Method for controlling the production of sulphites, of hydrogen sulphide and of acetaldehyde by yeasts

09551000 ยท 2017-01-24

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to the identification of alleles of the MET2 and SKP2 genes having the effect of reducing the production of sulphites, of hydrogen sulphide and of acetaldehyde by Saccharomyces, and to the use of these alleles in methods for controlling the production of these compounds during alcoholic fermentation.

Claims

1. A method for obtaining a yeast strain of the genus Saccharomyces producing an amount of SO.sub.2, of hydrogen sulfide and of acetaldehyde which is lower than that produced by the parent strain from which it is derived, said method being characterized in that it comprises: the selection of a parent strain containing an allele of the SKP2 gene, hereinafter known as SKP2.sup.(350/357X), encoding a Skp2 protein in which the amino acid in position 350 and the amino acid in position 357 are other than isoleucines, and/or an allele of the MET2 gene, hereinafter known as MET2.sup.301X, encoding a Met2 protein in which the amino acid in position 301 is other than a glycine; and the introduction, into said parent strain, of an allele of the SKP2 gene, hereinafter known as SKP2.sup.(350/357)I, encoding a Skp2 protein in which the amino acid in position 350 and the amino acid in position 357 are isoleucines, and/or of an allele of the MET2 gene, hereinafter known as MET2.sup.301G, encoding a Met2 protein in which the amino acid in position 301 is a glycine, wherein said yeast strain belongs to the Saccharomyces cervisiae species.

2. The method as claimed in claim 1, characterized in that said parent strain contains an allele of the SKP2 gene, hereinafter known as SKP2.sup.350V/357T, encoding a Skp2 protein in which the amino acid in position 350 is a valine and/or the amino acid in position 357 is a threonine, and/or an allele of the MET2 gene, hereinafter known as MET2.sup.301R, encoding a Met2 protein in which the amino acid in position 301 is an arginine.

3. The method as claimed in claim 1, characterized in that said parent strain contains an allele of the SKP2 gene, hereinafter known as SKP2.sup.350V/357T, encoding a Skp2 protein in which the amino acid in position 350 is a valine and the amino acid in position 357 is a threonine.

4. The method as claimed in claim 1, characterized in that said parent strain contains an allele of the SKP2 gene, hereinafter known as SKP2.sup.350V/357T, encoding a Skp2 protein in which the amino acid in position 350 is a valine and the amino acid in position 357 is a threonine and an allele of the MET2 gene, hereinafter known as MET2.sup.301R, encoding a Met2 protein in which the amino acid in position 301 is an arginine.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 illustrates the impact of allelic change on the formation of SO.sub.2 (A), of H.sub.25 (B) and of acetaldehyde (C) for the JN10 MET2.sup.JN17 and JN17 MET2.sup.JN10 strains and the corresponding parent JN10 and JN17 strains.

(2) FIG. 2 illustrates the formation of SO.sub.2 (A), of H.sub.2S (B) and of acetaldehyde (C) for the diploid strains JN17/JN10skp2::HPH and JN10/JN17skp2::HPH, which have just one functional allele of SKP2 (respectively the SKP2.sup.JN17 allele and the SKP2.sup.JN10 allele). And the corresponding parent JN10 and JN17 strains.

(3) FIG. 3 illustrates the formation of SO.sub.2 (A), of H.sub.2S (B) and of acetaldehyde (C) for haploid derivatives (4th backcross spores 1 to 4) having the following allele combinations: SKP2.sup.JN17/MET2.sup.JN17; SKP2.sup.JN10/MET2.sup.JN17; SKP2.sup.JN17/MET.sup.JN10; SKP2.sup.JN10/MET2.sup.JN10 on virtually identical genetic backgrounds.

(4) For example, if the parent strain contains an SKP2.sup.(350/357)X allele and a MET2.sup.301G allele, it will be possible to introduce herein an SKP2.sup.(350/357)I allele. Conversely, if the parent strain contains an SKP2.sup.(350/357)I allele and a MET2.sup.301X allele, it will be possible to introduce herein a MET2.sup.301G allele. If the parent strain contains an SKP2.sup.(350/357)X allele and a MET2.sup.301X allele, it is possible to introduce herein either an SKP2.sup.(350/357)I allele or a MET2.sup.301G allele. Preferably, it will be chosen to introduce herein both an SKP2.sup.(350/357)I allele and a MET2.sup.301G allele.

