Strain expressing FRSA and method for producing ethanol using same
09567576 ยท 2017-02-14
Assignee
Inventors
- Kyung-Jo Lee (Seoul, KR)
- Yu Ra Kim (Seoul, KR)
- Jung Kee Lee (Daejeon, KR)
- Sun-Shin Cha (Gyeonggi-do, KR)
- Kyu-Ho Lee (Seoul, KR)
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
Y02P20/52
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The present application relates to a strain expressing the FrsA protein, and a method for producing ethanol using the same. The FrsA of the present application has a high PDC enzyme activity for a pyruvate, which is a substrate, and thus can be used in a process for producing ethanol. In addition, an FrsA mutant having improved stability in a host cell can be more effective in producing ethanol due to the increase in stability when the FrsA mutant is overexpressed together with IIA.sup.Glc, compared with when using conventional Zymomonas mobilis-derived PDC.
Claims
1. An isolated polynucleotide encoding a mutant fermentation respiration switch (FrsA) protein, wherein the mutant FrsA protein has pyruvate decarboxylase activity, and wherein the mutant FrsA protein comprises the amino acid sequence of SEQ ID NO: 2, except that: (1) cysteine at the position corresponding to residue 131 of SEQ ID NO: 2 is replaced with alanine in the mutant FrsA protein, or (2) amino acids corresponding to residues 2-19 of SEQ ID NO: 2 are deleted and cysteine at the position corresponding to residue 131 of SEQ ID NO: 2 is replaced with alanine in the mutant FrsA protein.
2. The polynucleotide of claim 1, wherein the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 5 or 7.
3. A vector comprising the polynucleotide according to claim 1.
4. A microorganism comprising the vector according to claim 3.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) These and/or other aspects and advantages of the invention will become apparent and more readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(19) In the present disclosure, the biochemical properties of FrsA were characterized. Glucoses are catabolized to pyruvates during the metabolism. At this point FrsA (Fermentation Respiration Switch) protein functions as a switch at the branch point between respiration and fermentation to direct the metabolism to fermentation
(20) In the present disclosure, it was found that FrsA catalyzes the decarboxylation reaction of pyruvates without the help of a cofactor. Also it was found that IIA.sup.Glc protein increases the activity of FrsA protein.
(21) Also found in the present disclosure is that the ethanol productivity by a host can be increased by overexpressing FrsA and/or IIA.sup.Glc.
(22) Further it was found in the present disclosure that the ethanol productivity by a host can be further improved by using mutant FrsA and IIA.sup.Glc and overexpressing the same in a host.
(23) Thus in one aspect, the present disclosure provides an isolated FrsA gene and protein as well as its mutant forms. Encompassed in the present disclosure are wild-type FrsA gene and protein as well as biological equivalents thereof. The variation at the nucleic acid sequence may be or not be accompanied by amino acid changes. When the changes occur at the amino acid level, a variety of amino acid variants are included in the present disclosure as long as they are biologically equivalent to FrsA according to the present disclosure. In one embodiment the gene and protein are derived from Vibrio vulnificus. In other embodiment, the gene and protein are each represented by SEQ ID Nos: 1 and 2, respectively. Also encompassed in the present disclosure are sequence variants at a nucleic acid and amino acid level having substitutions therein as long as they are biologically equivalent thereto. In one embodiment, the variant is a mutant FrsA having an amino acid sequence of SEQ ID NO; 2 in which the cysteine at amino residue 131 is changed to alanine and a mutant frsA gene encoding the same. The mutant frsA gene and protein in which cysteine at residue 131 is changed to alanine are represented by SEQ ID NOs: 5 and 6, respectively.
(24) In one embodiment, the nucleic acid sequence encoding the protein of SEQ ID NO.2 is represented by SEQ ID NO. 1. But the sequence is not limited thereto. Due to the degeneracy of the codon encoding the amino acid, one amino acid sequence is represented by more than one nucleic acid sequences, which are also encompassed in the present disclosure.
(25) Further the present disclosure provides a cell or a microorganism transformed with frsA gene from V. vulnificus. In one embodiment, frsA gene is represented by SEQ ID NO: 1. In other embodiment, frsA gene is represented by a nucleotide sequence encoding FrsA protein represented by SEQ ID NO: 2 in which the cysteine residue at 131 is substituted with alanine and/or residues 2-19 from the N-terminal are deleted.
(26) The cells of the present disclosure which are transformed with a frsA gene or biological equivalent thereof including mutant frsA genes as described herein express FrsA protein and the amount and/or the time of the protein expression may be controlled as desired by for example use of an appropriate promoter known in the art.
(27) The cells may be further transformed with an ADH (Alcohol dehydrogenase) gene and/or IIA.sup.Glc gene.
