolism (for example, by the pentose phosphate pathway) consuming substrate in the process. Meanwhile, the cell strives to maintain homeostasis in the NAD+/NADH ratio, leading to the excess NADH produced in isobutanol production being consumed in wasteful reduction of other metabolic intermediates; e.g., by the production of lactate from pyruvate. Thus, an imbalance between NADH produced and NADPH consumed by the isobutanol pathway can lead to a reduction in the molar yield of isobutanol produced from glucose in two ways: 1) unnecessary operation of metabolism to produce NADPH, and 2) wasteful reaction of metabolic intermediates to maintain NAD+/NADH homeostasis.
Polypeptides with KARI Activity Suited for Biosynthetic Pathways
[0094] Disclosed herein are variants of a KARI enzyme from Anaerostipes caccae. Such variants provide alternatives for optimizing the efficiency of a biosynthetic pathway utilizing KARI, such as an isobutanol biosynthetic pathway, for particular production conditions. Demonstrated in the Examples is isobutanol production employing variants of the K9 KARI enzyme derived from Anaerostipes caccae. Thus, equipped with this disclosure, one of skill in the art will be able to produce recombinant host cells comprising a disclosed KARI enzyme or a variant or active fragment thereof suited for a range of production conditions. As such, the variants provided herein may also be useful in other biosynthetic pathways comprising a substrate to product conversion catalyzed by KARI activity.
[0095] In embodiments, polypeptides provided herein with KARI activity comprise substitutions in amino acids corresponding to S56 and S58 of SEQ ID NO: 93. In embodiments, polypeptides provided herein with KARI activity comprise substitutions in amino acids corresponding to Y53 of SEQ ID NO: 93. In some embodiments the amino acid at the position corresponding to S56 is A. In some embodiments, the amino acid at the position corresponding to S58 is D or E. In some embodiments, the amino acid at the position corresponding to Y53 is F, I, L, V, P, M, S, Q, E, P, or A. In some embodiments, the amino acid at the position corresponding to S56 is V or D. In some embodiments, the amino acid at the position corresponding to S58 is D or Q.
[0096] In embodiments, polypeptides provided herein comprise substitutions at the amino acids corresponding to those at positions 90 or 93 or both of SEQ ID NO: 93. In embodiments, the amino acid at position 90 is M, L, Y, or A. In embodiments, the amino acid at position 93 is I, A, V, L, or T. In embodiments, both positions are substituted. Example combinations of the substitutions are shown in Table 3. In embodiments, such polypeptides have KARI activity.
[0097] In other embodiments, polypeptides provided herein comprise substitutions at the amino acids corresponding to those at positions 90 or 93 or 94 or a combination thereof of SEQ ID NO: 93. In embodiments, the amino acid at position 90 is K, M, or Y. In embodiments, the amino acid at position 93 is A, 1, T or V. In embodiments, the amino acid at position 94 is 1, L, M, or F. In embodiments, a combination of or all of these positions are substituted. Example combinations of the substitutions are shown in Tables 5 and 6. In embodiments, such polypeptides have KARI activity.
[0098] In other embodiments, polypeptides provided herein comprise at least one amino acid substitution at at least one position corresponding to A73, L167, T191, S32, V220, L243, C46, E200, E68, D14, I234, A311, F189, K42, V158, G45, P124, K42, D196, L284, P101, M132, K270, K77, P125, K136, A162, D242, F115, Q213, Y262, F292, K238, I256, C156, M94, F53, C209, S330, Q91, A210, A157, N107, K294, V56, I25, H235, I84, F189, Y254, V56, G114, E194, L211, D225, A166, L171, T218, G248, K96, V123, F53, M108, E186, D302, E58, G223, T93, G114, G151, D302, K42, K282, I283, G120, T191, Y254, V123, K126, K281, A174, V142, D168, E261, A92, M169, E274, A176, A214, I99, A210, T191, T187, L219, T187, L219, T191, G304, A105, C209, P101, A279, G120, A303, K314,1272, R181, E145, A214, T93, D127, N40, G207, E326, D295, E147, G149, V298, T273, T131, I122, D264, H118, R190, L315, D242, M312, S285, I234, L85, H140, or M237 of SEQ ID NO: 239. In embodiments, polypeptides provided herein comprise substitutions at at least 2 of these positions, at least 3 of these positions, or at at least 4 of these positions. Examples of combinations of such substitutions are provided in Table 11, along with examples of amino acids suitable for substituting at such positions.
[0099] In embodiments, polypeptides comprise at least one, at least two, or at least 3 of the following substitutions: T191N, T191S, E58D, E274K, T187S, K42N, A105T, A73T, A92D, A279T, A176T, G120S, M169K, R181K, or A214V.
[0100] In embodiments, polypeptides comprise a substitution at the position corresponding to position 53 of SEQ ID NO: 93 selected from L, I, M, V, P, S, A, E, or Q. In embodiments, the amino acid at position 53 is F.
[0101] In embodiments, polypeptides provided herein comprise one of the following substitutions or a combination thereof: Y53F, 556A, K57E, 558E, N87P, K90A/Y, T93L, M94L, E148Q, H37N, G450, G66A, E148G, E148Q, V156A, T191S, Y254F, or K278M. In embodiments, polypeptides provided herein comprise substitutions at each of positions corresponding to positions 53, 56, 57, 58, 87, and 90 of SEQ ID NO: 93. In embodiments, the amino acids at the positions are 53F, 56A, 57E, 58E, 87P, 90A/Y. In embodiments, such polypeptides further comprise a substitution at the position corresponding to 93 or 94 or both. In embodiments, the amino acids at these positions are 93L or 94L. Examples of such substitution combinations may include, but are not limited to, the following:
TABLE-US-00005 53, 56, 57, 58, 87, 90, 93, 94 53, 56, 57, 58, 87, 90, 93, 94, 148 53, 56, 57, 58, 87, 90, 93, 94, 37 53, 56, 57, 58, 87, 90, 93, 94, 45 53, 56, 57, 58, 87, 90, 93, 94, 66 53, 56, 57, 58, 87, 90, 93, 94, 148 53, 56, 57, 58, 87, 90, 93, 94, 156 53, 56, 57, 58, 87, 90, 93, 94, 191 53, 56, 57, 58, 87, 90, 93, 94, 254 53, 56, 57, 58, 87, 90, 93, 94, 278 53, 56, 57, 58, 87, 90, 94, 37 53, 56, 57, 58, 87, 90, 94, 66.sup.a 53, 56, 57, 58, 87, 90, 94, 148 53, 56, 57, 58, 87, 90, 94, 156.sup.a 53, 56, 57, 58, 87, 90, 94, 191 53, 56, 57, 58, 87, 90, 93 53, 56, 57, 58, 87, 90, 93, 191 53, 56, 57, 58, 87, 90, 93, 94, 258 53, 56, 57, 58, 87, 90, 94, 148
[0102] Examples of such substitution combinations may include, but are not limited to:
TABLE-US-00006 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, E148Q Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, H37N Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, G45C Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, G66A Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, E148G Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, V156A Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, T191S Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, Y254F Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, K278M Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, H37N Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, G66A Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, E148Q Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, V156A Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, T191S Y53F, S56A, K57E, S58E, N87P, K90A, T93L Y53F, S56A, K57E, S58E, N87P, K90A, T93L, T191S Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, N258S Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, E148Q
[0103] In embodiments, polypeptides comprise substitutions at the amino acids at positions corresponding to positions 158, 67, 162, 312, 169, or a combination thereof. In embodiments, the amino acid at position 158 is T, K, or W. In embodiments, the amino acid at position 67 is L, M, or Q. In embodiments, the amino acid at position 162 is Q, P, H, R, C, N. In embodiments, the amino acid at position 169 is Q, C, T, E, or M. In embodiments, the amino acid at position 312 is C or L.
[0104] In embodiments, polypeptides comprise substitutions at the amino acids at positions corresponding to position 53, 56, 57, 58, 87, or a combination thereof. In embodiments, polypeptides further comprise substitutions at positions 87, 147, 164, 304, 258, 71, 184, 79, 98, 169, 100, 312, or combinations thereof. Examples of such substitution combinations may include, but are not limited to, the following:
TABLE-US-00007 53, 56, 57, 58, 87 53, 56, 57, 58, 87, 147 53, 56, 57, 58, 87, 164 53, 56, 57, 58, 87, 304 53, 56, 57, 58, 87, 258 53, 56, 57, 58, 87, 71 53, 56, 57, 58, 87, 184 53, 56, 57, 58, 87, 79 53, 56, 57, 58, 87, 98 53, 56, 57, 58, 87, 169 53, 56, 57, 58, 87, 169 53, 56, 57, 58, 87, 169 53, 56, 57, 58, 87, 100, 312
[0105] Examples of such substitution combinations may include, but are not limited to, the following:
TABLE-US-00008 Y53L, S56V, K57E, S58E, N87P Y53L, S56V, K57E, S58E, N87P, E147V Y53L, S56V, K57E, S58E, N87P, G164D Y53L, S56V, K57E, S58E, N87P, G304V Y53L, S56V, K57E, S58E, N87P, N258S Y53L, S56V, K57E, S58E, N87P, T71S Y53L, S56V, K57E, S58E, N87P, V184I Y53L, S56V, K57E, S58E, N87P, A79D Y53L, S56V, K57E, S58E, N87P, D98V Y53L, S56V, K57E, S58E, N87P, M169F Y53L, S56V, K57E, S58E, N87P, M169K Y53L, S56V, K57E, S58E, N87P, M169L Y53L, S56V, K57E, S58E, N87P, E100Q, M312K
[0106] In embodiments, a KARI variant having SEQ ID NO: 239 further comprises substitution(s) selected from: A73T, L167M and T191S, S32Y and V220I, L2435, C46S and E200E, E68G, D14N, I234N and A311V, F189L, K42M and V158D, G45D, P124S, K42N, D196V and L284C, P101S, M132V and K270N, K77M, P125S, K136E, A162T and D242V, F115I, Q213H and Y262N, F292I, K238M, I256T and 0156V, M94L, F53L, C209S and S330Y, Q91R and A210D, A157S, N107S, F53I and K294M, V56A, I25N and H235Y, I84N and F189Y, Y254H, V56A, G114C, E194D, L211S and D225E, A166T, L171S, T218I and G248C, K96E and V123A, K96E and V123A, F53I and M108L; E186D, F53I, D302E, E58D, G223D, T93A, G114D and G151S, D302E, K42N, K282N and 1283F, G120S, T191N and Y254H, V123A and K126M, K281M, A174D, V142F, D168E and E261E, A92D, M169K, E274K, A176-1, A214V, I99V and A210T, T191S, T187S, L219W, G304C, A105T, C209R, P101S, A279T, G120S, A303T and K314M, I272N, R181K, E145V and A214T, T93I, D127E, N40D and T191S, G207S and E326K, D295E, E147D, G149C and V298A, T273S, T131A, I122F, D264V, H118Y and R190G, L315M, D264V, D242N, M312I, S285Y, I234M, L85M, H140Y and M237L, and a combination thereof.
[0107] In embodiments, a KARI variant having SEQ ID NO: 239 further comprises substitution(s) selected from: F53L, F53I, F53M, F53V, F53P, F53S, F53A, F53E, F53Q, Y53F, S56V, K57E, S58E and N87P, Y53L, S56V, K57E, S58E and N87P, Y53I, S56V, K57E, S58E and N87P, and a combination thereof.
[0108] In embodiments, a KARI variant having SEQ ID NO: 239 further comprises substitution(s) selected from: Y53L, S56V, K57E, S58E and N87P, Y53L, S56V, K57E, S58E, N87P and E147V, Y53L, S56V, K57E, S58E, N87P and G164D, Y53L, S56V, K57E, S58E, N87P, and G304V, Y53L, S56V, K57E, S58E, N87P and N258S, Y53L, S56V, K57E, S58E, N87P and T71S, Y53L, S56V, K57E, S58E, N87P and V184I, Y53L, S56V, K57E, S58E, N87P and A79D, Y53L, S56V, K57E, S58E, N87P and D98V, Y53L, S56V, K57E, S58E, N87P and M169F, Y53L, S56V, K57E, S58E, N87P and M169K, Y53L, S56V, K57E, S58E, N87P and M169L, Y53L, S56V, K57E, S58E, N87P, E100Q and M312K, and a combination thereof.
[0109] In embodiments, a KARI variant having SEQ ID NO: 239 further comprises substitution(s) selected from those of ECB11, EC2A2, EC2B12, K9SB2_SH, EGC10, EGG8, EGD9, EHG1, EHG2, EHH12, EHH10, EHH6, EHH9, EKC5, EKG4, EJF5, EJA1, EJB8, EJB10, and a combination thereof.
[0110] In embodiments, polypeptides provided herein comprise amino acid sequences with at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98% identity to the sequences of K9JM2, K9JM3, K9JM4, K9JM5, K9JM6, K9JM7, K9JM8, K9JM9, K9JM10, K9JM11, K9JM12, K9JM13, K9JM14, K9JM15, K9JM16, K9JM17, K9JM18, K9JM19, K9JM20, K9JM21, K9JM22, K9JM23, K9JM24, K9JM25, K9JM26, K9JM27, K9JM28, K9JM29, K9JM30, K9JM31, JM32, JM33, JM34, JM35, JM36, JM37, JM38, JM39, JM40, JM42, JM43, JM44, K9SB2, K9_DAVID_SH, K9ALL3, K9_URSALA (K9SB2+A56V), JM41, K9ALL148, K9JM148, K9ALL156, K9JM156, K9ALL191, K9JM191, K9ALL254, K9ALL278, K9ALL37, K9JM375, K9ALL66, K9JM66, K9ALL8Q, K9JM8Q, K9ALL45, K9_LUCY, K9_ILYA, K9ALL258, K9YW25-T191S, PLH689::ALL3, F53L, F53I, F53M, F53V, F53P, F53S, F53A, F53E, F53Q, T11-1, T11-2, T11-3, T11-4, T11-5, T11-6, T11-7, T11-10, T11-12, T11-13, T11-14, T11-15, T11-16, T11-18, T11-19, T11-21, T11-22, T11-25, T11-27, T11-28, T11-29, T11-30, T11-32, T11-33, T11-35, T11-36, T11-37, T11-38, T11-39, T11-42, T11-43, T11-44, T11-45, T11-46, T11-47, T11-49, T11-50, T11-52, T11-54, T11-55, T11-56, T11-57, T11-58, T11-59, T11-60, T11-61, T11-62, T11-64, T11-66, T11-67, T11-69, T11-70, T11-72, T11-74, T11-75, T11-76, T11-79, T11-80, T11-81, T11-83, T11-84, T11-85, T11-86, T11-87, T11-88, T11-91, T11-94, T11-95, T11-96, T11-97, T11-99, T11-103, T11-104, T11-109, T11-114, T11-116, T11-117, T11-119, T11-121, T11-110, T11-111, T11-122, T11-124, T11-125, T11-128, T11-130, T11-131, T11-134, E147V, G164D, G304V, N258S, T71S, V184I, A279D, D98V, M169F, M169K, M169L, E100Q_M312K, ECB11, EC2A2, EC2B12, EGC10, EGD9, EGG8, EHG1, EHG2, EHH6, EHH9, EHH10, EHH12, EKC5, EKG4, EJF5, EJB8, EJA1, EJB10, K9_Lucy_SH, or K9JM1 or an active fragment thereof. Accordingly, in embodiments, polypeptides provided herein comprise amino acid sequences with at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98% identity to the sequences of K9JM36 (SEQ ID NO: 227), K9JM43 (SEQ ID NO: 233), K9JM44 (SEQ ID NO: 234), or K9ALL3 (SEQ ID NO: 237), or an active fragment thereof. In embodiments, polypeptides comprise the sequence of K9JM36 (SEQ ID NO: 227), K9JM43 (SEQ ID NO: 233), K9JM44 (SEQ ID NO: 234), or K9ALL3 (SEQ ID NO: 237), or an active fragment thereof
[0111] In embodiments, substitutions in KARI enzymes such as that derived from Anaerostipes caccae lower the K.sub.M for NADH.
[0112] In embodiments, the polypeptides comprise fewer than 10, 15, or 20 substitutions. In embodiments, the polypeptides match the Profile HMM based on experimentally verified KARIs and given in Table Z with an E value less than <10.sup.3. Sequences can be compared to the profile HMM given in Table Z using hmmsearch (HMMER software package available from Janelia Farm Research Campus, Ashburn, Va.).
[0113] Also provided herein are polynucleotides encoding polypeptides provided herein. Also provided herein are recombinant host cells comprising such polypeptides or polynucleotides and methods comprising such recombinant host cells.
Molecular Techniques
[0114] Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) (hereinafter Maniatis), and by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987).
Identification of Additional Polypeptides Having KARI Activity
[0115] Equipped with this disclosure, one of skill in the art will be readily able to identify additional suitable polypeptides having KARI activity.
[0116] The sequences of other polynucleotides, genes and/or polypeptides can be identified in the literature and in bioinformatics databases well known to the skilled person using sequences disclosed herein and available in the art. For example, such sequences can be identified through BLAST searching of publicly available databases with polynucleotide or polypeptide sequences provided herein. In such a method, identities can be based on the Clustal W method of alignment using the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix.
[0117] Additionally, polynucleotide or polypeptide sequences disclosed herein can be used to identify other KARI homologs in nature. For example, each of the KARI encoding nucleic acid fragments disclosed herein can be used to isolate genes encoding homologous proteins. Isolation of homologous genes using sequence-dependent protocols is well known in the art. Examples of sequence-dependent protocols include, but are not limited to (1) methods of nucleic acid hybridization; (2) methods of DNA and RNA amplification, as exemplified by various uses of nucleic acid amplification technologies [e.g., polymerase chain reaction (PCR), Mullis et al., U.S. Pat. No. 4,683,202; ligase chain reaction (LCR), Tabor et al., Proc. Acad. Sci. USA 82:1074 (1985); or strand displacement amplification (SDA), Walker et al., Proc. Natl. Acad. Sci. U.S.A., 89:392 (1992)]; and (3) methods of library construction and screening by complementation.
[0118] It will be appreciated that one of ordinary skill in the art, equipped with this disclosure, can generate active fragments of polypeptides provided herein, for example, by truncating polypeptides provided herein based on sequence alignments at the N-terminus and confirming KARI activity. In embodiments, Anaerostipes caccae KARIs and variants thereof provided herein are truncated at the N-terminus relative to the wild-type sequence (SEQ ID NO: 93).
Generation of Variants
[0119] Variants described herein may be generated by any method known in the art. Methods known in the art for site-directed mutagenesis include, for example, QuikChange (Agilent, Santa Clara, Calif.) and Change-IT (Affymetrix/USB, Santa Clara, Calif.). Methods known in the art for random point mutagenesis include, for example, error-prone PCR (e.g., Bloom et al., BMC Biol. 2007, 5:29, doi:10.1186/1741-7007-5-29.) or GeneMorph (Agilent, Santa Clara, Calif.), exposure to chemical mutagens (e.g., ethyl methanesulfonate) or ultraviolet light, use of modified nucleotides in PCR (e.g., Wong et al., Nucleic Acids Res. 2004, 32:3, e26.), and use of special mutator strains. Methods known in the art for DNA recombination or shuffling include, for example, random fragmentation and reassembly (e.g. Stemmer 1994 Proc. Natl. Acad. Sci. USA 91:22, 10747-10751.), heteroduplex repair (e.g., Volkov et al., Nucleic Acids Res. 1999 27:18, e18.), staggered extension (e.g., Zhao et al., Nat. Biotechnol. 1998, 16:3, 258-261.), unpaired-primer shuffling (e.g., Milano et al., U.S. Pat. No. 7,879,582), site-directed recombination (e.g., Hiraga et al., J. Mol. Biol. 2003, 330:2, 287-296.), and synthetic shuffling (e.g., Ness et al., Nat. Biotechnol. 2002, 20, 1251-1255.). Other methods for protein variant library construction include, for example, circular permutation (e.g., Guntas et al., PLoS One. 2012, 7(4):e35998), and chemical DNA synthesis.
[0120] Equipped with this disclosure, one of skill in the art can readily make and use the variants provided herein as well as variants with less than 100% identity (as described above) thereto.
[0121] Additional polypeptides having KARI activity can be obtained using methods described and demonstrated herein. For example, a polypeptide having KARI activity can be employed in the construction of a site-saturation gene library as described herein. Kits for construction of such gene libraries are commercially available (for example, from USB Corporation, Cleveland, Ohio, #78480.) Site-directed mutagenesis can also be carried out using commercially available kits (for example, the QuickChange II XL site directed mutagenesis kit, Catalog #200524, Stratagene, La Jolla, Calif.). Primer design for target sites for mutagenesis is well-known in the art, and multiple sequence alignment to identify the target sites is likewise well-known.
[0122] Cofactor Specificity
[0123] To determine cofactor specificity, V.sub.max/K.sub.M ratios may be calculated for each cofactor at saturating acetolactate, those variants with a higher ratio for NADH will react at a higher rate with NADH than NADPH under conditions of equal-molar concentrations of the two cofactors and saturating acetolactate. V-.sub.max and K.sub.M values for NADH and NADPH can be determined using methods known in the art and/or provided herein. For example, to determine V.sub.max and K.sub.M values for NADH and NADPH, the partially purified proteins may be assayed at various concentrations of NADH and NADPH.
KARI Structure
[0124] Structural information useful in the identification and modification of polypeptides having KARI activity is provided in art, such as in the references described here as well as in the Profile HMM provided herewith in Table Z and described in US App. Pub. Nos. 20100197519 and 20090163376.
[0125] It was reported that phosphate p2 oxygen atoms of NADPH form hydrogen bonds with side chains of Arg162, Ser165 and Ser167 of spinach KARI (Biou V., et al. The EMBO Journal, 16: 3405-3415, 1997). Studies by Ahn et al., (J. Mol. Biol., 328: 505-515, 2003) had identified three NADPH phosphate binding sites (Arg47, Ser50 and Thr52) for Pseudomonas aeruginosa (PAO-KARI) following comparing its structure with that of the spinach KARI. The structure of PF5-KARI with bound NADPH, acetolactate and magnesium ions was built based on the crystal structure of P. aeruginosa PAO1-KARI (PDB ID 1NP3, Ahn H. J. et al., J. Mol. Biol., 328: 505-515, 2003) which has 92% amino acid sequence homology to PF5 KARI. PAO1-KARI structure is a homo-dodecamer and each dodecamer consists of six homo-dimers with extensive dimer interface. The active site of KARI is located in this dimer interface. The biological assembly is formed by six homo-dimers positioned on the edges of a tetrahedron resulting in a highly symmetrical dodecamer of 23 point group symmetry.
[0126] The model of PF5-KARI dimer was built based on the coordinates of monomer A and monomer B of PAO1-KARI and sequence of PF5-KARI using DeepView/Swiss PDB viewer (Guex, N. and Peitsch, M. C., Electrophoresis, 18: 2714-2723, 1997). This model was then imported to program O (Jones, T. A. et al, Acta Crystallogr. A 47: 110-119, 1991) on a Silicon Graphics system for further modification.
[0127] The structure of PAO1-KARI has no NADPH, substrate or inhibitor or magnesium in the active site. Therefore, the spinach KARI structure (PDB ID 1yve, Biou V. et al., The EMBO Journal, 16: 3405-3415, 1997.), which has magnesium ions, NADPH and inhibitor (N-Hydroxy-N-isopropyloxamate) in the acetolacate binding site, was used to model these molecules in the active site. The plant KARI has very little sequence homology to either PF5- or PAO1 KARI (<20% amino acid identity), however the structures in the active site region of these two KARI enzymes are very similar. To overlay the active site of these two KARI structures, commands LSQ_ext, LSQ_improve, LSQ_mol in the program O were used to line up the active site of monomer A of spinach KARI to the monomer A of PF5 KARI model. The coordinates of NADPH, two magnesium ions and the inhibitor bound in the active site of spinach KARI were extracted and incorporated to molecule A of PF5 KARI. A set of the coordinates of these molecules were generated for monomer B of PF5 KARI by applying the transformation operator from monomer A to monomer B calculated by the program.
[0128] Because there is no NADPH in the active site of PAO1 KARI crystal structure, the structures of the phosphate binding loop region in the NADPH binding site (residues 44-45 in PAO1 KARI, 157-170 in spinach KARI) are very different between the two. To model the NADPH bound form, the model of the PF5-KARI phosphate binding loop (44-55) was replaced by that of 1yve (157-170). Any discrepancy of side chains between these two was converted to those in the PF5-KARI sequence using the mutate_replace command in program O, and the conformations of the replaced side-chains were manually adjusted. The entire NADPH/Mg/inhibitor bound dimeric PF5-KARI model went through one round of energy minimization using program CNX (ACCELRYS San Diego Calif., Burnger, A. T. and Warren, G. L., Acta Crystallogr., D 54: 905-921, 1998) after which the inhibitor was replaced by the substrate, acetolactate (AL), in the model.
KARI Activity
[0129] Polypeptides described herein include those with KARI activity. KARI activity can be confirmed by assaying for the enzymatic conversion of acetolactate to 2,3-dihydroxyisovalerate using methods described in the art (for example in U.S. Pat. No. 8,129,162, incorporated herein by reference). For example, the conversion may be followed by measuring the disappearance of the cofactor, NADPH or NADH, from the reaction at 340 nm using a plate reader (such as from Molecular Device, Sunnyvale, Calif.).
[0130] KARI activity may also be confirmed by expressing a given KARI in a host cell comprising polynucleotides encoding polypeptides that catalyze the substrate to product conversions given in
[0131] Once variants have been generated, KARI activity with NADH or NADPH can be readily assessed using methods known in the art and/or disclosed herein. For example, KARI activity may be determined by measuring the disappearance of the NADPH or NADH from the reaction at 340 nm or by determination of the Michaelis constant via measurement of formation of 2,3-dihydroxyisovalerate using HPLC/MS.
Confirmation of Isobutanol Production
[0132] The presence and/or concentration of isobutanol in the culture medium can be determined by a number of methods known in the art (see, for example, U.S. Pat. No. 7,851,188, incorporated by reference). For example, a specific high performance liquid chromatography (HPLC) method utilizes a Shodex SH-1011 column with a Shodex SHG guard column, both may be purchased from Waters Corporation (Milford, Mass.), with refractive index (RI) detection. Chromatographic separation is achieved using 0.01 M H.sub.2SO.sub.4 as the mobile phase with a flow rate of 0.5 mL/min and a column temperature of 50 C. Isobutanol has a retention time of 46.6 min under the conditions used.
[0133] Alternatively, gas chromatography (GC) methods are available. For example, a specific GC method utilizes an HP-INNOWax column (30 m0.53 mm id, 1 m film thickness, Agilent Technologies, Wilmington, Del.), with a flame ionization detector (FID). The carrier gas is helium at a flow rate of 4.5 mL/min, measured at 150 C. with constant head pressure; injector split is 1:25 at 200 C., oven temperature is 45 C. for 1 min, 45 to 220 C. at 10 C./min, and 220 C. for 5 min; and FID detection is employed at 240 C. with 26 mL/min helium makeup gas. The retention time of isobutanol is 4.5 min.
Reduction of DHMB
[0134] The production of DHMB in a host cell comprising an isobutanol biosynthetic pathway indicates that not all of the pathway substrates are being converted to the desired product. Thus, yield is lowered. In addition, DHMB can have inhibitory effects on product production. For example, DHMB can decrease the activity of enzymes in the biosynthetic pathway or have other inhibitory effects on yeast growth and/or productivity during fermentation. Thus, the methods described herein provide ways of reducing DHMB during fermentation. The methods include both methods of decreasing the production of DHMB and methods of removing DHMB from fermenting compositions.
Decreasing DHMB Production
[0135] In some embodiments described herein, a recombinant host cell can comprise reduced or eliminated ability to convert acetolactate to DHMB. The ability of a host cell to convert acetolactate to DHMB can be reduced or eliminated, for example, by a modification or disruption of a polynucleotide or gene encoding a polypeptide having acetolactate reductase activity or a modification or disruption of a polypeptide having acetolactate reductase activity. In other embodiments, the recombinant host cell can comprise a deletion, mutation, and/or substitution in an endogenous polynucleotide or gene encoding a polypeptide having acetolactate reductase activity or in an endogenous polypeptide having acetolactate reductase. Such modifications, disruptions, deletions, mutations, and/or substitutions can result in acetolactate reductase activity that is reduced, substantially eliminated, or eliminated. In some embodiments of the invention, the product of the biosynthetic pathway is produced at a greater yield or amount compared to the production of the same product in a recombinant host cell that does not comprise reduced or eliminated ability to convert acetolactate to DHMB. In some embodiments, the conversion of acetolactate to DHMB in a recombinant host cell is reduced, substantially eliminated, or eliminated. In some embodiments, the polypeptide having acetolactate reductase activity is selected from the group consisting of: YMR226C, YER081W, YIL074C, YBR006W, YPL275W, YOL059W, YIR036C, YPL061W, YPL088W, YCR105W, YOR375C, and YDR541C.
[0136] Thus, the product can be a composition comprising isobutanol that is substantially free of, or free of DHMB. In some embodiments, the composition comprising butanol contains no more than about 5 mM, about 4 mM, about 3 mM, about 2 mM, about 1 mM, about 0.5 mM, about 0.4 mM, about 0.3 mM DHMB, or about 0.2 mM DHMB.
[0137] Any product of a biosynthetic pathway that involves the conversion of acetolactate to a substrate other than DHMB can be produced with greater effectiveness in a recombinant host cell disclosed herein having the described modification of acetolactate reductase activity. Such products include, but are not limited to, butanol, e.g., isobutanol, 2-butanol, and BDO, and branched chain amino acids.
[0138] In some embodiments, the host cell comprises at least one deletion, mutation, and/or substitution in at least one endogenous polynucleotide encoding a polypeptide having acetolactate reductase activity. In some embodiments, the host cell comprises at least one deletion, mutation, and/or substitution in each of at least two endogenous polynucleotides encoding polypeptides having acetolactate reductase activity.
[0139] In some embodiments, a polypeptide having acetolactate reductase activity can catalyze the conversion of acetolactate to DHMB. In some embodiments, a polypeptide having acetolactate reductase activity is capable of catalyzing the reduction of acetolactate to 2S,3S-DHMB (fast DHMB) and/or 2S,3R-DHMB (slow DHMB).
DHMB Removal
[0140] In other embodiments, a reduction in DHMB can be achieved by removing DHMB from a fermentation. Thus, fermentations with reduced DHMB concentrations are also described herein. Removal of DHMB can result, for example, in a product of greater purity, or a product requiring less processing to achieve a desired purity. Therefore, compositions comprising products of biosynthetic pathways such as ethanol or butanol with increased purity are also provided.
[0141] DHMB can be removed during or after a fermentation process and can be removed by any means known in the art. DHMB can be removed, for example, by extraction into an organic phase or reactive extraction.
[0142] In some embodiments, the fermentation broth comprises less than about 0.5 mM DHMB. In some embodiments, the fermentation broth comprises less than about 1.0 mM DHMB after about 5 hours, about 10 hours, about 15 hours, about 20 hours, about 25 hours, about 30 hours, about 35 hours, about 40 hours, about 45 hours, or about 50 hours of fermentation. In some embodiments, the fermentation broth comprises less than about 5.0 mM DHMB after about 20 hours, about 25 hours, about 30 hours, about 35 hours, about 40 hours, about 45 hours, or about 50 hours of fermentation.
Biosynthetic Pathways
[0143] While KARI variants presented herein are suitable for production of isobutanol (see Examples), it is envisioned that KARIs disclosed herein may be useful in any biosynthetic pathway which employs a substrate to product conversion catalyzed by KARI activity such as acetolactate to 2,3-dihydroxyisovalerate or 2-aceto-2-hydroxybutanoate to 2,3-dihydroxy-3-methylpentanoate. Such pathways include, but are not limited to, pathways for producing pantothenic acid, valine, leucine, isoleucine or 3,3-dimethylmalate.
[0144] In one embodiment, the pathway comprising the substrate to product conversion catalyzed by KARI is a pantothenic acid biosynthetic pathway comprising the following substrate to product conversions: [0145] pyruvate to acetolactate, which may be catalyzed, for example, by acetolactate synthase, [0146] acetolactate to 2,3-dihydroxyisovalerate, which may be catalyzed, for example, by ketol-acid reductoisomerase (KARI); [0147] 2,3-dihydroxyisovalerate to -ketoisovalerate, which may be catalyzed, for example, by dihydroxyacid dehydratase (DHAD), [0148] -ketoisovalerate to 2-dehydropantoate, which may be catalyzed, for example, by 3-methyl-2-oxobutanoate hydroxymethyltransferase (panB, which may be classified as EC 2.1.2.11); [0149] 2-dehydropantoate to (R)-pantoate, which may be catalyzed, for example by 2-dehydropantoate 2-reductase (panE, which may be classified as EC 1.1.1.169) [0150] (R)-pantoate to (R)-pantothenate. which may be catalyzed, for example, by pantoate-beta-alanine ligase (panC, which may be classified as EC 6.3.2.1).
[0151] In another embodiment, the pathway comprising a substrate to product conversion catalyzed by KARI is a valine biosynthetic pathway comprising the following substrate to product conversions: [0152] pyruvate to acetolactate, which may be catalyzed, for example, by acetolactate synthase, [0153] acetolactate to 2,3-dihydroxyisovalerate, which may be catalyzed, for example, by ketol-acid reductoisomerase (KARI); [0154] 2,3-dihydroxyisovalerate to -ketoisovalerate, which may be catalyzed, for example, by dihydroxyacid dehydratase (DHAD), [0155] -ketoisovalerate to valine, which may be catalyzed, for example, by branched chain aminotransferase (ilvE (BAT); which may be classified as EC 2.6.1.42).
[0156] In another embodiment, the pathway comprising a substrate to product conversion catalyzed by KARI is an isoleucine biosynthetic pathway comprising the following substrate to product conversions: [0157] pyruvate and -ketobutyrate to 2-aceto-2-hydroxybutanoate, which may be catalyzed for example, by acetolactate synthase, [0158] 2-aceto-2-hydroxybutanoate to 2,3-dihydroxy-3-methylpentanoate, which may be catalyzed for example, by KARI; [0159] 2,3-dihydroxy-3-methylpentanoate to 3-methyl-2-oxo-pentanoate, which may be catalyzed for example, by DHAD, [0160] 3-methyl-2-oxo-pentanoate to isoleucine, which may be catalyzed, for example, by branched chain aminotransferase (ilvE (BAT); which may be classified as EC 2.6.1.42).
[0161] In another embodiment, the pathway comprising a substrate to product conversion catalyzed by KARI is a leucine biosynthetic pathway comprising the following substrate to product conversions: [0162] pyruvate to acetolactate, which may be catalyzed, for example, by acetolactate synthase, [0163] acetolactate to 2,3-dihydroxyisovalerate, which may be catalyzed, for example, by ketol-acid reductoisomerase (KARI); [0164] 2,3-dihydroxyisovalerate to -ketoisovalerate, which may be catalyzed, for example, by dihydroxyacid dehydratase (DHAD), [0165] -ketoisovalerate to 2-isopropylmalate, which may be catalyzed, for example, by 2-isopropylmalate synthase (leuA, which may be classified as EC 2.3.3.13); [0166] 2-isopropylmalate to 2-isopropylmaleate, which may be catalyzed, for example, by 3-isopropylmalate dehydratase (leu1; which may be classified as E04.2.1.33); [0167] 2-isopropylmaleate to 3-isopropylmalate, which may be catalyzed, for example, by 3-isopropylmalate dehydratase (leu1; which may be classified as E04.2.1.33); [0168] 3-isopropylmalate to 2-isopropyl-3-oxosuccinate, which may be catalyzed, for example by 3-isopropylmalate dehydrogenase (leuB, which may be classified as EC 1.1.1.85); [0169] 2-isopropyl-3-oxosuccinate to 4-methyl-2-oxopentanoate (spontaneous reaction); and [0170] 4-methyl-2-oxopentanoate to leucine, which may be catalyzed, for example, by branched chain aminotransferase (ilvE (BAT); which may be classified as EC 2.6.1.42).
[0171] In another embodiment, the pathway comprising a substrate to product conversion catalyzed by KARI is a 3,3-dimethylmalate biosynthetic pathway comprising the following substrate to product conversions: [0172] pyruvate to acetolactate, which may be catalyzed, for example, by acetolactate synthase, [0173] acetolactate to 2,3-dihydroxyisovalerate, which may be catalyzed, for example, by ketol-acid reductoisomerase (KARI); [0174] 2,3-dihydroxyisovalerate to -ketoisovalerate, which may be catalyzed, for example, by dihydroxyacid dehydratase (DHAD), [0175] -ketoisovalerate to (R)-3,3 dimethylmalate, which may be catalyzed for example, by dimethylmalatedehydrogenase (DMMID, which may be classified as 1.1.1.84).
Isobutanol Biosynthetic Pathways
[0176] Certain suitable isobutanol biosynthetic pathways are disclosed in U.S. Patent Application Publication No. US 20070092957, which is incorporated by reference herein. A diagram of the disclosed isobutanol biosynthetic pathways is provided in
[0182] Steps in another example isobutanol biosynthetic pathway include conversion of:
[0183] i) pyruvate to acetolactate, (pathway step a)
[0184] ii) acetolactate to 2,3-dihydroxyisovalerate, (pathway step b)
[0185] iii) 2,3-dihydroxyisovalerate to -ketoisovalerate, (pathway step c)
[0186] iv) -ketoisovalerate to isobutyryl-CoA, (pathway step f)
[0187] v) isobutyryl-CoA to isobutyraldehyde, (pathway step g), and
[0188] vi) isobutyraldehyde to isobutanol, (pathway step e)
[0189] Steps in another example isobutanol biosynthetic pathway include conversion of:
[0190] i) pyruvate to acetolactate, (pathway step a)
[0191] ii) acetolactate to 2,3-dihydroxyisovalerate, (pathway step b)
[0192] iii) 2,3-dihydroxyisovalerate to -ketoisovalerate, (pathway step c)
[0193] iv) -ketoisovalerate to valine, (pathway step h)
[0194] v) valine to isobutylamine, (pathway step i)
[0195] vi) isobutylamine to isobutyraldehyde, (pathway step j), and
[0196] vii) isobutyraldehyde to isobutanol: (pathway step e)
[0197] The substrate to product conversions for steps f, g, h, i, j, and k of alternative pathways are described in U.S. Patent Application Publication No. US 2007/0092957 A1, which is incorporated by reference herein.