DETAILED DESCRIPTION

(5) In the context of the disclosure of the present invention, the name SKP2.sup.(350/357)I allele encompasses: an allele (more specifically known as SKP2.sup.350I/357X allele) encoding an Skp2 protein in which the amino acid in position 350 is an isoleucine and the amino acid in position 357 is other than an isoleucine; an allele (more specifically known as SKP2.sup.350X/357I allele) encoding an Skp2 protein in which the amino acid in position 350 is other than an isoleucine; an allele (more specifically known as SKP2.sup.350I/357I allele) in which the amino acid in position 350 and the amino acid in position 357 are both isoleucines, the latter allele being particularly preferred.

(6) According to one preferred embodiment of the present invention, said parent strain contains an allele of the SKP2 gene, hereinafter known as SKP2.sup.350V/357T, encoding an Skp2 protein in which the amino acid in position 350 is a valine and/or the amino acid in position 357 is a threonine, and/or an allele of the MET2 gene, hereinafter known as MET2.sup.301R, encoding a Met2 protein in which the amino acid in position 301 is an arginine.

(7) Advantageously, said yeast strain belongs to the Saccharomyces cerevisiae species.

(8) The SKP2.sup.(350/357)I allele and/or the MET2.sup.301G allele can be introduced into the parent strain by various methods, well known in themselves to those skilled in the art. They can be introduced, for example, by crossing with a strain which has the desired SKP2.sup.(350/357)I allele and/or MET2.sup.301G allele, and selection from the descendants of this cross, of those to which said allele has been transmitted.

(9) The SKP2.sup.(350/357)I allele and/or the MET2.sup.301G allele can also be introduced by replacement of the initial allele (respectively SKP2.sup.(350/357)X and MET2.sup.301X) or in addition to said allele, using conventional genetic engineering techniques (cf. for example AMBERG et al., Methods in yeast genetics: a Cold Spring Harbor Laboratory course manual, Cold Spring Harbor Laboratory Press, 2005).

(10) If the method in accordance with the invention is carried out using a haploid parent strain carrying the SKP2.sup.(350/357)X allele, the introduction, into said strain, of a copy of the SKP2.sup.(350/357)I allele by crossing produces a heterozygous SKP2.sup.(350/357)X/SKP2.sup.(350/357)I strain, producing an amount of sulfites, hydrogen sulfide and acetaldehyde which is lower than that produced by the parent strain from which it is derived. It is also possible to obtain haploid descendants of this strain which have the SKP2.sup.(350/357)I allele and therefore produce low amounts of sulfites, of hydrogen sulfide and of acetaldehyde. By means of the series of backcrosses between descendants having the SKP2.sup.(350/357)I allele and the parent strain, it is thus possible to obtain a strain with a genome close to that of the parent strain, having acquired the SKP2.sup.(350/357)I allele and producing low amounts of sulfites, of hydrogen sulfide and of acetaldehyde. Likewise, if the method in accordance with the invention is carried out using a parent strain carrying the MET2.sup.301X allele, the crossing of said strain with a strain having the MET2.sup.301G allele produces a heterozygous MET2.sup.301X/MET2.sup.301G strain, producing an amount of sulfites, of hydrogen sulfide and of acetaldehyde which is lower than that produced by the parent strain from which it is derived. It is also possible, as in the case of SKP2, to obtain haploid descendants of this strain having the MET2.sup.301G allele, and by means of backcrosses with the parent strain, to obtain a strain having the MET2.sup.301G allele on the genetic background of the parent strain.

(11) The subject of the present invention is also an isolated polynucleotide encoding the Skp2 protein of sequence SEQ ID NO: 2, which corresponds to the SKP2.sup.350I/357I allele.

(12) According to one preferred embodiment of the present invention, this polynucleotide is defined by the sequence SEQ ID NO: 1.