(28) ADH genes which may be employed for the present disclosure may come from various origins. For example, in one embodiment ADH genes from S. cerevisiae having GenBank Accession NOs: NM_001183340, NM_001182812, or NM_001181122 may be included in the present disclosure without being limited thereto.
(29) IIA.sup.Glc protein encoded by crr gene is a glucose-specific transporter. This protein is capable of regulating the activity of a target protein by binding to the target. It was found in the present disclosure that one of its targets is FrsA protein and IIA.sup.Glc protein can increase the activity of FrsA by about 2 times when the cells were transformed with IIA.sup.Glc in addition to FrsA.
(30) ADH and/or IIA.sup.Glc may be used in the present disclosure to facilitate the activity of FrsA by being transformed into appropriate cells as described herein.
(31) In the present disclosure, for the production of ethanol, frsA genes may be transformed into host cells or microorganisms such as bacteria or yeast cells which are able to utilize as a carbon source various substrates including a hexose, a pentose and lactose.
(32) In one embodiment, microorganisms or cells which may be cultivated in an anaerobic or facultative anaerobic condition are used. Anaerobic microorganisms can grow in the absence of oxygen and their growth is inhibited by the presence of oxygen. The facultative anaerobic microorganisms usually need oxygen for respiration; however are able to grow also in the absence of oxygen.
(33) Examples of facultative anaerobic microorganisms include Escherichia coli, Corynebacterium glutamicum, Erwinia chrysanthemi, Zymomonas mobilis, Klebsiella spp, Bacillus stearothrermophilus, Kluveromyces spp., Pachysolen tanophilus, lactic acid bacteria, Clostridium spp., and Candida shehatae as bacterial cells, and include Saccharomyces seravisiae, and Pichia stipites as yeast cells, without being limited thereto.
(34) Cells or microorganisms which also may be used for the present disclosure include Archaea Euryarchaeota, Hyperthermophiles, Thermococcus spp. Pyrococcus spp., and Thermococcus onnurineus NA1. Lactic acid bacteria may be used for the present disclosure include Streptococcus spp., Lactobacillus spp., Lactococcus spp., and Leuconostoc spp.
(35) The cells or microorganisms which are employed in the present disclosure for the ethanol production have to meet some requirements such as a particular ranges of temperature for growth, a particular ranges of pH for growth, resistance to alcohol, resistance to osmotic pressure, a certain growth rate, a certain productivity to for example a certain substrate, a certain efficiency of production, genetic stability and resistance to inhibitors. Suitable cells may be selected by ordinary person in the art as desired. In one embodiment, S. cerevisiae, E. coli, or Zymomonas mobilis is used. In other embodiment, Thermococcus onnurineus NA1 is used. In still other embodiment, Corynebacterium glutamicum is used.
(36) Methods and vectors to introduce a frsA gene to cells are known in the art. For example, a nucleotide sequence encoding FrsA protein is obtained by an appropriate method such as PCR, the product of which is then cloned into an appropriate vector conventionally used for protein expression such as pQE30, pGEM-T, pSC101, ColE1, pBR322, pUC8/9, pHC79, pUC19 or pET. The vectors carrying the gene are then transformed into appropriate cells. For the production of ethanol, FrsA proteins are over expressed in the transformed cells.
(37) The frsA gene in the present disclosure is present in cells as an integrated form into a host genome or as separately from the genome in a plasmid. In one embodiment, the gene is present as integrated in a host genome for stable expression of the protein.
(38) The frsA gene may also be introduced into bacterial cells as a part of an operon. The operon includes a frsA gene and regulatory sequences to control the expression of the frsA gene, in which the regulatory sequences include a promoter, an inducer, an operator and a ribosomal binding site. For examples of such operons, those described in U.S. Pat. No. 5,000,000 may be referred.
(39) The recombinant FrsA proteins expressed may be isolated and purified using methods known in the related art. For example, the cultured transformed cells are ruptured to prepare crude cell extracts, which then may be purified by conventional methods such as a chromatography column.
(40) As described in Table 1 of the present disclosure, the present FrsA shows a Km value similar to PDC from Zymomonas; however shows Kcat and Kcat/km values which are eight times higher than that of Zymomonas. This indicates the superior catalytic efficiency of the present FrsA. Further the present FrsA has a Kcat and Kcat/km value which are about 19 and about 110 times higher, respectively than that from S. cerevisiae.
(41) In other aspect, the present disclosure relates to a method to producing ethanol using the cells transformed with FrsA gene or its mutant as disclosed herein.
(42) Bioethanol is a type of biofuel which is produced by fermenting biomass. The present FrsA and its mutant forms when introduced into cells can advantageously be used for the production of ethanol at high efficiency through the fermentation of sugars.