[0198] Genes and polypeptides that can be used for the substrate to product conversions described above as well as those for additional isobutanol pathways, are described in U.S. Patent Appl. Pub. No. 20070092957 and PCT Pub. No. WO 2011/019894, both incorporated by reference herein. US Appl. Pub. Nos. 2011/019894, 20070092957, 20100081154, describe dihydroxyacid dehydratases including those from Lactococcus lactis and Streptococcus mutans. Ketoisovalerate decarboxylases include those derived from Lactococcus lactis, Macrococcus caseolyticus (SEQ ID NO: 542) and Listeria grayi (SEQ ID NO: 543).U.S. Patent Appl. Publ. No. 2009/0269823 and U.S. Appl. Publ. No. 20110269199, incorporated by reference, describe alcohol dehydrogenases. Alcohol dehydrogenases include SadB from Achromobacter xylosoxidans. Additional alcohol dehydrogenases include horse liver ADH and Beijerinkia indica ADH, and those that utilize NADH as a cofactor. In one embodiment a butanol biosynthetic pathway comprises a) a ketol-acid reductoisom erase that has a K.sub.M for NADH less than about 300 M, less than about 100 M, less than about 50 M, less than about 20 M or less than about 10 M, b) an alcohol dehydrogenase that utilizes NADH as a cofactor; or c) both a) and b).
[0199] Additionally described in U.S. Patent Application Publication No. US 20070092957 A1, which is incorporated by reference herein, are construction of chimeric genes and genetic engineering of bacteria and yeast for isobutanol production using the disclosed biosynthetic pathways.
Modifications
[0200] Functional deletion of the pyruvate decarboxylase gene has been used to increase the availability of pyruvate for utilization in biosynthetic product pathways. For example, U.S. Application Publication No. US 2007/0031950 A1 discloses a yeast strain with a disruption of one or more pyruvate decarboxylase genes and expression of a D-lactate dehydrogenase gene, which is used for production of D-lactic acid. U.S. Application Publication No. US 2005/0059136 A1 discloses glucose tolerant two carbon source independent (GCSI) yeast strains with no pyruvate decarboxylase activity, which may have an exogenous lactate dehydrogenase gene. Nevoigt and Stahl (Yeast 12:1331-1337 (1996)) describe the impact of reduced pyruvate decarboxylase and increased NAD-dependent glycerol-3-phosphate dehydrogenase in Saccharomyces cerevisiae on glycerol yield. U.S. Appl. Pub. No. 20090305363 discloses increased conversion of pyruvate to acetolactate by engineering yeast for expression of a cytosol-localized acetolactate synthase and substantial elimination of pyruvate decarboxylase activity.
[0201] Examples of additional modifications that may be useful in cells provided herein include modifications to reduce glycerol-3-phosphate dehydrogenase activity and/or disruption in at least one gene encoding a polypeptide having pyruvate decarboxylase activity or a disruption in at least one gene encoding a regulatory element controlling pyruvate decarboxylase gene expression as described in U.S. Patent Appl. Pub. No. 20090305363 (incorporated herein by reference), modifications to a host cell that provide for increased carbon flux through an Entner-Doudoroff Pathway or reducing equivalents balance as described in U.S. Patent Appl. Pub. No. 20100120105 (incorporated herein by reference). Other modifications include integration of at least one polynucleotide encoding a polypeptide that catalyzes a step in a pyruvate-utilizing biosynthetic pathway. Other modifications include at least one deletion, mutation, and/or substitution in an endogenous polynucleotide encoding a polypeptide having acetolactate reductase activity as described in U.S. application Ser. No. 13/428,585, filed Mar. 23, 2012, incorporated herein by reference. In embodiments, the polypeptide having acetolactate reductase activity is YMR226C of Saccharomyces cerevisae or a homolog thereof. Additional modifications include a deletion, mutation, and/or substitution in an endogenous polynucleotide encoding a polypeptide having aldehyde dehydrogenase and/or aldehyde oxidase activity U.S. application Ser. No. 13/428,585, filed Mar. 23, 2012, incorporated herein by reference. In embodiments, the polypeptide having aldehyde dehydrogenase activity is ALD6 from Saccharomyces cerevisiae or a homolog thereof. A genetic modification which has the effect of reducing glucose repression wherein the yeast production host cell is pdc- is described in U.S. Appl. Publ No. US 20110124060.
[0202] WIPO publication number WO/2001/103300 discloses recombinant host cells comprising (a) at least one heterologous polynucleotide encoding a polypeptide having dihydroxy-acid dehydratase activity; and (b)(i) at least one deletion, mutation, and/or substitution in an endogenous gene encoding a polypeptide affecting Fe-S cluster biosynthesis; and/or (ii) at least one heterologous polynucleotide encoding a polypeptide affecting Fe-S cluster biosynthesis. In embodiments, the polypeptide affecting Fe-S cluster biosynthesis is encoded by AFT1, AFT2, FRA2, GRX3, or CCC1. In embodiments, the polypeptide affecting Fe-S cluster biosynthesis is constitutive mutant AFT1 L99A, AFT1 L102A, AFT1 C291F, or AFT/0293F.
[0203] Additionally, host cells may comprise heterologous polynucleotides encoding a polypeptides with phosphoketolase activity and/or a heterologous polynucleotide encoding a polypeptide with phosphotransacetylase activity.
Microbial Hosts for Isobutanol Production
[0204] Microbial hosts for isobutanol production may be selected from bacteria, cyanobacteria, filamentous fungi and yeasts. The microbial host used for isobutanol production should be tolerant to isobutanol so that the yield is not limited by butanol toxicity. Microbes that are metabolically active at high titer levels of isobutanol are not well known in the art. Although butanol-tolerant mutants have been isolated from solventogenic Clostridia, little information is available concerning the butanol tolerance of other potentially useful bacterial strains. Most of the studies on the comparison of alcohol tolerance in bacteria suggest that butanol is more toxic than ethanol (de Cavalho, et al., Microsc. Res. Tech., 64: 215-22, 2004) and (Kabelitz, et al., FEMS Microbiol. Lett., 220: 223-227, 2003, Tomas, et al., J. Bacteriol., 186: 2006-2018, 2004) report that the yield of 1-butanol during fermentation in Clostridium acetobutylicum may be limited by 1-butanol toxicity. The primary effect of 1-butanol on Clostridium acetobutylicum is disruption of membrane functions (Hermann et al., Appl. Environ. Microbiol., 50: 1238-1243, 1985).
[0205] The microbial hosts selected for the production of isobutanol should be tolerant to isobutanol and should be able to convert carbohydrates to isobutanol. The criteria for selection of suitable microbial hosts include the following: intrinsic tolerance to isobutanol, high rate of glucose utilization, availability of genetic tools for gene manipulation, and the ability to generate stable chromosomal alterations.
[0206] Suitable host strains with a tolerance for isobutanol may be identified by screening based on the intrinsic tolerance of the strain. The intrinsic tolerance of microbes to isobutanol may be measured by determining the concentration of isobutanol that is responsible for 50% inhibition of the growth rate (IC50) when grown in a minimal medium. The IC50 values may be determined using methods known in the art. For example, the microbes of interest may be grown in the presence of various amounts of isobutanol and the growth rate monitored by measuring the optical density at 600 nanometers. The doubling time may be calculated from the logarithmic part of the growth curve and used as a measure of the growth rate. The concentration of isobutanol that produces 50% inhibition of growth may be determined from a graph of the percent inhibition of growth versus the isobutanol concentration. Preferably, the host strain should have an IC50 for isobutanol of greater than about 0.5%.
[0207] The microbial host for isobutanol production should also utilize glucose at a high rate. Most microbes are capable of metabolizing carbohydrates. However, certain environmental microbes cannot metabolize carbohydrates to high efficiency, and therefore would not be suitable hosts.
[0208] The ability to genetically modify the host is essential for the production of any recombinant microorganism. The mode of gene transfer technology may be by electroporation, conjugation, transduction or natural transformation. A broad range of host conjugative plasmids and drug resistance markers are available. The cloning vectors are tailored to the host microorganisms based on the nature of antibiotic resistance markers that can function in that host.
[0209] The microbial host also has to be manipulated in order to inactivate competing pathways for carbon flow by deleting various genes. This requires the availability of either transposons to direct inactivation or chromosomal integration vectors. Additionally, the production host should be amenable to chemical mutagenesis so that mutations to improve intrinsic isobutanol tolerance may be obtained.
[0210] Based on the criteria described above, suitable microbial hosts for the production of isobutanol include, but are not limited to, members of the genera Clostridium, Zymomonas, Escherichia, Salmonella, Rhodococcus, Pseudomonas, Bacillus, Vibrio, Lactobacillus, Enterococcus, Alcaligenes, Klebsiella, Paenibacillus, Arthrobacter, Corynebacterium, Brevibacterium, Pichia, Candida, Issatchenkia, Hansenula, Kluyveromyces, and Saccharomyces. Suitable hosts include: Escherichia coli, Alcaligenes eutrophus, Bacillus licheniformis, Paenibacillus macerans, Rhodococcus erythropolis, Pseudomonas putida, Lactobacillus plantarum, Enterococcus faecium, Enterococcus gallinarium, Enterococcus faecalis, Bacillus subtilis and Saccharomyces cerevisiae. In some embodiments, the host cell is Saccharomyces cerevisiae. S. cerevisiae yeast are known in the art and are available from a variety of sources, including, but not limited to, American Type Culture Collection (Rockville, Md.), Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversity Centre, LeSaffre, Gert Strand A B, Ferm Solutions, North American Bioproducts, Martrex, and Lallemand. S. cerevisiae include, but are not limited to, BY4741, CEN.PK 113-7D, Ethanol Red yeast, Ferm Pro yeast, Bio-Ferm XR yeast, Gert Strand Prestige Batch Turbo alcohol yeast, Gert Strand Pot Distillers yeast, Gert Strand Distillers Turbo yeast, FerMax Green yeast, FerMax Gold yeast, Thermosacc yeast, BG-1, PE-2, CAT-1, CBS7959, CBS7960, and CBS7961.
Construction of Production Host
[0211] Recombinant microorganisms containing the necessary genes that will encode the enzymatic pathway for the conversion of a fermentable carbon substrate to isobutanol may be constructed using techniques well known in the art. In the present invention, genes encoding the enzymes of one of the isobutanol biosynthetic pathways of the invention, for example, acetolactate synthase, acetohydroxy acid isomeroreductase, acetohydroxy acid dehydratase, branched-chain -keto acid decarboxylase, and branched-chain alcohol dehydrogenase, may be isolated from various sources, as described above.
[0212] Methods of obtaining desired genes from a bacterial genome are common and well known in the art of molecular biology. For example, if the sequence of the gene is known, suitable genomic libraries may be created by restriction endonuclease digestion and may be screened with probes complementary to the desired gene sequence. Once the sequence is isolated, the DNA may be amplified using standard primer-directed amplification methods such as polymerase chain reaction (U.S. Pat. No. 4,683,202) to obtain amounts of DNA suitable for transformation using appropriate vectors. Tools for codon optimization for expression in a heterologous host are readily available. Some tools for codon optimization are available based on the GC content of the host microorganism.
[0213] Once the relevant pathway genes are identified and isolated they may be transformed into suitable expression hosts by means well known in the art. Vectors or cassettes useful for the transformation of a variety of host cells are common and commercially available from companies such as EPICENTRE (Madison, Wis.), Invitrogen Corp. (Carlsbad, Calif.), Stratagene (La Jolla, Calif.), and New England Biolabs, Inc. (Beverly, Mass.). Typically the vector or cassette contains sequences directing transcription and translation of the relevant gene, a selectable marker, and sequences allowing autonomous replication or chromosomal integration. Suitable vectors comprise a region 5 of the gene which harbors transcriptional initiation controls and a region 3 of the DNA fragment which controls transcriptional termination. Both control regions may be derived from genes homologous to the transformed host cell, although it is to be understood that such control regions may also be derived from genes that are not native to the specific species chosen as a production host.
[0214] Initiation control regions or promoters, which are useful to drive expression of the relevant pathway coding regions in the desired host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genetic elements, including those used in the Examples, is suitable for the present invention including, but not limited to, CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADC, TRP1, URA3, LEU2, ENO, TPI (useful for expression in Saccharomyces), AOX1 (useful for expression in Pichia), and lac, ara, tet, trp, IP.sub.L, IP.sub.R, T7, tac, and trc (useful for expression in Escherichia coli, Alcaligenes, and Pseudomonas) as well as the amy, apr, npr promoters and various phage promoters useful for expression in Bacillus subtilis, Bacillus licheniformis, and Paenibacillus macerans. For yeast recombinant host cells, a number of promoters can be used in constructing expression cassettes for genes, including, but not limited to, the following constitutive promoters suitable for use in yeast: FBA1, TDH3 (GPD), ADH1, ILV5, and GPM1, and the following inducible promoters suitable for use in yeast: GAL1, GAL10, OLE1, and CUP1. Other yeast promoters include hybrid promoters UAS(PGK1)-FBA1p, UAS(PGK1)-ENO2p, UAS(FBA1)-PDC1p), UAS(PGK1)-PDC1p, and UAS(PGK)-OLE1p, described in U.S. application Ser. No. 13/428,585, filed Mar. 23, 2012, incorporated herein by reference.
[0215] Termination control regions may also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary, however, it is most preferred if included.
[0216] Certain vectors are capable of replicating in a broad range of host bacteria and can be transferred by conjugation. The complete and annotated sequence of pRK404 and three related vectors-pRK437, pRK442, and pRK442(H) are available. These derivatives have proven to be valuable tools for genetic manipulation in Gram-negative bacteria (Scott et al., Plasmid, 50: 74-79, 2003). Several plasmid derivatives of broad-host-range Inc P4 plasmid RSF1010 are also available with promoters that can function in a range of Gram-negative bacteria. Plasmid pAYC36 and pAYC37, have active promoters along with multiple cloning sites to allow for the heterologous gene expression in Gram-negative bacteria.
[0217] Chromosomal gene replacement tools are also widely available. For example, a thermosensitive variant of the broad-host-range replicon pWV101 has been modified to construct a plasmid pVE6002 which can be used to effect gene replacement in a range of Gram-positive bacteria (Maguin et al., J. Bacteriol., 174: 5633-5638, 1992). Additionally, in vitro transposomes are available to create random mutations in a variety of genomes from commercial sources such as EPICENTRE.
[0218] The expression of an isobutanol biosynthetic pathway in various microbial hosts is described in more detail below.
Expression of an Isobutanol Biosynthetic Pathway in E. coli
[0219] Vectors or cassettes useful for the transformation of E. coli are common and commercially available from the companies listed above. For example, the genes of an isobutanol biosynthetic pathway may be isolated from various sources, cloned into a modified pUC19 vector and transformed into E. coli NM522.
Expression of an Isobutanol Biosynthetic Pathway in Rhodococcus erythropolis
[0220] A series of E. coli-Rhodococcus shuttle vectors are available for expression in R. erythropolis, including, but not limited to, pRhBR17 and pDA71 (Kostichka et al., Appl. Microbiol. Biotechnol., 62: 61-68, 2003). Additionally, a series of promoters are available for heterologous gene expression in R. erythropolis (Nakashima et al., Appl. Environ. Microbiol., 70: 5557-5568, 2004 and Tao et al., Appl. Microbiol. Biotechnol., 68: 346-354, 2005). Targeted gene disruption of chromosomal genes in R. erythropolis may be created using the method described by Tao et al., supra, and Brans et al. (Appl. Environ. Microbiol., 66: 2029-2036, 2000).
[0221] The heterologous genes required for the production of isobutanol, as described above, may be cloned initially in pDA71 or pRhBR71 and transformed into E. coli. The vectors may then be transformed into R. erythropolis by electroporation, as described by Kostichka et al., supra. The recombinants may be grown in synthetic medium containing glucose and the production of isobutanol can be followed using methods known in the art.
[0222] Expression of an isobutanol biosynthetic pathway in B. subtilis
[0223] Methods for gene expression and creation of mutations in B. subtilis are also well known in the art. For example, the genes of an isobutanol biosynthetic pathway may be isolated from various sources, cloned into a modified pUC19 vector and transformed into Bacillus subtilis BE1010. Additionally, the five genes of an isobutanol biosynthetic pathway can be split into two operons for expression. The three genes of the pathway (bubB, ilvD, and kivD) can be integrated into the chromosome of Bacillus subtilis BE1010 (Payne, et al., J. Bacteriol., 173, 2278-2282, 1991). The remaining two genes (ilvC and bdhB) can be cloned into an expression vector and transformed into the Bacillus strain carrying the integrated isobutanol genes.
Expression of an Isobutanol Biosynthetic Pathway in B. licheniformis
[0224] Most of the plasmids and shuttle vectors that replicate in B. subtilis may be used to transform B. licheniformis by either protoplast transformation or electroporation. The genes required for the production of isobutanol may be cloned in plasmids pBE20 or pBE60 derivatives (Nagarajan et al., Gene, 114: 121-126, 1992). Methods to transform B. licheniformis are known in the art (Fleming et al. Appl. Environ. Microbiol., 61: 3775-3780, 1995). The plasmids constructed for expression in B. subtilis may be transformed into B. licheniformis to produce a recombinant microbial host that produces isobutanol.
Expression of an Isobutanol Biosynthetic Pathway in Paenibacillus macerans
[0225] Plasmids may be constructed as described above for expression in B. subtilis and used to transform Paenibacillus macerans by protoplast transformation to produce a recombinant microbial host that produces isobutanol.
Expression of the Isobutanol Biosynthetic Pathway in Alcaligenes (Ralstonia) eutrophus
[0226] Methods for gene expression and creation of mutations in Alcaligenes eutrophus are known in the art (Taghavi et al., Appl. Environ. Microbiol., 60: 3585-3591, 1994). The genes for an isobutanol biosynthetic pathway may be cloned in any of the broad host range vectors described above, and electroporated to generate recombinants that produce isobutanol. The poly(hydroxybutyrate) pathway in Alcaligenes has been described in detail, a variety of genetic techniques to modify the Alcaligenes eutrophus genome is known, and those tools can be applied for engineering an isobutanol biosynthetic pathway.
Expression of an Isobutanol Biosynthetic Pathway in Pseudomonas putida
[0227] Methods for gene expression in Pseudomonas putida are known in the art (see for example Ben-Bassat et al., U.S. Pat. No. 6,586,229, which is incorporated herein by reference). The butanol pathway genes may be inserted into pPCU18 and this ligated DNA may be electroporated into electrocompetent Pseudomonas putida DOT-T1 C5aAR1 cells to generate recombinants that produce isobutanol.
Expression of an Isobutanol Biosynthetic Pathway in Saccharomyces cerevisiae
[0228] Methods for gene expression in Saccharomyces cerevisiae are known in the art (e.g., Methods in Enzymolody, Volume 194, Guide to Yeast Genetics and Molecular and Cell Biolody, Part A, 2004, Christine Guthrie and Gerald R. Fink, eds., Elsevier Academic Press, San Diego, Calif.). Expression of genes in yeast typically requires a promoter, followed by the gene of interest, and a transcriptional terminator. A number of yeast promoters, including those used in the Examples herein, can be used in constructing expression cassettes for genes encoding an isobutanol biosynthetic pathway, including, but not limited to constitutive promoters FBA, GPD, ADH1, and GPM, and the inducible promoters GAL1, GAL10, and CUP1. Suitable transcriptional terminators include, but are not limited to FBAt, GPDt, GPMt, ERG10t, GAL1t, CYC1, and ADH1. For example, suitable promoters, transcriptional terminators, and the genes of an isobutanol biosynthetic pathway may be cloned into E. coli-yeast shuttle vectors and transformed into yeast cells as described in U.S. App. Pub. No. 20100129886. These vectors allow strain propagation in both E. coli and yeast strains. Typically the vector contains a selectable marker and sequences allowing autonomous replication or chromosomal integration in the desired host. Typically used plasmids in yeast are shuttle vectors pRS423, pRS424, pRS425, and pRS426 (American Type Culture Collection, Rockville, Md.), which contain an E. coli replication origin (e.g., pMB1), a yeast 2 origin of replication, and a marker for nutritional selection. The selection markers for these four vectors are His3 (vector pRS423), Trp1 (vector pRS424), Leu2 (vector pRS425) and Ura3 (vector pRS426). Construction of expression vectors with genes encoding polypeptides of interest may be performed by either standard molecular cloning techniques in E. coli or by the gap repair recombination method in yeast.
[0229] The gap repair cloning approach takes advantage of the highly efficient homologous recombination in yeast. Typically, a yeast vector DNA is digested (e.g., in its multiple cloning site) to create a gap in its sequence. A number of insert DNAs of interest are generated that contain a 21 bp sequence at both the 5 and the 3 ends that sequentially overlap with each other, and with the 5 and 3 terminus of the vector DNA. For example, to construct a yeast expression vector for Gene X, a yeast promoter and a yeast terminator are selected for the expression cassette. The promoter and terminator are amplified from the yeast genomic DNA, and Gene X is either PCR amplified from its source organism or obtained from a cloning vector comprising Gene X sequence. There is at least a 21 bp overlapping sequence between the 5 end of the linearized vector and the promoter sequence, between the promoter and Gene X, between Gene X and the terminator sequence, and between the terminator and the 3 end of the linearized vector. The gapped vector and the insert DNAs are then co-transformed into a yeast strain and plated on the medium containing the appropriate compound mixtures that allow complementation of the nutritional selection markers on the plasmids. The presence of correct insert combinations can be confirmed by PCR mapping using plasmid DNA prepared from the selected cells. The plasmid DNA isolated from yeast (usually low in concentration) can then be transformed into an E. coli strain, e.g. TOP10, followed by mini preps and restriction mapping to further verify the plasmid construct. Finally the construct can be verified by sequence analysis.
[0230] Like the gap repair technique, integration into the yeast genome also takes advantage of the homologous recombination system in yeast. Typically, a cassette containing a coding region plus control elements (promoter and terminator) and auxotrophic marker is PCR-amplified with a high-fidelity DNA polymerase using primers that hybridize to the cassette and contain 40-70 base pairs of sequence homology to the regions 5 and 3 of the genomic area where insertion is desired. The PCR product is then transformed into yeast and plated on medium containing the appropriate compound mixtures that allow selection for the integrated auxotrophic marker. For example, to integrate Gene X into chromosomal location Y, the promoter-coding regionX-terminator construct is FOR amplified from a plasmid DNA construct and joined to an autotrophic marker (such as URA3) by either SOE FOR or by common restriction digests and cloning. The full cassette, containing the promoter-coding regionX-terminator-URA3 region, is FOR amplified with primer sequences that contain 40-70 bp of homology to the regions 5 and 3 of location Y on the yeast chromosome. The PCR product is transformed into yeast and selected on growth media lacking uracil. Transformants can be verified either by colony FOR or by direct sequencing of chromosomal DNA.
Expression of an Isobutanol Biosynthetic Pathway in Lactobacillus plantarum
[0231] The Lactobacillus genus belongs to the Lactobacillales family and many plasmids and vectors used in the transformation of Bacillus subtilis and Streptococcus may be used for Lactobacillus. Non-limiting examples of suitable vectors include pAM1 and derivatives thereof (Renault et al., Gene 183:175-182, 1996); and (O'Sullivan et al., Gene, 137: 227-231, 1993); pMBB1 and pHW800, a derivative of pMBB1 (Wyckoff et al., Appl. Environ. Microbiol., 62: 1481-1486, 1996); pMG1, a conjugative plasmid (Tanimoto et al., J. Bacteriol., 184: 5800-5804, 2002); pNZ9520 (Kleerebezem et al., Appl. Environ. Microbiol., 63: 4581-4584, 1997); pAM401 (Fujimoto et al., Appl. Environ. Microbiol., 67: 1262-1267, 2001); and pAT392 (Arthur et al., Antimicrob. Agents Chemother., 38: 1899-1903, 1994). Several plasmids from Lactobacillus plantarum have also been reported (van Kranenburg R, et al. Appl. Environ. Microbiol., 71: 1223-1230, 2005).
[0232] Expression of an Isobutanol Biosynthetic Pathway in Various Enterococcus Species (E. faecium, E. Gallinarium, and E. faecalis)
[0233] The Enterococcus genus belongs to the Lactobacillales family and many plasmids and vectors used in the transformation of Lactobacilli, Bacilli and Streptococci species may be used for Enterococcus species. Non-limiting examples of suitable vectors include pAM1 and derivatives thereof (Renault et al., Gene, 183: 175-182, 1996); and (O'Sullivan et al., Gene, 137: 227-231, 1993); pMBB1 and pHW800, a derivative of pMBB1 (Wyckoff et al. Appl. Environ. Microbiol., 62: 1481-1486, 1996); pMG1, a conjugative plasmid (Tanimoto et al., J. Bacteriol., 184: 5800-5804, 2002); pNZ9520 (Kleerebezem et al., Appl. Environ. Microbiol., 63: 4581-4584, 1997); pAM401 (Fujimoto et al., Appl. Environ. Microbiol., 67: 1262-1267, 2001); and pAT392 (Arthur et al., Antimicrob. Agents Chemother., 38, 1899-1903, 1994). Expression vectors for E. faecalis using the nisA gene from Lactococcus may also be used (Eichenbaum et al., Appl. Environ. Microbiol., 64: 2763-2769, 1998). Additionally, vectors for gene replacement in the E. faecium chromosome may be used (Nallaapareddy et al., Appl. Environ. Microbiol., 72: 334-345, 2006).
Fermentation Media
[0234] Fermentation media in the present invention must contain suitable carbon substrates. Suitable substrates may include but are not limited to monosaccharides such as glucose and fructose, oligosaccharides such as lactose or sucrose, polysaccharides such as starch or cellulose or mixtures thereof and unpurified mixtures from renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt. Additionally the carbon substrate may also be one-carbon substrates such as carbon dioxide, or methanol for which metabolic conversion into key biochemical intermediates has been demonstrated. In addition to one and two carbon substrates methylotrophic microorganisms are also known to utilize a number of other carbon containing compounds such as methylamine, glucosamine and a variety of amino acids for metabolic activity. For example, methylotrophic yeast are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth C1 Compd., [Int. Symp.], 7th (1993), 415-32. (eds): Murrell, J. Collin; Kelly, Don P. Publisher: Intercept, Andover, UK). Similarly, various species of Candida will metabolize alanine or oleic acid (Sulter et al., Arch. Microbiol., 153: 485-489, 1990). Hence it is contemplated that the source of carbon utilized in the present invention may encompass a wide variety of carbon containing substrates and will only be limited by the choice of microorganism.
[0235] Although it is contemplated that all of the above mentioned carbon substrates and mixtures thereof are suitable in the present invention, preferred carbon substrates are glucose, fructose, and sucrose.
[0236] In addition to an appropriate carbon source, fermentation media must contain suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art, suitable for growth of the cultures and promotion of the enzymatic pathway necessary for isobutanol production.
Culture Conditions
[0237] Typically cells are grown at a temperature in the range of about 25 C. to about 40 C. in an appropriate medium. Suitable growth media in the present invention are common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth or Yeast Medium (YM) broth. Other defined or synthetic growth media may also be used, and the appropriate medium for growth of the particular microorganism will be known by one skilled in the art of microbiology or fermentation science. The use of agents known to modulate catabolite repression directly or indirectly, e.g., cyclic adenosine 2,3-monophosphate (cAMP), may also be incorporated into the fermentation medium.
[0238] Suitable pH ranges for the fermentation are between pH 5.0 to pH 9.0, where pH 6.0 to pH 8.0 is preferred for the initial condition.
[0239] Fermentations may be performed under aerobic or anaerobic conditions, where anaerobic or microaerobic conditions are preferred.
Industrial Batch and Continuous Fermentations
[0240] The present process employs a batch method of fermentation. A classical batch fermentation is a closed system where the composition of the medium is set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the medium is inoculated with the desired microorganism or microorganisms, and fermentation is permitted to occur without adding anything to the system. Typically, however, a batch fermentation is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. In batch systems the metabolite and biomass compositions of the system change constantly up to the time the fermentation is stopped. Within batch cultures cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die. Cells in log phase generally are responsible for the bulk of production of end product or intermediate.
[0241] A variation on the standard batch system is the Fed-Batch system. Fed-Batch fermentation processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the fermentation progresses. Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Measurement of the actual substrate concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO.sub.2. Batch and Fed-Batch fermentations are common and well known in the art and examples may be found in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass., or Deshpande, Mukund (Appl. Biochem. Biotechnol., 36: 227, 1992), herein incorporated by reference.
[0242] Although the present invention is performed in batch mode it is contemplated that the method would be adaptable to continuous fermentation methods. Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth.
[0243] Continuous fermentation allows for modulation of one factor or any number of factors that affect cell growth or end product concentration. For example, one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate. In other systems a number of factors affecting growth may be altered continuously while the cell concentration, measured by medium turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to the medium being drawn off must be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.
[0244] It is contemplated that the present invention may be practiced using either batch, fed-batch or continuous processes and that any known mode of fermentation would be suitable. Additionally, it is contemplated that cells may be immobilized on a substrate as whole cell catalysts and subjected to fermentation conditions for isobutanol production.
Methods for Isobutanol Isolation from the Fermentation Medium
[0245] Bioproduced isobutanol may be isolated from the fermentation medium using methods known in the art for ABE fermentations (see, e.g., Durre, Appl. Microbiol. Biotechnol. 49:639-648 (1998), Groot et al., Process. Biochem. 27:61-75 (1992), and references therein). For example, solids may be removed from the fermentation medium by centrifugation, filtration, decantation, or the like. Then, the isobutanol may be isolated from the fermentation medium using methods such as distillation, azeotropic distillation, liquid-liquid extraction, adsorption, gas stripping, membrane evaporation, or pervaporation.
[0246] Because isobutanol forms a low boiling point, azeotropic mixture with water, distillation can be used to separate the mixture up to its azeotropic composition. Distillation may be used in combination with another separation method to obtain separation around the azeotrope. Methods that may be used in combination with distillation to isolate and purify butanol include, but are not limited to, decantation, liquid-liquid extraction, adsorption, and membrane-based techniques. Additionally, butanol may be isolated using azeotropic distillation using an entrainer (see, e.g., Doherty and Malone, Conceptual Design of Distillation Systems, McGraw Hill, N.Y., 2001).
[0247] The butanol-water mixture forms a heterogeneous azeotrope so that distillation may be used in combination with decantation to isolate and purify the isobutanol. In this method, the isobutanol containing fermentation broth is distilled to near the azeotropic composition. Then, the azeotropic mixture is condensed, and the isobutanol is separated from the fermentation medium by decantation. The decanted aqueous phase may be returned to the first distillation column as reflux. The isobutanol-rich decanted organic phase may be further purified by distillation in a second distillation column.
[0248] The isobutanol can also be isolated from the fermentation medium using liquid-liquid extraction in combination with distillation. In this method, the isobutanol is extracted from the fermentation broth using liquid-liquid extraction with a suitable solvent. The isobutanol-containing organic phase is then distilled to separate the butanol from the solvent.
[0249] Distillation in combination with adsorption can also be used to isolate isobutanol from the fermentation medium. In this method, the fermentation broth containing the isobutanol is distilled to near the azeotropic composition and then the remaining water is removed by use of an adsorbent, such as molecular sieves (Aden et al., Lignocellulosic Biomass to Ethanol Process Design and Economics Utilizing Co-Current Dilute Acid Prehydrolysis and Enzymatic Hydrolysis for Corn Stover, Report NREL/TP-510-32438, National Renewable Energy Laboratory, June 2002).
[0250] Additionally, distillation in combination with pervaporation may be used to isolate and purify the isobutanol from the fermentation medium. In this method, the fermentation broth containing the isobutanol is distilled to near the azeotropic composition, and then the remaining water is removed by pervaporation through a hydrophilic membrane (Guo et al., J. Membr. Sci. 245, 199-210 (2004)).
[0251] In situ product removal (ISPR) (also referred to as extractive fermentation) can be used to remove butanol (or other fermentative alcohol) from the fermentation vessel as it is produced, thereby allowing the microorganism to produce butanol at high yields. One method for ISPR for removing fermentative alcohol that has been described in the art is liquid-liquid extraction. In general, with regard to butanol fermentation, for example, the fermentation medium, which includes the microorganism, is contacted with an organic extractant at a time before the butanol concentration reaches a toxic level. The organic extractant and the fermentation medium form a biphasic mixture. The butanol partitions into the organic extractant phase, decreasing the concentration in the aqueous phase containing the microorganism, thereby limiting the exposure of the microorganism to the inhibitory butanol.
[0252] Liquid-liquid extraction can be performed, for example, according to the processes described in U.S. Patent Appl. Pub. No. 2009/0305370, the disclosure of which is hereby incorporated in its entirety. U.S. Patent Appl. Pub. No. 2009/0305370 describes methods for producing and recovering butanol from a fermentation broth using liquid-liquid extraction, the methods comprising the step of contacting the fermentation broth with a water immiscible extractant to form a two-phase mixture comprising an aqueous phase and an organic phase. Typically, the extractant can be an organic extractant selected from the group consisting of saturated, mono-unsaturated, poly-unsaturated (and mixtures thereof) C.sub.12 to C.sub.22 fatty alcohols, C.sub.12 to C.sub.22 fatty acids, esters of C.sub.12 to C.sub.22 fatty acids, C.sub.12 to C.sub.22 fatty aldehydes, and mixtures thereof. The extractant(s) for ISPR can be non-alcohol extractants. The ISPR extractant can be an exogenous organic extractant such as oleyl alcohol, behenyl alcohol, cetyl alcohol, lauryl alcohol, myristyl alcohol, stearyl alcohol, 1-undecanol, oleic acid, lauric acid, myristic acid, stearic acid, methyl myristate, methyl oleate, undecanal, lauric aldehyde, 20-methylundecanal, and mixtures thereof.
[0253] In some embodiments, the alcohol can be formed by contacting the alcohol in a fermentation medium with an organic acid (e.g., fatty acids) and a catalyst capable of esterifying the alcohol with the organic acid. In such embodiments, the organic acid can serve as an ISPR extractant into which the alcohol esters partition. The organic acid can be supplied to the fermentation vessel and/or derived from the biomass supplying fermentable carbon fed to the fermentation vessel. Lipids present in the feedstock can be catalytically hydrolyzed to organic acid, and the same catalyst (e.g., enzymes) can esterify the organic acid with the alcohol. The catalyst can be supplied to the feedstock prior to fermentation, or can be supplied to the fermentation vessel before or contemporaneously with the supplying of the feedstock. When the catalyst is supplied to the fermentation vessel, alcohol esters can be obtained by hydrolysis of the lipids into organic acid and substantially simultaneous esterification of the organic acid with butanol present in the fermentation vessel. Organic acid and/or native oil not derived from the feedstock can also be fed to the fermentation vessel, with the native oil being hydrolyzed into organic acid. Any organic acid not esterified with the alcohol can serve as part of the ISPR extractant. The extractant containing alcohol esters can be separated from the fermentation medium, and the alcohol can be recovered from the extractant. The extractant can be recycled to the fermentation vessel. Thus, in the case of butanol production, for example, the conversion of the butanol to an ester reduces the free butanol concentration in the fermentation medium, shielding the microorganism from the toxic effect of increasing butanol concentration. In addition, unfractionated grain can be used as feedstock without separation of lipids therein, since the lipids can be catalytically hydrolyzed to organic acid, thereby decreasing the rate of build-up of lipids in the ISPR extractant.
[0254] In situ product removal can be carried out in a batch mode or a continuous mode. In a continuous mode of in situ product removal, product is continually removed from the reactor. In a batchwise mode of in situ product removal, a volume of organic extractant is added to the fermentation vessel and the extractant is not removed during the process. For in situ product removal, the organic extractant can contact the fermentation medium at the start of the fermentation forming a biphasic fermentation medium. Alternatively, the organic extractant can contact the fermentation medium after the microorganism has achieved a desired amount of growth, which can be determined by measuring the optical density of the culture. Further, the organic extractant can contact the fermentation medium at a time at which the product alcohol level in the fermentation medium reaches a preselected level. In the case of butanol production according to some embodiments of the present invention, the organic acid extractant can contact the fermentation medium at a time before the butanol concentration reaches a toxic level, so as to esterify the butanol with the organic acid to produce butanol esters and consequently reduce the concentration of butanol in the fermentation vessel. The ester-containing organic phase can then be removed from the fermentation vessel (and separated from the fermentation broth which constitutes the aqueous phase) after a desired effective titer of the butanol esters is achieved. In some embodiments, the ester-containing organic phase is separated from the aqueous phase after fermentation of the available fermentable sugar in the fermentation vessel is substantially complete.
Isobutanol Production
[0255] As described and demonstrated herein, Applicants have discovered KARI enzyme variants suited for use in isobutanol production pathways.