(13) This polynucleotide can be used, in the context of the method in accordance with the invention described above, to introduce the SKP2.sup.350I/357I allele into a yeast strain.

(14) A subject of the present invention is also a nucleic acid vector containing a polynucleotide of sequence SEQ ID NO: 1, or a fragment thereof containing at least the region 1045-1075 of SEQ ID NO: 1.

(15) Said vector may be any type of vector usable in yeast, in particular in Saccharomyces. Such vectors are well known in themselves. Use may, for example, be made of extrachromosomal replicating vectors, such as the Yep vectors or the Yrp vectors. Use may also be made of integrating vectors such as the Yip vectors.

(16) In the context of an integrating vector, the polynucleotide of sequence SEQ ID NO: 1, or said fragment, is flanked upstream and downstream by sequences of at least 20 bp, preferably of 40 to 60 bp, which are homologues to those flanking the SKP2 gene or the region 1045-1075 of said gene in the strain into which it is desired to introduce the SKP2.sup.350I/357I allele.

(17) The DNA fragment containing the sequence SEQ ID NO: 1, or at least the region 1045-1075 of SEQ ID NO: 1, will be optionally combined with a marker gene (gene encoding a protein which confers resistance to an inhibitor or gene which makes it possible to complement a mutation responsible for an auxotrophy of the recipient strain) facilitating the selection of the clones having acquired the fragment by transformation.

(18) A subject of the present invention is also a method for evaluating the capacity of a strain of Saccharomyces, preferably of Saccharomyces cerevisiae, to produce SO.sub.2, hydrogen sulfide and acetaldehyde, characterized in that it comprises: genotyping of said strain for the SKP2 gene, and the detection of the presence of an SKP2.sup.(350/357)X allele and in particular of the SKP2.sup.350V/357T allele, and/or of an SKP2.sup.(350/357)I allele, and in particular of the SKP2.sup.350I/357I allele; and/or the genotyping of said strain for the SKP2 gene, and the detection of the presence of an SKP2.sup.(350/357)X allele and in particular of the SKP2.sup.350V/357T allele, and/or of an SKP2.sup.(350/357)I allele, and in particular of the SKP2.sup.350I/357I allele.

(19) A subject of the present invention is also reagents for carrying out the genotyping method in accordance with the invention.

(20) These reagents comprise in particular: allele-specific oligonucleotide probes for differentiating the SKP2.sup.350V/357T allele from an SKP2.sup.(350/357)I allele, and in particular from the SKP2.sup.350I/357I allele, or for differentiating the MET2.sup.301R allele from the MET2.sup.301G allele, by hybridizing selectively with one or other of the alleles to be differentiated; specific primers for differentiating the SKP2.sup.350V/357T allele from an SKP2.sup.(350/357)I allele, and in particular from the SKP2.sup.350I/357I allele, or for differentiating the MET2.sup.301R allele from the MET2.sup.301G allele, and also kits of primers containing at least one specific primer in accordance with the invention. Generally, these kits of primers comprise a primer specific for each allele to be detected, and a common primer, capable of hybridizing, under the same amplification conditions, with all the alleles of the gene concerned.

(21) Probes in accordance with the invention for differentiating the SKP2.sup.350V/357T allele from an SKP2.sup.(350/357)I allele, and in particular from the SKP2.sup.350I/357I allele, can for example be made up of fragments of 15 to 30 bp of the sequence: CTAGAAAATGTAACGRTAGACACCGAATCGCTAGATAYTCCAATGGAATTCTT (SEQ ID NO: 4, where A, T, C, G, R and Y have their usual meaning in the IUPAC code), said fragments containing at least the locus of the G/A polymorphism, or at least the locus of the C/T polymorphism, and where appropriate the 2 polymorphic loci of said sequence, or made up of the sequences complementary thereto.

(22) The probes in which R=G, and also the probes in which YC, can hybridize selectively with the SKP2.sup.350V/357T allele, while the probes in which R=A and those in which Y=T can hybridize selectively with an SKP2.sup.(350/357)I allele, and in particular the SKP2.sup.350I/357I allele.