(43) The cells or microorganisms which may be used for the present methods are as described above. Also the cells may be further transformed with IIA.sup.Glc in addition to FrsA as described above. In one embodiment, the present methods include steps of providing cells expressing or carrying FrsA of the present disclosure; contacting the cells with a carbon source; and culturing or incubating the cells under a fermentation condition.
(44) The media, culture condition such as temperatures and types of carbon source and the like may be appropriately selected considering the types of cells utilized from what is known in the art by ordinary person in the art without difficulty. For example Peterson & Ingram et. al. Ann. N.Y. Acad. Sci. 1125: 36372 (2008) may be referred.
(45) For the cells or microorganisms carrying or expressing FrsA are as described hereinbefore.
(46) Carbon sources which may be used for the present method are not particularly limited as long as it can be used for the ethanol production. For example, carbon sources from biomass are used in one embodiment. Biomass refers to biological materials or organic matter derived from living or recently living organisms, which are often plants or plant-based materials.
(47) Biomass mainly consists of two components, i.e., carbohydrates and non-carbohydrates. The carbohydrates are subdivided into a cellulose, i.e., a linear polymer consisting of -1,4 linked glucose unit; hemi-cellulose, i.e., a complex branched polymer consisting of a -1,4 linked xylose backbone and branches consisting of arabinose, galactose, mannose and glucuronic acid. The non-carbohydrates are lignins having cross-linked phenylpropanoid structures. In one embodiment, biomass such as lignocelluloses are used and the biomass is pretreated by a process such as described in WO2009/071996 before the biomass is used for the present methods.
(48) Also carbon sources which may be used for the present disclosure include lactose or major sugars present in biomass such as glucose, xylose, arabinose, galactose and mannose without being limited thereto.
(49) The fermentation process may be regulated by controlling the amount of oxygen present and/or the pH. The control of the amount of oxygen, i.e., anaerobic or facultative anaerobic condition and pH may vary depending on the microorganisms employed and for example, Lin et al, Appl Microbiol Biotechnol (2006) 69: 627642 may be referred.
(50) The anaerobic or facultative anaerobic microorganisms which may be employed for the present disclosure include, for example, Escherichia coli, Corynebacterium glutamicum, Erwinia chrysanthemi, Zymomonas mobilis, Klebsiella spp, Bacillus stearothrermophilus, Kluveromyces spp., Pachysolen tanophilus, lactic acid bacteria, Clostridium spp., Candida shehatae as bacterial cells, and include Saccharomyces seravisiae, and Pichia stipites as yeast cells, without being limited thereto.
(51) The transformed cells of the present disclosure carrying FrsA or its mutants may be cultured using methods known in the art. Also the cells may be cultivated in various culture methods known in the art such as batch culture, continuous culture, fluid batch culture or reactor culture.
(52) The present disclosure is further explained in more detail with reference to the following examples. These examples, however, should not be interpreted as limiting the scope of the present invention in any manner.
EXAMPLES
Example 1
Expression of Proteins and Purification
(53) 1-1. frsA Cloning and Purification
(54) Genomic DNA from V. vulnificus (3) was used as template and [FrsAexp-FK (5-GGGGTACCCCGAATATGTCAGAAGAAGTCAGC-3(SEQ ID NO: 9); KpnI restriction site is underlined) and FrsAexp-RH (5-CCCAAGCTTGTCACCTTAAGAGTTCATCTTCCAGC-3(SEQ ID NO: 10); HindIII restriction site is underlined] are used as primers to amplify a full length frsA gene of 1,255-bp in length.
(55) Then the amplified fragment was digested with KpnI and HindIII and cloned into a vector pQE30 (Qiagen, USA) to obtain pQE-frsA. E. coli JM109 (Promega) cells carrying the vector was grown in a medium containing 0.2 mM isothiopropylthio-D-galactoside and FrsA proteins were isolated and purified from the cells using Ni.sup.+-nitrilotriacetic acid affinity column and size exclusion chromatography (Qiagen) according to the manufacturer's instruction.