[0256] In embodiments, isobutanol production employing such a variant may provide reduced glycerol accumulation. In embodiments, the molar ratio of isobutanol to glycerol is increased for a variant of a polypeptide having KARI activity described above with K.sub.M for NADH lower than that of the unsubstituted polypeptide. In embodiments, the molar ratio of isobutanol to glycerol is greater than 1. In embodiments, the molar ratio of isobutanol to glycerol is greater than 2. In embodiments, the molar ratio is greater than 3. In embodiments, the molar ratio is greater than 4, greater than 5, greater than 6, greater than 7, greater than 8, greater than 9, greater than 10, greater than 12, or greater than 14. In embodiments, the molar ratio is in the range of about 1 to 5, about 1 to 10, about 2 to 8, about 5 to 10, about 5 to 15 about 10 to 15 or about 12 to 15.
EXAMPLES
[0257] The present invention is further defined in the following Examples. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various uses and conditions.
General Methods:
[0258] Materials and methods suitable for the maintenance and growth of bacterial cultures are also well known in the art. Techniques suitable for use in the following Examples may be found in Manual of Methods for General Bacteriology, Phillipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips, eds., American Society for Microbiology, Washington, D C., 1994, or by Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition, Sinauer Associates, Inc., Sunderland, Mass., 1989. All reagents, restriction enzymes and materials used for the growth and maintenance of bacterial cells were obtained from Aldrich Chemicals (Milwaukee, Wis.), BD Diagnostic Systems (Sparks, Md.), Life Technologies (Rockville, Md.), or Sigma Chemical Company (St. Louis, Mo.), unless otherwise specified.
[0259] The meaning of abbreviations used is as follows: A means Angstrom, min means minute(s), h means hour(s), l means microliter(s), ng/l means nano gram per microliter, pmol/l means pico mole per microliter, ml means milliliter(s), L means liter(s), g/L mean gram per liter, ng means nano gram, sec means second(s), ml/min means milliliter per minute(s), w/v means weight per volume, v/v means volume per volume, nm means nanometer(s), mm means millimeter(s), cm means centimeter(s), mM means millimolar, M means molar, g means gram(s), g means microgram(s), mg means milligram(s), g means the gravitation constant, rpm means revolutions per minute, HPLC means high performance liquid chromatography, MS means mass spectrometry, HPLC/MS means high performance liquid chromatography/mass spectrometry, EDTA means ethylendiamine-tetraacetic acid, dNTP means deoxynucleotide triphosphate, C. means degrees Celsius, and V means voltage.
[0260] The numbering of the positions of substitutions given in the Examples is based on the full-length Anaerostipes caccae KARI sequence (SEQ ID NO: 93).
Construction of Strains PNY2068 and PNY2115 Used in the Examples
[0261] Saccharomyces cerevisiae strain PNY0827 is used as the host cell for further genetic manipulation for PNY2068 and PNY2115. PNY0827 refers to a strain derived from Saccharomyces cerevisiae which has been deposited at the ATCC under the Budapest Treaty on Sep. 22, 2011 at the American Type Culture Collection, Patent Depository 10801 University Boulevard, Manassas, Va. 20110-2209 and has the patent deposit designation PTA-12105.
Deletion of URA3 and Sporulation into Haploids
[0262] In order to delete the endogenous URA3 coding region, a deletion cassette was PCR-amplified from pLA54 (SEQ ID NO: 1) which contains a P.sub.TEF1-kanMX4-TEF1t cassette flanked by loxP sites to allow homologous recombination in vivo and subsequent removal of the KANMX4 marker. FOR was done by using Phusion High Fidelity FOR Master Mix (New England BioLabs; Ipswich, Mass.) and primers BK505 (SEQ ID NO: 2) and BK506 (SEQ ID NO: 3). The URA3 portion of each primer was derived from the 5 region 180 bp upstream of the URA3 ATG and 3 region 78 bp downstream of the coding region such that integration of the kanMX4 cassette results in replacement of the URA3 coding region. The PCR product was transformed into PNY0827 using standard genetic techniques (Methods in Yeast Genetics, 2005, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pp. 201-202) and transformants were selected on YEP medium supplemented 2% glucose and 100 g/ml Geneticin at 30 C. Transformants were screened by colony PCR with primers LA468 (SEQ ID NO: 4) and LA492 (SEQ ID NO: 5) to verify presence of the integration cassette. A heterozygous diploid was obtained: NYLA98, which has the genotype MATa/ URA3/ura3::loxP-kanMX4-loxP. To obtain haploids, NYLA98 was sporulated using standard methods (Codn A C, Gasent-Ramirez J M, Benitez T. Factors which affect the frequency of sporulation and tetrad formation in Saccharomyces cerevisiae baker's yeast. Appl Environ Microbiol. 1995 PMID: 7574601). Tetrads were dissected using a micromanipulator and grown on rich YPE medium supplemented with 2% glucose. Tetrads containing four viable spores were patched onto synthetic complete medium lacking uracil supplemented with 2% glucose, and the mating type was verified by multiplex colony PCR using primers AK109-1 (SEQ ID NO: 6), AK109-2 (SEQ ID NO: 7), and AK109-3 (SEQ ID NO: 8). The resulting indentified haploid strain called NYLA103, which has the genotype: MATa ura3::loxP-kanMX4-loxP, and NYLA106, which has the genotype: MATa ura3::loxP-kanMX4-loxP.
Deletion of His3
[0263] To delete the endogenous HIS3 coding region, a scarless deletion cassette was used. The four fragments for the FOR cassette for the scarless HIS3 deletion were amplified using Phusion High Fidelity FOR Master Mix (New England BioLabs; Ipswich, Mass.) and CEN.PK 113-7D genomic DNA as template, prepared with a Gentra Puregene Yeast/Bact kit (Qiagen, Valencia, Calif.). HIS3 Fragment A was amplified with primer oBP452 (SEQ ID NO: 9) and primer oBP453 (SEQ ID NO: 10), containing a 5 tail with homology to the 5 end of HIS3 Fragment B. HIS3 Fragment B was amplified with primer oBP454 (SEQ ID NO: 11), containing a 5 tail with homology to the 3 end of HIS3 Fragment A, and primer oBP455 (SEQ ID NO: 12) containing a 5 tail with homology to the 5 end of HIS3 Fragment U. HIS3 Fragment U was amplified with primer oBP456 (SEQ ID NO: 13), containing a 5 tail with homology to the 3 end of HIS3 Fragment B, and primer oBP457 (SEQ ID NO: 14), containing a 5 tail with homology to the 5 end of HIS3 Fragment C. HIS3 Fragment C was amplified with primer oBP458 (SEQ ID NO: 15), containing a 5 tail with homology to the 3 end of HIS3 Fragment U, and primer oBP459 (SEQ ID NO: 16). FOR products were purified with a FOR Purification kit (Qiagen). HIS3 Fragment AB was created by overlapping FOR by mixing HIS3 Fragment A and HIS3 Fragment B and amplifying with primers oBP452 (SEQ ID NO: 9) and oBP455 (SEQ ID NO: 12). HIS3 Fragment UC was created by overlapping FOR by mixing HIS3 Fragment U and HIS3 Fragment C and amplifying with primers oBP456 (SEQ ID NO: 13) and oBP459 (SEQ ID NO: 16). The resulting FOR products were purified on an agarose gel followed by a Gel Extraction kit (Qiagen). The HIS3 ABUC cassette was created by overlapping FOR by mixing HIS3 Fragment AB and HIS3 Fragment UC and amplifying with primers oBP452 (SEQ ID NO: 9) and oBP459 (SEQ ID NO: 16). The PCR product was purified with a FOR Purification kit (Qiagen). Competent cells of NYLA106 were transformed with the HIS3 ABUC FOR cassette and were plated on synthetic complete medium lacking uracil supplemented with 2% glucose at 30 C. Transformants were screened to verify correct integration by replica plating onto synthetic complete medium lacking histidine and supplemented with 2% glucose at 30 C. Genomic DNA preps were made to verify the integration by FOR using primers oBP460 (SEQ ID NO: 17) and LA135 (SEQ ID NO: 18) for the Send and primers oBP461 (SEQ ID NO: 19) and LA92 (SEQ ID NO: 20) for the 3 end. The URA3 marker was recycled by plating on synthetic complete medium supplemented with 2% glucose and 5-FOA at 30 C. following standard protocols. Marker removal was confirmed by patching colonies from the 5-FOA plates onto SD-URA medium to verify the absence of growth. The resulting identified strain, called PNY2003 has the genotype: MATa ura3::loxP-kanMX4-loxP his3.
Deletion of PDC1
[0264] To delete the endogenous PDC1 coding region, a deletion cassette was PCR-amplified from pLA59 (SEQ ID NO: 21), which contains a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using Phusion High Fidelity FOR Master Mix (New England BioLabs; Ipswich, Mass.) and primers LA678 (SEQ ID NO: 22) and LA679 (SEQ ID NO: 23). The PDC1 portion of each primer was derived from the 5 region 50 bp downstream of the PDC1 start codon and 3 region 50 bp upstream of the stop codon such that integration of the URA3 cassette results in replacement of the PDC1 coding region but leaves the first 50 bp and the last 50 bp of the coding region. The PCR product was transformed into PNY2003 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 2% glucose at 30 C. Transformants were screened to verify correct integration by colony FOR using primers LA337 (SEQ ID NO: 24), external to the 5 coding region and LA135 (SEQ ID NO: 18), an internal primer to URA3. Positive transformants were then screened by colony FOR using primers LA692 (SEQ ID NO: 25) and LA693 (SEQ ID NO: 26), internal to the PDC1 coding region. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 2% glucose at 30 C. Transformants were plated on rich medium supplemented with 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 2% glucose to verify absence of growth. The resulting identified strain, called PNY2008 has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66.
Deletion of PDC5
[0265] To delete the endogenous PDC5 coding region, a deletion cassette was PCR-amplified from pLA59 (SEQ ID NO: 21), which contains a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using Phusion High Fidelity FOR Master Mix (New England BioLabs; Ipswich, Mass.) and primers LA722 (SEQ ID NO: 28) and LA733 (SEQ ID NO: 29). The PDC5 portion of each primer was derived from the 5 region 50 bp upstream of the PDC5 start codon and 3 region 50 bp downstream of the stop codon such that integration of the URA3 cassette results in replacement of the entire PDC5 coding region. The PCR product was transformed into PNY2008 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers LA453 (SEQ ID NO: 30), external to the 5 coding region and LA135 (SEQ ID NO: 18), an internal primer to URA3. Positive transformants were then screened by colony FOR using primers LA694 (SEQ ID NO: 31) and LA695 (SEQ ID NO: 32), internal to the PDC5 coding region. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich YEP medium supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2009 has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66 pdc5::loxP71/66.
Deletion of FRA2
[0266] The FRA2 deletion was designed to delete 250 nucleotides from the 3 end of the coding sequence, leaving the first 113 nucleotides of the FRA2 coding sequence intact. An in-frame stop codon was present 7 nucleotides downstream of the deletion. The four fragments for the FOR cassette for the scarless FRA2 deletion were amplified using Phusion High Fidelity FOR Master Mix (New England BioLabs; Ipswich, Mass.) and CEN.PK 113-7D genomic DNA as template, prepared with a Gentra Puregene Yeast/Bact kit (Qiagen, Valencia, Calif.). FRA2 Fragment A was amplified with primer oBP594 (SEQ ID NO: 33) and primer oBP595 (SEQ ID NO: 34), containing a 5 tail with homology to the 5 end of FRA2 Fragment B. FRA2 Fragment B was amplified with primer oBP596 (SEQ ID NO: 35), containing a 5 tail with homology to the 3 end of FRA2 Fragment A, and primer oBP597 (SEQ ID NO: 36), containing a 5 tail with homology to the 5 end of FRA2 Fragment U. FRA2 Fragment U was amplified with primer oBP598 (SEQ ID NO: 37), containing a 5 tail with homology to the 3 end of FRA2 Fragment B, and primer oBP599 (SEQ ID NO: 38), containing a 5 tail with homology to the 5 end of FRA2 Fragment C. FRA2 Fragment C was amplified with primer oBP600 (SEQ ID NO: 39), containing a 5 tail with homology to the 3 end of FRA2 Fragment U, and primer oBP601 (SEQ ID NO: 40). FOR products were purified with a FOR Purification kit (Qiagen). FRA2 Fragment AB was created by overlapping FOR by mixing FRA2 Fragment A and FRA2 Fragment B and amplifying with primers oBP594 (SEQ ID NO: 33) and oBP597 (SEQ ID NO: 36). FRA2 Fragment UC was created by overlapping FOR by mixing FRA2 Fragment U and FRA2 Fragment C and amplifying with primers oBP598 (SEQ ID NO: 37) and oBP601 (SEQ ID NO: 40). The resulting FOR products were purified on an agarose gel followed by a Gel Extraction kit (Qiagen). The FRA2 ABUC cassette was created by overlapping FOR by mixing FRA2 Fragment AB and FRA2 Fragment UC and amplifying with primers oBP594 (SEQ ID NO: 33) and oBP601 (SEQ ID NO: 40). The PCR product was purified with a FOR Purification kit (Qiagen).
[0267] To delete the endogenous FRA2 coding region, the scarless deletion cassette obtained above was transformed into PNY2009 using standard techniques and plated on synthetic complete medium lacking uracil and supplemented with 1% ethanol. Genomic DNA preps were made to verify the integration by FOR using primers oBP602 (SEQ ID NO: 41) and LA135 (SEQ ID NO: 18) for the Send, and primers oBP602 (SEQ ID NO: 41) and oBP603 (SEQ ID NO: 42) to amplify the whole locus. The URA3 marker was recycled by plating on synthetic complete medium supplemented with 1% ethanol and 5-FOA (5-Fluoroorotic Acid) at 30 C. following standard protocols. Marker removal was confirmed by patching colonies from the 5-FOA plates onto synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify the absence of growth. The resulting identified strain, PNY2037, has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66 pdc5::loxP71/66 fra2.
Addition of Native 2 Micron Plasmid
[0268] The loxP71-URA3-loxP66 marker was PCR-amplified using Phusion DNA polymerase (New England BioLabs; Ipswich, Mass.) from pLA59 (SEQ ID NO: 29), and transformed along with the LA811817 (SEQ ID NOs: 43, 44) and LA812818 (SEQ ID NOs: 45, 46) 2-micron plasmid fragments (amplified from the native 2-micron plasmid from CEN.PK 113-7D, Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversity Centre) into strain PNY2037 on SE-URA plates at 30 C. The resulting strain PNY2037 2::loxP71-URA3-loxP66 was transformed with pLA34 (pRS423::cre) (also called, pLA34) (SEQ ID NO: 27) and selected on SE HIS URA plates at 30 C. Transformants were patched onto YP-1% galactose plates and allowed to grow for 48 hrs at 30 C. to induce Ore recombinase expression. Individual colonies were then patched onto SE URA, SE HIS, and YPE plates to confirm URA3 marker removal. The resulting identified strain, PNY2050, has the genotype: MATa ura3::loxP-kanMX4-loxP, his3 pdc1::loxP71/66 pdc5::loxP71/66 fra2 2-micron.
Construction of PNY2068 from PNY2050
[0269] PNY2068 [MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66 pdc5::loxP71/66 fra2 2-micron gpd2 ymr226c::P.sub.FBA1-alsS_Bs-CYC1t-loxP71/66 ald6::(UAS)PGK1-P.sub.FBA1-kivD_Lg-TDH3t-loxP71/66 adh1::P.sub.ILV5-ADH_Bi(y)-ADH1t-loxP71/66 pdc1::P.sub.PDC1-ADH_Bi(y)-ADH1t-loxP71/66] was constructed as follows from PNY2050.
Deletion of GPD2
[0270] To delete the endogenous GPD2 coding region, a deletion cassette was PCR-amplified from pLA59 (SEQ ID NO: 21), which contains a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using Phusion High Fidelity FOR Master Mix (New England BioLabs; Ipswich, Mass.) and primers LA512 (SEQ ID NO: 47) and LA513 (SEQ ID NO: 48). The GPD2 portion of each primer was derived from the 5 region 50 bp upstream of the GPD2 start codon and 3 region 50 bp downstream of the stop codon such that integration of the URA3 cassette results in replacement of the entire GPD2 coding region. The PCR product was transformed into PNY2050 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers LA516 (SEQ ID NO: 49), external to the 5 coding region and LA135 (SEQ ID NO: 18), internal to URA3. Positive transformants were then screened by colony FOR using primers LA514 (SEQ ID NO: 50) and LA515 (SEQ ID NO: 51), internal to the GPD2 coding region. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich medium supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, PNY2056, has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66 pdc5::loxP71/66 fra2 2-micron gpd2.
Deletion of YMR226 and integration of AlsS
[0271] To delete the endogenous YMR226C coding region, an integration cassette was PCR-amplified from pLA71 (SEQ ID NO: 52), which contains the gene acetolactate synthase from the species Bacillus subtilis with a FBA1 promoter and a CYC1 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using KAPA HiFi from Kapa Biosystems, Woburn, Mass. and primers LA829 (SEQ ID NO: 53) and LA834 (SEQ ID NO: 54). The YMR226C portion of each primer was derived from the first 60 bp of the coding sequence and 65 bp that are 409 bp upstream of the stop codon. The PCR product was transformed into PNY2056 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers N1257 (SEQ ID NO: 55), external to the 5 coding region and LA740 (SEQ ID NO: 61), internal to the FBA1 promoter. Positive transformants were then screened by colony FOR using primers N1257 (SEQ ID NO: 55) and LA830 (SEQ ID NO: 56), internal to the YMR226C coding region, and primers LA830 (SEQ ID NO: 56), external to the 3 coding region, and LA92 (SEQ ID NO: 20), internal to the URA3 marker. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich medium supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, PNY2061, has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66 pdc5::loxP71/66 fra2 2-micron gpd2 ymr226c::P.sub.FBA1-alsS_Bs-CYC1t-loxP71/66.
Deletion of ALD6 and Integration of KivD
[0272] To delete the endogenous ALD6 coding region, an integration cassette was PCR-amplified from pLA78 (SEQ ID NO: 57), which contains the kivD gene from the species Listeria grayi with a hybrid FBA1 promoter and a TDH3 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using KAPA HiFi from Kapa Biosystems, Woburn, Mass. and primers LA850 (SEQ ID NO: 58) and LA851 (SEQ ID NO: 59). The ALD6 portion of each primer was derived from the first 65 bp of the coding sequence and the last 63 bp of the coding region. The PCR product was transformed into PNY2061 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers N1262 (SEQ ID NO: 60), external to the 5 coding region and LA740 (SEQ ID NO: 61), internal to the FBA1 promoter. Positive transformants were then screened by colony FOR using primers N1263 (SEQ ID NO: 62), external to the 3 coding region, and LA92 (SEQ ID NO: 20), internal to the URA3 marker. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich medium supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, PNY2065, has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66 pdc5::loxP71/66 fra2 2-micron gpd2 ymr226c::P.sub.FBA1-alsS_Bs-CYC1t-loxP71/66 ald6::(UAS)PGK1-P.sub.FBA1-kivD_Lg-TDH3t-loxP71.
Deletion of ADH1 and Integration of ADH
[0273] ADH1 is the endogenous alcohol dehydrogenase present in Saccharomyces cerevisiae. As described below, the endogenous ADH1 was replaced with alcohol dehydrogenase (ADH) from Beijerinckii indica.
[0274] To delete the endogenous ADH1 coding region, an integration cassette was PCR-amplified from pLA65 (SEQ ID NO: 63), which contains the alcohol dehydrogenase from the species Beijerinckii indica with an ILV5 promoter and a ADH1 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using KAPA HiFi from Kapa Biosystems, Woburn, Mass. and primers LA855 (SEQ ID NO: 64) and LA856 (SEQ ID NO: 65). The ADH1 portion of each primer was derived from the 5 region 50 bp upstream of the ADH1 start codon and the last 50 bp of the coding region. The PCR product was transformed into PNY2065 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers LA414 (SEQ ID NO: 66), external to the 5 coding region and LA749 (SEQ ID NO: 67), internal to the ILV5 promoter. Positive transformants were then screened by colony FOR using primers LA413 (SEQ ID NO: 68), external to the 3 coding region, and LA92 (SEQ ID NO: 20), internal to the URA3 marker. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich medium supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2066 has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66 pdc5::loxP71/66 fra2 2-micron gpd2 ymr226c::P.sub.FBA1-alsS_Bs-CYC1t-loxP71/66 ald6::(UAS)PGK1-P.sub.FBA1-kivD_Lg-TDH3t-loxP71/66 adh1::P.sub.ILV5-ADH_Bi(y)-ADH/t-loxP71/66.
Integration of ADH into pdc1 Locus
[0275] To integrate an additional copy of ADH at the pdc1 region, an integration cassette was PCR-amplified from pLA65 (SEQ ID NO: 63), which contains the alcohol dehydrogenase from the species Beijerinckii indica with an ADH1 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using KAPA HiFi from Kapa Biosystems, Woburn, Mass. and primers LA860 (SEQ ID NO: 69) and LA679 (SEQ ID NO: 23). The PDC1 portion of each primer was derived from the 5 region 60 bp upstream of the PDC1 start codon and 50 bp that are 103 bp upstream of the stop codon. The endogenous PDC1 promoter was used. The PCR product was transformed into PNY2066 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers LA337 (SEQ ID NO: 24), external to the 5 coding region and N1093 (SEQ ID NO: 70), internal to the BiADH gene. Positive transformants were then screened by colony FOR using primers LA681 (SEQ ID NO: 71), external to the 3 coding region, and LA92 (SEQ ID NO: 20), internal to the URA3 marker. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich medium supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain was called PNY2068 and has the genotype: MATa ura3::loxP-kanMX4-loxP his3 pdc1::loxP71/66 pdc5::loxP71/66 fra2 2-micron gpd2 ymr226c::P.sub.FBA1-alsS_Bs-CYC1t-loxP71/66 ald6::(UAS)PGK1-P.sub.FBA1-kivD_Lg-TDH3t-loxP71/66 adh1::P.sub.ILV5-ADH_Bi(y)-ADH1t-loxP71/66 pdc1::P.sub.PDC1-ADH_Bi(y)-ADH1t-loxP71/66.
Construction of PNY2115 from PNY2050
[0276] Construction of PNY2115 [MATa ura3::loxP his38 pdc5::loxP66/71 fra2 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66] from PNY2050 was as follows.
pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66
[0277] To integrate alsS into the pdc1::loxP66/71 locus of PNY2050 using the endogenous PDC1 promoter, An integration cassette was PCR-amplified from pLA71 (SEQ ID NO: 52), which contains the gene acetolactate synthase from the species Bacillus subtilis with a FBA1 promoter and a CYC1 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using KAPA HiFi and primers 895 (SEQ ID NO: 72) and 679 (SEQ ID NO: 73). The PDC1 portion of each primer was derived from 60 bp of the upstream of the coding sequence and 50 bp that are 53 bp upstream of the stop codon. The PCR product was transformed into PNY2050 using standard genetic techniques and transformants were selected on synthetic complete media lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers 681 (SEQ ID NO: 74), external to the 3 coding region and 92 (SEQ ID NO: 75), internal to the URA3 gene. Positive transformants were then prepped for genomic DNA and screened by FOR using primers N245 (SEQ ID NO: 76) and N246 (SEQ ID NO: 77). The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete media lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich media supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete media lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2090 has the genotype MATa his3A, pdc1::loxP71/66, pdc5::loxP71/66 fra2 2-micron pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66.
pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66
[0278] To delete the endogenous PDC6 coding region, an integration cassette was PCR-amplified from pLA78 (SEQ ID NO: 57), which contains the kivD gene from the species Listeria grayi with a hybrid FBA1 promoter and a TDH3 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using KAPA HiFi and primers 896 (SEQ ID NO: 78) and 897 (SEQ ID NO: 79). The PDC6 portion of each primer was derived from 60 bp upstream of the coding sequence and 59 bp downstream of the coding region. The PCR product was transformed into PNY2090 using standard genetic techniques and transformants were selected on synthetic complete media lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers 365 (SEQ ID NO: 80) and 366 (SEQ ID NO: 81), internal primers to the PDC6 gene. Transformants with an absence of product were then screened by colony FOR N638 (SEQ ID NO: 82), external to the 5 end of the gene, and 740 (SEQ ID NO: 83), internal to the FBA1 promoter. Positive transformants were than the prepped for genomic DNA and screened by FOR with two external primers to the PDC6 coding sequence. Positive integrants would yield a 4720 bp product, while PDC6 wild type transformants would yield a 2130 bp product. The URA3 marker was recycled by transforming with pLA34 containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete media lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich media supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete media lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain is called PNY2093 and has the genotype MATa ura3::loxP his38 pdc5::loxP71/66 fra2 2-micron pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66.
adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66
[0279] To delete the endogenous ADH1 coding region and integrate BiADH using the endogenous ADH1 promoter, an integration cassette was PCR-amplified from pLA65 (SEQ ID NO: 63), which contains the alcohol dehydrogenase from the species Beijerinckii with an ILV5 promoter and a ADH1 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using KAPA HiFi and primers 856 (SEQ ID NO: 84) and 857 (SEQ ID NO: 85). The ADH1 portion of each primer was derived from the 5 region 50 bp upstream of the ADH1 start codon and the last 50 bp of the coding region. The PCR product was transformed into PNY2093 using standard genetic techniques and transformants were selected on synthetic complete media lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers BK415 (SEQ ID NO: 86), external to the 5 coding region and N1092 (SEQ ID NO: 87), internal to the BiADH gene. Positive transformants were then screened by colony FOR using primers 413 (SEQ ID NO: 88), external to the 3 coding region, and 92 (SEQ ID NO: 75), internal to the URA3 marker. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete media lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich media supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete media lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2101 has the genotype MATa ura3::loxP his38 pdc5::loxP71/66 fra2 2-micron pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66.
fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66
[0280] To integrate BiADH into the fra2locus of PNY2101, an integration cassette was PCR-amplified from pLA65 (SEQ ID NO: 63), which contains the alcohol dehydrogenase from the species Beijerinckii indica with an ILV5 promoter and an ADH1 terminator, and a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using KAPA HiFi and primers 906 (SEQ ID NO: 89) and 907 (SEQ ID NO: 90). The FRA2 portion of each primer was derived from the first 60 bp of the coding sequence starting at the ATG and 56 bp downstream of the stop codon. The PCR product was transformed into PNY2101 using standard genetic techniques and transformants were selected on synthetic complete media lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers 667 (SEQ ID NO: 91), external to the 5 coding region and 749 (SEQ ID NO: 92), internal to the ILV5 promoter. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete media lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich media supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete media lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2110 has the genotype MATa ura3::loxP his38 pdc5::loxP66/71 2-micron pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66.
GPD2 Deletion
[0281] To delete the endogenous GPD2 coding region, a deletion cassette was FOR amplified from pLA59 (SEQ ID NO: 21), which contains a URA3 marker flanked by degenerate loxP sites to allow homologous recombination in vivo and subsequent removal of the URA3 marker. FOR was done by using KAPA HiFi and primers LA512 (SEQ ID NO: 47) and LA513 (SEQ ID NO: 48). The GPD2 portion of each primer was derived from the 5region 50 bp upstream of the GPD2 start codon and 3 region 50 bp downstream of the stop codon such that integration of the URA3 cassette results in replacement of the entire GPD2 coding region. The PCR product was transformed into PNY2110 using standard genetic techniques and transformants were selected on synthetic complete medium lacking uracil and supplemented with 1% ethanol at 30 C. Transformants were screened to verify correct integration by colony FOR using primers LA516 (SEQ ID NO: 49) external to the 5 coding region and LA135 (SEQ ID NO: 18), internal to URA3. Positive transformants were then screened by colony FOR using primers LA514 (SEQ ID NO: 50) and LA515 (SEQ ID NO: 51), internal to the GPD2 coding region. The URA3 marker was recycled by transforming with pLA34 (SEQ ID NO: 27) containing the CRE recombinase under the GAL1 promoter and plated on synthetic complete medium lacking histidine and supplemented with 1% ethanol at 30 C. Transformants were plated on rich medium supplemented with 1% ethanol and 0.5% galactose to induce the recombinase. Marker removal was confirmed by patching colonies to synthetic complete medium lacking uracil and supplemented with 1% ethanol to verify absence of growth. The resulting identified strain, called PNY2115, has the genotype MATa ura3::loxP his38 pdc5::loxP66/71 fra2 2-micron pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66.
Example 1
Combinatorial Mutagenesis of K9SB2 SH at Positions 90 and 93 to Generate K9YW Library
[0282] Positions 90 and 93 (numbering is based on the full length KARI enzyme from Anaerostipes caccae, SEQ ID NO: 93) were selected for combinatorial mutagenesis of Anaerostipes caccae KARI variant K9SB2_SH (SEQ ID NO: 94). Substitutions at these positions were observed previously in screens of an K9SB2 ePCR library. A set of variants containing each possible combination of Lys, Ala, Met, Leu, or Tyr at position 90 with Thr, Leu, Ile, Val, or Ala at position 93 was generated. The 25 variants were prepared via sequential mutagenesis at positions 90 and 93 with K9SB2_SH_DHAD (SEQ ID NO: 95) as the initial template. Both mutagenesis procedures were initiated via a PCR step with a mix of mutagenic primers followed by a second reaction employing the PCR product as a megaprimer.
[0283] The PCR reaction for mutagenesis at position 90 was performed with PFUultra polymerase (Catalog #600380; Agilent Technologies, Stratagene Products Division, La Jolla, Calif.). The primers in the mix (Table 1; Position 90) and primer SB2_r1 (TGG ACC GGT AAT GTA GTC ACC; SEQ ID NO: 96) were commercially synthesized by Integrated DNA Technologies, Inc (Coralville Iowa). The PCR reaction consisted of 1 l of K9SB2_SH-DHAD (SEQ ID NO: 95) (50 ng/l), 4 l of 90mix (10 uM), 4 ul SB2_r1 (10 uM), 10 ul of 10 PFUultra buffer, 1 l of 10 mM dNTP mix, 1 l of PFUultra DNA polymerase, and 34 l of ddH.sub.2O. The following conditions were used for the PCR reaction: The starting temperature was 95 C. for 2.0 min followed by 35 heating/cooling cycles. Each cycle consisted of 95 C. for 30 sec, 55 C. for 30 sec, and 68 C. for 30 sec. At the completion of the temperature cycling, the sample was kept at 68 C. for 10.0 min more, and then held awaiting sample recovery at 4 C. The reaction product was separated from the template via agarose gel electrophoresis (1% agarose, 1TBE buffer) and recovered using the illustra GFX PCR DNA and Gel Band Purification kit (Cat#28-9034-70, GE Healthcare Life Sciences, Piscataway, N.J.) as recommended by the manufacturer.
TABLE-US-00009 TABLE1 PrimersforCombinatorialMutagenesis ForwardPrimerSetforPosition90 SB2_K90(native): Cccagatgaaaagcaggctaccatgtacaaaaacg (SEQIDNO:97) SB2_K90M_f: Cccagatgaaatgcaggctaccatgtacaaaaacg (SEQIDNO:98) SB2_K90L_f: Cccagatgaattgcaggctaccatgtacaaaaacg (SEQIDNO:99) SB2_K90Y_f: Cccagatgaataccaggctaccatgtacaaaaacg (SEQIDNO:100) SB2_K90A_f: Cccagatgaagctcaggctaccatgtacaaaaacg (SEQIDNO:101) ForwardPrimerSetforPosition93 SB2_T93(native): caggctaccatgtacaaaaacgacatcgaacc (SEQIDNO:102) SB2_T93I_f: caggctatcatgtacaaaaacgacatcgaacc (SEQIDNO:103) SB2_T93A_f: caggctgctatgtacaaaaacgacatcgaacc (SEQIDNO:104) SB2_T93L__f: caggctttgatgtacaaaaacgacatcgaacc (SEQIDNO:105) SB2_T93V_f: caggctgttatgtacaaaaacgacatcgaacc (SEQIDNO:106)
[0284] The isolated reaction product was employed as a megaprimer to generate the set of position 90 variants employing the QuikChange Lightning Site-Directed Mutagenesis Kit (Catalog #200523, Agilent Technologies, Stratagene Products Division, La Jolla, Calif.). Except for the primers, templates, and ddH.sub.2O, all reagents used here were supplied with the kit. The reaction mixture contained 1 l K9SB2_SH_DHAD (50 ng/l), 4 l of K90 megaprimer, 5 l of 10 reaction buffer, 1 l of dNTP mix, 1.5 ul QuikSolution, 1 ul QuikChange Lightning Enzyme, and 37.5 l of ddH.sub.2O. The following conditions were used for the reactions: The starting temperature was 95 C. for 2 min followed by 18 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 14 min. At the completion of the temperature cycling, the samples incubated at 68 C. for 7 min and then held awaiting sample recovery at 4 C. 2 l of the Dpn I (10 U/l) was added to each reaction and the mixtures were incubated for 5 min at 37 C.
[0285] 4 l of each mutagenic reaction was transformed into One Shot Top10 Chemically Competent E. coli (Invitrogen, Catalog # C404003) on agar plates containing the LB medium and 100 g/ml ampicillin (Cat#L1004, Teknova Inc. Hollister, Calif.) and incubated at 37 C. overnight. Multiple transformants were then selected for TempliPhi (GE Healthcare) based DNA sequencing employing primers pHR81-F (ACACCCAGTATTTTCCCTTTCC, SEQ ID NO: 107) and pHR81-Rev (CTA GTG TAC AGA TGT ATG TCG G, SEQ ID NO: 108). Transformants with confirmed KARI sequences were inoculated into LB medium containing 100 g/ml ampicillin and incubated at 37 C. with shaking at 225 rpm. Plasmid DNA was isolated from the cells with the QIAprep Spin Miniprep Kit (Catalog #2706, Qiagen, Valencia, Calif.) according to the protocol provided by the manufacturer. Clones were combined into a K90 plasmid mix.
[0286] The PCR reaction for mutagenesis at position 93 was performed as described above with modifications. The primers in 93 mix (Table 1) were commercially synthesized by Integrated DNA Technologies, Inc (Coralville Iowa). The PCR reaction consisted of 1 l of K9SB2_SH-DHAD (SEQ ID NO: 95) (50 ng/l), 4 l of 93mix (10 uM), 4 ul SB2_11, 10 ul of 10PFU ultra reaction buffer, 1 l of 10 mM dNTP mix, 1 l of PFUultra DNA polymerase, and 34 l of ddH.sub.2O. The subsequent reaction employing the QuikChange Lightning Site-Directed Mutagenesis Kit was performed as described above with modifications. The reaction mixture contained 1 l K90 plasmid mix (50 ng/l), 4 l of K90 megaprimer, 5 l of 10 reaction buffer, 1 l of dNTP mix, 1.5 ul QuikSolution, 1 ul QuikChange Lightning Enzyme, and 37.5 l of ddH.sub.2O.
[0287] Following the two mutagenesis steps and templiphi-based DNA sequencing, plasmids for 25 variants were isolated and DNA sequences reconfirmed. The amino acid substitutions for variants are provided in Table 2.
TABLE-US-00010 TABLE 2 KARI variants in K9YW Library Amino Acid Variant Position 90 Position 93 SEQ ID NO: K9YW1 K T 94 (K9SB2_SH) K9YW2 K I 109 K9YW3 K A 110 K9YW4 K V 111 K9YW5 K L 112 K9YW6 M T 113 K9YW7 M I 114 K9YW8 M A 115 K9YW9 M V 116 K9YW10 M L 117 K9YW11 L T 118 K9YW12 L I 119 K9YW13 L A 120 K9YW14 L V 121 K9YW15 L L 122 K9YW16 Y T 123 (K9YWJM) K9YW17 Y I 124 K9YW18 Y A 125 K9YW19 Y V 126 K9YW20 Y L 127 K9YW21 A T 128 K9YW22 A I 129 K9YW23 A A 130 K9YW24 A V 131 K9YW25 A L 132
Example 2
Yeast Isobutanol Production for K9YW Variants
[0288] The resultant 25 plasmids from combinatorial mutagenesis at positions 90 and 93 were employed to evaluate isobutanol production in yeast grown under anaerobic conditions in a 48-well plate. Isobutanol production strains were made in host PNY2259 (MATa ura3::loxP his38 pdc6 pdc1::P[PDC1]-DHAD|ilvD_Sm-PDC1t-P[FBA1]-ALS|alsS_Bs-CYC1t pdc5::P[PDC5]-ADH|sadB_Ax-PDC5t gpd2::loxP fra2::P[PDC1]-ADH|adh_HI-ADH1t adh1::UAS(PGK1)P[FBA1]-kivD_Lg(y)-ADH1t yprc15::P[PDC5]-ADH|adh_HI-ADH1t ymr226c, ald6::loxP) by transforming the plasmids containing the coding sequences for the KARI variants and plating on synthetic medium without uracil (1% ethanol as carbon source). Yeast colonies from the transformation on SE-Ura plates appeared after 3-5 days of incubation at 30 C. At least three colonies from each variant were patched onto fresh SE-Ura plates and incubated at 30 C.
Yeast Cultivation Conditions:
[0289] Aerobic cultivation medium: SE-Ura medium with 2 g/l ethanol.
[0290] Anaerobic cultivation medium: SEG-Ura with 30 g/l glucose and 1 g/l ethanol, supplemented with 10 mg/l ergosterol, 50 mM MES buffer (pH 5.5), 30 mg/l thiamine, and 30 mg/l nicotinic acid.
[0291] 48-well plates: Axygen catalog # P-5ML-48-C-S, 5 ml/well total volume, culture volume of 1.5 ml/well.