(23) Probes in accordance with the invention for differentiating the MET2.sup.301R allele from the MET2.sup.301G allele can for example be made up of fragments of 15 to 30 bp of the sequence: ATTTCTGGGCAAAAASGTCAAAGCGTGGTGT (SEQ ID NO: 3, where A, T, C, G and S have their usual meaning in the IUPAC code), said fragments containing the locus of the CIG polymorphisms of said sequence, or made up of the sequences complementary thereto. The probes in which SC can hybridize selectively with the MET2.sup.301R allele, while the probes in which S=G can hybridize selectively with the MET2.sup.301G allele.

(24) Specific primers in accordance with the invention for differentiating SKP2.sup.350V from SKP2.sup.350I can for example be made up of fragments of 15 to 30 bp of the sequence SEQ ID NO: 4 containing at least the locus of the G/A polymorphism or the sequence complementary thereto. The primers in which R=G can be used for the selective amplification of SKP2.sup.350V, while the primers in which R=A can be used for the selective amplification of SKP2.sup.350I.

(25) Specific primers in accordance with the invention for differentiating SKP2.sup.357T from SKP2.sup.357I can for example be made up of fragments of 15 to 30 bp of the sequence SEQ ID NO: 4 containing at least the locus of the C/T polymorphism, or the sequences complementary thereto.

(26) The primers in which YC can be used for the selective amplification of SKP2.sup.357T and those in which Y=T can be used for the selective amplification of SKP2.sup.357I.

(27) According to one preferred embodiment of a kit of primers in accordance with the invention for differentiating the SKP2.sup.350V/357T allele from an SKP2.sup.(350/357)I allele, it comprises a pair of specific primers for differentiating SKP2.sup.350V from SKP2.sup.350I, and a pair of specific primers for differentiating SKP2.sup.357T from SKP2.sup.357I.

(28) Specific primers in accordance with the invention for differentiating the MET2.sup.301R allele from the MET2.sup.301G allele can for example be made up of fragments of 15 to 30 bp of the sequence SEQ ID NO: 3 containing at least the locus of the C/G polymorphism in said sequence, or made up of the sequences complementary thereto. The primers in which SC can be used for the selective amplification of the MET2.sup.301R allele, while the primers in which S=G can be used for the selective amplification of the MET2.sup.301G allele.

(29) Common primers which can be used in combination with the specific primers for differentiating the MET2.sup.301R allele from the MET2.sup.301G allele in the kits of primers in accordance with the invention can for example be made up of fragments of 15 to 30 bp of the following sequence: ATGTTATGCCTGAGGTATGTGTGGTATCTA (SEQ ID NO: 5, where A, T, C and G have their usual meaning in the IUPAC code), or made up of the sequences complementary thereto.

(30) Common primers which can be used in combination with the specific primers for differentiating SKP2.sup.350V from SKP2.sup.350I and/or with the specific primers for differentiating SKP2.sup.357T from SKP2.sup.357I in the kits of primers in accordance with the invention can for example be made up of fragments of 15 to 30 bp of the following sequence: AGTCCACTACAAAAAGTCATTTATTTTTGC (SEQ ID NO: 6, where A, T, C and G have their usual meaning in the IUPAC code), or made up of the sequences complementary thereto.

(31) The present invention will be understood more clearly from the further description which follows, which refers to nonlimiting examples illustrating the effects of the alleles of the MET2 and SKP2 genes on the production of SO.sub.2, of hydrogen sulfide and of acetaldehyde.

THE EXAMPLES

EXAMPLE 1

Effect of the Alleles of the MET2 Gene on the Production of SO2, of Hydrogen Sulfide and of Acetaldehyde

(32) The Saccharomyces cerevisiae JN10 strain (strong producer of SO.sub.2, H.sub.2S and acetaldehyde) has a MET2 gene allele which encodes a Met2 protein in which the amino acid in position 301 is an arginine, whereas the JN17 strain (weak producer of these same compounds) has a MET2 gene allele encoding a Met2 protein in which the amino acid in position 301 is a glycine.

(33) The impact of the replacement of the MET2 allele of JN10 (MET2.sup.JN10) with that of JN17 (MET2.sup.JN17), or conversely that of the replacement of the MET2 allele of JN17 with that of JN10, were evaluated.