(56) For cloning E. coli FrsA, primers specific to frsA gene of E. coli were used. The primers are as follows: ECFrsAexp-FB (5-CGGGATCCATGACACAGGCAAACCTGAG-3(SEQ ID NO: 11); BamHI restriction site is underlined) and ECFrsAexp-RH: 5-CCCAAGCTTGCTATCTCCTGTTGTGATGC-3(SEQ ID NO: 12); HindIII restriction site is underlined). E. coli FrsA was prepared as described above Nit nitrilotriacetic acid affinity column and size exclusion chromatography (Qiagen) according to the manufacturer's instruction. The purified proteins were then electrophoresed on a SDS-PAGE gel (Sodium Dodecyl Sulfate-Polyacrylamide) and stained with Coomassie Brilliant blue. As shown in
(57) 1-2. IIA.sup.Glc Cloning and Purification
(58) Genomic DNA from V. vulnificus(3) was used as template and as primers Crrexp-F (5-CGGGATCCGACACAATGGGTCTGTTTGAC-3(SEQ ID NO: 13); BamHI restriction site is underlined) and Crrexp-R (5-AACTGCAGTAGTAATTACTTAGTTACGCG-3(SEQ ID NO: 14); PstI restriction site is underlined) are used to amplify crr gene of 522-bp in size encoding full length IIA.sup.Glc. The amplified products were then digested with BamHI and PstI and cloned into a vector pQE30 to obtain pQE-crr. Phosphorylated and non-phosphorylated recombinant IIA.sup.Glc proteins were overexpressed in E. coli JM109 in a medium comprising 1.0 mM phophoenolpyruvate or 1.0% glucose, respectively. The expressed proteins were then prepared using Ni.sup.+-nitrilotriacetic acid affinity column and size exclusion chromatography (Qiagen) according to the manufacturer's instruction as described above.
(59) 1-3. Site Directed Mutation in FrsA.
(60) FrsA mutation having alanine at amino acid residue 131 based on SEQ ID NO: 1 instead of cysteine was constructed by overlap-extension method (4) using primers encompassing the mutated region. Nucleotide sequence encoding FrsA having substitution at amino acid residue 131 (C131A) was amplified using two sets of primers as follows: FrsAexp-FK/FrsA FrsA C131AR (5-GTAACCTGCGATGCTGTAAGCCAAGGATGc-3(SEQ ID NO: 15))/FrsA C131AF (5-GCATCCTTGGCTTACAGCATCGCAGGTTAC-3(SEQ ID NO: 16)). Then the two kinds of PCR products as obtained above were then used a template for the 2.sup.nd PCR using FrsAexp-FK and FrsAexp-RH as primers represented by SEQ ID Nos: 9 and 10, respectively. Then the amplified products were then digested with KpnI HindIII and ligated into pQE30 to obtain pQE-frsAC131A. The constructed plasmid were confirmed by sequencing.
(61) 1-4. Preparation of Mutant V. vulnificus Having a Deletion in frsA Gene
(62) Genomic DNA of V. vulnificus MO624/O30 was used as a template and two primers [frsA-up F (5-ACATGCATGCAATAATCGTTTGCGCAGCTCGATACCC-3(SEQ ID NO: 17); SphI restriction site is underlined) and frsA-up R (5-GCTCTAGATCGGCATGTATTGAGTCAATGCCGAGG-3(SEQ ID NO: 18); XbaI restriction site is underlined)] were used to amplify 838 bp DNA fragment comprising upstream region of frsA. Then the fragment was digested with SphI and XbaI and cloned into pBluescript SK II(+)(Promega) to obtain pSKfrsAup.
(63) 1,118-bp DNA fragment comprising downstream of frsA gene prepared by PCR using genomic DNA as a template as described above and the following primers: frsA-downF (5-GCTCTAGAAGGGGATCCGGTCTCGCCATATTCGGA-3(SEQ ID NO: 19); XbaI restriction site is underlined) and frsA-downR (5-GGACTAGTATCCGCTCGAGTGAGCAACATTTGGCC-3(SEQ ID NO: 20); SpeI restriction site is underlined). The amplified fragment was the digested with SpeI and XbaI and cloned into pSKfrsAup to obtain pSKfrsAup/down, which was then digested with SphI and SpeI to obtain 1,956-bp DNA fragment. The 1,956-bp DNA fragment was then cloned into a suicide vector pDM4(5) to obtain pDM4-frsA. SM10pir strain (6) carrying E. coli pDM4-frsA was conjugated with V. vulnificus MO624/O30. The successfully conjugated bacteria were selected in thiosulfate citrate bile salt sucrose medium (7). Then the selected colonies were confirmed by PCR using frsA-upF and frsA-downR as primers to confirm the deletion. The strain with frsA deletion was named SM201.