[0292] Plates were covered with a permeable adhesive film (VWR catalog number 60941-086) for aerobic cultivation. Plates were shaken at 225 rpm at 30 C. For anaerobic cultivation, freshly inoculated plates covered with permeable film were purged of oxygen by equilibration in an anaerobic chamber for 2 hours. The plate covers were then exchanged for adhesive aluminum covers (VWR catalog number 89049-034) and each plate was placed into an airtight plastic box (Mitsubishi Gas Chemical America, Inc; New York, N.Y.; Catalog 50-25) along with a fresh oxygen scavenger pack (Mitsubishi Gas Chemical America, Inc; New York, N.Y.; Catalog 10-01). The entire assembly (plate(s) and oxygen scavenger pack inside a sealed airtight plastic box) was removed from the anaerobic chamber and shaken at 225 rpm at 30 C.
Experimental Protocol
[0293] Single yeast colonies on SE Ura agar plates were streaked onto fresh SE Ura agar plates and incubated at 30 C. until dense patches of cells had grown. Liquid precultures in 48-well plates were inoculated with loops of these cells for initial aerobic cultivation. After shaking overnight, the OD600 of each culture well was measured by transferring 0.15 ml of each well into a flat-bottom 96-well plate and measuring the absorbance of each well at 600 nm with a Molecular Devices (Sunnyvale, Calif.) plate reader. A linear transformation based on an experimentally-determined calibration line was applied to these plate reader-measured optical densities to convert them into comparable absorbance values for a cuvette-based spectrophotometer.
[0294] A calculated portion of each aerobic preculture well was inoculated into the corresponding well of a fresh 48-well plate with 1.5 ml of the SEG Ura medium, to achieve an initial OD600 (in cuvette spectrophotometer absorbance units) of 0.2. In the process of inoculating the fresh plate, the aerobic preculture plate was centrifuged, the supernatant was removed from each well, and the cells in each well were resuspended in fresh SEG Ura medium. This anaerobic cultivation plate was shaken for 2 days. The isobutanol concentration in the culture supernatants was measured by HPLC (Table 3).
TABLE-US-00011 TABLE 3 Isobutanol Titer Mean Standard Isobutanol Deviation of Titer Isobutanol Titer Variant Position 90 Position 93 (mM) (mM) K9SB2_SH K T 15 5 K9YW2 K I 17 1 K9YW3 K A 1 1 K9YW4 K V 14 2 K9YW5 K L 15 3 K9YW6 M T 1 1 K9YW7 M I 11 2 K9YW8 M A 1 0 K9YW9 M V 17 2 K9YW10 M L 16 4 K9YW11 L T 10 3 K9YW12 L I 5 1 K9YW13 L A 8 13 K9YW14 L V 0 0 K9YW15 L L 4 6 K9YWJM Y T 17 2 K9YW17 Y I 6 5 K9YW18 Y A 0 0 K9YW19 Y V 1 0 K9YW20 Y L 13 2 K9YW21 A T 11 4 K9YW22 A I 8 11 K9YW23 A A 15 3 K9YW24 A V 13 3 K9YW25 A L 19 6
Example 3
Combinatorial Mutagenesis of K9SB2 SH at Positions 90, 93, and 94 to Generate K9JM Library
[0295] Additional derivatives of K9SB2_SH were prepared based on combinatorial mutagenesis at positions 90, 93, and 93 (numbering based on full length Anaerostipes caccae KARI). Generated variants contained Lys, Met, or Tyr at position 90, Ala, Ile, Thr, or Val at position 93, and Ile, Leu, Met, or Phe at position 94. Mutagenesis was performed via an initial FOR step with mixes of mutagenic primers followed by a set of reactions employing the FOR products as megaprimers. Mutagenic primers listed in Table 4 were commercially synthesized by Integrated DNA Technologies, Inc (Coralville Iowa).
TABLE-US-00012 TABLE4 Primersformutagenesis SEQ Pri- ID mer# Sequence NO: 1 ccagatgaaAAGcaggctACCTTGtacaaaaacgacatcg 133 2 ccagatgaaAAGcaggctATCATGtacaaaaacgacatcg 134 3 ccagatgaaAAGcaggctATCATCtacaaaaacgacatcg 135 4 ccagatgaaAAGcaggctATCTTGtacaaaaacgacatcg 136 5 ccagatgaaAAGcaggctGCCATCtacaaaaacgacatcg 137 6 ccagatgaaAAGcaggctGCCTTGtacaaaaacgacatcg 138 7 ccagatgaaAAGcaggctGTCATGtacaaaaacgacatcg 139 8 ccagatgaaATGcaggctACCATCtacaaaaacgacatcg 140 9 ccagatgaaATGcaggctACCTTGtacaaaaacgacatcg 141 10 ccagatgaaATGcaggctATCATGtacaaaaacgacatcg 142 11 ccagatgaaTACcaggctACCATGtacaaaaacgacatcg 143 12 ccagatgaaATGcaggctGCCATGtacaaaaacgacatcg 144 13 ccagatgaaAAGcaggctACCTTCtacaaaaacgacatcg 145 14 ccagatgaaAAGcaggctGTCATCtacaaaaacgacatcg 146 15 ccagatgaaAAGcaggctGTCTTGtacaaaaacgacatcg 147 16 ccagatgaaATGcaggctATCATCtacaaaaacgacatcg 148 17 ccagatgaaATGcaggctATCTTGtacaaaaacgacatcg 149 18 ccagatgaaTTGcaggctACCATCtacaaaaacgacatcg 150 19 ccagatgaaTTGcaggctACCTTGtacaaaaacgacatcg 151 20 ccagatgaaTTGcaggctATCATGtacaaaaacgacatcg 152 21 ccagatgaaTTGcaggctGCCATGtacaaaaacgacatcg 153 22 ccagatgaaTACcaggctGCCATGtacaaaaacgacatcg 154 23 ccagatgaaTACcaggctACCATCtacaaaaacgacatcg 155 24 ccagatgaaTACcaggctACCTTGtacaaaaacgacatcg 156 25 ccagatgaaTACcaggctATCATGtacaaaaacgacatcg 157 26 ccagatgaaATGcaggctGCCATCtacaaaaacgacatcg 158 27 ccagatgaaATGcaggctGCCTTGtacaaaaacgacatcg 159 28 ccagatgaaATGcaggctGTCATGtacaaaaacgacatcg 160 29 ccagatgaaAAGcaggctATCTTCtacaaaaacgacatcg 161 30 ccagatgaaAAGcaggctGCCTTCtacaaaaacgacatcg 162 31 ccagatgaaATGcaggctACCTTCtacaaaaacgacatcg 163 32 ccagatgaaTTGcaggctATCATCtacaaaaacgacatcg 164 33 ccagatgaaTTGcaggctATCTTGtacaaaaacgacatcg 165 34 ccagatgaaTTGcaggctGCCATCtacaaaaacgacatcg 166 35 ccagatgaaTTGcaggctGCCTTGtacaaaaacgacatcg 167 36 ccagatgaaTACcaggctGCCATCtacaaaaacgacatcg 168 37 ccagatgaaTACcaggctGCCTTGtacaaaaacgacatcg 169 38 ccagatgaaTTGcaggctGTCATGtacaaaaacgacatcg 170 39 ccagatgaaTACcaggctATCATCtacaaaaacgacatcg 171 40 ccagatgaaTACcaggctATCTTGtacaaaaacgacatcg 172 41 ccagatgaaTACcaggctGTCATGtacaaaaacgacatcg 173 42 ccagatgaaATGcaggctGTCATCtacaaaaacgacatcg 174 43 ccagatgaaATGcaggctGTCTTGtacaaaaacgacatcg 175 44 ccagatgaaATGcaggctATCTTCtacaaaaacgacatcg 176 45 ccagatgaaATGcaggctGCCTTCtacaaaaacgacatcg 177 46 ccagatgaaAAGcaggctGTCTTCtacaaaaacgacatcg 178 47 ccagatgaaTTGcaggctACCTTCtacaaaaacgacatcg 179 48 ccagatgaaTACcaggctACCTTCtacaaaaacgacatcg 180 49 ccagatgaaTTGcaggctGTCATCtacaaaaacgacatcg 181 50 ccagatgaaTTGcaggctGTCTTGtacaaaaacgacatcg 182 51 ccagatgaaTACcaggctGTCATCtacaaaaacgacatcg 183 52 ccagatgaaTACcaggctGTCTTGtacaaaaacgacatcg 184 53 ccagatgaaTTGcaggctATCTTCtacaaaaacgacatcg 185 54 ccagatgaaTTGcaggctGCCTTCtacaaaaacgacatcg 186 55 ccagatgaaTACcaggctGCCTTCtacaaaaacgacatcg 187 56 ccagatgaaTACcaggctATCTTCtacaaaaacgacatcg 188 57 ccagatgaaTTGcaggctGTCTTCtacaaaaacgacatcg 189 58 ccagatgaaTACcaggctGTCTTCtacaaaaacgacatcg 190 Re- gctgaaaacacaccttgtaatatccacttacatgactttgg 191 verse
PCR with Mutagenic Primers
[0296] Primers were combined into six groups. Group 1: primers 1-10; Group 2: primers 11-20; Group 3: primers 21-30; Group 4: primers 31-40; Group 5: primers 41-50; Group 6: primers 51-58. 10 L aliquots of each primer were placed into a sterile 1.5 mL Eppendorf tubes. The primer mixture was then diluted 10-fold with molecular biology grade water, to a final overall concentration of 10 M. The Reverse primer was diluted 10-fold to a final concentration of 10 M.
[0297] The PCR was performed using Phusion DNA Polymerase (New England BioLabs, Ipswich, Mass.); all reagents with the exception of primers, DNA template and molecular biology grade water, were supplied with the polymerase. DNA template used was plasmid K9SB2_SH_DHAD (SEQ ID NO: 95). The PCR reactions were composed of 10 L 5 Phusion HF Buffer, 2 L 5 mM dNTPs, 2.5 L of 10 M forward primer mixture, 2.5 L of 10 M reverse primer, 2 L 50 ng/L template DNA, 0.5 L Phusion DNA Polymerase and 30.5 L molecular biology grade water. The following conditions were used for all reactions: The starting temperature was 98 C. for 30 sec followed by 30 heating/cooling cycles. Each cycle consisted of 98 C. for 10 sec, 58 C. for 15 sec, and 72 C. for 2.0 min. At the completion of the temperature cycling, a final 72 C. step run for 5.0 minutes and the samples were held at 4 C. until sample recovery could occur.
[0298] The desired FOR products were separated using gel electrophoresis. 5.5 L 10 Loading Dye (Invitrogen, 10816-015) was added to each sample. 20 L of each sample was loaded into the lanes of a 1% agarose gel and the gel was run at 140 V for 30 minutes in 1TBE buffer to separate DNA sizes. Expected fragment size was approximately 3500 bp and bands of this size were excised from the gel and placed in pre-weighed sterile eppendorf tubes. The tubes were purified from the gel using the QIAquick Gel Extraction Kit (Catalog #28704, Qiagen, Valencia, Calif.) according to the manufacture's protocol, with the following modification. The filter unit was washed three times with 750 L PE Buffer. The recovered FOR products were then used as the primers for the next step in the process.
Amplification of the Yeast Expression Plasmids with the Mega-Primers
[0299] The PCR step in which the plasmid was amplified and the mutations were introduced was performed by employing Agilent's Quikchange Lightning Site-Directed Mutagenesis kit (Catalog #210518, Agilent Technologies, Stratagene Products Division, La Jolla, Calif.). The reaction consisted of 250 ng purified mega-primer FOR product, 100 ng K9SB2_SH_DHAD template DNA (SEQ ID NO: 95), 5 L lox reaction buffer, 1.5 L Quik Solution, 1 L dNTP mix and a volume of molecular biology grade water to bring the entire reaction volume to 50 L. Except for the primers, template, and ddH.sub.2O, all reagents used here were supplied with the kit indicated above. The following conditions were used for both reactions: The starting temperature was 95 C. for 30 sec followed by 16 heating/cooling cycles. Each cycle consisted of 95 C. for 30 sec, 55 C. for 30 sec, and 68 C. for 6.0 min. At the completion of the temperature cycling, the samples held awaiting sample recovery at 4 C. 1 l of the Dpn I (10 U/l) was added to each reaction and the mixtures were incubated for 1 hour at 37 C.
[0300] 2 l of each mutagenic reaction was transformed into One Shot TOP10 Chemically Competent E. coli (Invitrogen, Catalog #C404003) according to the manufacturer's instructions. The transformants were spread on agar plates containing the LB medium and 100 g/ml ampicillin (Cat#L1004, Teknova Inc. Hollister, Calif.) and incubated at 37 C. overnight. Multiple transformants were then selected for TempliPhi (GE Healthcare) based DNA sequencing employing primers pHR81-F (ACACCCAGTATTTTCCCTTTCC SEQ ID NO: 107). and pHR81-Rev (CTA GTG TAC AGA TGT ATG TCG G, SEQ ID NO: 108). Transformants with confirmed KARI sequences were inoculated into LB medium containing 100 g/ml ampicillin and incubated at 37 C. with shaking at 225 rpm. Plasmid DNA was isolated from the cells with the QIAprep Spin Miniprep Kit (Catalog #2706, Qiagen, Valencia, Calif.) according to the protocol provided by the manufacturer. KARIs JM1-JM31 were identified (Table 5) and isobutanol production was analyzed (Example 4).
TABLE-US-00013 TABLE 5 KARI variants Position Amino Acid Variant Position 90 Position 93 94 SEQ ID NO: K9JM1 L A L 192 K9JM2 L T L 193 K9JM3 Y T M 194 K9JM4 M A L 195 K9JM5 M A I 196 K9JM6 M T I 197 K9JM7 K V I 198 K9JM8 K A I 199 K9JM9 Y A F 200 K9JM10 Y T I 201 K9JM11 Y T L 202 K9JM12 M I L 203 K9JM13 L V L 204 K9JM14 K I M 205 K9JM15 K I F 206 K9JM16 K I L 207 K9JM17 L I I 208 K9JM18 M A M 209 K9JM19 M I M 210 K9JM20 M T L 211 K9JM21 K V L 212 K9JM22 K V F 213 K9JM23 K A L 214 K9JM24 K T L 215 K9JM25 L A M 216 K9JM26 L V M 217 K9JM27 L I M 218 K9JM28 M I I 219 K9JM29 K V M 220 K9JM30 K I I 221 K9JM31 K T F 222
[0301] A second iteration of mutagenesis was performed to generate additional variants.
Mega-Primer Generating PCR
[0302] A subset of the primers in Table 4 were combined into three groups. Group S-1: primers 31, 44, 45, 48, 55, 56 and 58; Group S-2: primers 22, 25, 28 and 41; Group S-3: primers 24, 37, 40, 43 and 52. 10 L aliquots of each primer were placed into a sterile 1.5 mL Eppendorf tubes. The primer mixture was then diluted 10-fold with molecular biology grade water, to a final overall concentration of 10 M. The reverse primer was diluted 10-fold to a final concentration of 10 M.
[0303] The PCR was performed using Phusion DNA Polymerase (New England BioLabs; Ipswich, Mass.); all reagents with the exception of primers, DNA template and molecular biology grade water, were supplied with the polymerase. DNA templates for the groups S-1, S-2 and S-3 were JM31 (SEQ ID NO: 222), JM29 (SEQ ID NO: 220) and JM16 (SEQ ID NO: 207), respectively. The mega-primer FOR reaction was composed of 10 L 5 Phusion HF Buffer, 1 L 10 mM dNTPs, 2.5 L of 10 M forward primer mixture, 2.5 L of 10 M reverse primer, 2.5 L 1 ng/L template DNA, 0.5 L Phusion DNA Polymerase and 1 L 50 mM MgCl.sub.2 and 32.5 L molecular biology grade water. The following conditions were used for all reactions: The starting temperature was 98 C. for 30 sec followed by 30 heating/cooling cycles. Each cycle consisted of 98 C. for 10 sec, 60 C. for 15 sec, and 72 C. for 2 minute and 20 seconds. At the completion of the temperature cycling, a final 72 C. step run for 5.0 minutes and the samples were held at 4 C. until sample recovery could occur.
[0304] The desired FOR products were separated using gel electrophoresis. 5.5 L 10 Loading Dye (Invitrogen, 10816-015) was added to each sample. 20 L of each sample was loaded into the lanes of a 1% agarose gel and the gel was run at 140 V for 30 minutes in 1TBE buffer to separate DNA sizes. Expected fragment size was approximately 3500 bp and bands of this size were excised from the gel and placed in pre-weighed sterile eppendorf tubes. The tubes were purified from the gel using the QIAquick Gel Extraction Kit (Catalog #28704, Qiagen, Valencia, Calif.) according to the manufacture's protocol, with the following modification. The filter unit was washed three times with 750 L PE Buffer. The recovered FOR products were then used as the primers for the next step in the process.
Amplification of the Yeast Expression Plasmids with the Mega-Primers
[0305] The PCR step in which the plasmid was amplified and the mutations were introduced was performed by employing Agilent's Quikchange Lightning Site-Directed Mutagenesis kit (Catalog #210518, Agilent Technologies, Stratagene Products Division, La Jolla, Calif.). The reaction consisted of 250 ng purified mega-primer FOR product, 100 ng K9SB2_SH_DHAD template DNA (SEQ ID NO: 95), 5 L lox reaction buffer, 1.5 L Quik Solution, 1 L dNTP mix and a volume of molecular biology grade water to bring the entire reaction volume to 50 L. Except for the primers, template, and ddH.sub.2O, all reagents used here were supplied with the kit indicated above. The following conditions were used for both reactions: The starting temperature was 95 C. for 30 sec followed by 16 heating/cooling cycles. Each cycle consisted of 95 C. for 30 sec, 55 C. for 30 sec, and 68 C. for 6.0 min. At the completion of the temperature cycling, the samples held awaiting sample recovery at 4 C. 1 l of the Dpn I (10 U/l) was added to each reaction and the mixtures were incubated for 1 hour at 37 C.
[0306] 2 l of each mutagenic reaction was transformed into One Shot TOP10 Chemically Competent E. coli (Invitrogen, Catalog #0404003) according to the manufacturer's instructions. The transformants were spread on agar plates containing the LB medium and 100 g/ml ampicillin (Cat#L1004, Teknova Inc. Hollister, Calif.) and incubated at 37 C. overnight. Multiple transformants were then selected for TempliPhi (GE Healthcare) based DNA sequencing employing primers primers pHR81-F (ACACCCAGTATTTTCCCTTTCC, SEQ ID NO: 107). and pHR81-Rev (CTA GTG TAC AGA TGT ATG TCG G, SEQ ID NO: 108). Transformants with confirmed KARI sequences were inoculated into LB medium containing 100 g/ml ampicillin and incubated at 37 C. with shaking at 225 rpm. Plasmid DNA was isolated from the cells with the QIAprep Spin Miniprep Kit (Catalog #2706, Qiagen, Valencia, Calif.) according to the protocol provided by the manufacturer. KARIs JM32-JM44 were identified (see table 6) and isobutanol production was analyzed (Example 5).
TABLE-US-00014 TABLE 6 KARI Variants Position Amino Acid Variant Position 90 Position 93 94 SEQ ID NO: JM32 M A F 223 JM33 M V L 224 JM34 M V M 225 JM35 Y A F 226 JM36 Y A L 227 JM37 Y A M 228 JM38 Y I L 229 JM39 Y I M 230 JM40 Y T F 231 JM41 Y T L 240 JM42 Y V F 232 JM43 Y V L 233 JM44 Y V M 234
Example 4
Isobutanol Production of JM Variants in PNY2259 Growth Media
[0307] Three types of media were used during the growth procedure of yeast strains: a SE-ura recovery plate, an aerobic pre-culture media and an anaerobic culture media. All chemicals were obtained from Sigma unless otherwise noted (St. Louis, Mo.)
[0308] Yeast transformation recovery plate (SE-ura): 50 mM MES (pH 5.5), 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.2% ethanol, 0.01% w/v leucine, 0.01% w/v histidine, and 0.002% w/v tryptophan.
[0309] Aerobic pre-culture media (SE-Ura-His): 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.2% ethanol, 0.2% glucose, 0.01% w/v leucine, 0.1% w/v histidine, and 0.002% w/v tryptophan.
[0310] Anaerobic culture media (SEG-Ura-His): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.1% ethanol, 3% glucose, 0.01% leucine, 0.1% histidine, 0.002% tryptophan, 30 mg/L nicotinic acid, 30 mg/L thiamine and 10 mg/L ergosterol made up in 50/50 v/v Tween/ethanol solution.
Deep-Well Plate Growth Procedure
[0311] 1.5 mL aliquots of the aerobic pre-culture media were dispensed into each well of an Axygen 48 deep-well plate (#P-5 mL-48-C-S, Axygen, Union City, Calif.) and inoculated with cells grown on a SE-Ura-His agar plate. A sterile air permeable cover (#60941-086, VWR, Radnor, Pa.) was used to seal the culture plate. The plate was placed in a 30 C. incubator and was grown for 24 hours with shaking, when a target OD.sub.600 value of 1.5 to 2.0 was reached; as determined by a Spectra Max384 Plus plate reader (Molecular Devices, Sunnyvale, Calif.). OD.sub.600 values were recorded. Cells were pelleted in the plate via centrifugation using Heraeus Multifuge X1R centrifuge (Thermo Scientific, Waltham, Mass.) and a M-20 plate rotor (#41102742, Thermo Scientific, Waltham, Mass.) and the resulting supernatants were discarded. The cell pellets were transferred to a Coy Anaerobic Bag (Grass Lake, Mich.) where pellets were resuspended in 0.1 mL anaerobic growth media (described above) that had been to equilibrate to anaerobic conditions for at least 24 hours. The pellet/media suspension was used to inoculate 1.5 mL aliquots of anaerobic culture media in an Axygen 48 deep-well plate (#P-5 mL-48-C-S, Axygen, Union City, Calif.) to an initial target OD.sub.600 value of 0.2. The plate was then sealed with a sterile foil seal (60941-076, VWR, Radnor, Pa.) and placed into MGC 2.5 L anerobic jar with oxygen scavenging pack (#50-25, #10-01, MGC AnaeroPac System, Japan), which was then sealed. The anaerobic jar was removed from the Coy Anaerobic Bag and was placed into a 30 C. incubator and was grown with shaking for 69 hours. At the end of the first anaerobic passage, cells were centrifuged samples of the supernatant were saved for HPLC analysis. The pellets were used to inoculate the subsequent anaerobic passage as dictated by the experiment; subsequent passages were grown 24-72 hours. Three transformants were evaluated for each variant (results given in Table 7). Select variants were analyzed in a serum vial study (results given in Table 8).
Serum Vial Growth Procedure
[0312] 10 mL aliquots of aerobic pre-culture media in 125 mL flask with filtered lids were inoculated with cells grown on a SE-Ura-His agar plate. The aerobic pre-culture was grown aerobically for approximately 24 hours at 30 C. with shaking, until a target OD.sub.600 value of approximately 1.5 to 2 was achieved. OD.sub.600 values were determined using Cary 300 spectrophotemeter (Agilent Technologies, Wilmington, Del.) and the values were recorded. Cultures were transferred to 50 mL tubes (#89039-666, VWR, Radnor, Pa.) and cells were pelleted via centrifugation and the supernatant was discarded. Cell pellets were transferred into a Coy Anaerobic Bag (Grass Lake, Mich.) where pellets were resuspended in 1.0 mL anaerobic growth media (SEG-Ura-His). The resuspended cell pellets were used to inoculate 30 mL SEG-Ura-His media in 50 mL serum bottles (Wheaton, 223748, Millville, N.J.) to a target initial OD.sub.600 value of 0.2. All anaerobic media, serum vials, stoppers and crimps were allowed to degas in the anaerobic bag for at least 24 hours prior to inoculation. Serum bottles were stoppered, crimped and transferred out of the anaerobic bag and grown at 30 C. with shaking at 240 rpm. Anaerobic cultures were grown for 24 to 72 hours to a target OD.sub.600 value of at least 1.2. Additional anaerobic growth steps used the cells from the previous anaerobic culture step as inoculant, with an aliquot of supernatant saved for HPLC analysis. Three transformants were evaluated for each variant (results given in Table 8).
HPLC Analysis
[0313] Samples were taken for HPLC analysis and to obtain OD.sub.600 values at the end of the anaerobic growth period. HPLC analysis was performed using a Waters 2695 separations unit, 2996 photodiode array detector, and 2414 refractive index detector (Waters, Milford, Mass.) with a Shodex Sugar SH-G pre-column and Shodex Sugar SH1011 separations column (Shodex, JM Science, Grand Island, N.Y.). Compounds were separated by isocratic elution at 0.01 N sulfuric acid with a flow rate of 0.5 mL/min. Chromatograms were analyzed using the Waters Empower Pro software.
TABLE-US-00015 TABLE 7 Isobutanol Titers: K9JM Variants Deep-Well Plate Analysis SEQ ID Isobutanol Titer, mM NO: Variant Passage 1 Passage 2 Passage 3 Passage 4 94 K9SB2_SH 5.77 6.03 95.90 8.47 78.47 23.81 22.80 5.68 192 K9JM1 5.27 5.57 80.63 30.76 109.4 8.76 29.83 5.31 193 K9JM2 2.03 1.62 91.33 19.55 113.97 2.40 15.27 15.01 194 K9JM3 27.73 2.30 99.73 14.27 102.00 15.76 20.30 6.56 195 K9JM4 12.93 12.19 104.13 7.40 82.93 21.81 20.9 6.22 196 K9JM5 2.53 0.45 49.87 32.36 30.25 42.78 9.8 9.43 197 K9JM6 2.93 2.22 92.43 13.83 95.47 11.86 13.3 2.97 198 K9JM7 14.60 20.80 102.30 6.50 103.73 1.27 27.43 1.16 199 K9JM8 2.47 3.09 50.47 57.01 84.87 16.92 17.93 3.03 200 K9JM9 4.47 2.29 48.80 51.54 72.53 24.84 27.60 12.27 201 K9JM10 2.20 3.12 35.50 61.49 84.90 13.63 19.57 4.75 202 K9JM11 17.47 9.49 106.73 3.70 94.40 16.76 37.83 8.98 203 K9JM12 5.80 5.04 102.77 13.48 91.35 9.12 23.30 7.65
TABLE-US-00016 TABLE 8 Isobutanol Titers: K9JM Select Variants Serum Vial Analysis Isobutanol, mM Variant Passage 1 K9SB2_SH 15.03 6.07 K9_David_SH; 8.43 3.49 SEQ ID NO: 236 K9JM3 24.07 8.01 K9JM4 30.27 2.36 K9JM7 34.13 3.62 K9JM9 22.70 6.46 K9JM11 31.93 3.23 K9JM12 23.23 5.32
Example 5
Isobutanol Production of K9JM Variants and Derivatives in PNY2115
[0314] Variants prepared in Examples 3 and Example 11 were analyzed for isobutanol production in yeast strain PNY2115 (MATa ura3::loxP his38, pdc5::loxP66/71 fra2 2-micron plasmid (CEN.PK2) pdc1::P[PDC1]-ALS|alsS_Bs-CYC1t-loxP71/66 pdc6::(UAS)PGK1-P[FBA1]-KIVD|Lg(y)-TDH3t-loxP71/66 adh1::P[ADH1]-ADH|Bi(y)-ADHt-loxP71/66 fra2::P[ILV5]-ADH|Bi(y)-ADHt-loxP71/66 gpd2::loxP71/66).
Growth Media
[0315] Four types of media were used during the growth procedure of yeast strains: SE-ura agar plate, SAG-2-ura agar plate, an aerobic pre-culture media and an anaerobic culture media. All chemicals were obtained from Sigma unless otherwise noted (St. Louis, Mo.).
[0316] Yeast transformation recovery plate (SE-ura): 50 mM MES (pH 5.5), 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.2% ethanol, 0.01% w/v leucine, 0.01% w/v histidine, and 0.002% w/v tryptophan.
[0317] Glucose adaptation plate (SAG-2-Ura): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 3 mM sodium acetate (pH 7.0), 2% w/v glucose, 0.01% leucine, 0.01% histidine, 0.002% tryptophan.
[0318] Aerobic pre-culture media (SAG-0.2-Ura): 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 3 mM sodium acetate (pH 7.0), 0.2% glucose, 0.01% w/v leucine, 0.01% w/v histidine, and 0.002% w/v tryptophan.
[0319] Anaerobic culture media (SAG-3-Ura): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 3 mM sodium acetate (pH 7.0), 3% w/v glucose, 0.01% leucine, 0.01% histidine, 0.002% tryptophan, 30 mg/L nicotinic acid, 30 mg/L thiamine and 10 mg/L ergosterol made up in 50/50 v/v Tween/ethanol solution.
Transformation and Glucose Adaptation
[0320] Competent cells of the PNY2115 were made and transformed with 1 L of purified plasmid (0.4-0.8 g total DNA) using a Frozen-EZ Yeast Transformation II kit (Zymo Research; Orange, Calif.). Transformation mixtures were plated on SE-ura plates and incubated at 30 C. for 4 days. Three colonies for each transformant were selected and patched onto SE-ura plates and incubated at 30 C. for 2 days. Six transformants were employed for K9SB2_SH, K9ALL3 (SEQ ID NO: 237), and K9JM11. The variants then underwent glucose adaptation by patching onto SAG-2-Ura plates and growing for 2 days at 30 C.
[0321] 1.5 mL aliquots of the aerobic pre-culture media were dispensed into each well of a VWR 48 deep-well plate (#82004-674, VWR, Radnor, Pa.) and inoculated with cells grown on a SAG-2-Ura agar plate, as described above. A sterile air permeable cover (#60941-086, VWR, Radnor, Pa.) was used to seal the culture plate. The plate was placed in a 30 C. incubator and was grown for 24 hours with shaking, when a target OD.sub.600 value of 1.5 to 2.0 was reached; as determined by a Spectra Max384 Plus plate reader (Molecular Devices, Sunnyvale, Calif.). OD.sub.600 values were recorded. Cells were pelleted in the plate via centrifugation Heraeus Multifuge X1R centrifuge (Thermo Scientific, Waltham, Mass.) and a M-20 plate rotor (#41102742, Thermo Scientific, Waltham, Mass.) and the resulting supernatants were discarded. The cell pellets were transferred to a Coy Anaerobic Bag (Grass Lake, Mich.) where pellets were resuspended in 0.1 mL anaerobic growth media (described above) that had been to equilibrate to anaerobic conditions for at least 24 hours. The pellet/media suspension was used to inoculate 1.5 mL aliquots of anaerobic culture media in an a VWR 48 deep-well plate (#82004-674, VWR, Radnor, Pa.) to an initial target OD.sub.600 value of 0.2. The plate was then sealed with a sterile foil seal (60941-076, VWR, Radnor, Pa. and placed into MGC 2.5 L anerobic jar with oxygen scavenging pack (#50-25, #10-01, MGC AnaeroPac System, Japan), which was then sealed. The anaerobic system with removed from the Coy Anaerobic Bag and was placed into a 30 C. incubator and was grown with shaking for 69 hours. At the end of the first anaerobic passage, cells were centrifuged samples of the supernatant were saved for HPLC analysis. The pellets were used to inoculate the subsequent anaerobic passage as dictated by the experiment; subsequent passages were grown 24 72 hours. Three transformants were evaluated for each variant. Select variants were analyzed in a serum vial study.
Serum Vial Growth Procedure
[0322] 10 mL aliquots of aerobic pre-culture media in 125 mL flask with filtered lids were inoculated with cells grown on a CM+glucose agar plate (#03080, Teknova, Hollister, Calif.) spread with 20 L 3 M sterile sodium acetate (pH 7.0). The aerobic pre-culture was grown aerobically for approximately 24 hours at 30 C. with shaking, until a target OD.sub.600 value of approximately 1.5 to 2 was achieved. OD.sub.600 values were determined using Cary 300 spectrophotemeter (Agilent Technologies, Wilmington, Del.) and the values were recorded. Cultures were transferred to 50 mL tubes (#89039-666, VWR, Radnor, Pa.) and cells were pelleted via centrifugation and the supernatant was discarded. Cell pellets were transferred into a Coy Anaerobic Bag (Grass Lake, Mich.) where pellets were resuspended in 1.0 mL anaerobic growth media (SAG-Ura). The resuspended cell pellets were used to inoculate 30 mL SAG-Ura media in 50 mL serum bottles (Wheaton, 223748, Millville, N.J.) to a target initial OD.sub.600 value of 0.2. All anaerobic media, serum vials, stoppers and crimps were allowed to degas in the anaerobic bag for at least 24 hours prior to inoculation. Serum bottles were stoppered, crimped and transferred out of the anaerobic bag and grown at 30 C. with shaking at 240 rpm. Anaerobic cultures were grown for 24 to 72 hours to a target OD.sub.600 value of at least 1.2. Additional anaerobic growth steps used the cells from the previous anaerobic culture step as inoculant, with an aliquot of supernatant saved for HPLC analysis. Three transformants were evaluated for each variant.
HPLC Analysis
[0323] Samples were taken for HPLC analysis and to obtain OD.sub.600 values at the end of the anaerobic growth period. HPLC analysis was performed using a Waters 2695 separations unit, 2996 photodiode array detector, and 2414 refractive index detector (Waters, Milford, Mass.) with a Shodex Sugar SH-G pre-column and Shodex Sugar SH1011 separations column (Shodex, JM Science, Grand Island, N.Y.). Compounds were separated by isocratic elution at 0.01 N sulfuric acid with a flow rate of 0.5 mL/min. Chromatograms were analyzed using the Waters Empower Pro software.
TABLE-US-00017 TABLE 9 Isobutanol Titer Amino acid Isobutanol, mM Variant SEQ ID NO: Passage 1 K9SB2_SH 94 13.60 7.47 K9ALL3 237 18.01 5.12 K9JM11 202 16.40 9.13 K9JM32 223 6.12 1.78 K9JM33 224 12.80 5.54 K9JM34 225 12.27 3.40 K9JM35 226 2.32 0.24 K9JM36 227 27.13 14.19 K9JM37 228 16.09 2.16 K9JM38 229 11.33 9.41 K9JM39 230 4.93 4.20 K9JM40 231 1.04 0.40 K9JM41 240 18.44 12.83 K9JM42 232 1.32 0.41 K9JM43 233 24.01 8.08 K9JM44 234 25.81 2.42 K9ALL148 241 29.85 8.08 K9JM148 242 18.53 7.70 K9ALL156 243 25.56 16.80 K9JM156 244 20.99 0.76 K9ALL191 245 17.94 7.59 K9JM191 246 16.91 12.73 K9ALL254 247 25.44 4.69 K9ALL278 248 19.76 4.06 K9ALL37 249 7.81 3.51 K9JM37S 250 7.83 4.90 K9ALL66 251 8.28 5.19 K9JM66 252 17.98 2.92 K9ALL8Q 253 17.50 8.84 K9JM8Q 254 12.80 6.65 K9ALL45 255 26.61 8.72
Example 6
Kinetic Characterization of K9JM and K9YW Variants
[0324] For characterization, genes for KARI variants were subcloned into a E. coli expression plasmid via digestion with Pmel and Sfil and ligation into the corresponding sites of a JEA1.PS.pBAD plasmid (SEQ ID NO: 238). The resulting E. coli plasmids were transformed into an electro-competent strain of E. coli Bw25113 (ilvC) (described in U.S. Pat. No. 8,129,162, which is herein incorporated by reference in its entirety) using a BioRad Gene Pulser II (Bio-Rad Laboratories Inc., Hercules, Calif.). The transformed clones were spread on agar plates containing the LB medium and 100 g/ml ampicillin (#101320-154, Teknova Inc. Hollister, Calif.) and incubated at 37 C. overnight. A single transformant for each strain was streaked out onto LB plates with 100 g/mL ampicillin. A single colony from each of these plates was used to inoculate 3 mL LB broth with 100 g/mL ampicillin and 0.025% (w/v) arabinose and grown overnight with shaking at 225 rpm. The cultures were harvested by centrifugation at 4000g for 5 min. Cells were resuspended in 300 ul BugBuster Master Mix (EMD Sciences, Catalog #71456-4). The mixture was centrifuged for 10 min at 16,000g and the supernatant was collected.
[0325] Protein concentration of cell lysates was measured using the BioRad protein assay reagent (BioRad Laboratories, Inc., Hercules, Calif. 94547). Between 0.2 and 1.0 micrograms of crude extract protein was added to a reaction buffer consisting of 100 mM MOPS KOH, pH 6.8, 10 mM MgCl.sub.2, 1 mM EDTA, 1 mM glucose-6-phosphate (Sigma-Aldrich), 0.2 Units of Leuconostoc mesenteroides glucose-6-phosphate dehydrogenase (Sigma-Aldrich), and various concentrations of NADH or NADPH, to a volume of 90 L. The reaction was initiated by the addition of 10 L of [R/S]-acetolactate to a final concentration of 5 mM and a final volume of 100 L. After 10 min incubations at 30 C., the reaction was quenched by withdrawing 50 L of the reaction mixture and adding it to 150 L of 0.1% formic acid. To measure the kinetic parameters for reactions with NADH, the cofactor concentrations used were 0.0003, 0.001, 0.003, 0.01, 0.03, 0.1, 0.3 and 1 mM. The cofactor concentrations employed for reactions with NADPH were 0.0003, 0.001, 0.003, 0.01, 0.03, 0.1, 0.3 and 1 mM.
[0326] To analyze for 2,3-dihydroxyisovalerate, 2 L of the formic acid quenched reaction mixture was injected into a Waters Acquity HPLC equipped with Waters SQD mass spectrometer (Waters Corporation, Milford, Mass.). The chromatography conditions were: flow rate (0.5 ml/min), on a Waters Acquity HSS T3 column (2.1 mm diameter, 100 mm length). Buffer A consisted of 0.1% (v/v) in water, Buffer B was 0.1% formic acid in acetonitrile. The sample was analyzed using 1% buffer B (in buffer A) for 1 min, followed by a linear gradient from 1% buffer B at 1 min to 75% buffer B at 1.5 min. The reaction product, 2,3-dihydroxyisovalerate, was detected by ionization at m/z=133, using electrospay ionization 30 V cone voltage. The amount of product 2,3-dihydroxyisovalerate was calculated by comparison to an authentic standard.