(34) Firstly, the initial MET2.sup.JN10 or MET2.sup.JN17 allele was deleted and replaced with a cassette containing a geneticin-resistance gene (KANMX4), according to the method described by Wach et al. (Yeast, 10, 1793-808, 1994). The transformed cells are selected on the basis of their resistance to the antibiotic, and of their methionine auxotrophy.

(35) The MET2.sup.JN17 allele amplified from the genomic DNA of the JN17 strain was then introduced, as a replacement for the geneticin-resistance cassette, into the JN10 strain, and vice versa, the MET2.sup.JN10 allele amplified from the genomic DNA of the JN10 strain was introduced, as a replacement for the geneticin-resistance cassette, into the JN17 strain. The transformed strains are selected on the basis of the restoration of their methionine prototrophy.

(36) The impacts of the allelic change on the formation of SO.sub.2, of H.sub.2S and of acetaldehyde were evaluated during alcoholic fermentations under enological conditions.

(37) The results are represented in FIG. 1. A: production of SO.sub.2; B: production of H.sub.2S; C: production of acetaldehyde.

(38) The replacement of the MET2.sup.JN10 allele with the MET2.sup.JN17 allele in the JN10 strain (JN10-MET2.sup.JN17 strain) leads to a reduction in the concentration of SO.sub.2 formed of approximately 40%. Likewise, the production of H.sub.2S is significantly reduced, 1 on a scale ranging from 0 to 2. The acetaldehyde level is also decreased by close to 40%. The reverse allelic replacement (MET2.sup.JN10 allele on the genetic background of the JN17 strain: JN17-MET2.sup.JN10 strain) has no impact on the production of SO.sub.2, nor on that of acetaldehyde; on the other hand, an increase in the production of H.sub.2S is observed compared with the JN17 parental strain.

EXAMPLE 2

Effect of the Alleles of the SKP2 Gene in the Production of SO2, of Acetaldehyde and of Hydrogen Sulfide

(39) The SKP2 gene allele present in the Saccharomyces cerevisiae JN10 strain) (SKP2.sup.JN10) encodes an Skp2 protein in which the amino acid in position 350 is a valine and the amino acid in position 357 is a threonine, whereas the allele present in the JN17 strain (SKP2.sup.JN17) encodes an Skp2 protein in which the amino acids in positions 350 and 357 are isoleucines.

(40) The impact of the allelic form of the SKP2 gene (SKP2.sup.JN10 or SKP2.sup.JN17) was evaluated via the construction of hemizygotes. The allelic replacement was in fact a method that was more difficult to carry out than in the case of the MET2 gene since the inactivation of the SKP2 gene results only in a delay of growth on minimum medium (Yoshida et al., 2011, mentioned above), this being a phenotype which, contrary to the methionine auxotrophy observed in the case of the MET2 gene, is not easily usable as a selectable marker.

(41) Firstly, the SKP2 gene was inactivated in each of the JN10 and JN17 parental strains, by insertion of the HPH cassette which confers resistance to hygromycin B, so as to obtain respectively the JN10skp2::HPH strains and the JN17skp2::HPH strain. The JN10skp2::HPH strain was then crossed with the JN17 strain, and the JN17skp2::HPH strain was crossed with the JN10 strain, so as to obtain respectively the diploid strains JN17JN10skp2::HPH and JN10/JN17skp2::HPH, which have just one functional allele of SKP2 (respectively the SKP2.sup.JN17 allele and the SKP2.sup.JN10 allele). The production of sulfites, of acetaldehyde and of hydrogen sulfide by these strains which are hemizygote for SKP2 was evaluated under enological alcoholic fermentation conditions. The results are shown in FIG. 2. A: production of SO.sub.2; B: production of acetaldehyde; C: production of hydrogen sulfide.

(42) It is noted that the production of SO.sub.2 is lower in the hemizygote which has the SKP2.sup.JN17 allele than in that which has the SKP2.sup.JN10 allele. Likewise, the acetaldehyde content is lower when the SKP2.sup.JN17 allele is active than when the allele is the one derived from the JN10 strain. Finally, the hydrogen sulfide content is lower when the SKP2.sup.JN17 allele is active than when the allele is the one derived from the JN10 strain. The SKP2.sup.JN17 allele therefore results in a reduction in SO.sub.2, acetaldehyde and hydrogen sulfide contents.