Example 2
Biochemical Characterization of FrsA
(64) 2-1 Measurement of Reaction Rate Constant
(65) FrsA enzymatic analysis was performed in 50 mM sodium phosphate solution (pH 7.0) containing 1 mM DTT and various concentrations of pyruvate. To measure the amount of acetaldehyde produced from pyruvate, 2 mM NADH and 3.7 U of yeast was added to the FrsA reaction mixture (8). Cell lysates from wild-type E. coli and frsA mutants (9) were used in the range of 0.005 to 1 mg in amount. The acetaldehyde reaction was initiated by adding FrsA (1 nM) and incubated at 37 C. for 5 min and stopped by adding 50 mM potassium hydrogen phthalate buffer (pH3.0). The residual NADH in the reaction mixture was determined by measuring absorption at 340 nm. For CO.sub.2 measurement, FrsA enzyme reaction was performed in 50 mM Tris-HCl buffer (pH 7.0). The amount of carbon dioxide dissolved in the reaction solution was quantified by spectrophotometry after the reaction solution was treated with 10 mM calcium hydroxide (10). Concentrations of the pyruvate and acetaldehyde in the cell lysates and reaction mixtures were determined using Pyruvate Assay Lit (BioVision, USA) and Acetaldehyde UV-method kit (Roche, USA), respectively according to the manufacturer's instruction. To increase the sensitivity of the Acetaldehyde UV-method kit, the reaction mixture was additionally treated with dye (50 ml of 1.0% Tween 20 solution containing 40 mg iodonitrotetrazolium chloride and 10 mg phenazine methosulfate) followed by absorption measurement at 490 nm (11). Results are shown in
(66) Values of K.sub.m and K.sub.cat were calculated as follows. The concentration of reaction products were calculated in the mM unit from the absorption values which were obtained for a total of 1 min for each substrate concentration (S). Then initial reaction rate (Vo) for each concentration of the substrate was determined (here the unit is mM.sub.(product)/sec/mg.sub.(enzyme)). Lineweaver-Burk plot was drawn with the reciprocal values of S and Vo on a X and Y axes, respectively in which case, the reciprocal of X-intercept is K.sub.m, and the reciprocal of Y-intercept is V.sub.max. K.sub.eat value expressed in the unit of sec.sup.1 was calculated by changing the unit weight of the enzyme to the concentration in mM in the calculated V.sub.max (mM.sub.(product)/sec/mg.sub.(enzyme)).
(67) The reaction rates of PDC from Zymomonas and yeast were determined in the same way as described for FrsA. Briefly, ADH/NADH coupled assay as described above was performed using a reaction solution MES, pH 6.0 containing 5 mM MgCl.sub.2 and 1 mM thiamine pyrophosphate at 25 C. In case of Zymomonas, before the reaction was performed, the enzymes were pretreated in a buffer having the following composition (0.1 M sodium citrate buffer, pH 6.0, 20 mM Mg.sup.2+, 1.5 mM thiamine pyrophosphate) and the reaction was initiated by adding thereto 105 mol sodium citrate buffer, pH 6.0, 21 M MgSO.sub.4, 18 M sodium pyruvate, 0.19 M NADH, 3.7 U yeast alcohol dehydrogenase. The reaction products were analyzed in the same way as described above.
(68) 2-3 NMR Spectroscopy
(69) 5 mM pyruvate, -ketoglutarate or -ketobutyrate was added to a solution (50 mM sodium phosphate and 1 mM dithiothreitol in 95% D.sub.2O). Then the reaction mixture was incubated at 20 C. for 90 minutes in the presence or absence of 2 M FrsA. Then the reaction mixture was kept on ice for 2 hours after which NMR spectroscopy was performed using Bruker DRX500 spectrometer at 500 MHz 1H resonance frequency. Results are shown in
(70) 2-4 Enzyme Characteristics of FrsA
(71) A. Activation of Decarboxylation Reaction of Pyruvate by FrsA
(72) When FrsA as prepared in Example 1 was added to a reaction mixture containing pyruvate, it was found that the concentration of pyruvate was decreased (
(73) B. Substrate Specificity
(74) Further to prove the substrate specificity to pyruvate, various substrate such as acetate, lactate, oxaloacetate, -ketoglutarate, and -ketobutyrate were used in the same reaction as described above instead of pyruvate. Based on NMR data, it was found that no carbon dioxide was generated in the substrates other than pyruvate (
(75) C. Activity in Cells
(76) Then to confirm the activity of FrsA in cells, the concentrations of pyruvate in V. vulnificus and in frsA deleted mutant of Example 1 which were incubated in the presence of glucose were compared. As a result, the pyruvate concentration was found to be 3 times higher in the frsA deleted mutant than those of V. vulnificus under anaerobic condition. In contrast, the concentration was found to be similar under aerobic condition (
(77) These results indicate that FrsA catalyzes the pyruvate decarboxylation reaction to decompose the pyruvate into acetaldehyde and carbon dioxide. According to the reaction rate analyses, FrsA is an efficient enzyme having a high catalytic activity having k.sub.cat and k.sub.cat/km of 1,372 11 s.sup.1 and 3,518 183 s.sup.1mM.sup.1, respectively, which is 8 times higher value compared to PDC (pyruvate dehydrogenase complex), and becomes 17 times higher when IIA.sup.Glc was added. (Table 1). Thus FrsA enzyme has an activity enough to catalyze the fermentation in cells.