[0327] To calculate the V.sub.max and cofactor K.sub.M values, the rate data for DHIV formation was fitted to the single substrate Michaelis-Menton equation, using a least-squares regression in Microsoft EXCEL. The kinetic parameters for the reactions with NADPH and with NADH are provided in Table 10. K9SB2_SH derivatives exhibit 1.7-3.2 fold increased K.sub.M for NADPH with less than 1.7 fold changes in the K.sub.M for NADH.
TABLE-US-00018 TABLE 10 Kinetic Parameters for E. coli extracts containing K9SB2_SH Variants V.sub.max NADPH, K.sub.M NADPH, V.sub.max NADH, K.sub.M NADH, Variant U/ml M U/mg M V.sub.max/K.sub.M.sup.NADH/V.sub.max/K.sub.M.sup.NADPH K9SB2_SH 0.49 62 0.56 16 4.5 K9YW25 6.1 106 7.2 15 8.5 K9JM11 3.4 199 4.3 26 9.7 K9YWJM 3.3 166 4 24 8.4 K9YW20 4.3 164 5.6 23 9.3
Example 7
Error Prone PCR of K9 Ursula
[0328] Error prone PCR of K9_Ursula (K9SB2+A56V) (SEQ ID NO: 239) was performed to generate a library that can be screened for variants with decreased K.sub.M values for NADH. Mutagenic PCR was performed with the GeneMorph II EZClone Domain Mutagenesis Kit (Catalog #200552, Agilent Technologies, Stratagene Products Division, La Jolla, Calif.). Primers K9G9_EZ_F1 (AAA CAT GGA AGA ATG TAA GAT GGC, SEQ ID NO: 256) and K9G9_EZ_R1 (TCA GTT GTT AAT CAA CTT GTC TTC G, SEQ ID NO: 257) were commercially synthesized by Integrated DNA Technologies, Inc (Coralville Iowa). Other than the primers, template, and ddH.sub.2O, reagents used here were supplied with the kit indicated above. The mutagenic FOR mixture consisted of 6 l of K9_Ursula in pBAD.KARI vector (SEQ ID NO: 258) (243 ng/l), 1.25 l of each primer (100 ng/l stocks), 5 l of 10 Mutazyme II reaction buffer, 1 l of 40 mM dNTP mix, 1.5 l of Mutazyme II DNA polymerase, and 34 l of ddH.sub.2O. The following conditions were used for the FOR reaction: The starting temperature was 95 C. for 2.0 min followed by 30 heating/cooling cycles. Each cycle consisted of 95 C. for 30 sec, 48 C. for 30 sec, and 72 C. for 2.0 min. At the completion of the temperature cycling, the sample was kept at 72 C. for 10.0 min more, and then held awaiting sample recovery at 4 C. The reaction product was separated from the template via agarose gel electrophloresis (1% agarose, 1TBE buffer) and recovered using the QIAquick Gel Extraction Kit (Cat#28704, Qiagen Incorporated, Valencia, Calif.) as recommended by the manufacturer.
[0329] The isolated reaction product was employed as a megaprimer to generate gene libraries in the EZClone reaction of the kit indicated above. Other than the megaprimer, template, and ddH.sub.2O, reagents used here were supplied with the kit indicated above. The reaction consisted of 25 l of the 2 EZClone enzyme mix, 6 l of megaprimer (99 ng/l), 2 l of K9_Ursula in a pBAD.KARI vector (SEQ ID NO: 258) (24 ng/l), 3 l of EZClone solution, and 14 l of ddH.sub.2O. The following conditions were used for the reaction: The starting temperature was 95 C. for 1.0 min followed by 30 heating/cooling cycles. Each cycle consisted of 95 C. for 50 sec, 60 C. for 50 sec, and 68 C. for 10.0 min. At the completion of the temperature cycling, the samples were kept at 72 C. for 10.0 min more, and then held awaiting sample recovery at 4 C. 1 l of the Dpn I (10 U/l) was added and the mixture was incubated for 2.5 hours at 37 C. The mixture was concentrated to 8 ul with the DNA Clean & Concentrator-5 (Cat#D4004, Zymo Research, Irvine Calif.).
[0330] 4 l of the Dpn I digested and concentrated EZClone reaction product was then transformed into 50 l XL10-Golde Ultracompetent E. coli cells (provided in the GeneMorph II EZClone Domain Mutagenesis Kit) as recommended by the manufacturer. The transformants were spread on agar plates containing the LB medium and 100 g/ml ampicillin (Cat#L1004, Teknova Inc. Hollister, Calif.), incubated at 37 C. overnight. The resultant library in XL-Gold was scraped off the agar plates with a solution containing M9 salts, combined, diluted into media containing the LB medium and 100 g/ml ampicillin, and incubated at 37 C. overnight. The library DNA was isolated from the cells with the QIAprep Spin Miniprep Kit (Catalog #2706, Qiagen, Valencia, Calif.) according to the protocol provided by the manufacturer. The amplified library was then used to transform an electro-competent strain of E. coli Bw25113 (ilvC) using a BioRad Gene Pulser II (Bio-Rad Laboratories Inc., Hercules, Calif.). The transformed clones were spread on agar plates containing the LB medium and 100 g/ml ampicillin (#101320-154, Teknova Inc. Hollister, Calif.) and incubated at 37 C. overnight. Clones were employed for high throughput screening as described in Example 8.
Example 8
Screening K9-Ursula ePCR Library for Variants with Reduced Km NADH
[0331] High Throughput Screening Assay of K9-Ursula ePCR Library
[0332] High throughput screening of the gene libraries of mutant KARI enzymes was performed as described herein: 10 freezing medium containing 554.4 g/L glycerol, 68 mM of (NH.sub.4).sub.2SO.sub.4, 4 mM MgSO.sub.4, 17 mM sodium citrate, 132 mM KH.sub.2PO.sub.4, 36 mM K.sub.2HPO.sub.4 was prepared with molecular pure water and filter-sterilized. Freezing medium was prepared by diluting the 10 freezing medium with the LB medium. An aliquot (200 L) of the 1 freezing medium was used for each well of the 96-well archive plates (cat #3370, Corning Inc. Corning, N.Y.).
[0333] Clones from the LB agar plates were selected and inoculated into the 96-well archive plates containing the freezing medium and grown overnight at 37 C. without shaking. The archive plates were then stored at 80 C. E. coli strain Bw25113(ilvC), as described in U.S. Pat. No. 8,129,162, transformed with pBAD-HisB (Invitrogen) was always used as the negative control. The positive control for the library was K9_Ursula in a pBAD.KARI vector (SEQ ID NO: 258) in E. coli strain Bw25113 (ilvC)
[0334] Clones from archive plates were inoculated into the 96-deep well plates. Each well contained 3.0 l of cells from thawed archive plates, 200 l of the LB medium containing 100 g/ml ampicillin and 0.02% (w/v) arabinose as the inducer. Cells were the grown overnight at 37 C. with 80% humidity while shaking (900 rpm), harvested by centrifugation (3750 rpm, 5 min at 25 C.). (Eppendorf centrifuge, Brinkmann Instruments, Inc. Westbury, N.Y.) and the cell pellet was stored at 20 C. for later analysis.
[0335] The assay substrate, (R,S)-acetolactate, was synthesized as described by Aulabaugh and Schloss (Aulabaugh and Schloss, Biochemistry, 29: 2824-2830, 1990). All other chemicals used in the assay were purchased from Sigma. The enzymatic conversion of acetolactate to ,-dihydroxyisovalerate by KARI was followed by measuring the oxidation of the cofactor, NADH, from the reaction at 340 nm using a plate reader (Saphire 2, Tecan, Mannedorf, Switzerland). The activity was calculated using the molar extinction coefficient of 6220 M.sup.1 cm.sup.1 NADH.
[0336] Frozen cell pellet in deep-well plates and BugBuster (Novagen 71456, Darmstadt, Germany) were warmed up at room temperature for 30 min at the same time. 75 l of 50% BugBuster (v/v in water) was added to each well after 30 min warm-up and cells were suspended using plate shaker. The plates with cell pellet/50% Bug Buster suspension were incubated at room temperature for 30 min. Cell lysate diluted with 75 L d.d water, resulting in 0.5 lysate. Assays of the diluted cell free extracts were performed at 30 C. in buffer containing 2.4 mM (R/S)-acetolactate, 100 mM HEPES pH 6.8, 100 mM KCl, 10 mM MgCl.sub.2, 75 or 200 M NADH and 6.25 or 12.5 L of 0.5 cell lysate.
Identification of K9-Urusla Variants: Primary Screening
[0337] For each volume of cell lysate, the ratio for the measured rate of NADH oxidation at 75 M NADH to the measured rate of NADH oxidation at 200 M NADH was calculated for each variant and positive control well (2 per plate). The mean and standard deviation of ratios for the positive control wells (104 per cell lysate) were calculated.
[0338] A variant well was considered to contain an initial hit if the rate ratio was both greater than 0.785 (three standard deviations higher than the positive control mean) and less than 1. Between the two cell lysate volumes, a total of 630 hits were identified from a pool of 5404 potential variants. These initial hits were consolidated, forming a smaller library, CL1, for further analysis.
Identification of K9-Ursula Variants: Secondary Screening
[0339] Multiple approaches were employed to evaluate variants from the consolidated library. In one approach, the secondary screen was performed in a manner similar to the primary screen with modifications. The consolidated hit library (CL1) was grown in biological triplicate and cell free extracts were prepared and assayed as described above. Rate data was collected and analyzed as described below. For each volume of cell lysate of the CL1 library, the ratio for the measured rate of NADH oxidation at 75 M NADH to the measured rate of NADH oxidation at 200 M NADH was calculated for each variant and positive control well (2 per plate). These ratios were used to calculate Km NADH using the following equation, which can be derived from ratios of Michealis-Menton equations for the two substrate concentrations:
HTS K.sub.m=75(1R)/(R75/200) where R=rate ratio
[0340] A variant well was considered to contain an initial hit if the Km was less than 125 M and the rate at 200 M NADH was greater than 0.8. Hits were also collected from variants that exhibited a rate ratio greater that 0.617, regardless of the rate at 200 M NADH. The ratios and HTS Km values for these variants are provided in Table 11.
[0341] In another approach, NADH K.sub.M values for variants from the consolidated library were measured in enzymes assays performed manually with a plate reader. Clones from the CL1 archive plates were inoculated into the 96-deep well plates. Each well contained 3.0 l of cells from thawed archive plates, 200 l of the LB medium containing 100 g/ml ampicillin and 0.02% (w/v) arabinose as the inducer. Cells were the grown overnight at 37 C. with 80% humidity while shaking (900 rpm), harvested by centrifugation (3750 rpm, 5 min at 25 C.). (Eppendorf centrifuge, Brinkmann Instruments, Inc. Westbury, N.Y.) and the cell pellet was stored at 20 C. for later analysis.
[0342] Cell pellets were thawed and suspended in 20 L Bug Buster Master Mix (Novagen #) and incubated at room temperature for 15 minutes. 140 L of 20 mM HEPES (pH 6.8) was added to each well. The plates were centrifuged at 4,000 rpm for 10 minutes at 4 C. 120 L of the supernatant (CFE) was transferred a 96-well plate (Corning 3370).
[0343] To determine the Plate K.sub.M for NADH, the CFEs were assayed at various concentrations of NADH (50, 100, 200 and 400 M). Assays were conducted at 30 C. in a buffer containing 100 mM HEPES (pH 6.8), 10 mM MgCl.sub.2, 5.2 mM (R/S)-acetolactate and a concentration of NADH. 180 L aliquot of the buffer was added to each well of a 96-well flat bottom plate (Corning 3370) and the reaction was initiated with the addition of 20 L of CFE to each well. The rate of conversion of S-acetolactate to DHIV was determined by measuring the rate of oxidation of NADH to NAD.sup.+ at 340 nm using a Spectra Max 384 plus plate reader (Molecular Devices). Total assay length was two minutes, with each well being read every 15 seconds. K.sub.M values were calculated by plotting specific activity (U/mg) vs. cofactor concentration and the data were fit to the Michaelis-Menton equation. The Plate K.sub.M values for hits identified by the HTS screening described above are included in Table 11.
[0344] Sequence analysis of K9-Ursula variants
[0345] DNA sequencing of the variants identified in secondary HTS screening was accomplished by using TempliPhi (GE Healthcare) with the primers pBAD-For (ATGCCATAGCATTTTTATCC, SEQ ID NO: 260) and pBAD-Rev (CTGATTTAATCTGTATCAGGCT, SEQ ID NO: 261). The sequences are shown in Table 11.
TABLE-US-00019 TABLE 11 KARI Variants Observed Amino Acid Rate Seq HTS Plate Substitutions Relative to Ratio Name NADH K.sub.M NADH K.sub.M SEQ ID NO: 239 0.92 T11-1 11 145 A73T 0.90 T11-2 14 15 L167M, T191S 0.86 T11-3 21 77 S32Y, V220I 0.86 T11-4 21 33 L243S 0.86 T11-5 22 139 C46S, E200E 0.85 T11-6 23 na E68G 0.85 T11-7 25 na D14N, I234N, A311V 0.84 T11-8 26 157 none 0.83 T11-9 27 201 none 0.83 T11-10 28 149 F189L 0.82 T11-11 30 154 none 0.81 T11-12 32 na K42M, V158D 0.80 T11-13 34 109 G45D 0.80 T11-14 36 79 P124S 0.79 T11-15 37 na K42N, D196V, L284C 0.79 T11-16 37 na P101S, M132V, K270N 0.79 T11-17 37 208 none 0.79 T11-18 39 na K77M 0.78 T11-19 40 156 P125S 0.779 T11-20 41 68 none 0.78 T11-21 42 na K136E, A162T, D242V 0.78 T11-22 42 79 F115I, Q213H, Y262N 0.772 T11-23 43 6 none 0.772 T11-24 43 203 none 0.77 T11-25 44 15 F292I 0.74 T11-26 52 145 none 0.74 T11-27 54 156 K238M 0.73 T11-28 56 42 I256T, C156V 0.73 T11-29 57 133 M94L 0.73 T11-30 58 200 F53L, C209S, S330Y 0.73 T11-31 58 210 none 0.72 T11-32 60 na Q91R, A210D 0.72 T11-33 61 104 A157S 0.719 T11-34 61 444 none 0.71 T11-35 64 149 N107S 0.71 T11-36 64 185 F53I, K294M 0.71 T11-37 65 81 V56A 0.71 T11-38 65 85 I25N, H235Y 0.71 T11-39 65 58 I84N, F189Y 0.71 T11-40 65 178 none 0.711 T11-41 65 105 none 0.71 T11-42 65 120 Y254H 0.71 T11-43 67 81 V56A 0.70 T11-44 69 65 G114C, E194D, L211S, D225E 0.70 T11-45 69 14 A166T, L171S, T218I, G248C 0.70 T11-46 70 na K96E, V123A 0.70 T11-47 70 149 F53I, M108L 0.70 T11-48 70 116 none 0.70 T11-49 71 128 E186D 0.69 T11-50 74 185 F53I 0.69 T11-51 76 157 none 0.69 T11-52 76 158 D302E 0.69 T11-53 76 313 none 0.69 T11-54 76 313 E58D 0.68 T11-55 77 79 G223D 0.68 T11-56 77 240 T93A, G114D, G151S 0.68 T11-57 78 158 D302E 0.68 T11-58 78 86 K42N, K282N, I283F 0.68 T11-59 81 292 G120S 0.68 T11-60 81 120 T191N, Y254H 0.68 T11-61 81 223 V123A, K126M 0.67 T11-62 82 217 K281M 0.67 T11-63 82 287 none 0.67 T11-64 82 87 A174D 0.67 T11-65 82 138 none 0.67 T11-66 83 353 V142F, D168E, E261E 0.67 T11-67 83 178 A92D 0.67 T11-68 83 230 none 0.67 T11-69 84 174 M169K 0.67 T11-70 85 153 E274K 0.67 T11-71 85 185 none 0.67 T11-72 86 89 A176T 0.67 T11-73 86 228 none 0.66 T11-74 87 173 A214V 0.66 T11-75 88 195 I99V, A210T 0.66 T11-76 88 188 T191S 0.66 T11-77 88 352 none 0.66 T11-78 89 128 none 0.66 T11-79 89 125 T187S 0.66 T11-80 90 175 L219W 0.66 T11-81 91 149 T191S 0.65 T11-82 93 185 none 0.65 T11-83 94 76 F53I 0.65 T11-84 95 163 G304C 0.65 T11-85 95 352 A105T 0.65 T11-86 96 134 C209R 0.65 T11-87 97 254 P101S 0.65 T11-88 98 141 A279T 0.65 T11-89 99 269 none 0.65 T11-90 99 148 none 0.64 T11-91 99 290 G120S, A303T, K314M 0.64 T11-92 99 228 none 0.64 T11-93 100 157 none 0.64 T11-94 101 231 I272N 0.64 T11-95 102 255 R181K 0.64 T11-96 102 351 E145V, A214T 0.64 T11-97 103 223 T93I 0.64 T11-98 103 251 none 0.64 T11-99 104 226 D127E 0.64 T11-100 105 102 none 0.63 T11-101 106 156 none 0.63 T11-102 106 240 none 0.63 T11-103 107 260 N40D, T191S 0.63 T11-104 107 225 G207S, E326K 0.63 T11-105 108 190 none 0.63 T11-106 108 138 none 0.63 T11-107 108 195 none 0.63 T11-108 109 89 none 0.63 T11-109 110 183 D295E 0.63 T11-110 111 217 E147D 0.63 T11-111 111 126 G149C, V298A 0.63 T11-112 112 313 none 0.63 T11-113 112 236 none 0.62 T11-114 114 255 T273S 0.62 T11-115 114 235 none 0.62 T11-116 114 145 T131A 0.62 T11-117 115 146 I122F 0.62 T11-118 116 136 none 0.62 T11-119 116 157 D264V 0.62 T11-120 116 258 none 0.62 T11-121 116 178 H118Y, R190G 0.62 T11-122 116 197 L315M 0.62 T11-123 116 263 none 0.62 T11-124 116 132 D264V 0.62 T11-125 118 174 D242N 0.62 T11-126 119 168 none 0.62 T11-127 120 245 none 0.61 T11-128 121 123 M312I 0.61 T11-129 121 196 none 0.61 T11-130 121 315 S285Y 0.61 T11-131 121 173 I234M 0.61 T11-132 122 129 none 0.61 T11-133 122 122 none 0.61 T11-134 123 147 L85M, H140Y, M237L 0.61 T11-135 123 132 none 0.61 T11-136 123 220 none 0.61 T11-137 123 198 none na - Km value could not be calculated from the data
Example 9
Kinetic Characterization of K9 Ursula Derivatives
[0346] Several K9_Ursula derivatives from Example 8 were selected for kinetic characterization. Variants were expressed in E. coli and analyzed as described Example 6. The kinetic parameters for the KARI reactions with NADH and NADPH as cofactors are provided in Table 12. Two independent clones containing same amino acid substitution of T191S (#1 and #2) were analyzed. Amino acid substitutions at positions 58 and 191 were observed to lower the K.sub.M of NADH.
TABLE-US-00020 TABLE 12 Kinetic Parameters for E. coli Extracts Containing K9_Ursula Derivatives Substitutions V.sub.max K.sub.M V.sub.max K.sub.M From NADPH, NADPH, NADH, NADH, V.sub.max/K.sub.M.sup.NADH/ K9_Ursula U/ml M U/ml M V.sub.max/K.sub.M.sup.NADPH none 2.6 1740 5.2 154 22 (K9_Ursula) T191N 4.2 429 5.2 52 10 E58D 6.1 1904 6.5 67 30 T191S (#1) 2.0 1649 3.6 82 36 T191S (#2) 2.5 1525 4.0 110 22 E274K 5.5 4694 5.6 115 41 T187S 2.7 1275 3.6 116 15 K42N 3.6 2171 5.9 128 28 A105T 5.0 1713 8.9 129 24 A73T 4.2 1868 6.6 137 22 A92D 2.3 2729 3.8 138 32 A279T 3.3 1671 6.2 138 23 A176T 1.5 1235 3.4 159 18 G120S 2.1 2006 5.0 191 25 M169K 2.4 2180 4.4 196 20 R181K 2.6 2009 6.1 214 22 A214V 4.9 3644 8.1 215 28
Example 10
Preparation and Characterization of K9 Ursula Derivatives with Substitutions at Position 53
Generation of Position 53 Variants in K9_Ursula
[0347] Amino acid replacements at positions 53 were incorporated individually into K9_Ursula via site directed mutagenesis and the resultant variants were expressed in E. coli and characterized. Site directed mutagenesis of K9_Ursula was performed with the QuikChange Lightning Site-Directed Mutagenesis Kit (Catalog #210518, Agilent Technologies, Stratagene Products Division, La Jolla, Calif.). Primers listed in Table 13 were commercially synthesized by Integrated DNA Technologies, Inc (Coralville Iowa). Primers were combined into four mixes, as indicated in Table 13 (column labeled Mix).
TABLE-US-00021 TABLE13 PrimerMixesEmployedforSiteDirected Mutagenesis SEQ ID Pri- Mix NO mers Sequence 53-1 262 F53I GGTTGTAACGTTATCATTGGTTTAATCGAAGGTGTGG AGGAGTGG 53-1 263 F53I CCACTCCTCCACACCTTCGATTAAACCAATGATAACG rev TTACAACC 53-1 264 F53L GGTTGTAACGTTATCATTGGTTTATTGGAAGGTGTGG AGGAGTGG 53-1 265 F53L CCACTCCTCCACACCTTCCAATAAACCAATGATAACG rev TTACAACC 53-1 266 F53S GGTTGTAACGTTATCATTGGTTTATCCGAAGGTGTGG AGGAGTGG 53-1 267 F53S CCACTCCTCCACACCTTCGGATAAACCAATGATAACG rev TTACAACC 53-1 268 F53V GGTTGTAACGTTATCATTGGTTTAGTCGAAGGTGTGG AGGAGTGG 53-1 269 F53V CCACTCCTCCACACCTTCGACTAAACCAATGATAACG rev TTACAACC 53-1 270 F53Y GGTTGTAACGTTATCATTGGTTTATACGAAGGTGTGG AGGAGTGG 53-1 271 F53Y CCACTCCTCCACACCTTCGTATAAACCAATGATAACG rev TTACAACC 53-2 272 F53D GGTTGTAACGTTATCATTGGTTTAGACGAAGGTGTGG AGGAGTGG 53-2 273 F53D CCACTCCTCCACACCTTCGTCTAAACCAATGATAACG rev TTACAACC 53-2 274 F53H GGTTGTAACGTTATCATTGGTTTACACGAAGGTGTGG AGGAGTGG 53-2 275 F53H CCACTCCTCCACACCTTCGTGTAAACCAATGATAACG rev TTACAACC 53-2 276 F53K GGTTGTAACGTTATCATTGGTTTAAAGGAAGGTGTGG AGGAGTGG 53-2 277 F53K CCACTCCTCCACACCTTCCTTTAAACCAATGATAACG rev TTACAACC 53-2 278 F53M GGTTGTAACGTTATCATTGGTTTAATGGAAGGTGTGG AGGAGTGG 53-2 279 F53M CCACTCCTCCACACCTTCCATTAAACCAATGATAACG rev TTACAACC 53-2 280 F53N GGTTGTAACGTTATCATTGGTTTAAACGAAGGTGTGG AGGAGTGG 53-2 281 F53N CCACTCCTCCACACCTTCGTTTAAACCAATGATAACG rev TTACAACC 53-2 282 F53W GGTTGTAACGTTATCATTGGTTTATGGGAAGGTGTGG AGGAGTGG 53-2 283 F53W CCACTCCTCCACACCTTCCCATAAACCAATGATAACG rev TTACAACC 53-3 284 F53E GGTTGTAACGTTATCATTGGTTTAGAAGAAGGTGTGG AGGAGTGG 53-3 285 F53E CCACTCCTCCACACCTTCTTCTAAACCAATGATAACG rev TTACAACC 53-3 286 F53G GGTTGTAACGTTATCATTGGTTTAGGTGAAGGTGTGG AGGAGTGG 53-3 287 F53G CCACTCCTCCACACCTTCACCTAAACCAATGATAACG rev TTACAACC 53-3 288 F53P GGTTGTAACGTTATCATTGGTTTACCAGAAGGTGTGG AGGAGTGG 53-3 289 F53P CCACTCCTCCACACCTTCTGGTAAACCAATGATAACG rev TTACAACC 53-3 290 F53Q GGTTGTAACGTTATCATTGGTTTACAAGAAGGTGTGG AGGAGTGG 53-3 291 F53Q CCACTCCTCCACACCTTCTTGTAAACCAATGATAACG rev TTACAACC 53-4 292 F53A GGTTGTAACGTTATCATTGGTTTAGCTGAAGGTGTGG AGGAGTGG 53-4 293 F53A CCACTCCTCCACACCTTCAGCTAAACCAATGATAACG rev TTACAACC 53-4 294 F53C GGTTGTAACGTTATCATTGGTTTATGTGAAGGTGTGG AGGAGTGG 53-4 295 F53C CCACTCCTCCACACCTTCACATAAACCAATGATAACG rev TTACAACC 53-4 296 F53R GGTTGTAACGTTATCATTGGTTTACGTGAAGGTGTGG AGGAGTGG 53-4 297 F53R CCACTCCTCCACACCTTCACGTAAACCAATGATAACG rev TTACAACC 53-4 298 F53T GGTTGTAACGTTATCATTGGTTTAACCGAAGGTGTGG AGGAGTGG 53-4 299 F53T CCACTCCTCCACACCTTCGGTTAAACCAATGATAACG rev TTACAACC
[0348] Except for the primers, templates, and ddH.sub.2O, all reagents used here were supplied with the kit indicated above. The mutagenesis reaction mixture contained 1 l K9_Ursula in pBAD.KARI (50 ng/l), 1 l of each primer mix (11.5 uM total primer concentration), 5 l of 10 reaction buffer, 1 l of dNTP mix, 1.5 l of QuikSolution reagent, 1 l of QuikChange Lightning Enzyme and 39.5 l of ddH.sub.2O. The following conditions were used for the reaction: The starting temperature was 95 C. for 2 min followed by 18 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 4.0 min. At the completion of the temperature cycling, the samples were incubated at 68 C. for 5.0 min and then held awaiting sample recovery at 4 C. 2 l of the Dpn I was added to each reaction and the mixtures were incubated for 30 min at 37 C.
[0349] 2 l of each mutagenic reaction was transformed into One Shot TOP10 Chemically Competent E. coli (Invitrogen, Catalog #C404003) according to the manufacturer's instructions. The transformants were spread on agar plates containing the LB medium and 100 g/ml ampicillin (Cat#L1004, Teknova Inc. Hollister, Calif.) and incubated at 37 C. overnight. Multiple transformants were then selected for TempliPhi (GE Healthcare) based DNA sequencing employing primers pBAD-For (ATGCCATAGCATTTTTATCC, SEQ ID NO: 260) and pBAD-Rev (CTGATTTAATCTGTATCAGGCT, SEQ ID NO: 261). Transformants with confirmed KARI sequences were inoculated into LB medium containing 100 g/ml ampicillin and incubated at 37 C. with shaking at 225 rpm. Plasmid DNA was isolated from the cells with the QIAprep Spin Miniprep Kit (Catalog #2706, Qiagen, Valencia, Calif.) according to the protocol provided by the manufacturer.
Characterization of Position 53 Variants
[0350] K9_Ursula and a subset of the derivatives containing substitutions at position 53 were expressed in E. coli strain Bw25113 (ilvC) and characterized as described in Example 6. Kinetic parameters for the reactions with NADH and with NADPH are provided in Table 14. K9_Ursula derivatives containing substitutions F53L and F53I were designated as K9_Lucy (SEQ ID NO: 300) and K9_llya (SEQ ID NO: 301), respectively (Table 14).
TABLE-US-00022 TABLE 14A Kinetic Parameters for E. coli lysates containing Phe 53 variants Substitution relative to V.sub.max K.sub.M V.sub.max K.sub.M SEQ ID NO: NADPH, NADPH, NADH, NADH, 239 U/ml M U/ml M V.sub.max/K.sub.M.sup.NADH/V.sub.max/K.sub.M.sup.NADPH None 4.1 1095 11.1 159 19 (K9_Ursala) F53L 10.8 324 13.4 26 15 (K9_Lucy) F53I 27.3 2558 13.7 27 48 (K9_Ilya) F53M 9.6 313 13.9 41 11 F53V 13.5 431 18.3 48 12 F53P 10.1 439 14.7 40 16 (K9_Pria) F53S 6.7 762 10.4 104 11 F53A 9.0 1132 10.1 75 17 F53E 8.9 383 12.2 47 11 F53Q 7.4 1272 13.7 108 22
TABLE-US-00023 TABLE 14B Amino Acid Substitutions in K9_Ursula, K9_Lucy, K9_Ilya Amino Acid Seq ID Variant No: Amino Acid Substitutions K9_Ursula 239 Y53F, S56V, K57E, S58E, N87P K9_Lucy 300 Y53L, S56V, K57E, S58E, N87P K9_Ilya 301 Y53I, S56V, K57E, S58E, N87P
Purification and Kinetic Analysis of K9_Lucy and K9_llya
[0351] For expression and characterization, E. coli plasmids (pBAD.KARI) were used to transform an electro-competent strain of E. coli Bw25113 (ilvC) using a BioRad Gene Pulser II (Bio-Rad Laboratories Inc., Hercules, Calif.). The transformed clones were spread on agar plates containing the LB medium and 100 g/ml ampicillin (#101320-154, Teknova Inc. Hollister, Calif.) and incubated at 37 C. overnight. A single transformant for each strain was streaked out onto LB plates with 100 g/mL ampicillin. A single colony from each of these plates was used to inoculate 10 mL LB broth with 100 g/mL ampicillin. These cultures were grown for 8 hours at 37 C. with shaking in 125 mL baffled flasks with vented, filtered lids. 200 L of this culture was used to inoculate two 500 mL baffled flasks with filtered vented lids containing LB broth with 100 g/mL ampicillin and 0.2% (w/v) arabinose. The expression cultures were grown for 16-18 hours at 37 C. with shaking. Cells were harvested in 40 mL aliquots via centrifugation; the supernatant was discarded and cell pellets were frozen at 80 C. until purification.
[0352] K9_Lucy and K9_llya variants were purified using the same process. Two cell pellets, representing 40 mL cell culture aliquots each, were resuspended in 4 mL Bug Buster Master Mix (Novagen 71456, Darmstadt, Germany) and incubated for 15 minutes at room temperature followed by 15 minutes at 60 C. Denatured proteins and cell debris was pelleted by centrifugation at 7,000 rpm for 30 minutes and 4 C. The supernatant was decanted, save and filtered through a Acrodisc 0.2 m syringe filter (PN4192, Pall, Ann Arbor, Mich.). K9_Lucy and K9_llya was purified from the filtered heat treated cell free extract using a GE Healthcare HiLoad 26/60 Superdex 200 gel filtration column (17-1071-01, Buckinghamshire, England). The column was pre-equilibrated with 0.2 CV equilibration with 50 mM HEPES (pH 7.5) 5 mM MgCl.sub.2 buffer at a 2.0 mL/min flow rate prior to protein loading. K9_Lucy and K9_llya were eluted over a 1.5 CV isocratic step consisting of 50 mM HEPES (pH 7.5) 5 mM MgCl.sub.2 buffer at a 2.0 mL/min flow rate. Fractions 2.5 mL in volume were collected using a Frac-950 fraction collector (Buckinghamshire, England) in a serpentine pattern. Variants all eluted between fractions D5-E5 or D6-E4. Fractions were pooled using a 15 mL Amicon Ultra YM-30 spin filter (UF0903008, Millipore, Billercia, Mass.) and washed with 10 mL 100 mM HEPES (pH 6.8) and 10 mM MgCl.sub.2 buffer. Filtrate was discarded and the purified protein was eluted from the membrane using 1 mL buffer containing 100 mM HEPES (pH 6.8) and 10 mM MgCl.sub.2. Kinetic parameters for purified proteins (Table 15) were determined in the same manner as described in Example 6 for E. coli crude extracts.
TABLE-US-00024 TABLE 15 Kinetic Values for Purified K9_Ursula Derivatives V.sub.max K.sub.m V.sub.max K.sub.m NADPH, NADPH, NADH, NADH, V.sub.max/K.sub.M.sup.NADH/ Variant U/mg M U/mg M V.sub.max/K.sub.M.sup.NADPH K9_Lucy 3.9 408 5.9 32 19 K9_Ilya 4.8 378 6.7 31 17
Example 11
Site Directed Mutadenesis of K9YW and K9JM Variants and Derivatives
[0353] Site directed mutagenesis of the K9SB2_SH derivatives was performed to incorporate additional amino acid replacements. Mutagenesis was performed as described in Example 10 with modifications. For mutagenesis reactions performed with variants in a yeast shuttle plasmid, the 68 C. step during the temperature cycling was increased from 4.0 min to 10 min.
[0354] Variant K9ALL3 (in a yeast shuttle plasmid) was derived from K9YW25 employing primers AlaLL1 (CCAGATGAAGCTCAGGCTTTGTTGTACAAAAACGACATCGAACC, SEQ ID NO: 692) and AlaLL1rev (GGT TCG ATG TCG TTT TTG TAC AAO AAA GCC TGA GCT TCA TCT GG, SEQ ID NO: 693). The mutagenesis reaction contained 1 l K9YW25_DHAD (generated via mutagenesis of K9SB2_SH_DHAD in Example 1) (50 ng/l), 1 ul of a mix of primers ALL1 and ALL1rev (10 uM each), 5 l of 10 reaction buffer, 1 l of dNTP mix, 1.5 l of QuikSolution reagent, 1 l of QuikChange Lightning Enzyme and 39.5 l of ddH.sub.2O. For expression in E. coli, the gene for K9ALL3 was subcloned into the Pmel and Sfil sites of the JEA1.PS.pBAD plasmid (SEQ ID NO: 238).
[0355] Variant K9ALL191 (in an E. coli expression plasmid) was derived from K9ALL3 employing primers T191S (CTTGGAAACTACCTTCAGATCCGAAACTGAAACCGACTTGTTC, SEQ ID NO: 694) and T191Srev (GAA CAA GTC GGT TTC AGT TTC GGA TCT GAA GGT AGT TTC CAA G, SEQ ID NO: 695). The mutagenesis reaction contained 1 l K9ALL3 in a pBAD.KARI (SEQ ID NO: 530) plasmid (50 ng/l), 1 l of a mix of primers (10 uM each), 5 l of 10 reaction buffer, 1 l of dNTP mix, 1.5 l of QuikSolution reagent, 1 l of QuikChange Lightning Enzyme and 39.5 l of ddH.sub.2O.
[0356] Variant K9ALL254 (in an E. coli expression plasmid) was derived from K9ALL3 employing primers Y254F (GTTTCTCCGGTATGCGTTTCTCTATCTCCAACACTG, SEQ ID NO: 696) and Y254 Frev (CAGTGTTGGAGATAGAGAAACGCATACCGGAGAAAC, SEQ ID NO: 697). The mutagenesis reaction contained 1 l K9ALL3 in a pBAD.KARI plasmid (50 ng/l), 1 l of a mix of the above primers (10 uM each), 5 l of 10 reaction buffer, 1 l of dNTP mix, 1.5 l of QuikSolution reagent, 1 l of QuikChange Lightning Enzyme and 39.5 l of ddH.sub.2O.
[0357] Variant K9ALL278 (in an E. coli expression plasmid) was derived from K9ALL3 employing primers K278M (CATTACTGAAGATACCAAGATGGCTATGAAGAAGATTTTGTCTGAC, SEQ ID NO: 698) and K278Mrev (GTCAGACAAAATCTTCTTCATAGCCATCTTGGTATCTTCAGTAATG, SEQ ID NO: 699). The mutagenesis reaction contained 1 l K9ALL3 in a pBAD.KARI plasmid (50 ng/l), 1 l of a mix of the above primers (10 uM each), 5 l of 10 reaction buffer, 1 l of dNTP mix, 1.5 l of QuikSolution reagent, 1 l of QuikChange Lightning Enzyme and 39.5 l of ddH.sub.2O.
[0358] Variant K9JM191 (in an E. coli expression plasmid) was derived from K9JM11 employing primers T191S (CTTGGAAACTACCTTCAGATCCGAAACTGAAACCGACTTGTTC, SEQ ID NO: 700) and T191Srev (GAA CAA GTC GGT TTC AGT TTC GGA TCT GAA GGT AGT TTC CAA G, SEQ ID NO: 701). The mutagenesis reaction contained 1 l K9JM11 in pBAD.KARI (SEQ ID NO: 259) (50 ng/l), 1 l of mix of primers (10 uM each), 5 l of 10 reaction buffer, 1 l of dNTP mix, 1.5 l of QuikSolution reagent, 1 l of QuikChange Lightning Enzyme and 39.5 l of ddH.sub.2O. For yeast studies, K9JM191 was subcloned into the Pmel and Sfil sites of K9_David_DHAD.