EXAMPLE 3

Combined Effect of the Alleles of the MET2 and SKP2 Gene of the Production of SO2 and of Hydrogen Sulfide

(43) The impact of a combination of the two allelic forms SKP2.sup.JN17 and MET2.sup.JN17 was evaluated by means of the construction of virtually isogenic strains having more than 93% of the genome of the JN10 strain, following cycles of backcrosses. The backcrosses consist of a series of successive crosses with the same strain (in this case JN10). The JN17 strain is first of all hybridized with the JN10 strain. The hybrid obtained, which has 50% of the genome of the JN10 strain and 50% of the genome of the JN17 strain and has the following genotype: SKP2.sup.JN17/SKP2.sup.JN10 and MET2.sup.JN17/MET2.sup.JN10, is induced to sporulate. After sporulation, the haploid spores having the following genotype: SKP2.sup.JN17 and MET2.sup.JN17 are selected by allele-specific PCR for these two genes. These spores are then crossed again with the JN10 strain. A new hybrid is obtained, which has 75% of the genome of the JN10 strain and 25% of the genome of the JN17 strain and has the following genotype: SKP2.sup.JN17/SKP2.sup.JN10 and MET2.sup.JN17/MET2.sup.JN10; this hybrid is in turn induced to sporulate. The asci are dissected and a spore having the following genotype: SKP2.sup.JN17 and MET2.sup.JN17 is selected. The cycles of crossing/sporulation/selection of a spore are continued until derivatives having a very high percentage of the genome of the JN10 strain, in this case 93.25%, are obtained.

(44) By sporulation of the diploid clones obtained during the final cycle, haploid derivatives (4th backcross spores 1 to 4) having the following allele combinations: SKP2.sup.JN17/MET2.sup.JN17; SKP2.sup.JN10/MET2.sup.JN17; SKP2.sup.JN17/MET2.sup.JN10; SKP2.sup.JN10/MET2.sup.JN10 on virtually identical genetic backgrounds are obtained. The production of SO.sub.2, of H.sub.2S and of acetaldehyde of these various derivatives was evaluated under enological alcoholic fermentation conditions. The results are shown in table I below, and by FIG. 3.

(45) TABLE-US-00001 TABLE I Acetaldehyde SKP2 allele MET2 allele SO.sub.2 (mg/l) H.sub.2S (mg/l) JN10 JN10 46 2 43 JN10 JN17 28 1 20 JN17 JN10 5 1 6 JN17 JN17 5 0 6 H.sub.2S scale: 0 = production not detected, 1 = medium production, 2 = strong production

(46) It is noted that the SO.sub.2 production of a derivative which has the two alleles SKP2.sup.JN10/MET2.sup.JN10 is identical to that of the initial JN10 strain, whereas a derivative which has a combination of alleles of SKP2.sup.JN10/MET2.sup.JN17 type produces intermediate amounts of SO.sub.2. Moreover, derivatives which have either the SKP2.sup.JN17/MET2.sup.JN10 allele combination or the two alleles of the JN17 strain, SKP2.sup.JN17/MET2.sup.JN17, both produce very low amounts of SO.sub.2 which are identical to those of the initial JN17 strain.

(47) The effect of the various allele combinations on the production of acetaldehyde is identical to that observed on the production of SO.sub.2.

(48) Furthermore, the derivatives which have the two alleles of the JN10 strain produce high amounts of H.sub.2S, identical to the JN10 parental strain, while the derivatives which have one of the two alleles of the JN17 strain, and therefore have the following genotypes: SKP2.sup.JN17/MET2.sup.JN10 or SKP2.sup.JN10/MET2.sup.JN17, produce H.sub.2S in intermediate amounts and only the derivative which has the two alleles SKP2.sup.JN17/MET2.sup.JN17 does not produce detectable H.sub.2S, in the same way as the JN17 parental strain.