(78) TABLE-US-00001 TABLE 1 Summary of the kinetic parameters obtained for FrsA.sup.a and PDC K.sub.m k.sub.cat k.sub.cat/K.sub.m (mM) (sec.sup.1) (sec.sup.1 mM.sup.1) FrsA Wildtype 0.39 0.02 1,372 11 3,518 183 Wildtype +dephospho-IIA.sup.Glc 0.39 0.03 2,980 158 7,641 713 +phospho-IIA.sup.Glc 0.39 0.01 1,311 48 3,362 150 PDC Zymomonas mobilis.sup.22 0.40 180 450 Saccharomyces cerevisiae.sup.23 2.29 73 32 .sup.aAverages and standard deviations (in parentheses) were derived from at least three independent assays.
Example 3
Construction of Frsa Expression Plasmid and Production of Ethanol Using the Same
(79) 3-1 Construction of expression plasmid
(80) pXMJ-pdc/adhB cloning
(81) Genomic DNA from Zymomonas mobilis ZM4 (ATCC31821) as a template and primers [ZmPDC FPstI (5-GATCCTGCAGAAAGGAGGACAACCATGAGTTATACTGTCGGTAC-3(SEQ ID NO: 21); PstI restriction site is underlined) and ZmPDC RXbaI (5-GATCTCTAGACTAGAGGAGCTTGTTAACAG-3(SEQ ID NO: 22); XbaI restriction site is underlined)] as primers were used for PCR to amplify full length pdc gene of 1,721-bp in size. Then the amplified fragment was digested with PstI and XbaI and cloned into an expression vector pXMJ19 (M. Jakoby et al. 1999. Construction and application of new Corynebacterium glutamicum vectors. Biotechnology Techniques. 13:437441)) to obtain pXMJ-pdc. Then to clone pXMJ-pdc/adhB, genomic DNA from Zymomonas mobilis ZM4 as a template and primers [ZmadhB FK (5-GGGGTACCAAAGGAGGACAACCTAGCTATGGCTTCTTCAACTTTTTATATTC C-3(SEQ ID NO: 23); KpnI restriction site is underlined) and ZmadhB RE (5-CGGAATTCTTAGAAAGCGCTCAGGAAGAGTTC-3(SEQ ID NO: 24); EcoRI restriction site is underlined)] as primers were used for PCR to amplify full length adhB gene of 1,171-bp in size. Then the fragment was digested with KpnI and EcoRI and cloned into pXMJ-pdc plasmid to obtain pXMJ-pdc/adhB.
(82) pXMJ-frsA/crr/adhB cloning
(83) Genomic DNA from V. vulnificus (Wright, A. C., Simpson, L. M., Oliver, J. D. & Morris, J. G., Jr. Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infect Immun 58, 1769-73 (1990)) as a template and [VvfrsAFP(5-AACTGCAGAAAGGAGGACAACCCCGAATATGTCAGAAGAAGTCAGC-3(SEQ ID NO: 25); PstI restriction site is underlined) and VvfrsA RX (5-GCTCTAGAGATTTGTCACCTTAAGAGTTCATC-3(SEQ ID NO: 26); XbaI restriction site is underlined)] as primers were used for PCR to amplify full length frsA gene of 1,264-bp in size. The amplified DNA was then digested with PstI and XbaI and cloned into an expression vector pXMJ19 to obtain pXMJ-frsA. Then to clone pXMJ-frsA/crr, genomic DNA from V. vulnificus as a template and [VvcrrFBamHI(5-CTAGGGATCCAAAGGAGGACAACCGACACAATGGGTCTGTTTGACAAAC-3(SEQ ID NO: 27); BamHI restriction site is underlined) and VvcrrRKpnI(5-GGGGTACCGTAGTAATTACTTAGTTACGCGTAG-3(SEQ ID NO: 28); KpnI restriction site is underlined)] as primers were used for PCR to amplify a full length crr gene of 524-bp in size. The amplified DNA was then digested with BamHI and KpnI and cloned into a pXMJ-frsA plasmid to obtain pXMJ-frsA/crr. Genomic DNA from V. vulnificus ZM4 as a template and [ZmadhB FK (5-GGGGTACCAAAGGAGGACAACCTAGCTATGGCTTCTTCAACTTTTTATATTC C-3(SEQ ID NO: 29); KpnI restriction site is underlined) and ZmadhB RE (5-CGGAATTCTTAGAAAGCGCTCAGGAAGAGTTC-3(SEQ ID NO: 30); EcoRI restriction site is underlined)] as primers were used for PCR to amplify a full length adhB gene of 1,171-bp in length. The amplified product was then digested with KpnI and EcoRI and cloned into a pXMJ-frsA/crr plasmid to obtain pXMJ-frsA/crr/adhB.