[0359] Variant K9YW25-T191S (in an E. coli expression plasmid) was derived from K9YW25 employing primers T191S (CTTGGAAACTACCTTCAGATCCGAAACTGAAACCGACTTGTTC, SEQ ID NO: 702) and T191Srev (GAA CAA GTC GGT TTC AGT TTC GGA TCT GAA GGT AGT TTC CAA G, SEQ ID NO: 703). The mutagenesis reaction contained 1 l K9YW25 in pBAD.KARI (50 ng/l), 1 l of mix of T191S and T191Srev (10 uM each), 2.5 l of 10 reaction buffer, 0.5 l of dNTP mix, 0.75 l of QuikSolution reagent, 0.5 l of QuikChange Lightning Enzyme and 19.25 l of ddH.sub.2O. The following conditions were used for the reaction: The starting temperature was 95 C. for 2 min followed by 18 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 3.0 min. At the completion of the temperature cycling, the samples were incubated at 68 C. for 5.0 min and then held awaiting sample recovery at 4 C.
[0360] Variant K9ALL258 (in a yeast shuttle plasmid) was derived from K9ALL3 employing primers 258-1 (GGTATGCGTTACTCTATCTCCTCCACTGCTGAATACGGTGACTAC, SEQ ID NO: 704) and 258-1r (GTA GTC ACC GTA TTC AGC AGT GGA GGA GAT AGA GTA ACG CAT ACC; SEQ ID NO: 705). The mutagenesis reaction contained 1 l pLH689::ALL3 (SEQ ID NO: 304) (50 ng/l), 1 ul of a mix of primers 258-1 and 258-1r (10 uM each), 5 l of 10 reaction buffer, 1 l of dNTP mix, 1.5 l of QuikSolution reagent, 1 l of QuikChange Lightning Enzyme and 39.5 l of ddH2O.
[0361] Additional variants in yeast shuttle plasmids were prepared employing in mutagenesis reactions containing mixtures of K9ALL3 and K9JM11 templates. Each reaction contained 0.5 l K9JM11_DHAD (50 ng/l), 0.5 l K9ALL3 DHAD (SEQ ID NO: 533) (50 ng/l), 1 l of a primer mix listed in Table (10 uM each primer), 5 l of 10 reaction buffer, 1 l of dNTP mix, 1.5 l of QuikSolution reagent, 1 l of QuikChange Lightning Enzyme and 39.5 l of ddH.sub.2O.
TABLE-US-00025 TABLE16 PrimerMixesforSiteDirectedMutagenesis ofK9ALL3/K9JM11 Pri- Mix mers Sequence 37 H37N1 GTTCTCAAGGTCACGCTAATGCCCTGAATGCTAAGG AATC(SEQIDNO:554) 37 H37N1 GATTCCTTAGCATTCAGGGCATTAGCGTGACCTTGA rev GAAC(SEQIDNO:555) 50/45 G45C CCTGAATGCTAAGGAATCCTGTTGTAACGTTATCATT GG(SEQIDNO:556) 50/45 G45C CCAATGATAACGTTACAACAGGATTCCTTAGCATTCA rev GG(SEQIDNO:557) 50/45 I50V- GGTTGTAACGTTATCGTTGGTTTATTCGAAGGTGCG FA GAGG(SEQIDNO:558) 50/45 I50V- CCTCCGCACCTTCGAATAAACCAACGATAACGTTAC FArev AACC(SEQIDNO:559) 66 G66A GAAAAGAGCTGAAGAACAAGCTTTCGAAGTCTACAC C(SEQIDNO:560) 66 G66A GGTGTAGACTTCGAAAGCTTGTTCTTCAGCTCTTTTC rev (SEQIDNO:561) 148 E148G GTTAGATCCGAATACGAAGGTGGTAAAGGTGTCCCA TGCTTGG(SEQIDNO:562) 148 E148G CCAAGCATGGGACACCTTTACCACCTTCGTATTCGG rev ATCTAAC(SEQIDNO:563) 148 E148Q GTTAGATCCGAATACGAACAAGGTAAAGGTGTCCCA TGCTTGG(SEQIDNO:564) 148 E148Q CCAAGCATGGGACACCTTTACCTTGTTCGTATTCGG rev ATCTAAC(SEQIDNO:565) 156 V156A GIGTCCCATGCTTGGCCGCTGTCGAACAAGACGC (SEQIDNO:566) 156 V156A GCGTCTTGTTCGACAGCGGCCAAGCATGGGACAC rev (SEQIDNO:567) 191 T191S CTTGGAAACTACCTTCAGATCCGAAACTGAAACCGA CTTGTTC(SEQIDNO:568) 191 T191S GAACAAGTCGGTTTCAGTTTCGGATCTGAAGGTAGT rev TTCCAAG(SEQIDNO:569) 254 Y254F GTTTCTCCGGTATGCGTTTCTCTATCTCCAACACTG (SEQIDNO:570) 254 Y254F CAGTGTTGGAGATAGAGAAACGCATACCGGAGAAA rev C(SEQIDNO:571)
[0362] The amino acid substitutions of the variants prepared are provided in Table 17.
TABLE-US-00026 TABLE 17 Amino Acid Substitutions of K9SB2_SH Variants Amino Acid Seq Variant ID No: Amino Acid Substitutions K9ALL3 237 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L K9ALL8Q 253 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, E148Q K9ALL37 249 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, H37N K9ALL45 255 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, G45C K9ALL66 251 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, G66A K9ALL148 241 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, E148G K9ALL156 243 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, V156A K9ALL191 245 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, T191S K9ALL254 247 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, Y254F K9ALL278 248 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, K278M K9JM37S 250 Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, H37N K9JM66 252 Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, G66A K9JM148 242 Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, E148Q K9JM156 244 Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, V156A K9JM191 246 Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, T191S K9YW25 132 Y53F, S56A, K57E, S58E, N87P, K90A, T93L K9YW25- 303 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, T191S T191S K9ALL258 302 Y53F, S56A, K57E, S58E, N87P, K90A, T93L, M94L, N258S K9JM8Q 254 Y53F, S56A, K57E, S58E, N87P, K90Y, M94L, E148Q
Example 12
Kinetic Characterization of Site Directed K9 Variants
[0363] A subset of the variants prepared in Example 11 were expressed in E. coli and analyzed as described Example 6. Three additional variants (K9JM36, K9JM43, K9JM44) described in Example 3 were subcloned into the Pmel and Sfil sites of the JEA1.PS.pBAD plasmid (SEQ ID NO: 238), expressed in E. coli, and analyzed in the same manner. The kinetic parameters for the KARI reactions with NADH and NADPH as cofactors are provided in Table 18.
TABLE-US-00027 TABLE 18 Kinetic Parameters for E. coli extracts containing K9 Variants V.sub.max K.sub.M V.sub.max K.sub.M NADPH, NADPH, NADH, NADH, V.sub.max/K.sub.M.sup.NADH/ Variant U/ml M U/ml M V.sub.max/K.sub.M.sup.NADPH K9SB2_SH 0.49 62 0.56 16 5 K9ALL3 4.3 204 4.5 21 10 K9ALL191 6.0 129 5.7 14 9 K9ALL254 4.9 216 5.2 21 11 K9JM11 3.8 205 4.3 26 9 K9JM191 4.8 120 5.3 17 8 K9YW25 10.0 130 10.5 14 10 K9YW25- 13.5 78 13.3 13 6 191 K9JM36 3.5 232 4.1 28 10 K9JM43 3.9 211 4.0 28 8 K9JM44 5.3 215 5.3 25 9
Example 13
Construction of a Site-Saturation Gene Library Targeting Position 158 and Screening the Isobutanol Production of the Resultant Variants in PNY2068
[0364] The forward primer mixture (called K9_158f in this example) containing primers encoding all 19 individual amino acid changes at the amino acid corresponding to position 158 of the wild-type Anaerostipes caccae KARI sequence (SEQ ID NO: 93) (Table 19) and the reverse primer K9 309T_111711r: CTTTCTCATAGCCTTAGTGTGGAC (SEQ ID NO: 415; called K9_309Tr in this example) were employed to create a single-site saturation library targeting the position of 158 of K9 KARI. A plasmid containing the variant K9SB2_SH (plasmid K85B2_SH_81, SEQ ID NO: 532) was used as the template.
[0365] In brief, a megaprimer was prepared through a regular FOR. The megaprimer FOR mixture consisted of 45 l of SuperMix (Invitrogen, Carlsbad, Calif., #10572063), 2.0 l K9_158f (20 M), 2.0 l K9_309Tr (20 M) and 1.0 l template (50 ng/l). The PCR program for making the megaprimer is: the starting temperature was 95 C. for 1.0 min followed by 35 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 55 C. for 20 sec, and 72 C. for 1.0 min. The megaprimer was then used to introduce mutation into K9SB2_SH using the same procedure as shown in Example 5 (U.S. application Ser. No. 13/428,585, filed Mar. 23, 2012, incorporated herein by reference). The PCR product was transformed into E. coli. Bw25113 ( ilvC) and clones were sequenced.
[0366] The resultant variants with unique sequences together with K8SB2_SH_81 were analyzed for isobutanol production in yeast strain PNY2068 (triple for each mutant). The plasmid having K9 KARI variants and the plasmid pYZ067ADHKivD were transformed into the yeast strain PNY2068. The transformed cells were plated on synthetic medium without histidine and uracil (1% ethanol as carbon source). Three transformants were transferred to fresh plates of the same media. The transformants were tested for isobutanol production under anaerobic conditions in 48-well plates (Axygen, Union City, Calif. #391-05-061). The promising transformants were further tested for isobutanol production under anaerobic conditions in 15 ml serum vials.
[0367] Yeast colonies from the transformation on SE-Ura-His plates appeared after 5-7 days. The three colonies from each variant were patched onto fresh SE-Ura-His plates, and incubated at 30 C. for 3 days.
Growth Media and Procedure
[0368] Two types of media were used during the growth procedure of yeast strains: an aerobic pre-culture media and an anaerobic culture media. All chemicals were obtained from Sigma unless otherwise noted (St. Louis, Mo.).
[0369] Aerobic pre-culture media (SE-Ura): 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.2% ethanol, 0.2% glucose, 0.01% w/v leucine, 0.002% w/v histidine, and 0.002% w/v tryptophan.
[0370] Anaerobic culture media (SEG-Ura-His): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.1% ethanol, 3% glucose, 0.01% leucine, 0.002% w/v histidine, 0.002% tryptophan, 30 mg/L nicotinic acid, 30 mg/L thiamine and 10 mg/L ergosterol made up in 50/50 v/v Tween/ethanol solution.
[0371] The patched cells were inoculated into 48-well plates. Each well contains 1.5 ml aerobic media. The plates were covered with permeable foils and grown at 30 C. with shaking overnight. The cell density (OD.sub.600) was then measured. The amount of cells to make a 1.5 ml of cell suspension (in anaerobic media) with the final OD.sub.600=0.2 for each well were calculated, and a 1.5 ml cell suspension was prepared with anaerobic media and added into each well. Oxygen in 48-well plates was removed using an anaerobic chamber following the manufacturer's protocol (Coy Laboratory Products Inc. Grass Lake, Mich.). Cells were then grown at 30 C. with shaking for two days. After two days of anaerobic growth, the cell density (OD.sub.600) was then measured. Cells were centrifuged at 4,000 g for 5 min and the supernatant was collected for the isobutanol measurement using liquid chromatography/mass spectrometry (LC/MS).
[0372] Based on 48-well plate data, the top performers were chosen and patched. The patched cells were inoculated into 24-well plates. Each well contains 3.0 ml aerobic media. The plates were covered with permeable foils and grown at 30 C. with shaking overnight. The cell density (OD.sub.600) was then measured. The amount of cells to make a 10 ml of cell suspension (in anaerobic media) with the final OD.sub.600=0.2 for each vial were calculated, and a 10 ml cell suspension was prepared with anaerobic media and added into each vial. Each vial was capped and cells were then grown at 30 C. with shaking for two days. After two days of anaerobic growth, the cell density (OD.sub.600) was then measured. Cells were centrifuged at 4,000 g for 5 min and the supernatant was collected for the isobutanol measurement using LC/MS.
LC/MS Analysis of Yeast Strains with K9 KARI Mutants
[0373] Samples were taken for LC/MS analysis at the end of the anaerobic growth period. LC/MS analysis was performed using a Waters AcQuity UPLC separations unit and AcQuity TQD triple quad mass spectrometer (Waters, Milford, Mass.) with a Waters AcQuity UPLC HSS T3 separations column (Waters, Milford, Mass.). Compounds were separated using a reverse phase gradient of water (+0.1% formic acid) and acetonitrile (+0.1% formic acid) starting with 99% aqueous and ending with 99% organic, at a flow rate of 0.5 mL/min. Chromatograms were analyzed using Waters Masslynx 4.1 software (Waters, Milford, Mass.). Micro molar yields for isobutanol were calculated using Waters Quanlynx software (Waters, Milford, Mass.) using a calibration curve of triplicate analyses of standards.
TABLE-US-00028 TABLE19 ForwardPrimers Targeted position(s) ofK9- KARI Primers 158 K9_158C_011212f GCTTGGTTGCTTGTGAACAAGAC (SEQIDNO:416) K9_158S_011212f GCTTGGTTGCTTCTGAACAAGAC (SEQIDNO:417) K9_158L_022312f GCTTGGTTGCTTTGGAACAAGAC (SEQIDNO:418) K9_158F_022312f GCTTGGTTGCTTTTGAACAAGAC (SEQIDNO:419) K9_158Y_022312f GCTTGGTTGCTTATGAACAAGAC (SEQIDNO:420) K9_158W_022312f GCTTGGTTGCTTGGGAACAAGAC (SEQIDNO:421) K9_158P_022312f GCTTGGTTGCTCCAGAACAAGAC (SEQIDNO:422) K9_158H_022312f GCTTGGTTGCTCATGAACAAGAC (SEQIDNO:423) K9_158Q_022312f GCTTGGTTGCTCAAGAACAAGAC (SEQIDNO:424) K9_158A_022312f GCTTGGTTGCTGCTGAACAAGAC (SEQIDNO:425) K9_158D_022312f GCTTGGTTGCTGATGAACAAGAC (SEQIDNO:426) K9_158E_022312f GCTTGGTTGCTGAAGAACAAGAC (SEQIDNO:427) K9_158G_022312f GCTTGGTTGCTGGTGAACAAGAC (SEQIDNO:428) K9_158I_022312f GCTTGGTTGCTATTGAACAAGAC (SEQIDNO:429) K9_158M_022312f GCTTGGTTGCTATGGAACAAGAC (SEQIDNO:430) K9_158T_022312f GCTTGGTTGCTACTGAACAAGAC (SEQIDNO:431) K9_158R_022312f GCTTGGTTGCTAGAGAACAAGAC (SEQIDNO:432) K9_158K_022312f GCTTGGTTGCTAAGGAACAAGAC (SEQIDNO:433) K9_158N_022312f GCTTGGTTGCTAACGAACAAGAC (SEQIDNO:434)
TABLE-US-00029 TABLE 20 Isobutanol production of some K9 variants in stain PNY2068 Nucleic Acid Amino Acid SEQ ID Variant Seq ID No: NO: Repeat Isobutanol titer (mM) ECB11 534 512 1 69.8 2 74.3 3 66.6 EC2A2 535 513 1 73.1 2 67.5 3 72.2 EC2B12 536 514 1 71.2 2 71.5 3 71.0 K9SB2_SH 94 1 63.6 2 66.2 3 57.7
Example 14
Construction of a Site-Saturation Gene Library Targeting Position 67 and Screening the Isobutanol Production of the Resultant Variants in PNY2115
[0374] The forward primer mixture (called K9_67f in this example) containing primers encoding all 19 individual amino acid changes at the amino acid corresponding to position 67 of the wild-type Anaerostipes caccae KARI sequence (SEQ ID NO: 93) (Table 21) and the reverse primer K9_309T_111711r: CTTTCTCATAGCCTTAGTGTGGAC (SEQ ID NO: 415; called K9_309Tr in this example) were employed to create a single-site saturation library targeting the position of 67 of K9 KARI. A plasmid containing the variant K9SB2_SH (K85B2_SH_81, SEQ ID NO: 532) was used as the template.
[0375] In brief, a megaprimer was prepared through a regular FOR. The megaprimer FOR mixture consisted of 45 l of SuperMix (Invitrogen, Carlsbad, Calif., #10572063), 2.0 l K9_67f (20 M), 2.0 l K9_309Tr (20 M) and 1.0 l template (50 ng/l). The PCR program for making the megaprimer is: the starting temperature was 95 C. for 1.0 min followed by 35 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 55 C. for 20 sec, and 72 C. for 1.0 min. The PCR product was cleaned up using a DNA cleaning kit (Cat#D4003, Zymo Research, Orange, Calif.) as recommended by the manufacturer.
[0376] The Megaprimers were then used to generate a gene library using the QuickChange Lightning kit (Stratagene #210518, La Jolla Calif.). A 25 l reaction mixture contained: 2.5 l of 10 reaction buffer, 0.5 l of 50 ng/l template, 20.25 l of Megaprimer, 0.5 l of 40 mM dNTP mix, 0.5 l enzyme mixture and 0.75 l QuickSolution. Except for the Megaprimer and the templates, all reagents used here were supplied with the kit indicated above. This reaction mixture was placed in a thin well 200 l-capacity FOR tube and the following reactions were used for the FOR: The starting temperature was 95 C. for 2 min followed by 20 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 5 min. At the completion of the temperature cycling, the samples were kept at 68 C. for 10 min more, and then held at 4 C. for later processing. 0.5 l Dpn I was added into the finished FOR reaction mixture and then incubated at 37 C. for 2 hr. The PCR product was cleaned up using a DNA cleaning kit (Cat#D4003, Zymo Research, Orange, Calif.) as recommended by the manufacturer. The PCR product was transformed into E. coli. Bw25113 ( ilvC) and clones were sequenced.
[0377] The resultant variants with unique sequences together with K8SB2_SH_81 were analyzed for isobutanol production in yeast strain PNY2115 (triple for each mutant). The plasmid having K9 KARI variants and the plasmid pYZ067ADHKivD were transformed into the yeast host PNY2115. The transformed cells were plated on synthetic medium without histidine and uracil (1% ethanol as carbon source). Three transformants were transferred to fresh plates of the same media. The transformants were tested for isobutanol production under anaerobic conditions in 48-well plates (Axygen, Union City, Calif. #391-05-061). The promising transformants were further tested for isobutanol production under anaerobic conditions in 15 ml serum vials.
[0378] Yeast colonies from the transformation on SE-Ura-His plates appeared after 5-7 days. The three colonies from each variant were patched onto fresh SE-Ura-His plates, and incubated at 30 C. for 3 days.
Growth Media and Procedure
[0379] Two types of media were used during the growth procedure of yeast strains: an aerobic pre-culture media and an anaerobic culture media. All chemicals were obtained from Sigma unless otherwise noted (St. Louis, Mo.).
[0380] Aerobic pre-culture media (SE-Ura): 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.2% ethanol, 0.2% glucose, 0.01% w/v leucine, 0.002% w/v histidine, and 0.002% w/v tryptophan.
[0381] Anaerobic culture media (SEG-Ura-His): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.1% ethanol, 3% glucose, 0.01% leucine, 0.002% w/v histidine, 0.002% tryptophan, 30 mg/L nicotinic acid, 30 mg/L thiamine and 10 mg/L ergosterol made up in 50/50 v/v Tween/ethanol solution.
[0382] The patched cells were inoculated into 48-well plates. Each well contains 1.5 ml aerobic media. The plates were covered with permeable foils and grown at 30 C. with shaking overnight. The cell density (OD.sub.600) was then measured. The amount of cells to make a 1.5 ml of cell suspension (in anaerobic media) with the final OD.sub.600=0.2 for each well were calculated, and a 1.5 ml cell suspension was prepared with anaerobic media and added into each well. 48-well plates were sealed with aluminum foil. Cells were then grown at 30 C. with shaking for three days. After three days of anaerobic growth, the cell density (OD.sub.600) was then measured. Cells were centrifuged at 4,000 g for 5 min and the supernatant was collected for the isobutanol measurement using LC/MS.
[0383] Based on 48-well plate data, the top performers were chosen and patched. The patched cells were inoculated into 24-well plates. Each well contains 3.0 ml aerobic media. The plates were covered with permeable foils and grown at 30 C. with shaking overnight. The cell density (OD.sub.600) was then measured. The amount of cells to make a 10 ml of cell suspension (in anaerobic media) with the final OD.sub.600=0.2 for each vial were calculated, and a 10 ml cell suspension was prepared with anaerobic media and added into each vial. Each vial was capped and cells were then grown at 30 C. with shaking for three days. After three days of anaerobic growth, the cell density (OD.sub.600) was then measured. Cells were centrifuged at 4,000 g for 5 min and the supernatant was collected for the isobutanol measurement using LC/MS.
LC/MS Analysis of Yeast Strains with K9 KARI Mutants
[0384] Samples were taken for LC/MS analysis at the end of the anaerobic growth period. LC/MS analysis was performed using a Waters AcQuity UPLC separations unit and AcQuity TQD triple quad mass spectrometer (Waters, Milford, Mass.) with a Waters AcQuity UPLC HSS T3 separations column (Waters, Milford, Mass.). Compounds were separated using a reverse phase gradient of water (+0.1% formic acid) and acetonitrile (+0.1% formic acid) starting with 99% aqueous and ending with 99% organic, at a flow rate of 0.5 mL/min. Chromatograms were analyzed using Waters Masslynx 4.1 software (Waters, Milford, Mass.). Micro molar yields for isobutanol were calculated using Waters Quanlynx software (Waters, Milford, Mass.) using a calibration curve of triplicate analyses of standards.
TABLE-US-00030 TABLE22 ForwardPrimers Targeted position(s) ofK9-KARI Primers 67 K9_67L_011212f GAAGAACAAGGTTTGGAAGTC (SEQIDNO:435) K9_67C_011212f GAAGAACAAGGTTGTGAAGTC (SEQIDNO:436) K9_67S_011212f GAAGAACAAGGTTCTGAAGTC (SEQIDNO:437) K9_67Y_011212f GAAGAACAAGGTTATGAAGTC (SEQIDNO:438) K9_67W_011212f GAAGAACAAGGTTGGGAAGTC (SEQIDNO:439) K9_67V_011212f GAAGAACAAGGTGTTGAAGTC (SEQIDNO:440) K9_67A_011212f GAAGAACAAGGTGCTGAAGTC (SEQIDNO:441) K9_67D_011212f GAAGAACAAGGTGATGAAGTC (SEQIDNO:442) K9_67E_011212f GAAGAACAAGGTGAAGAAGTC (SEQIDNO:443) K9_67G_011212f GAAGAACAAGGTGGTGAAGTC (SEQIDNO:444) K9_67I_011212f GAAGAACAAGGTATTGAAGTC (SEQIDNO:445) K9_67M_011212f GAAGAACAAGGTATGGAAGTC (SEQIDNO:446) K9_67T_011212f GAAGAACAAGGTACTGAAGTC (SEQIDNO:447) K9_67R_011212f GAAGAACAAGGTAGAGAAGTC (SEQIDNO:448) K9_67K_011212f GAAGAACAAGGTAAGGAAGTC (SEQIDNO:449) K9_67N_011212f GAAGAACAAGGTAACGAAGTC (SEQIDNO:450) K9_67Q_011212f GAAGAACAAGGTCAAGAAGTC (SEQIDNO:451) K9_67H_011212f GAAGAACAAGGTCATGAAGTC (SEQIDNO:452) K9_67P_011212f GAAGAACAAGGTCCAGAAGTC (SEQIDNO:453)
TABLE-US-00031 TABLE 23 Isobutanol production of some K9 variants in stain PNY2115 Nucleic Acid Amino Acid SEQ ID Variant Seq ID No: NO: Repeat Isobutanol titer (mM) EGC10 537 515 1 86.0 2 94.7 3 101.6 EGG8 539 517 1 103.6 2 116.6 3 96.9 EGD9 538 516 1 112.4 2 103.6 3 102.3 K9SB2_SH 94 1 99.0 2 90.4 3 84.2
Example 15
[0385] Construction of a Site-Saturation Gene Library Targeting Position 162 and Screening the Isobutanol Production of the Resultant Variants in PNY2115
[0386] The forward primer mixture (called K9_162f in this example) containing primers encoding all 19 individual amino acid changes at the amino acid corresponding to position 162 of the wild-type Anaerostipes caccae KARI sequence (SEQ ID NO: 93) (Table 24 and the reverse primer K9_309 T_111711r: CTTTCTCATAGCCTTAGTGTGGAC (SEQ ID NO: 415; called K9_309Tr in this example) were employed to create a single-site saturation library targeting the position of 162 of K9 KARI. A plasmid containing the variant K9SB2_SH (or K85B2_SH_81) was used as the template.
[0387] In brief, a megaprimer was prepared through a regular FOR. The megaprimer FOR mixture consisted of 45 l of SuperMix (Invitrogen, Carlsbad, Calif., #10572063), 2.0 l K9_162f (20 M), 2.0 l K9_309Tr (20 M) and 1.0 l template (50 ng/l). The PCR program for making the megaprimer is: the starting temperature was 95 C. for 1.0 min followed by 35 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 55 C. for 20 sec, and 72 C. for 1.0 min. The PCR product was cleaned up using a DNA cleaning kit (Cat#D4003, Zymo Research, Orange, Calif.) as recommended by the manufacturer.
[0388] The Megaprimers were then used to generate a gene library using the QuickChange Lightning kit (Stratagene #210518, La Jolla Calif.). A 25 l reaction mixture contained: 2.5 l of 10 reaction buffer, 0.5 l of 50 ng/l template, 20.25 l of Megaprimer, 0.5 l of 40 mM dNTP mix, 0.5 l enzyme mixture and 0.75 l QuickSolution. Except for the Megaprimer and the templates, all reagents used here were supplied with the kit indicated above. This reaction mixture was placed in a thin well 200 l-capacity FOR tube and the following reactions were used for the FOR: The starting temperature was 95 C. for 2 min followed by 20 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 5 min. At the completion of the temperature cycling, the samples were kept at 68 C. for 10 min more, and then held at 4 C. for later processing. 0.5 l Dpn I was added into the finished FOR reaction mixture and then incubated at 37 C. for 2 hr. The PCR product was cleaned up using a DNA cleaning kit (Cat#D4003, Zymo Research, Orange, Calif.) as recommended by the manufacturer. The PCR product was transformed into E. coli. Bw25113 ( ilvC) and clones were sequenced.
[0389] The resultant variants with unique sequences together with K8SB2_SH_81 were analyzed for isobutanol production in yeast strain PNY2115 (triple for each mutant). The plasmid having K9 KARI variants and the plasmid pYZ067ADHKivD were transformed into the yeast host PNY2115. The transformed cells were plated on synthetic medium without histidine and uracil (1% ethanol as carbon source). Three transformants were transferred to fresh plates of the same media. The transformants were tested for isobutanol production under anaerobic conditions in 48-well plates (Axygen, Union City, Calif. #391-05-061). The promising transformants were further tested for isobutanol production under anaerobic conditions in 15 ml serum vials.
[0390] Yeast colonies from the transformation on SE-Ura-His plates appeared after 5-7 days. The three colonies from each variant were patched onto fresh SE-Ura-His plates, and incubated at 30 C. for 3 days.
Growth Media and Procedure
[0391] Two types of media were used during the growth procedure of yeast strains: an aerobic pre-culture media and an anaerobic culture media. All chemicals were obtained from Sigma unless otherwise noted (St. Louis, Mo.).
[0392] Aerobic pre-culture media (SE-Ura): 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.2% ethanol, 0.2% glucose, 0.01% w/v leucine, 0.002% w/v histidine, and 0.002% w/v tryptophan.
[0393] Anaerobic culture media (SEG-Ura-His): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.1% ethanol, 3% glucose, 0.01% leucine, 0.002% w/v histidine, 0.002% tryptophan, 30 mg/L nicotinic acid, 30 mg/L thiamine and 10 mg/L ergosterol made up in 50/50 v/v Tween/ethanol solution.
[0394] The patched cells were inoculated into 48-well plates. Each well contains 1.5 ml aerobic media. The plates were covered with permeable foils and grown at 30 C. with shaking overnight. The cell density (OD.sub.600) was then measured. The amount of cells to make a 1.5 ml of cell suspension (in anaerobic media) with the final OD.sub.600=0.2 for each well were calculated, and a 1.5 ml cell suspension was prepared with anaerobic media and added into each well. 48-well plates were sealed with aluminum foil. Cells were then grown at 30 C. with shaking for three days. After three days of anaerobic growth, the cell density (OD.sub.600) was then measured. Cells were centrifuged at 4,000 g for 5 min and the supernatant was collected for the isobutanol measurement using LC/MS.
[0395] Based on 48-well plate data, the top performers were chosen and patched. The patched cells were inoculated into 24-well plates. Each well contains 3.0 ml aerobic media. The plates were covered with permeable foils and grown at 30 C. with shaking overnight. The cell density (OD.sub.600) was then measured. The amount of cells to make a 10 ml of cell suspension (in anaerobic media) with the final OD.sub.600=0.2 for each vial were calculated, and a 10 ml cell suspension was prepared with anaerobic media and added into each vial. Each vial was capped and cells were then grown at 30 C. with shaking for three days. After three days of anaerobic growth, the cell density (OD.sub.600) was then measured. Cells were centrifuged at 4,000 g for 5 min and the supernatant was collected for the isobutanol measurement using LC/MS.
LC/MS Analysis of Yeast Strains with K9 KARI Mutants
[0396] Samples were taken for LC/MS analysis at the end of the anaerobic growth period. LC/MS analysis was performed using a Waters AcQuity UPLC separations unit and AcQuity TQD triple quad mass spectrometer (Waters, Milford, Mass.) with a Waters AcQuity UPLC HSS T3 separations column (Waters, Milford, Mass.). Compounds were separated using a reverse phase gradient of water (+0.1% formic acid) and acetonitrile (+0.1% formic acid) starting with 99% aqueous and ending with 99% organic, at a flow rate of 0.5 mL/min. Chromatograms were analyzed using Waters Masslynx 4.1 software (Waters, Milford, Mass.). Micro molar yields for isobutanol were calculated using Waters Quanlynx software (Waters, Milford, Mass.) using a calibration curve of triplicate analyses of standards.
TABLE-US-00032 TABLE25 ForwardPrimers Targeted position(s) ofK9-KARI Primers 162 K9_162V_011212f GTCGAACAAGACGTTACTGGC (SEQIDNO:454) K9_162D_011212f GTCGAACAAGACGATACTGGC (SEQIDNO:455) K9_162E_011212f GTCGAACAAGACGAAACTGGC (SEQIDNO:456) K9_162G_011212f GTCGAACAAGACGGTACTGGC (SEQIDNO:457) K9_162F_011212f GTCGAACAAGACTTTACTGGC (SEQIDNO:458) K9_162L_011212f GTCGAACAAGACTTGACTGGC (SEQIDNO:459) K9_162C_011212f GTCGAACAAGACTGTACTGGC (SEQIDNO:460) K9_162S_011212f GTCGAACAAGACTCTACTGGC (SEQIDNO:461) K9_162Y_011212f GTCGAACAAGACTATACTGGC (SEQIDNO:462) K9_162W_011212f GTCGAACAAGACTGGACTGGC (SEQIDNO:463) K9_162I_011212f GTCGAACAAGACATTACTGGC (SEQIDNO:464) K9_162M_011212f GTCGAACAAGACATGACTGGC (SEQIDNO:465) K9_162T_011212f GTCGAACAAGACACTACTGGC (SEQIDNO:466) K9_162R_011212f GTCGAACAAGACAGAACTGGC (SEQIDNO:467) K9_162K_011212f GTCGAACAAGACAAGACTGGC (SEQIDNO:468) K9_162N_011212f GTCGAACAAGACAACACTGGC (SEQIDNO:469) K9_162Q_011212f GTCGAACAAGACCAAACTGGC (SEQIDNO:470) K9_162H_011212f GTCGAACAAGACCATACTGGC (SEQIDNO:471) K9_162P_011212f GTCGAACAAGACCCAACTGGC (SEQIDNO:472)
TABLE-US-00033 TABLE 26 Isobutanol production of some K9 variants in strain PNY2115 Nucleic Acid Amino Acid SEQ ID Variant Seq ID No: NO: Repeat Isobutanol titer (mM) EHG1 540 518 1 69.9 2 74.8 3 72.1 EHG2 541 519 1 80.8 2 70.5 3 65.8 EHH12 545 523 1 73.9 2 79.2 3 70.1 EHH10 544 522 1 75.9 2 81.9 3 79.4 EHH6 542 520 1 78.7 2 82.6 3 92.6 EHH9 543 521 1 <10 2 86.7 3 86.8 K9SB2_SH 94 1 67.3 2 60.7 3 76.1
Example 16
[0397] Construction of a Site-Saturation Gene Library Targeting Position 312 and Screening the Isobutanol Production of the Resultant Variants in PNY2115
[0398] The forward primer mixture (called K9_312r in this example) containing primers encoding all 19 individual amino acid changes at the amino acid corresponding to position 312 of the wild-type Anaerostipes caccae KARI sequence (SEQ ID NO: 93) (Table 27) and the reverse primer K9 219 032212f: GAAGCTGCTAAGAAGGCTGACATC (SEQ ID NO: 473; called K9_219f in this example) were employed to create a single-site saturation library targeting the position of 312 of K9 KARI. A plasmid containing the variant K9SB2_SH (or K85B2_SH_81) was used as the template.
[0399] In brief, a megaprimer was prepared through a regular FOR. The megaprimer FOR mixture consisted of 45 l of SuperMix (Invitrogen, Carlsbad, Calif., #10572063), 2.0 l K9_219f (20 M), 2.0 l K9_312r (20 M) and 1.0 l template (50 ng/l). The PCR program for making the megaprimer is: the starting temperature was 95 C. for 1.0 min followed by 35 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 55 C. for 20 sec, and 72 C. for 1.0 min. The PCR product was cleaned up using a DNA cleaning kit (Cat#D4003, Zymo Research, Orange, Calif.) as recommended by the manufacturer.
[0400] The Megaprimers were then used to generate a gene library using the QuickChange Lightning kit (Stratagene #210518, La Jolla Calif.). A 25 l reaction mixture contained: 2.5 l of 10 reaction buffer, 0.5 l of 50 ng/l template, 20.25 l of Megaprimer, 0.5 l of 40 mM dNTP mix, 0.5 l enzyme mixture and 0.75 l QuickSolution. Except for the Megaprimer and the templates, all reagents used here were supplied with the kit indicated above. This reaction mixture was placed in a thin well 200 l-capacity FOR tube and the following reactions were used for the FOR: The starting temperature was 95 C. for 2 min followed by 20 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 5 min. At the completion of the temperature cycling, the samples were kept at 68 C. for 10 min more, and then held at 4 C. for later processing. 0.5 l Dpn I was added into the finished FOR reaction mixture and then incubated at 37 C. for 2 hr. The PCR product was cleaned up using a DNA cleaning kit (Cat#D4003, Zymo Research, Orange, Calif.) as recommended by the manufacturer. The PCR product was transformed into E. coli. Bw25113 ( ilvC) and clones were sequenced.
[0401] The resultant variants with unique sequences together with K8SB2_SH_81 were analyzed for isobutanol production in yeast strain PNY2115 (triple for each mutant). The plasmid having K9 KARI variants and the plasmid pYZ067ADHKivD were transformed into the yeast host PNY2115. The transformed cells were plated on synthetic medium without histidine and uracil (1% ethanol as carbon source). Three transformants were transferred to fresh plates of the same media. The transformants were tested for isobutanol production under anaerobic conditions in 48-well plates (Axygen, Union City, Calif. #391-05-061). The promising transformants were further tested for isobutanol production under anaerobic conditions in 15 ml serum vials.
[0402] Yeast colonies from the transformation on SE-Ura-His plates appeared after 5-7 days. The three colonies from each variant were patched onto fresh SE-Ura-His plates, and incubated at 30 C. for 3 days.
Growth Media and Procedure
[0403] Two types of media were used during the growth procedure of yeast strains: an aerobic pre-culture media and an anaerobic culture media. All chemicals were obtained from Sigma unless otherwise noted (St. Louis, Mo.).
[0404] Aerobic pre-culture media (SE-Ura): 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.2% ethanol, 0.2% glucose, 0.01% w/v leucine, 0.002% w/v histidine, and 0.002% w/v tryptophan.
[0405] Anaerobic culture media (SEG-Ura-His): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.1% ethanol, 3% glucose, 0.01% leucine, 0.002% w/v histidine, 0.002% tryptophan, 30 mg/L nicotinic acid, 30 mg/L thiamine and 10 mg/L ergosterol made up in 50/50 v/v Tween/ethanol solution.
[0406] The patched cells were inoculated into 48-well plates. Each well contains 1.5 ml aerobic media. The plates were covered with permeable foils and grown at 30 C. with shaking overnight. The cell density (OD.sub.600) was then measured. The amount of cells to make a 1.5 ml of cell suspension (in anaerobic media) with the final OD.sub.600=0.2 for each well were calculated, and a 1.5 ml cell suspension was prepared with anaerobic media and added into each well. 48-well plates were sealed with aluminum foil. Cells were then grown at 30 C. with shaking for three days. After three days of anaerobic growth, the cell density (OD.sub.600) was then measured. Cells were centrifuged at 4,000 g for 5 min and the supernatant was collected for the isobutanol measurement using LC/MS.
[0407] Based on 48-well plate data, the top performers were chosen and patched. The patched cells were inoculated into 24-well plates. Each well contains 3.0 ml aerobic media. The plates were covered with permeable foils and grown at 30 C. with shaking overnight. The cell density (OD.sub.600) was then measured. The amount of cells to make a 10 ml of cell suspension (in anaerobic media) with the final OD.sub.600=0.2 for each vial were calculated, and a 10 ml cell suspension was prepared with anaerobic media and added into each vial. Each vial was capped and cells were then grown at 30 C. with shaking for three days. After three days of anaerobic growth, the cell density (OD.sub.600) was then measured. Cells were centrifuged at 4,000 g for 5 min and the supernatant was collected for the isobutanol measurement using LC/MS.