(84) pXMJ-frsA[mt]/crr/adhB Cloning
(85) pQE-frsAC131A plasmid encoding FrsA having a substitution at residue 131 from cysteine to alanine as prepared in Example 1-3 was used as a template and two primers [VvfrsA[mt] FP(5-AACTGCAGAAAGGAGGACAACCTAGCTATGGCCATAGAAACCTCGGCATTG-3(SEQ ID NO: 31); PstI restriction site is underlined) and VvfrsA RX (5-GCTCTAGAGATTTGTCACCTTAAGAGTTCATC-3(SEQ ID NO: 32); XbaI restriction site is underlined)] were used for PCR to amplify frsA DNA fragment of 1,210-bp in length. Then the amplified product was digested with PstI and XbaI and cloned into an expression vector pXMJ19 to obtain pXMJ-frsA[mt]. Then to clone pXMJ-frsA[mt]/crr, genomic DNA from V. vulnificus as a template and two primers [VvcrrFBamHI (5-CTAGGGATCCAAAGGAGGACAACCGACACAATGGGTCTGTTTGACAAAC-3(SEQ ID NO: 33); BamHI restriction site is underlined) and VvcrrRKpnI (5-GGGGTACCGTAGTAATTACTTAGTTACGCGTAG-3(SEQ ID NO: 34); KpnI restriction site is underlined)] were used for PCR to amplify a full length crr gene of 524-bp in length. Then the amplified product was then digested with BamHI and KpnI and cloned into pXMJ-frsA[mt] to obtain pXMJ-frsA[mt]/crr. Then genomic DNA from Zymomonas mobilis ZM4 was used as a template and [ZmadhB FK (5-GGGGTACCAAAGGAGGACAACCTAGCTATGGCTTCTTCAACTTTTTATATTC C-3(SEQ ID NO: 35); KpnI restriction site is underlined) and ZmadhB RE (5-CGGAATTCTTAGAAAGCGCTCAGGAAGAGTTC-3(SEQ ID NO: 36); EcoRI restriction site is underlined)] as primers were used for PCR to amplify a full length adhB gene of 1,171-bp DNA in length. The amplified product was then digested with KpnI and EcoRI and cloned into pXMJ-frsA[mt]/crr to obtain pXMJ-frsA[mt]/crr/adhB.
(86) 3-2 Production of Ethanol Using E. coli
(87) Overexpression of FrsA/IIA.sup.Glc in E. coli
(88) Each of the plasmids constructed in Example 3-1 was introduced into E. coli K12 (Escherichia coli K-12 F-prime factors, old and new. Bacteriological Reviews. 36:587-607) and the transformed cells were grown in a medium used for ethanol production (LB, 5% glucose) at 37 C. without shaking. E. coli K12 was treated with 100 mM MES buffer (2-(N-morpholino)ethanesulfonic acid) at 0 and 12 hours during the culture to prevent an abrupt drop of pH by adding 100 mM MES to the LB medium containing 100 mM MES and 5% glucose, which increased pH of the medium. All the media for culturing contained 4 g/ml of chloramphenicol.
(89) In the meantime, ADH analyses were performed to measure the amount of ethanol produced on aliquots of sample taken at the indicated time during the incubation. Specifically 990 l of reaction buffer (glycine 500 mM, hydrazine sulfate 75 mM, sodium pyrophosphate tetrabasic 75 mM, 3.7 unit ADH, 5 mM NAD.sup.+, pH 9.0) was mixed with 10 l of sample, and the mixture was then incubated at 37 C. for 30 min. After the incubation, NADH produced was measured by taking absorptions at 340 nm. Then the values were used to determine the concentration of ethanol produced by the extrapolation from the calibration curve for ethanol. Results are shown in
(90) As a result, it was found that there is no difference in the amount of ethanol produced when FrsA (pXMJ-frsA/adh) was overexpressed in E. coli. However when FrsA and IIA.sup.Glc (pXMJ-frsA/crr/adh) were overexpressed, the amount of ethanol produced was increased about 310% compared to the control. The amount of ethanol produced when FrsA/IIA.sup.Glc (pXMJ-frsA/crr/adh) was overexpressed was found to be 42% of the amount produced when Pyruvate Decarboxyalse (PDC) (pXMJ-pdc/adh) was overexpressed.