LC/MS Analysis of Yeast Strains with K9 KARI Mutants
[0408] Samples were taken for LC/MS analysis at the end of the anaerobic growth period. LC/MS analysis was performed using a Waters AcQuity UPLC separations unit and AcQuity TQD triple quad mass spectrometer (Waters, Milford, Mass.) with a Waters AcQuity UPLC HSS T3 separations column (Waters, Milford, Mass.). Compounds were separated using a reverse phase gradient of water (+0.1% formic acid) and acetonitrile (+0.1% formic acid) starting with 99% aqueous and ending with 99% organic, at a flow rate of 0.5 mL/min. Chromatograms were analyzed using Waters Masslynx 4.1 software (Waters, Milford, Mass.). Micro molar yields for isobutanol were calculated using Waters Quanlynx software (Waters, Milford, Mass.) using a calibration curve of triplicate analyses of standards.
TABLE-US-00034 TABLE28 ForwardPrimers Targeted position(s) ofK9-KARI Primers 312 K9_312Y_030812r GGAGGCCAACTTTCTTATAGCC (SEQIDNO:474) K9_312A_030812r GGAGGCCAACTTTCTAGCAGCC (SEQIDNO:475) K9_312L_030812r GGAGGCCAACTTTCTTAAAGCC (SEQIDNO:476) K9_312R_030812r GGAGGCCAACTTTCTTCTAGCC (SEQIDNO:477) K9_312K_030812r GGAGGCCAACTTTCTTTTAGCC (SEQIDNO:478) K9_312F_050712r GGAGGCCAACTTTCTAAAAGCC (SEQIDNO:479) K9_312P_050712r GGAGGCCAACTTTCTAGGAGCC (SEQIDNO:480) K9_312N_050712r GGAGGCCAACTTTCTATTAGCC (SEQIDNO:481) K9_312I_050712r GGAGGCCAACTTTCTAATAGCC (SEQIDNO:482) K9_312C_050712r GGAGGCCAACTTTCTACAAGCC (SEQIDNO:483) K9_312H_050712r GGAGGCCAACTTTCTATGAGCC (SEQIDNO:484) K9_312V_050712r GGAGGCCAACTTTCTAACAGCC (SEQIDNO:485) K9_312D_050712r GGAGGCCAACTTTCTATCAGCC (SEQIDNO:486) K9_312G_050712r GGAGGCCAACTTTCTACCAGCC (SEQIDNO:487) K9_312S_050712r GGAGGCCAACTTTCTAGAAGCC (SEQIDNO:488) K9_312T_050712r GGAGGCCAACTTTCTAGTAGCC (SEQIDNO:489) K9_312Q_050712r GGAGGCCAACTTTCTTTGAGCC (SEQIDNO:490) K9_312E_050712r GGAGGCCAACTTTCTTTCAGCC (SEQIDNO:491) K9_312W_050712r GGAGGCCAACTTTCTCCAAGCC (SEQIDNO:492)
TABLE-US-00035 TABLE 29 Isobutanol production of K9 variants in strain PNY2115 Nucleic Acid Amino Acid SEQ ID Variant Seq ID No: NO: Repeat Isobutanol titer (mM) EKC5 546 524 1 94.8 2 85.0 3 90.8 K9SB2_SH 94 1 81.6 2 79.4 3 79.5
TABLE-US-00036 TABLE 30 Isobutanol production of K9 variants in strain PNY2115 Nucleic Acid Amino Acid SEQ ID Variant Seq ID No: NO: Repeat Isobutanol titer (mM) EKG4 547 525 1 64.4 2 57.6 3 62.7 K9SB2_SH 94 1 62.6 2 57.4 3 32.5
Example 17
Construction of a Site-Saturation Gene Library Targeting Position 169 and Screening the Isobutanol Production of the Resultant Variants in PNY2115
[0409] The forward primer mixture (called K9_169f in this example) containing primers encoding all 19 individual amino acid changes at the amino acid corresponding to position 169 of the wild-type Anaerostipes caccae KARI sequence (SEQ ID NO: 93) (Table 31) and the reverse primer K9_309T_111711r: CTTTCTCATAGCCTTAGTGTGGAC (SEQ ID NO: 415; called K9_309Tr in this example) were employed to create a single-site saturation library targeting the position of 169 of K9 KARI. A plasmid containing the variant K9SB2_SH (or K85B2_SH_81) was used as the template.
[0410] In brief, a megaprimer was prepared through a regular FOR. The megaprimer FOR mixture consisted of 45 l of SuperMix (Invitrogen, Carlsbad, Calif., #10572063), 2.0 l K9_169f (20 M), 2.0 l K9_309Tr (20 M) and 1.0 l template (50 ng/l). The PCR program for making the megaprimer is: the starting temperature was 95 C. for 1.0 min followed by 35 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 55 C. for 20 sec, and 72 C. for 1.0 min. The PCR product was cleaned up using a DNA cleaning kit (Cat#D4003, Zymo Research, Orange, Calif.) as recommended by the manufacturer.
[0411] The Megaprimers were then used to generate a gene library using the QuickChange Lightning kit (Stratagene #210518, La Jolla Calif.). A 25 l reaction mixture contained: 2.5 l of 10 reaction buffer, 0.5 l of 50 ng/l template, 20.25 l of Megaprimer, 0.5 l of 40 mM dNTP mix, 0.5 l enzyme mixture and 0.75 l QuickSolution. Except for the Megaprimer and the templates, all reagents used here were supplied with the kit indicated above. This reaction mixture was placed in a thin well 200 l-capacity FOR tube and the following reactions were used for the FOR: The starting temperature was 95 C. for 2 min followed by 20 heating/cooling cycles. Each cycle consisted of 95 C. for 20 sec, 60 C. for 10 sec, and 68 C. for 5 min. At the completion of the temperature cycling, the samples were kept at 68 C. for 10 min more, and then held at 4 C. for later processing. 0.5 l Dpn I was added into the finished FOR reaction mixture and then incubated at 37 C. for 2 hr. The PCR product was cleaned up using a DNA cleaning kit (Cat#D4003, Zymo Research, Orange, Calif.) as recommended by the manufacturer. The PCR product was transformed into E. coli. Bw25113 ( ilvC) and clones were sequenced.
[0412] The resultant variants with unique sequences together with K8SB2_SH_81 were analyzed for isobutanol production in yeast strain PNY2115 (triple for each mutant). The plasmid having K9 KARI variants and the plasmid pYZ067ADHKivD were transformed into the yeast host PNY2115. The transformed cells were plated on synthetic medium without histidine and uracil (1% ethanol as carbon source). Three transformants were transferred to fresh plates of the same media. The transformants were tested for isobutanol production under anaerobic conditions in 48-well plates (Axygen, Union City, Calif. #391-05-061). The promising transformants were further tested for isobutanol production under anaerobic conditions in 15 ml serum vials.
[0413] Yeast colonies from the transformation on SE-Ura-His plates appeared after 5-7 days. The three colonies from each variant were patched onto fresh SE-Ura-His plates, and incubated at 30 C. for 3 days.
Growth Media and Procedure
[0414] Two types of media were used during the growth procedure of yeast strains: an aerobic pre-culture media and an anaerobic culture media. All chemicals were obtained from Sigma unless otherwise noted (St. Louis, Mo.).
[0415] Aerobic pre-culture media (SE-Ura): 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.2% ethanol, 0.2% glucose, 0.01% w/v leucine, 0.002% w/v histidine, and 0.002% w/v tryptophan.
[0416] Anaerobic culture media (SEG-Ura-His): 50 mM MES (pH 5.5, 6.7 g/L yeast nitrogen base without amino acids (Difco, 291940, Sparks, Md.), 1.4 g/L yeast synthetic drop-out medium supplement without histidine, leucine, tryptophan and uracil, 0.1% ethanol, 3% glucose, 0.01% leucine, 0.002% w/v histidine, 0.002% tryptophan, 30 mg/L nicotinic acid, 30 mg/L thiamine and 10 mg/L ergosterol made up in 50/50 v/v Tween/ethanol solution.
[0417] The patched cells were inoculated into 48-well plates. Each well contains 1.5 ml aerobic media. The plates were covered with permeable foils and grown at 30 C. with shaking overnight. The cell density (OD.sub.600) was then measured. The amount of cells to make a 1.5 ml of cell suspension (in anaerobic media) with the final OD.sub.600=0.2 for each well were calculated, and a 1.5 ml cell suspension was prepared with anaerobic media and added into each well. 48-well plates were sealed with aluminum foil. Cells were then grown at 30 C. with shaking for three days. After three days of anaerobic growth, the cell density (OD.sub.600) was then measured. Cells were centrifuged at 4,000 g for 5 min and the supernatant was collected for the isobutanol measurement using LC/MS.
[0418] Based on 48-well plate data, the top performers were chosen and patched. The patched cells were inoculated into 24-well plates. Each well contains 3.0 ml aerobic media. The plates were covered with permeable foils and grown at 30 C. with shaking overnight. The cell density (OD.sub.600) was then measured. The amount of cells to make a 10 ml of cell suspension (in anaerobic media) with the final OD.sub.600=0.2 for each vial were calculated, and a 10 ml cell suspension was prepared with anaerobic media and added into each vial. Each vial was capped and cells were then grown at 30 C. with shaking for three days. After three days of anaerobic growth, the cell density (OD.sub.600) was then measured. Cells were centrifuged at 4,000 g for 5 min and the supernatant was collected for the isobutanol measurement using LC/MS.
LC/MS Analysis of Yeast Strains with K9 KARI Mutants
[0419] Samples were taken for LC/MS analysis at the end of the anaerobic growth period. LC/MS analysis was performed using a Waters AcQuity UPLC separations unit and AcQuity TQD triple quad mass spectrometer (Waters, Milford, Mass.) with a Waters AcQuity UPLC HSS T3 separations column (Waters, Milford, Mass.). Compounds were separated using a reverse phase gradient of water (+0.1% formic acid) and acetonitrile (+0.1% formic acid) starting with 99% aqueous and ending with 99% organic, at a flow rate of 0.5 mL/min. Chromatograms were analyzed using Waters Masslynx 4.1 software (Waters, Milford, Mass.). Micro molar yields for isobutanol were calculated using Waters Quanlynx software (Waters, Milford, Mass.) using a calibration curve of triplicate analyses of standards.
TABLE-US-00037 TABLE31 ForwardPrimers Targeted position(s) ofK9-KARI Primers 169 K9_169I_030812f GCAAGGCTTTGGATATTGCTTTGGC (SEQIDNO:493) K9_169V_030812f GCAAGGCTTTGGATGTTGCTTTGGC (SEQIDNO:494) K9_169R_050712f GCAAGGCTTTGGATAGAGCTTTGGC (SEQIDNO:495) K9_169T_050712f GCAAGGCTTTGGATACTGCTTTGGC (SEQIDNO:496) K9_169K_050712f GCAAGGCTTTGGATAAGGCTTTGGC (SEQIDNO:497) K9_169N_050712f GCAAGGCTTTGGATAACGCTTTGGC (SEQIDNO:498) K9_169A_250712f GCAAGGCTTTGGATGCTGCTTTGGC (SEQIDNO:499) K9_169D_050712f GCAAGGCTTTGGATGATGCTTTGGC (SEQIDNO:500) K9_169E_250712f GCAAGGCTTTGGATGAAGCTTTGGC (SEQIDNO:501) K9_169G_050712f GCAAGGCTTTGGATGGTGCTTTGGC (SEQIDNO:502) K9_169F_050712f GCAAGGCTTTGGATTTTGCTTTGGC (SEQIDNO:503) K9_169L_050712f GCAAGGCTTTGGATTTGGCTTTGGC (SEQIDNO:504) K9_169C_050712f GCAAGGCTTTGGATTGTGCTTTGGC (SEQIDNO:505) K9_169S_050712f GCAAGGCTTTGGATTCTGCTTTGGC (SEQIDNO:506) K9_169Y_050712f GCAAGGCTTTGGATTATGCTTTGGC (SEQIDNO:507) K9_169W_050712f GCAAGGCTTTGGATTGGGCTTTGGC (SEQIDNO:508) K9_169P_050712f GCAAGGCTTTGGATCCAGCTTTGGC (SEQIDNO:509) K9_169H_050712f GCAAGGCTTTGGATCATGCTTTGGC (SEQIDNO:510) K9_169Q_050712f GCAAGGCTTTGGATCAAGCTTTGGC (SEQIDNO:511)
TABLE-US-00038 TABLE 31 Isobutanol production of K9 variants in strain PNY2115 Nucleic Acid Amino Acid SEQ ID Variant Seq ID No: NO: Repeat Isobutanol titer (mM) EJF5 548 526 1 69.9 2 74.8 3 72.1 EJA1 550 528 1 74.9 2 72.2 3 48.8 EJB8 549 527 1 57.6 2 67.3 3 67.6 EJB10 551 529 1 64.7 2 71.4 3 57.4 K9SB2_SH 94 1 62.6 2 57.4 3 32.5
Example 18
K9 Lucy SH Variants
[0420] Additional variants based on K9_Lucy_SH, a truncated form of K9_Lucy lacking five N-terminal amino acids, were prepared and subcloned into the Pmel and Sfil sites of yeast expression plasmid pLH689 (SEQ ID NO: 306). Plasmids were transformed into strain PNY2115 and analyzed for isobutanol production as described in Example 5.
TABLE-US-00039 TABLE 32 Isobutanol Titers and Amino Acid Substitutions of Lucy_SH Variants AA Mean K9_Lucy_SH Seq ID Isobutanol Derivative No: (mM) Amino Acid Substitutions Control 553 28 Y53L, S56V, K57E, S58E, (K9_Lucy_SH) N87P E147V 552 24 Y53L, S56V, K57E, S58E, N87P, E147V G164D 404 38 Y53L, S56V, K57E, S58E, N87P, G164D G304V 405 19 Y53L, S56V, K57E, S58E, N87P, G304V N258S 406 62 Y53L, S56V, K57E, S58E, N87P, N258S T71S 407 11 Y53L, S56V, K57E, S58E, N87P, T71S V184I 408 27 Y53L, S56V, K57E, S58E, N87P, V184I A279D 409 31 Y53L, S56V, K57E, S58E, N87P, A79D D98V 410 3 Y53L, S56V, K57E, S58E, N87P, D98V M169F 411 16 Y53L, S56V, K57E, S58E, N87P, M169F M169K 412 20 Y53L, S56V, K57E, S58E, N87P, M169K M169L 413 32 Y53L, S56V, K57E, S58E, N87P, M169L E100Q M312K 414 9 Y53L, S56V, K57E, S58E, N87P, E100Q, M312K
TABLE-US-00040 TABLE Z HMMER2.0 [2.2 g] File format version: a unique identifier for this save file format. NAME Functionally Verified KARIs Name of the profile HMM LENG 354 Model length: the number of match states in the model. ALPH Amino Symbol alphbet: This determines the symbol alphabet and the size of the symbol emission probability distributions. IAmino, the alphabet size is set to 20 and the symbol alphabet to ACDEFGHIKLMNPQRSTVWY (alphabetic order). MAP yes Map annotation flag: If set to yes, each line of data for the match state/consensus column in the main section of the file is followed by an extra number. This number gives the index of the alignment column that the match state was made from. This information provides a map of the match states (1 . . . M) onto the columns of the alignment (1 . . . alen). It is used for quickly aligning the model back to the original alignment, e.g. when using hmmalign -mapali. COM hmmbuild -n Functionally Verified KARIs Command line for every HMMER command that modifies the save file: This one means that hmmbuild (default patrameters) was exp-KARI.hmm exp-KARI_mod.aln applied to generate the save file. COM hmmcalibrate exp-KARI.hmm Command line for every HMMER command that modifies the save file: This one means that hmmcalibrate (default parametrs) was applied to the save profile. NSEQ 25 Sequence number: the number of sequences the HMM was trained on DATE Mon Dec 8 17:34:51 2008 Creation date: When was the save file was generated. XT 8455 4 1000 1000 8455 4 8455 4 Eight special transitions for controlling parts of the algorithm-specific parts of the Plan7 model. The null probability used to convert these back to model probabilities is 1.0. The order of the eight fields is N>B, N>N, E>C, E>J, C>T, C>C, J>B, J>J. NULT 4 8455 The transition probability distribution for the null model (single G state). NULE 595 1558 85 338 294 453 1158 197 249 902 1085 142 21 313 The extreme value distribution parameters and lambda respectively; both floating point values. These values are set 45 531 201 384 1998 644 when the model is calibrated with hmmcalibrate. They are used to determine E-values of bit scores. EVD 333.712708 0.110102 Position in HMM A C D E F G H I K L M N P Q R S T V W Y alignment m>m m>i m>d i>m i>i d>m d>d b>m m>e 650 * 1463 1(Q) 648 1356 136 44 1453 1166 219 1455 321 1417 911 227 1496 3263 122 643 684 1239 1542 1030 7100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 701 1378 650 * 2(M) 4231 3929 5216 5402 3438 4370 4528 3232 5113 2613 5320 5052 4790 4977 4823 4692 4459 3629 4103 4017 7200% 147 501 232 42 382 397 104 625 209 467 722 276 396 44 95 361 121 368 296 251 3303 3318 325 3473 136 701 1378 * * 3(F) 1308 1104 2227 2120 3516 2093 244 196 1891 64 66 1626 2278 1503 1798 1617 1350 389 305 1335 8600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 943 1060 * * 4(A) 1616 1744 1125 33 2015 1540 262 1686 937 1765 911 252 1658 154 383 488 640 3 2038 1421 8700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 901 7402 1125 894 1115 2352 314 * * 5(C) 346 2578 1084 712 2092 1540 384 167 624 482 125 731 1705 451 883 631 338 50 774 133 8800% 149 500 235 43 381 398 106 626 210 466 721 275 394 45 96 359 118 369 295 249 1009 1006 7567 131 3527 1916 444 * * 6(S) 800 586 1937 1415 821 1740 954 1279 1204 584 19 1258 1964 1013 1358 1715 476 1117 1320 938 9000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 17 6953 7995 894 1115 146 3378 * * 7(K) 956 2411 803 501 2743 1919 558 2483 2435 2420 1502 57 2010 1146 458 829 224 2040 2577 1913 9100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 8(V) 2472 2010 5089 4702 2534 4789 4391 2241 4574 151 1318 4442 4600 4417 4628 4080 82 3023 3952 3510 9200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 9(Y) 4673 3685 5210 5505 2423 5069 1332 3424 5065 392 2838 3726 4920 3835 4458 4313 4533 3643 581 4349 9300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 10(Y) 2170 2625 2489 2097 1555 2986 1481 2628 906 2674 2098 2051 3206 1513 1078 2258 1039 2435 2009 4185 9400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 11(D) 2498 4412 3500 1042 4581 2437 1765 4500 733 4361 3682 515 2961 1429 2799 2158 2558 3974 4550 3541 9500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 12(K) 11 2371 348 819 2692 535 527 2443 2294 2387 1461 590 1960 68 904 67 837 1993 2554 1871 9600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 13(D) 2663 4633 3700 580 4789 2487 1872 4738 731 4578 3963 1073 3046 1551 2987 2292 2742 4201 4759 3709 9700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 14(C) 2503 3193 4265 3818 2010 3276 2896 762 3517 1437 1051 3233 3509 3212 3411 2499 1792 1507 2796 2431 9800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 15(D) 1363 2905 2748 542 3202 2072 920 2977 290 2912 2023 1270 2294 489 1186 53 1116 2518 3086 2349 9900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 16(L) 1268 1113 3338 540 1057 2827 1716 569 2409 2299 236 2381 2862 2089 2316 232 1213 1306 1645 1304 10000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 17(S) 1350 2877 588 1045 3189 496 920 2963 628 2901 2011 1860 2289 489 1184 2139 190 2503 3077 2343 10100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 2336 8139 325 894 1115 701 1378 * * 18(G) 454 832 968 1110 2112 3143 1211 2091 1317 2264 1691 978 1499 1202 1421 646 774 1550 1916 1919 10200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 3098 179 * * 19(H) 898 1313 545 482 320 1336 4297 1552 160 1493 1035 579 1675 363 322 934 951 1354 725 107 10300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 3098 179 * * 20(D) 872 1812 3234 432 2215 967 433 2172 569 2269 1704 99 1453 184 1141 728 973 1814 2146 1646 10400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 3098 179 * * 21(E) 766 1695 521 2831 2050 1029 293 1804 118 1919 1331 69 1441 4 527 653 814 1512 1988 1505 10500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 3098 179 * * 22(Y) 1337 1229 1681 1596 1268 1957 121 918 1294 769 585 1229 2163 1111 1301 1443 1359 932 592 3932 10600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 109 3775 * * 23(I) 2294 1931 4749 4227 1724 4227 3320 2306 3952 1990 634 3878 94 3538 3812 3411 2247 1576 2891 2629 10700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 24(I) 2801 2299 5406 5003 2108 5164 4649 3051 4886 1593 869 4829 4788 4454 4829 4493 2764 1435 3781 3585 10800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 25(K) 234 2632 306 500 3007 2141 719 2712 2540 2619 1730 778 2231 2257 968 1109 1152 2288 2738 2136 10900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 26(G) 2184 3900 796 392 4174 2903 1580 4030 1636 3937 3173 967 2810 1 2362 1069 2220 3530 4130 3229 11000% 149 501 233 42 375 399 104 625 210 463 722 276 396 44 96 358 116 371 296 251 155 3318 9181 3674 118 701 1378 * * 27(K) 3243 3775 4129 2558 4750 3647 1490 4021 3681 3617 2982 2368 3580 1076 1318 3119 2876 3817 3395 3374 12600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 28(K) 1684 2925 1665 979 3407 2535 923 3021 2737 2865 2032 202 2582 1301 804 1564 1681 2645 2905 2448 12700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 29(V) 2623 2122 5300 4990 2769 5101 5131 2388 4945 1532 1474 4790 4868 4890 5101 4482 2619 3219 4505 3990 12800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 30(A) 3309 1828 4057 4294 4382 656 3657 4147 4169 4428 3497 2821 2904 3694 3937 1470 59 2957 4610 4522 12900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 31(V) 2625 2122 5304 4993 2772 5111 5142 2881 4950 1532 1474 4796 4873 4896 5108 4492 2621 2896 4512 3997 13000% 148 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 32(I) 2790 2287 5403 5009 2155 5170 4698 3324 4899 1175 912 4835 4802 4495 4860 4506 2757 1192 3838 3622 13100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 33(G) 4435 4203 5092 5462 5893 3834 5028 6627 5765 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 13200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 34(Y) 4838 3766 5229 5579 1502 5108 1300 3726 5134 3040 3131 3723 4963 3861 4500 4356 4689 3881 2986 4507 13300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 35(G) 4435 4203 5092 5462 5893 3834 5028 6627 5765 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 13400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 36(S) 1473 2007 3647 3780 3430 2363 3314 228 3616 3373 2876 2840 3093 3395 3541 3475 1885 2307 3927 3474 13500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 37(Q) 4589 4392 3927 4146 5099 4221 4099 5973 3840 5564 5304 4230 4693 4575 3826 4704 4772 5612 4577 4751 13600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 38(G) 677 2128 3838 4171 4647 3536 3816 4506 4340 4749 3857 3009 3149 3871 4137 1784 2005 3297 4725 4735 13700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 39(H) 2667 3375 2682 2114 3744 3201 4738 3782 445 3553 2886 2112 866 1265 1506 2614 2557 3469 3282 2908 13800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 40(A) 3631 2768 4492 4815 4888 2992 4271 4781 4818 5025 4365 3727 3728 4477 4545 2567 2762 3852 4724 4942 13900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 41(H) 3103 3404 2950 2573 783 3679 4549 3407 1372 3071 2715 2454 3764 2546 1428 2990 2976 3308 2269 295 14000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 42(A) 3357 1795 4134 4277 4057 2118 3548 3549 4035 4024 3192 2817 2900 3608 3823 217 1660 276 4363 4211 14100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 43(Q) 1061 1950 2044 1475 1236 2372 1154 789 1218 1062 1123 743 2446 2895 1441 1392 1005 693 1678 1278 14200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 44(N) 4000 4117 3389 3749 5073 3911 4123 6022 4503 5797 5419 4397 4479 4255 4592 4115 4312 5371 4650 4731 14300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 45(L) 4414 3800 5638 5628 2290 4980 4628 1886 5423 3316 1236 5514 4997 4750 5002 5379 4399 2629 3665 3690 14400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 46(R) 1731 3015 275 931 3487 2518 973 3116 2321 2955 2123 224 2603 256 2808 1596 1613 2730 2995 2515 14500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 47(D) 2896 4843 3855 944 5037 2600 2082 5082 2528 4903 4373 1209 3196 1786 3536 2501 3007 4517 5004 3956 14600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 48(S) 1536 2212 2363 2679 4293 2279 3082 4365 3331 4524 3676 288 3026 2967 3497 3508 1962 3259 4477 4066 14700% 148 500 232 44 381 398 105 627 211 465 721 275 393 45 95 360 118 370 295 250 155 3318 9181 2405 302 701 1378 * * 49(G) 2521 3968 1232 911 4849 3373 2126 4854 2535 4752 4136 53 3115 1836 3440 2284 2716 4157 4880 3914 15400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 50(V) 2767 2324 5232 4770 396 4827 3784 36 4546 848 611 4472 4518 3980 4367 4081 2716 3323 3037 2660 15500% 148 500 233 43 381 399 106 626 211 466 720 275 394 45 96 359 117 369 294 249 148 3381 9181 203 2928 701 1378 * * 51(D) 1684 3285 2735 2014 3554 2196 1177 3350 92 3279 2427 692 2505 770 1595 1483 1666 332 3460 2676 15700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 52(V) 3122 2888 5092 5160 3522 4180 4687 905 5060 2626 2570 4662 4579 4940 4923 4013 3297 3796 4414 4190 15800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 53(V) 369 366 3075 2462 883 2557 1420 1415 378 757 117 2098 2610 1809 2037 1630 1166 2145 1385 343 15900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 54(V) 2624 2122 5302 4991 2772 5108 5139 2623 4948 1533 1475 4794 4871 4894 5106 4488 2620 3088 4511 3996 16000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 55(G) 929 2107 3852 4182 4633 3492 3809 4486 4335 4732 3835 2997 3132 3863 4127 1761 1982 3275 4720 4725 16100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 56(L) 3427 2938 5791 5325 1449 5374 4410 543 5063 3041 255 5207 4820 4126 4691 4757 3351 883 3184 3234 16200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 57(R) 3040 3724 3266 82 4620 3470 1396 3905 804 3529 2874 2133 3439 978 3800 2894 2709 3682 3353 3267 16300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 58(K) 31 2412 803 1532 2743 1920 559 2483 1772 2421 1503 556 1229 727 1079 566 893 2041 2579 1915 16400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 59(G) 2671 4661 1614 587 4832 3103 1901 4803 2269 4648 4047 421 3049 1587 3230 2297 2766 4245 4850 3752 16500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 60(S) 1499 2308 1932 1859 4006 1604 2121 3754 1362 3793 2945 1833 2827 1794 1902 2738 1771 2970 3910 3479 16600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 247 8139 2699 894 1115 701 1378 * * 61(K) 1362 2232 619 98 2567 427 435 2309 1599 2265 1349 1101 1861 886 512 833 740 1868 2441 1767 16700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 9 7900 8943 894 1115 344 2238 * * 62(S) 1288 1904 3742 4011 4384 2155 3593 4209 3996 4479 3573 2789 2948 3606 3832 3517 228 3028 4600 4451 16800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 63(W) 726 873 3261 2634 1926 2567 1425 660 2252 701 68 2174 2617 1898 18 1648 972 983 4091 958 16900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 64(E) 1527 2404 212 1636 2722 1878 556 2474 1241 2419 1497 350 1985 100 659 96 70 2025 2589 1903 17000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 65(K) 8 2242 895 770 2502 1963 609 2192 2589 22 1353 631 2052 692 617 889 906 361 2455 1836 17100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 66(A) 3631 2768 4492 4815 4888 2992 4271 4781 4818 5025 4365 3727 3728 4477 4545 2567 2762 3852 4724 4942 17200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 67(Q) 1006 2441 869 1767 2780 1965 586 2510 1702 2445 1534 603 2052 1923 873 888 236 630 2596 1949 17300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 68(A) 1489 2393 167 1234 2711 1873 547 2462 895 2408 1485 1161 1977 90 648 666 141 2014 2577 1892 17400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 69(D) 2104 2898 2124 985 3163 2096 1397 2935 693 2897 2025 723 2329 543 1250 1245 1368 2501 3087 530 17500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 70(G) 2294 2898 2521 2885 4852 3641 3456 5042 3796 5094 4356 365 3545 3376 4005 2451 2700 3996 4706 4575 17600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 71(F) 2596 2266 4685 4188 3199 4136 1018 505 3812 1986 405 3595 3961 3157 3524 3277 2509 1337 1621 840 17700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 72(K) 47 2348 338 950 2668 1854 512 507 1721 2364 1438 490 1947 672 436 806 687 1970 2533 1851 17800% 149 500 232 46 381 399 105 627 210 466 721 277 393 45 95 359 117 370 295 250 155 3318 9181 2159 366 701 1378 * * 73(V) 1810 1639 4149 3689 1869 3417 2822 29 3369 320 897 3230 112 3099 3291 2619 767 3269 2708 2354 18400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 74(K) 847 1093 2131 1554 304 127 1127 637 1445 645 1186 1534 2401 1174 1547 764 172 528 1519 1413 18500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 75(T) 1284 2794 1526 1290 3096 2041 1289 2863 548 2808 1914 668 2242 427 1095 1451 1827 2411 2986 2264 18600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 76(V) 1089 957 3143 2535 943 2618 1496 1052 2198 792 1859 145 686 1884 2111 1695 945 2346 1458 1106 18700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 77(W) 1606 2321 752 612 2628 323 527 2366 1480 2331 1416 510 789 73 421 23 829 1936 2212 1843 18800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 78(E) 1509 3540 1372 3127 3861 120 1391 3685 1319 3605 2787 900 2659 1005 1976 400 655 3194 3790 2957 18900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 79(A) 3390 1868 4092 4341 4332 2153 3680 3942 4157 4333 3471 2869 2948 3730 3919 1525 931 2894 4580 4483 19000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 80(V) 2003 1721 4449 3995 2160 3763 3240 1342 3745 1435 1124 3561 3855 3494 3700 2979 58 2574 3091 2698 19100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 81(K) 1714 2501 959 446 2858 2043 654 2574 1964 2506 1609 689 2135 203 1088 428 1032 2148 2652 2027 19200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 82(W) 265 2347 815 432 2663 634 519 2410 619 2361 1438 495 1952 1955 609 382 147 1966 2858 1853 19300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 83(A) 3391 1860 3998 4279 4411 2128 3684 4207 4197 4490 3565 2837 2929 3729 3959 706 1718 3001 4636 4534 19400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 84(D) 2747 4795 3813 396 4912 2496 1935 4905 2324 4735 4166 1079 3082 603 3296 2353 2844 4347 4929 3809 19500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 85(V) 2717 2220 5338 4951 2254 5099 4670 1963 4844 1553 1011 4759 4771 4509 4836 4427 2688 2741 3899 3628 19600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 86(V) 2635 2129 5306 4970 2652 5125 5011 2554 4915 354 1368 4781 4852 4798 5038 4487 2622 3019 4355 3902 19700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 87(M) 1340 1208 3317 2708 968 2860 1708 577 2346 932 4131 2382 2878 250 2265 228 1278 506 1629 1313 19800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 88(I) 2566 2177 5017 4470 669 4496 3487 2791 4191 1116 1394 4156 4228 3615 3972 3687 2499 1692 2860 2711 19900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 89(L) 4414 3800 5638 5628 2290 4980 4628 1886 5423 3316 1236 5514 4997 4750 5002 5379 4399 2629 3665 3690 20000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 90(I) 1212 1286 3846 3262 1360 3195 2166 1616 2918 1031 493 2824 3211 2583 2782 2308 1598 1299 2020 1668 20100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 91(P) 1614 2214 3396 3710 4516 2407 3618 4516 3976 4705 3849 2890 3993 3625 3900 666 2068 3354 4610 4474 20200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 92(D) 4580 4701 4174 3014 5700 3967 3905 6376 4478 6024 5744 3355 4501 3870 4926 4440 4750 5894 4922 5231 20300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 93(E) 1123 2199 983 2715 2589 2046 942 2250 625 2356 1979 870 2250 554 1093 463 932 1902 2660 2064 20400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 94(H) 399 1137 2012 14 1582 2306 1600 246 1252 190 325 1456 2374 1474 1479 94 905 896 1557 1158 20500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 95(Q) 2742 3142 2766 2681 2790 3344 2460 160 1802 2456 2353 2682 3710 4317 1866 2894 2844 2559 3295 2711 20600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 96(A) 1981 2315 809 268 2645 531 579 2374 232 2350 1445 567 1217 711 445 447 874 1951 2540 1883 20700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 97(D) 491 2351 1394 1381 2671 1854 1062 2421 1010 2367 1440 489 1947 1017 362 760 250 623 2535 1852 20800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 98(V) 2039 1706 4456 3939 1846 3939 3049 1986 3656 1460 826 804 3870 3351 3565 3105 2000 2330 2796 2442 20900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 99(Y) 4840 3766 5230 5581 1898 5109 1300 3727 5135 3041 3132 3723 4964 3861 4501 4357 4690 3883 3325 4377 21000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 100(E) 163 2353 734 1681 2674 1859 888 2422 1668 792 1443 777 1952 890 286 766 238 1975 2536 1856 21100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 257 8139 2649 894 1115 701 1378 * * 101(E) 1017 2763 862 2042 3060 1913 775 2836 495 2773 1886 1956 2143 136 1056 265 1185 2377 2948 2207 21200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 9 7891 8933 894 1115 338 2261 * * 102(E) 944 2422 863 2138 2740 436 567 2493 894 2437 1515 518 1994 1767 673 109 885 1023 2605 1917 21300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 103(I) 2660 2156 5316 4965 2520 5119 4900 3165 4894 297 1251 4775 4828 4705 4975 4470 2642 2240 4202 3814 21400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 104(E) 1068 2341 760 2003 628 1887 876 2380 1240 2347 1436 529 1983 881 618 804 855 1954 2530 1862 21500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 105(P) 343 3144 1561 442 3538 489 1216 3329 1038 3274 2420 848 2974 812 1635 469 1644 2849 3462 2693 21600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 106(N) 1173 2375 814 827 2376 2071 1767 2279 479 2336 1509 3151 2218 415 957 1093 1120 198 2486 647 21700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 107(M) 3415 2890 5826 5252 1352 5488 4282 1361 5022 2621 2728 5181 4778 4005 4613 4776 3292 59 3071 3194 21800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 108(K) 1941 3098 1997 1232 3650 2740 1025 3210 3059 3010 2208 499 2766 1457 1261 1817 90 2858 3002 2622 21900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 109(P) 1129 2426 740 964 2747 1913 589 2491 1139 2440 1525 552 1941 1446 655 480 913 2050 2610 1935 22000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 110(G) 2276 2907 2347 2709 4832 3554 3349 5005 3678 5053 4315 1193 3507 3243 3937 2418 2674 3974 4703 4521 22100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 111(A) 1730 2349 958 198 2661 1868 535 2405 927 2362 1444 414 1966 788 630 790 840 303 2540 1863 22200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 112(T) 1350 1149 14 1461 1155 2314 1111 758 1275 1024 1167 1475 2388 1111 1501 334 1843 354 1581 1182 22300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 113(L) 3333 2796 5806 5293 1506 5535 4502 1096 5103 2935 282 5232 4857 4172 4762 4864 3236 506 3264 3351 22400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 114(A) 1769 1525 158 857 1603 148 891 1181 752 187 712 1040 2228 660 1135 1111 913 1305 1913 1442 22500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 115(F) 4110 3437 5436 5431 4216 5143 2159 1742 5074 563 1124 4290 4871 3987 4561 4547 4016 2374 1356 292 22600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 116(A) 3091 1829 3998 4219 4413 119 3637 4216 4134 4469 3523 2798 2896 3656 3927 1514 1679 2983 4632 4539 22700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 117(H) 5197 4539 4720 5009 4036 4506 5435 6314 4911 5786 5667 4954 4960 5011 4732 5391 5395 6022 4063 3641 22800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 118(G) 4435 4203 5092 5462 5893 3834 5028 6627 5785 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 22900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 119(F) 4044 3387 5534 5444 4093 5246 2370 1514 5107 1089 868 4443 4880 3998 4592 4639 3934 2200 1536 523 23000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 120(N) 885 1899 2020 1781 2956 2135 1925 2602 1809 3 2052 3468 2633 1676 2141 413 1437 2139 3194 2737 23100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 121(I) 2673 2169 5324 4969 2477 5123 4876 3293 4893 358 1211 4780 4824 4681 4961 4472 2653 1969 4158 3791 23200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 122(H) 3381 3705 3197 3491 4166 638 5216 5496 3798 5304 4811 3481 4185 3770 3879 3508 3702 4793 4170 3759 23300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 123(Y) 4816 3757 5210 5549 3410 5097 2153 3719 5105 3041 3127 3715 4955 3851 4483 4344 4669 3870 547 3677 23400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 124(G) 1065 2519 948 272 2820 1844 998 2566 972 284 1622 1553 2090 229 802 938 1011 2133 2708 2021 23500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 125(Q) 412 2285 2466 2186 2068 2877 2019 1589 1588 1526 1121 2187 3153 3585 1718 2137 1964 1719 2789 2414 23600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 126(I) 2254 1916 4813 4439 2466 4221 3932 3248 4248 1515 1324 4044 4259 4063 4255 230 2280 2003 3673 3237 23700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 127(K) 888 2234 334 1172 2504 1881 546 93 1370 300 1337 465 1974 655 646 794 827 1255 2448 1798 23800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 128(P) 715 1925 3618 3897 4464 653 3594 4274 4053 4520 3596 2770 3775 3593 3911 1550 1770 3067 4647 4548 23900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 129(P) 479 2398 1173 637 2915 2106 848 2610 289 2586 1713 884 2238 1247 2195 51 1147 2184 2757 2174 24000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 130(A) 1787 2663 1377 529 2976 1992 762 2736 1785 2680 1776 623 2161 319 936 297 1120 2285 2853 2146 24100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 2336 8139 325 894 1115 701 1378 * * 131(F) 1308 1104 2227 2120 3516 2093 244 196 1891 64 66 1626 2278 1503 1798 1617 1350 389 305 1335 24200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 3098 179 * * 132(P) 603 937 997 1058 1832 1041 1092 1737 1074 1874 1416 992 3539 1065 1192 789 866 1383 1765 1661 24300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 3098 179 * * 133(K) 804 1483 564 230 1920 1335 101 1605 2889 1630 1021 349 1569 232 698 786 759 1358 1637 1317 24400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 109 3775 * * 134(D) 2405 4159 3349 651 4260 261 1744 4307 1947 4207 3514 2151 2936 1416 2754 2102 2471 3802 4324 637 24500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 135(I) 2047 1713 4504 3983 1821 3943 3061 2461 3697 1581 797 3593 3873 3371 3587 342 2009 1904 2784 2441 24600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 