(91) Improvement of Ethanol Production by Controlling pH of the Media
(92) The ethanol productivity by overexpression of FrsA/IIA.sup.Glc (pXMJ-frsA/crr/adh) was found to be increased about 254% when pH of the media was controlled by addition of MES buffer compared to the control in which pH was not controlled (
(93) These results indicate that the present FrsA is a novel PDC enzyme which can be used to produce ethanol by replacing PDC. Also the ethanol production can be increased by controlling pH of the medium employed.
(94) 3-3 Production of Ethanol Using Corynebacterium glutamicum
(95) Production of Ethanol Using Corvnebacterium Glutamicum Overexpressing FrsA/IIA.sup.Glc
(96) Each of the plasmids constructed in Example 3-1 was introduced into Corynebacterium glutamicum ATCC 13032. And the transformed cells were grown in a medium used for ethanol production (LB, 5% glucose) at 30 C. with shaking. All the media used for culturing contained 10 g/ml of chloramphenicol.
(97) In the meantime, ADH analyses were performed as described in 3-2 to measure the amount of ethanol produced on aliquots of supernatant of the sample taken at the indicated time during the incubation. Results are shown in
(98) As a result, it was found that there is no difference in the amount of ethanol produced when FrsA (pXMJ-frsA/adh) was overexpressed in C. glutamicum. However when FrsA/IIAGlc(pXMJ-frsA/crr/adh) was overexpressed, the ethanol production was increased about 2341% compared to the control.
(99) Ethanol Production Using FrsA[mt] Mutant
(100) The mutant FrsA was generated as described in Example 3-1 to improve its stability in host cells. As shown in
(101) Various plasmids carrying FrsA[mt] (pXMJ-pdc/adh, pXMJ-frsA[mt]/adh, pXMJ-frsA[mt]/crr/adh) were constructed and introduced into C. glutamicum and the amount of ethanol produced was determined with time as described in Example 3-2.
(102) Results are shown in
(103) These results indicate that C. glutamicum can be advantageously used for the ethanol production as a host. Also FrsA[mt] mutant proteins can be advantageously used for ethanol production due to its stability in cells.
(104) The various singular/plural permutations may be expressly set forth herein for sake of clarity. Although a few embodiments of the present disclosure have been shown and described, it would be appreciated by those skilled in the art that changes may be made in this embodiment without departing from the principles and sprit of the invention, the scope of which is defined in the claims and their equivalents.
REFERENCES
(105) 1. LIN, Y. & S. TANAKA. Ethanol fermentation from biomass resources: current state and prospects. Appl. Microbiol. Biotechnol. 69: 62742 (2006). 2. DIEN, B. S., M. A. COTTA & T. W. JEFFRIES. Bacteria engineered for fuel ethanol production: current status. Appl. Microbiol. Biotechnol. 63: 25866 (2003). 3. Wright, A. C., Simpson, L. M., Oliver, J. D. & Morris, J. G., Jr. Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infect Immun 58, 1769-73 (1990). 4. Sambrook, J. & Russell, D. W. Molecular cloning: a laboratory manual, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001). 5. Anand, Rishi D. et al. Restriction digestion monitors facilitate plasmid construction and PCR cloning. BioTechniques 36:982-985 (2004). 6. Simon, R., Priefer, U. & Puhler, A. A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Nat Biotechnol 1, 784-791 (1983). 7. Park, K. J. et al. Isolation and characterization of rpoS from a pathogenic bacterium, Vibrio vulnificus: role of .sup.S in survival of exponential-phase cells under oxidative stress. J Bacteriol 186, 3304-12 (2004). 8. Ullrich, J. Yeast pyruvate decarboxylase (2-oxoacid acrboxylase, EC 4.1.1.1) assay of thiamine pyrophosphate. Methods Enzymol. 18, 109-115 (1970). 9. Koo, B. M. et al. A novel fermentation/respiration switch protein regulated by enzyme IIA.sup.Glc in Escherichia coli. J Biol Chem 279, 31613-21 (2004). 10. Gu, W., Bousfield, D. W. & Tripp, C. P. Formation of calcium carbonate particles by direct contact of Ca(OH)2 powders with supercritical CO2. J Mater Chem 16, 3312-3317 (2006). 11. Hinman, L. M. & Blass, J. P. An NADH-linked spectrophotometric assay for pyruvate dehydrogenase complex in crude tissue homogenates. J Biol Chem 256, 6583-6 (1981). 12. Stephenson, M. P. & Dawes, E. A. Pyruvic acid and formic acid metabolism in Sarcina ventriculi and the role of ferredoxin. J Gen Microbiol 69, 331-43 (1971). 13. Erecinska, M. & Silver, I. A. Tissue oxygen tension and brain sensitivity to hypoxia. Respir Physiol 128, 263-76 (2001).