136(D) 2024 3444 3495 680 3868 2331 1596 44 1632 3675 2915 685 2782 1248 2305 478 2088 3196 3911 3098 24700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 137(V) 3122 2888 5092 5160 3522 4180 4687 905 5060 2626 2570 4662 4579 4940 4923 4013 3297 3796 4414 4190 24800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 138(I) 53 875 3230 2609 1867 393 1422 2613 2236 723 81 2157 2608 1885 2086 1633 276 271 1325 844 24900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 139(M) 315 2345 4754 4279 1396 4001 3301 697 3877 816 4676 3879 3994 3361 3676 3242 2531 1114 2746 2629 25000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 140(V) 2623 2122 5301 4990 2770 5102 5132 2415 4945 1532 1474 4791 4869 4890 5102 4483 2619 3206 4506 3991 25100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 141(A) 3405 2528 4529 4796 4340 2257 3851 3901 4447 4351 3532 3057 3052 3976 4112 1643 1844 2929 4572 4519 25200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 142(P) 4853 4392 5213 5573 5853 4408 5077 6679 5780 6281 6067 5357 4310 5648 5396 5166 5194 6092 4900 5786 25300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 143(K) 4484 4357 4380 3992 5413 4236 3307 5555 3994 5171 4707 3921 4535 3079 2169 4529 4408 5264 4403 4729 25400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 144(G) 2167 1833 3963 4199 4430 2715 3642 4236 4146 4489 3540 2795 2898 3661 3939 910 1682 2994 4647 4556 25500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 145(P) 2604 2948 4094 4235 3544 3269 3767 3353 3912 3066 2095 3659 4036 3912 3822 2883 2963 3249 4027 3787 25600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 146(G) 4435 4203 5092 5462 5893 3834 5028 6627 5765 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 25700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 147(H) 2569 3440 1867 1702 3820 2996 4731 3830 634 3639 2963 1838 1551 1305 748 2470 2510 3482 3434 2990 25800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 148(T) 194 1498 3255 2899 2240 2226 2291 1754 2652 1634 1430 2330 2747 2399 2684 567 2687 1484 2682 2351 25900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 149(V) 3122 2888 5092 5160 3522 4180 4687 905 5060 2626 2570 4662 4579 4940 4923 4013 3297 3796 4414 4190 26000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 150(R) 4845 4446 5107 4682 5507 4412 3791 5946 2789 5502 5118 4521 4754 3672 4219 4989 4832 5644 4538 4993 26100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 151(R) 962 2395 777 1012 2721 76 1031 2459 142 2413 1501 560 2018 128 2308 1224 66 2023 2585 1919 26200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 152(E) 902 2032 899 2078 2228 1934 611 1897 259 221 1156 520 2024 816 736 858 1303 287 2295 537 26300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 153(Y) 4820 3765 5219 5565 3303 5093 1317 3703 5127 3017 3111 3732 4959 3868 4500 4356 4679 3867 565 4052 26400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 154(V) 129 1901 989 821 2060 1969 654 1704 498 52 1037 703 2057 695 796 443 344 1871 2192 1626 26500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 155(Q) 576 2355 344 1156 2675 1856 515 508 1502 2370 1444 571 1949 1878 419 764 822 1976 2538 1856 26600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 156(G) 3239 3889 516 2361 5355 3646 3337 5629 3818 5498 4951 2619 3905 3187 4377 3211 3532 4837 4895 4826 26700% 149 500 232 44 381 399 105 627 211 466 721 277 393 45 95 359 117 368 295 250 155 3318 9181 2159 366 701 1378 * * 157(G) 753 2516 789 488 2848 2300 672 2582 596 2529 1627 481 2112 224 471 952 1024 2149 2694 2033 27300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 158(G) 52 2212 3792 4133 4698 3627 3843 4580 4356 4812 3937 3058 3216 3901 4170 1874 2095 3384 4734 4766 27400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 159(V) 2485 2030 5123 4769 2667 4797 4593 2349 4661 1545 1424 4502 4648 4554 4752 4115 825 2986 4159 3678 27500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 160(P) 2541 3139 2413 2753 4726 2991 3342 5055 3527 5058 4393 1199 4031 3244 3757 2665 2911 4148 4583 4362 27600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 161(C) 1577 3078 1357 656 2664 219 891 2359 617 2434 1576 891 2199 545 1093 872 1043 1946 2701 2102 27700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 162(L) 2140 2404 3995 3997 2053 3121 3283 1687 3689 3041 1200 3360 3626 3433 3567 480 2414 1973 3145 2755 27800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 163(I) 2527 2092 5072 4613 2047 4674 3911 2668 4413 117 841 4323 4439 4023 4320 3916 2488 2176 3342 3040 27900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 164(A) 3631 2768 4492 4815 4888 2992 4271 4781 4818 5025 4365 3727 3728 4477 4545 2567 2762 3852 4724 4942 28000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 165(V) 2623 2122 5301 4990 2770 5102 5132 2426 4946 1532 1474 4791 4869 4891 5102 4483 2619 3200 4506 3991 28100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 166(H) 495 2631 903 2051 722 3242 3753 2386 2056 2342 1863 2047 3330 1815 2362 2318 2233 2272 981 3315 28200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 167(Q) 4589 4392 3927 4146 5099 4221 4099 5973 3840 5564 5304 4230 4693 4575 3826 4704 4772 5612 4577 4751 28300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 168(D) 2873 4605 3943 902 4948 2633 2157 5087 2604 4922 4387 428 3235 1872 3575 2522 3009 4491 4932 3946 28400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 169(A) 1776 1612 1274 138 1698 2092 816 1295 150 1526 780 943 1212 538 1013 1056 894 1275 1968 635 28500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 170(S) 1545 2420 1001 1518 4049 2206 2206 3839 2264 3938 3103 1627 2814 1909 2758 2666 2313 3045 4143 3560 28600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 171(G) 2999 3461 2978 3207 5161 3669 3454 5283 15 5188 4565 3174 3946 3312 3140 3128 3317 4492 4622 4749 28700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 172(N) 887 2349 736 911 2668 1860 518 2415 711 2363 1440 1880 1954 436 799 671 1230 539 2534 1855 28800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 173(A) 3631 2768 4492 4815 4888 2992 4271 4781 4818 5025 4365 3727 3728 4477 4545 2567 2762 3852 4724 4942 28900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 174(K) 1368 2597 1358 720 2953 2298 1933 2803 1975 851 1706 958 2360 859 1012 1273 1094 2245 2690 2165 29000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 175(D) 27 2613 2320 1049 2923 1962 1973 2684 544 2624 1712 1408 2115 345 869 969 1058 2231 2793 2087 29100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 176(V) 1096 938 3279 2658 899 2643 1513 1265 1006 1388 124 2232 2688 1950 2151 1725 311 1669 1425 827 29200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 177(A) 3342 1826 4064 4295 4368 111 3651 4129 4159 4412 3484 2820 2903 3689 3929 1469 409 2949 4599 4508 29300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 178(L) 4414 3800 5638 5628 2290 4980 4628 1886 5423 3316 1236 5514 4997 4750 5002 5379 4399 2629 3665 3690 29400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 179(S) 2216 1831 3961 4157 4409 656 3608 4213 4076 4462 3514 2782 2892 3613 3895 2686 1675 2982 4623 4523 29500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 180(Y) 3634 3050 4918 4872 36 4597 1405 223 4437 250 1998 3545 4494 3522 4004 3782 3536 2621 2928 4349 29600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 181(A) 3391 1860 3998 4279 4411 2128 3684 4207 4197 4490 3565 2837 2929 3729 3959 706 1718 3001 4636 4534 29700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 182(K) 370 307 113 351 2280 1925 615 324 1888 2040 1194 632 2022 205 736 1541 14 1628 2330 1726 29800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 183(G) 2572 2028 3934 4246 4575 2752 3786 4406 4316 4661 3751 2958 3070 3837 4092 1679 1898 3191 4701 4686 29900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 184(I) 2178 1808 4630 4153 2094 4190 3417 3121 3909 311 1023 698 4099 3656 3864 3388 2148 1742 3147 2761 30000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 185(G) 4435 4203 5092 5462 5893 3834 5028 6627 5765 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 30100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 186(G) 1392 2751 4353 4536 4308 2864 3681 4084 4233 4354 3425 2859 2890 3744 3957 712 1656 2914 4553 4470 30200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 187(G) 855 1822 3738 3769 4188 2507 3358 3950 3667 4196 3283 2667 986 3302 3621 1441 2334 2867 4408 4236 30300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 188(R) 3706 3692 4490 3846 1391 4057 2273 3795 1906 3355 3181 3458 4263 2675 3948 3768 3671 3813 2293 1328 30400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 155 8139 3345 894 1115 701 1378 * * 189(A) 2844 1670 3814 3873 4048 1958 3316 3787 3686 4061 3156 2598 2734 3301 3572 1088 1907 2713 4286 4136 30500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 7992 9034 894 1115 1303 750 * * 190(G) 4176 3995 4855 5222 5686 3828 4823 6386 5533 6087 5741 4896 4606 5312 5178 4461 4560 5613 4754 5635 30600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 7992 9034 894 1115 422 1980 * * 191(V) 2496 2036 5139 4788 2680 4825 4637 2522 4686 1549 1431 4527 4668 4584 4783 4148 629 2919 4191 3706 30700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 192(I) 2760 2307 5270 4785 1172 4884 3992 3346 4576 662 572 4539 4535 4008 4400 4134 2703 757 3223 3041 30800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 193(E) 454 3086 801 3279 4125 2346 1868 3919 1868 3932 3156 1291 1208 1533 2450 1842 2097 3305 4121 3395 30900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 194(T) 2738 3109 4509 4810 4918 3305 4346 4865 4769 5072 4551 3987 3998 4580 4545 2999 4033 4113 4684 4915 31000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 195(T) 1323 1975 2766 2978 4207 2152 3105 4004 3295 4229 3354 134 2901 2988 3387 113 3742 2969 4405 4119 31100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 196(F) 4110 3437 5436 5431 4216 5143 2159 1742 5074 563 1124 4290 4871 3987 4561 4547 4016 2374 1356 292 31200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 197(K) 111 2844 1470 1220 3294 2415 860 2939 2448 2798 1945 1056 2475 767 2054 1421 1432 2544 2858 2356 31300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 198(E) 545 3735 1715 2880 3981 2308 1442 3818 1408 3725 2924 909 2713 1281 2087 1777 2041 3331 3909 3046 31400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 199(E) 4574 4665 2714 3919 5655 3995 3886 6219 4238 5898 5604 3415 4513 3838 4570 4456 4726 5786 4878 5197 31500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 200(T) 1211 1331 3446 2962 1399 2495 1930 869 2610 1374 769 2403 2815 2309 2526 1685 3305 195 1933 1430 31600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 201(E) 1941 3222 921 3293 3618 2473 1316 3186 916 3225 2465 1147 2749 923 1064 1790 1902 171 3398 2802 31700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 202(T) 1286 1898 3764 4016 4329 2157 3572 4120 3959 4408 3517 2789 2947 3588 3797 697 3756 2989 4554 4399 31800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 203(D) 4580 4701 4174 3014 5700 3967 3905 6376 4478 6024 5744 3355 4501 3870 4926 4440 4750 5894 4922 5231 31900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 204(L) 3705 3122 6060 5527 1359 5814 4569 1065 5292 3069 146 5564 4963 4163 4828 5215 3571 1279 3159 3298 32000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 205(F) 3777 3220 5271 5259 4268 4892 2120 417 4916 1143 1314 4142 4753 3956 4473 4270 3740 1899 1349 269 32100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 206(G) 4435 4203 5092 5462 5893 3834 5028 6627 5765 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 32200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 207(E) 4574 4665 2714 3919 5655 3995 3886 6219 4238 5898 5604 3415 4513 3838 4570 4456 4726 5786 4878 5197 32300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 208(Q) 3157 3746 3170 2450 4497 3515 1763 4161 443 3809 3189 2392 3620 4200 1284 3063 2944 3900 3556 3420 32400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 209(A) 2672 1334 3318 2853 1740 371 2072 483 2577 1549 928 2359 2798 2295 2567 1629 191 932 2245 1899 32500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 210(V) 2620 2125 5293 4983 2756 5076 5100 1877 4932 1522 1466 4777 4855 4870 5082 4456 2619 3416 4480 3969 32600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 211(L) 4414 3800 5638 5628 2290 4980 4628 1886 5423 3316 1236 5514 4997 4750 5002 5379 4399 2629 3665 3690 32700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 212(C) 2243 5044 4840 4445 1998 3905 3598 31 4138 449 930 3902 4040 3778 4010 3184 2306 1347 3209 2883 32800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 213(G) 4435 4203 5092 5462 5893 3834 5028 6627 5765 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 32900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 214(G) 677 2128 3838 4171 4647 3536 3816 4506 4340 4749 3857 3009 3149 3871 4137 1784 2005 3297 4725 4735 33000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 215(V) 378 724 3707 3104 1180 2986 1919 1210 2734 1302 359 2627 3014 2382 2566 2089 1123 1949 1773 1423 33100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 216(M) 948 1407 1515 156 1452 2164 1677 1030 821 1302 1976 1113 2245 718 1173 773 1715 1332 1794 1343 33200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 217(E) 1397 2528 725 2286 2932 240 791 2681 328 2645 1744 674 2162 351 939 545 1095 2227 2828 2143 33300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 218(L) 3705 3122 6060 5527 1359 5814 4569 1065 5292 3069 146 5564 4963 4163 4828 5215 3571 1279 3159 3298 33400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 219(V) 2600 2108 5251 4894 2568 5025 4783 2479 4810 1354 1358 4683 4772 4654 4895 4362 2584 3018 4181 3758 33500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 220(K) 1633 2905 1573 706 3375 2487 900 3003 2925 2849 2008 1128 2541 1714 784 1509 105 2617 2894 2418 33600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 221(A) 2352 2066 2593 2000 947 2434 1271 486 32 832 714 1817 2498 1493 1792 1483 274 453 1419 501 33700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 222(G) 224 1905 3562 3696 3684 3361 3297 3220 3625 81 2886 2733 2977 3326 3545 1606 1763 2574 4068 3810 33800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 223(F) 4781 3756 5207 5542 4341 5070 1342 3653 5111 2971 3065 3743 4949 3874 4496 4351 4650 3829 591 1725 33900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 224(E) 2413 4114 221 3465 4392 2485 1689 4248 1608 4112 3396 1094 2951 1336 871 2119 2441 3763 4239 3395 34000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 225(T) 1461 1864 3139 2645 2659 2483 2136 1734 1646 2359 1761 2298 2936 1995 920 1748 3354 967 2989 2654 34100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 226(L) 3831 3266 5314 5148 673 5068 2476 1443 4706 3059 789 4359 4756 3864 4314 4462 3729 2115 1672 1736 34200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 227(V) 1819 1960 4426 4359 2977 3037 3800 439 4098 2145 1909 3451 3600 3879 4011 2397 2510 2999 3974 3608 34300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 228(E) 2863 4790 1397 3563 4990 2594 2061 5021 2476 4848 4298 1204 3182 1761 3454 2476 2968 4462 4951 3920 34400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 229(A) 2686 1916 1440 275 2529 292 1240 2176 998 2345 1183 1184 2355 905 1425 512 1158 1817 2697 2174 34500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 230(G) 4435 4203 5092 5462 5893 3834 5028 6627 5765 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 34600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 231(Y) 4099 3483 4921 5048 109 4705 1565 2914 4494 2334 2010 3723 4707 3735 4111 4065 4068 3172 847 4618 34700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 232(Q) 1711 2410 772 934 2739 1925 604 2477 171 2433 1524 574 2035 2086 345 902 923 2042 2608 1941 34800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 233(P) 3403 4071 1922 817 5220 3359 3173 5423 3337 5281 4771 2564 4045 2989 3760 3320 3624 4817 4763 4636 34900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 234(E) 2870 4786 1265 3587 4993 2600 2068 5026 2483 4852 4303 1212 3188 1768 3458 2484 2974 4467 4950 3925 35000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 235(M) 3089 2618 5526 4976 1443 5128 4045 653 4735 1429 4269 4803 4610 3915 4423 4378 2995 1140 3054 3074 35100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 236(A) 3631 2768 4492 4815 4888 2992 4271 4781 4818 5025 4365 3727 3728 4477 4545 2567 2762 3852 4724 4942 35200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 237(Y) 4797 3764 5203 5543 1114 5069 1339 3694 5111 3013 3107 3741 4951 3876 4497 4354 4666 3859 588 4723 35300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 238(F) 3828 3605 4146 4086 4292 4207 2060 3492 774 3071 3005 3556 4434 3287 2952 3868 3858 3571 1593 494 35400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 239(E) 2775 4471 511 3582 4815 2610 2057 4863 2317 4711 4124 1234 3182 1755 3103 2442 2884 4306 4753 3820 35500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 240(C) 1407 5023 4397 4323 3016 2468 3398 1251 3952 2540 2082 3044 3133 3588 3744 1803 1473 1125 3677 3390 35600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 241(L) 3370 2847 5795 5233 1386 5465 4298 708 5010 2859 1349 5155 4777 4026 4622 4755 3254 814 3103 3213 35700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 242(H) 2519 4224 445 946 4287 2505 4583 4377 1764 4237 3571 2007 3009 1439 2361 2209 2559 3893 4267 3353 35800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 243(E) 3177 2571 2701 3711 4851 3438 3479 4765 3558 4932 4406 3081 4005 3370 3802 3269 3451 4260 4554 4524 35900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 244(L) 85 1333 3893 3280 1111 3185 2083 1066 2910 2310 1961 2823 3170 2501 2721 2289 113 436 1859 1558 36000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 245(K) 2513 3173 2941 2370 4402 3094 1824 3895 3666 3734 3068 2271 3377 1447 616 2537 751 3485 3625 3471 36100% 149 500 233 43 381 400 106 626 210 466 720 275 394 45 96 359 117 369 294 249 155 3318 9181 196 2974 701 1378 * * 246(L) 3571 3023 5954 5375 1321 5646 4390 632 5138 2962 1671 5358 4852 4044 4689 4963 3436 742 3082 3239 36300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 247(I) 2980 2484 5473 5109 1958 5196 4587 3728 4915 267 781 4933 4833 4427 4799 4598 2949 64 3627 3397 36400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 248(V) 1685 1658 4095 3732 2081 3082 2893 227 3402 1488 1383 3123 3419 3145 3320 367 1807 3332 2874 2504 36500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 249(D) 2963 4569 3864 1039 4953 2751 2187 4998 767 4822 4260 1424 3314 1891 3072 2624 3060 4467 4770 3962 36600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 250(L) 2768 2715 4842 4633 1675 3998 3790 1038 4207 3056 562 4150 4179 3740 3989 3399 699 1545 3154 3067 36700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 251(M) 2822 2356 5342 4861 1759 4985 4151 2587 4663 173 4005 4649 4601 4076 4487 4251 2764 766 3321 3210 36800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 252(Y) 4562 3630 5142 5401 1516 4992 1300 3544 4968 2963 2986 3671 4868 3786 4393 381 4432 3662 2413 4375 36900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 253(E) 1959 3457 568 3135 3841 2347 1410 3622 1165 3547 2751 1000 2716 1879 1666 1757 692 3162 3709 2960 37000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 254(G) 347 2818 1215 201 3253 2635 921 2921 1474 2822 1972 1002 2459 486 658 1397 1435 2521 2923 2378 37100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 255(G) 4435 4203 5092 5462 5893 3834 5028 6627 5765 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 37200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 256(I) 2042 1769 4321 3740 1316 3753 2668 3134 3389 1017 1999 194 3653 2958 3221 2884 1980 344 2325 2073 37300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 257(A) 1914 1640 1237 128 1748 661 793 1355 577 49 817 905 2155 498 993 1037 162 1149 2002 624 37400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 258(N) 365 3809 1001 557 4083 1196 1518 3930 1535 3838 3055 3219 2763 1148 2243 1845 2131 3433 4027 3144 37500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 259(M) 3656 3159 5816 5350 1349 5421 4248 822 4928 948 4920 5248 4838 4039 4539 4860 3558 1557 3044 3030 37600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 260(R) 1614 1949 2260 1663 886 2765 1089 1596 1089 360 1133 2239 2814 1215 2408 1789 1535 1468 1995 1546 37700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 261(Y) 1548 2973 568 509 2846 2207 1172 2986 441 2941 2110 1645 2446 659 1264 1389 1509 2582 2924 3695 37800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 262(S) 279 1844 3877 4131 4448 136 3634 4260 4132 4511 3561 2782 2903 3648 3936 3391 1692 3009 4661 4566 37900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 263(I) 2653 2149 5311 4961 2538 5114 4905 2957 4891 332 1267 4770 4827 4713 4978 4466 2636 2521 4218 3821 38000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 264(S) 2212 2711 4019 4348 4697 2899 4045 4988 4527 5102 4364 3492 3638 4203 4355 3681 2664 3902 4616 4605 38100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 265(N) 2725 4778 2906 990 4896 2486 1922 4885 2320 4718 4140 3045 3069 1612 3311 2334 2821 4325 4919 3794 38200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 266(T) 2061 3396 596 903 4071 2367 1713 3874 1685 3859 3103 2125 2850 1369 2277 1897 3157 3351 4055 3271 38300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 267(A) 3410 2035 3979 4290 4573 659 3798 4400 4332 4660 3754 2978 3080 3858 4099 1690 1908 3194 4697 4687 38400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 268(E) 2118 3486 1036 2964 3935 2588 1284 3596 1878 3417 2636 1209 2827 1323 773 1923 2032 3199 3455 2917 38500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 269(Y) 4524 3618 5100 5310 1910 4972 1299 3522 634 2951 2965 3649 4847 3741 4299 4199 4391 3637 2997 4211 38600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 155 8139 3345 894 1115 701 1378 * * 270(G) 4176 3995 4855 5222 5686 3828 4823 6386 5533 6087 5741 4896 4606 5132 5178 4461 4560 5613 4754 5635 38700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 7992 9034 894 1115 422 1980 * * 271(D) 2710 4705 3025 1828 4880 1758 1932 4863 2320 4703 4115 1084 3073 1621 3297 2330 2809 4301 4894 3793 38800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 272(Y) 2497 2175 4651 4137 2447 4046 2215 255 3766 892 1558 3537 3886 3109 3468 3181 2410 1282 1615 3508 38900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 273(V) 1425 1250 3480 2894 1283 3035 1955 691 2570 1 429 2568 3060 942 2514 2129 1701 2578 1907 1553 39000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 274(T) 516 1643 1918 1401 2170 2112 1387 1759 1234 2016 1265 1442 2421 1149 887 1341 2345 822 2454 2006 39100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 275(G) 677 2128 3838 4171 4647 3536 3816 4506 4340 4749 3857 3009 3149 3871 4137 1784 2005 3297 4725 4735 39200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 276(P) 992 2210 343 359 2447 1960 675 2143 533 2204 1351 651 2813 260 802 465 939 873 2467 1093 39300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 277(R) 1214 2548 1097 1072 175 2145 716 2587 848 2528 1653 795 2228 273 2862 417 1133 2191 2671 2084 39400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 278(V) 289 2035 5133 4789 2692 4777 4639 2142 4689 1561 1443 4511 4649 4585 4784 4102 2487 3125 4202 3717 39500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 279(I) 2265 1919 4828 4452 2473 4254 3954 3155 4265 1516 1326 4066 4279 4082 4274 226 2288 2182 3688 3250 39600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 280(D) 1731 3162 2329 550 3318 2239 1273 3221 1145 3214 2403 2295 2573 899 1742 1561 1851 2804 3366 1327 39700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 281(E) 1097 2699 1227 2368 2994 2011 796 2753 381 2704 1808 640 2190 358 992 1065 1162 2310 2885 1152 39800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 282(E) 166 2372 859 1835 2692 1861 1182 2444 490 2388 1462 590 478 1356 620 116 837 1994 2555 1871 39900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 283(T) 228 1688 3655 3444 3179 2145 2891 2611 3215 3076 2328 2557 2821 2916 3214 2251 2366 1397 3549 3270 40000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 284(K) 2991 3623 3848 2331 4472 3512 1356 3763 2942 3413 1860 2188 3430 937 2705 2874 2650 3556 3267 3189 40100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 285(E) 443 2370 732 1690 2691 1863 526 2442 1639 2385 1460 498 1960 1120 437 106 836 1992 2552 1869 40200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 286(A) 1871 2286 843 814 2570 1928 578 269 1096 2279 1391 586 2019 136 1056 62 881 1889 2488 1849 40300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 287(M) 3656 3159 5816 5350 1349 5421 4248 822 4928 948 4920 5248 4838 4039 4539 4860 3558 1557 3044 3030 40400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 288(K) 1646 2891 1591 287 3346 526 912 2971 2831 2832 1997 1146 2554 472 1762 1527 1524 2597 2885 1245 40500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 289(E) 172 2394 367 2205 2713 487 545 2465 134 2409 1485 1305 1975 663 831 795 72 2015 2577 1891 40600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 290(C) 1574 3024 4584 4122 2155 3932 3330 1746 3870 1406 1109 3691 3957 3613 3805 3144 2046 2342 3118 2720 40700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 291(L) 187 2175 4307 3889 898 3779 2344 944 3485 2855 476 3390 3782 3025 3298 2972 2345 1269 1846 1565 40800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 292(K) 862 2347 143 1211 2665 1855 873 2414 1692 2362 917 492 1949 889 603 763 783 1968 2532 1851 40900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 293(D) 2148 3878 2790 1765 4119 2356 1511 3962 1467 3852 3075 24 2782 1139 2142 1879 2163 3473 4024 3155 41000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 294(I) 2630 2131 5302 4991 2737 5092 5106 3464 4941 1495 1447 4789 4862 4869 5086 4473 2627 2071 4467 3968 41100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 295(Q) 346 3134 1818 1401 3862 2760 1314 3433 1329 3271 2513 1545 2936 3817 430 2018 2031 3060 3278 2908 41200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 296(S) 1354 2895 1712 354 3192 2068 914 2967 621 2903 2012 1817 2288 724 1177 1978 96 2508 3076 2340 41300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 297(G) 4435 4203 5092 5462 5893 3834 5028 6627 5765 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 41400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 298(E) 437 2374 769 2013 2697 1895 552 2438 623 2389 1472 536 1991 97 777 829 1488 1999 2559 1890 41500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 299(F) 4347 3577 4619 543 3858 4820 1320 3438 4609 2900 2894 3532 4750 3628 4209 4078 4237 3546 601 2917 41600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 300(A) 2827 1603 4068 3628 2047 3165 2823 1205 3349 1485 1089 3103 3432 3073 3298 2387 197 1100 2812 2447 41700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 301(K) 2364 3363 2464 163 4038 3041 1188 3501 2928 3234 2487 1693 3047 758 2488 458 2152 3194 3159 2895 41800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 302(M) 893 2361 740 1780 2680 537 524 2429 930 2376 1895 498 1958 66 722 775 833 1982 2545 1864 41900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 303(W) 2965 2553 4795 4482 3045 4315 1779 1426 4093 92 987 3564 4179 3330 3743 3475 2878 664 4754 84 42000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 304(I) 2621 2136 5246 4859 2364 4987 4577 3052 4747 250 1043 4641 4713 4488 4769 4301 2597 2384 3934 3596 42100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 305(L) 684 1319 1741 761 1375 2223 1037 927 1042 1693 533 1287 2325 915 1349 767 152 84 1756 1329 42200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 306(E) 364 4165 621 3314 4393 2398 1686 4282 1836 4169 3446 728 2893 1339 2626 2045 2402 3767 4362 3401 42300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 307(N) 939 979 1235 681 1738 1352 935 1357 549 1572 816 2186 2155 482 165 1022 880 30 1990 1446 42400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 308(Q) 667 2393 773 511 2721 316 544 2465 1211 2405 1484 584 1989 2135 1528 812 868 2019 2566 1895 42500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 309(A) 2050 1857 1081 526 2013 2012 188 1645 385 1213 1011 486 2103 346 1657 953 306 261 2169 1624 42600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 310(G) 1848 2459 2089 2292 1262 2944 2358 3563 2904 3628 3017 2347 3167 2550 3185 1986 2162 3006 2814 1874 42700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 311(Y) 475 1019 1606 1042 225 2192 935 946 891 1226 1222 357 2267 1002 1577 1172 888 800 1730 2446 42800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 312(P) 87 2372 1362 756 3738 2205 2007 3445 1924 3575 2761 1555 3598 1697 2362 1566 286 2803 3832 3277 42900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 2336 8139 325 894 1115 701 1378 * * 313(K) 804 1483 564 230 1920 1335 101 1605 2889 1630 1021 349 1569 232 698 786 759 1358 1637 1317 43000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 3098 179 * * 314(E) 766 1695 521 2831 2050 1029 293 1804 118 1919 1331 69 1441 4 527 653 814 1512 1988 1505 43100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 248 38 5840 6882 894 1115 109 3775 * * 315(T) 942 2382 739 1086 2714 151 581 2459 171 2415 1499 414 2004 128 839 1365 1730 2017 2592 1915 43200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 316(M) 2196 1920 4499 3891 1726 3822 2504 645 3523 1973 3030 3442 3673 2938 3257 2944 2114 326 2014 1662 43300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 317(H) 883 2314 747 517 2618 1863 1714 647 1272 2322 1408 1011 472 69 433 772 1411 299 2507 1836 43400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 318(A) 2474 2397 816 367 2797 273 722 2529 555 2507 1610 592 2110 837 805 138 1006 2092 2699 2039 43500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 319(M) 154 986 2485 337 1024 375 1232 325 444 867 1235 1752 2474 1419 1020 1455 670 411 831 535 43600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 320(R) 1311 2432 1349 724 2724 2272 799 2361 613 644 1079 976 597 382 2908 1246 1219 2044 2579 2061 43700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 321(R) 897 2364 833 905 2678 1930 568 2405 1293 2366 1485 575 2020 117 2045 95 893 1984 2543 1892 43800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 322(N) 505 2300 750 523 2598 121 525 594 485 95 1395 1720 1957 348 224 551 821 1910 2497 1828 43900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 323(E) 444 2266 766 1488 2551 1871 533 2276 889 2266 1474 1478 1963 682 629 781 12 279 2472 476 44000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 324(N) 1511 1770 728 204 2244 1781 426 282 601 2121 1133 1769 1827 1398 447 748 766 1713 1779 1595 44100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 325(N) 1053 3109 1756 1735 3404 2143 1074 3191 846 3124 2254 2158 2417 657 1430 1361 197 2727 3303 2540 44200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 326(H) 2064 3071 1245 1267 3262 2570 4711 3611 1060 3528 2812 1479 2961 1288 1287 670 2133 3161 3310 2601 44300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 327(Q) 891 2294 332 948 2585 739 537 2316 131 138 1391 518 1404 2021 634 785 619 561 2495 1830 44400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 328(I) 1632 1661 2846 86 1626 2983 1663 3240 1327 191 722 2160 3016 1615 822 2097 1556 560 2157 1805 44500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 329(E) 2734 3605 1382 3593 3624 2986 2317 3317 2175 3167 1983 1898 3440 2054 2556 2649 2820 3234 3920 3370 44600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 2336 8139 325 894 1115 701 1378 * * 330(W) 1530 1265 2068 1964 479 1810 483 1181 1470 968 802 1648 2104 1454 1405 1757 1583 1218 5462 838 44700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 38 5840 6882 894 1115 109 3775 * * 331(K) 8 2067 905 437 2275 1941 611 307 2031 2031 1189 636 2030 1425 709 864 350 1337 2323 1722 44800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 332(V) 2445 2012 5067 4708 2628 4682 4459 1586 4580 1533 1402 4414 4575 4456 4653 3990 1117 3227 4065 3597 44900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 333(G) 4435 4203 5092 5462 5893 3834 5028 6627 5765 6297 5970 5141 4804 5546 5385 4727 4815 5862 4924 5849 45000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 334(E) 1477 2744 762 2410 3114 2113 884 2850 445 2792 1912 619 2297 451 1346 1191 1280 2412 2952 2288 45100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 335(K) 1204 2643 366 1309 2998 2086 724 2722 2626 2637 1741 718 2200 1198 862 1073 1133 2287 2770 2133 45200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 336(L) 3571 3023 5954 5375 1321 5646 4390 632 5138 2962 1671 5358 4852 4044 4689 4963 3436 742 3082 3239 45300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 337(R) 4845 4446 5107 4682 5507 4412 3791 5946 2789 5502 5118 4521 4754 3672 4219 4989 4832 5644 4538 4993 45400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 338(E) 943 2422 1002 1200 2741 377 572 2493 982 2439 1517 522 1998 117 681 1129 534 2044 2609 1921 45500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 339(M) 3391 2885 5774 5202 1338 5407 4210 576 4943 1721 4369 5109 4742 3963 4648 4589 3273 771 3038 3137 45600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 340(M) 1812 1601 3997 3375 696 3401 2222 516 2983 441 4360 2991 3334 2559 641 2503 1740 404 1934 1661 45700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8139 9181 894 1115 701 1378 * * 341(P) 102 1789 1729 1313 428 2112 1410 2021 1236 2235 1470 1394 3205 695 1607 703 1207 1700 2613 2121 45800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 259 8139 2637 894 1115 701 1378 * * 342(W) 3486 3022 4312 4121 1891 4228 1173 2749 310 2389 2250 3147 4206 2971 3005 3484 3396 2818 5644 611 45900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 239 7889 2749 894 1115 1590 583 * * 343(I) 2220 1737 4860 4531 2271 4617 4497 3348 4448 1059 1008 4311 4407 4340 4559 3974 2216 2150 3915 3445 46000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 114 7660 3820 894 1115 1149 865 * * 344(A) 1699 2218 532 33 2555 553 413 2304 1212 2260 1348 582 1822 37 536 966 724 1859 2439 1755 46100% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 10 7753 8795 894 1115 897 1111 * * 345(A) 1523 2068 769 231 2383 1040 522 2084 928 2120 1245 517 1922 1335 611 251 768 123 2361 1732 46200% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 9 7949 8991 894 1115 1432 668 * * 346(N) 1650 3264 1760 348 3555 230 1131 3362 324 3285 2448 2847 1624 733 1607 1438 1645 2887 3466 2662 46300% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 193 7842 3049 894 1115 1432 668 * * 347(K) 150 2932 2433 1483 3710 2747 907 3141 3369 2897 2178 1487 2774 488 1175 1994 1888 2848 2822 2610 46400% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 11 7660 8702 894 1115 1824 479 * * 348(L) 740 922 1768 154 921 2070 829 1384 247 1472 100 1202 2134 805 485 1085 677 471 1340 944 46500% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 11 7660 8702 894 1115 943 1059 * * 349(V) 138 1046 3186 2599 1089 2803 1711 589 645 945 236 2305 2830 2012 2236 1892 1154 2537 1701 1344 46600% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 9 7842 8885 894 1115 380 2109 * * 350(D) 2086 3722 2888 1158 4001 1601 1510 3811 1573 3773 3018 904 2733 1154 2294 1833 2125 575 3993 3117 46700% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8046 9088 894 1115 701 1378 * * 351(K) 78 2308 398 137 2626 483 542 2374 2441 2323 1400 447 531 720 562 724 290 1929 2493 1812 46800% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 8 8046 9088 894 1115 701 1378 * * 352(D) 898 1911 1604 335 2089 1892 573 1746 489 144 811 609 34 182 708 541 74 281 2188 1605 46900% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 10 7745 8787 894 1115 701 1378 * * 353(K) 1676 2544 1956 1135 2823 2531 800 2469 2955 2426 1683 1240 2548 407 1469 1628 1517 119 2497 1619 47000% 149 500 233 43 381 399 106 626 210 466 720 275 394 45 96 359 117 369 294 249 11 7649 8691 894 1115 701 1378 * * 354(N) 1074 1925 1092 1190 3523 1781 1760 3345 1701 3432 2589 3429 1327 1460 2119 1182 1362 2558 3601 3046 47100% * * * * * * * * * * * * * * * * * * * * * * * * * * * * 0