Recombinant yeast and substance production method using the same

09546356 ยท 2017-01-17

Assignee

Inventors

Cpc classification

International classification

Abstract

Substance productivity is improved by introducing a metabolic pathway for synthesis of acetyl-CoA or acetic acid from glucose-6-phosphate into yeast. Acetic acid productivity, acetyl-CoA productivity, and productivity of a substance made from acetyl-CoA-derived are improved by attenuating genes involved in the glycolytic system of yeast and introducing a phosphoketolase gene into the yeast.

Claims

1. A recombinant, non-xylose fermenting Saccharomyces cerevisiae, which comprises an attenuated phosphofructokinase gene endogenous to said Saccharomyces cerevisiae, an introduced phosphoketolase gene, an introduced Clostridium acetobytylicum acetoacetic acid decarboxylase gene, an Clostridium acetobytylicum butyrate-acetoacetate CoA-transferase subunit A gene, an introduced Clostridium acetobytylicum butyrate-acetoacetate CoA-transferase subunit B gene, an introduced Clostridium acetobytylicum acetyl-CoA acetyltransferase gene, and an introduced Clostridium acetobytylicum isopropanol dehydrogenase gene, wherein isopropanol production by said Saccharomyces cerevisiae is enhanced compared with wild-type strain, and wherein said introduced phosphoketolase gene encodes the amino acid sequence of any one of SEQ ID NOS: 1 to 19.

2. A method for producing isopropanol, comprising a step of culturing the recombinant yeast of claim 1 in medium.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a characteristic diagram showing a part of a glycolytic system including a metabolic pathway in which a phosphofructokinase gene to be attenuated in the yeast according to the present invention is involved.

(2) FIG. 2 is a characteristic diagram showing a part of a pentose phosphate system including a metabolic pathway in which a phosphoketolase gene to be introduced into the yeast according to the present invention is involved.

(3) FIG. 3 is a characteristic diagram showing the result of conducting molecular phylogenetic tree analysis of phosphoketolase genes derived from various organisms.

(4) FIG. 4 is a characteristic diagram showing a pathway for synthesis of acetyl-CoA from acetylphosphate and acetic acid and a pathway for synthesis of another substance from acetyl-CoA.

(5) FIG. 5 is a characteristic diagram showing the result of conducting molecular phylogenetic tree analysis of phosphotransacetylase genes derived from various organisms.

(6) FIG. 6 is a flow chart for construction of a pESC-HIS-ZWF1-RPE1 vector.

(7) FIG. 7 is a flow chart for construction of a pESC-Leu-PKT vector and a pESC-Leu-PKT-PTA vector.

(8) FIG. 8 is a flow chart for construction of a pESC-Trp-ATF1 vector.

(9) FIG. 9 is a flow chart for construction of a vector for disruption of a PFK1 gene.

(10) FIG. 10 is a flow chart for construction of a vector for disruption of a PFK2 gene.

(11) FIG. 11 is a characteristic diagram showing the results of an acetic acid production test.

(12) FIG. 12 is a characteristic diagram showing the results of an ethyl acetate production test.

(13) FIG. 13 is a characteristic diagram showing the results of an isopropanol production test.

(14) FIG. 14 is a characteristic diagram showing the results of conducting metabolome analysis of yeast by CE-TOFMS.

EMBODIMENTS FOR CARRYING OUT THE INVENTION

(15) The present invention will be described in detail as follows with reference to drawings and examples.

(16) The recombinant yeast according to the present invention comprises an attenuated gene that encodes an enzyme involved in a glycolytic system, and an introduced phosphoketolase gene. The recombinant yeast has activity to convert xylulose 5-phosphate to acetylphosphate. Examples of yeast that can be used as a host include, but are not particularly limited to, yeast of the genus Candida such as Candida Shehatae, yeast of the genus Pichia such as Pichia stipitis, yeast of the genus Pachysolen such as Pachysolen tannophilus, yeast of the genus Saccharomyces such as Saccharomyces cerevisiae, and yeast of the genus Schizosaccharomyces such as Schizosaccharomyces pombe. In particular, Saccharomyces cerevisiae is preferred. A yeast strain to be used herein may be an experimental strain to be used for convenience of experiments or an industrial strain (practical strain) to be employed for practical usefulness. Examples of such an industrial strain include yeast strains to be used for production of wine, sake, and shochu (spirits).

(17) Here, an example of a gene that encodes an enzyme involved in a glycolytic system and is subjected to attenuation is a phosphofructokinase gene.

(18) Furthermore, as an enzyme involved in the glycolytic system, hexokinase, glucose phosphate isomerase, aldolase, triosephosphate isomerase, glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase, phosphoglyceromutase, enolase, and pyruvate kinase are known in addition to phosphofructokinase. Genes encoding these enzymes other than phosphofructokinase may also be attenuated.

(19) The phosphofructokinase gene encodes an enzyme that converts fructose-6-phosphate into fructose-1,6-bisphosphate in the glycolytic system, as shown in FIG. 1. The expression, the phosphofructokinase gene is attenuated means that phosphofructokinase activity is significantly lowered. In other words, the expression means that the amount of fructose-1,6-bisphosphate to be synthesized through the glycolytic system is significantly decreased. Examples of means for attenuating a phosphofructokinase gene include, but are not particularly limited to, disruption or deletion of the phosphofructokinase gene, disruption or deletion of the expression control region of the phosphofructokinase gene, addition of an inhibitor (e.g., citric acid) of phosphofructokinase, and a technique for suppressing the expression of the phosphofructokinase gene with the use of a method using RNA interference such as siRNA or an antisense method.

(20) In addition, as endogenous phosphofructokinase genes of Saccharomyces cerevisiae, a PFK1 gene and a PFK2 gene are known (THE JOURNAL OF BIOLOGICAL CHEMISTRY, Vol. 275, No. 52, Issue of December 29, pp. 40952-40960, 2000). When Saccharomyces cerevisiae is used as a host for the recombinant yeast according to the present invention, either the PFK1 gene or the PFK2 gene may be attenuated or both genes may be attenuated. Moreover, endogenous phosphofructokinase genes of yeast other than Saccharomyces cerevisiae are also known and can be specified referring to existing databases such as Genbank, DDBJ, and EMBL. As described above, phosphofructokinase genes specified by the above techniques and/or means can be attenuated by specifying endogenous phosphofructokinase genes of various types of yeast.

(21) Furthermore, the recombinant yeast according to the present invention acquires the capacity to convert xylulose 5-phosphate into acetylphosphate through exogenous introduction of a phosphoketolase gene (PKT gene). In addition, xylulose 5-phosphate is synthesized as a metabolite resulting from yeast's original pentose phosphate system from ribulose-5-phosphate (FIG. 2). Acetylphosphate synthesized by phosphoketolase is converted into acetic acid by yeast's original acetic acid kinase. Therefore, in the recombinant yeast prepared by attenuating a phosphofructokinase gene and introducing a phosphoketolase gene, the productivity of acetic acid to be secreted to medium is drastically improved.

(22) Examples of phosphoketolase genes to be preferably used herein include, but are not particularly limited to, phosphoketolase genes derived from lactic acid bacteria or bifidobacteria having a metabolic pathway for heterolactic fermentation. Here, the term heterolactic fermentation refers to fermentation whereby pyruvic acid generated via the glycolytic system from glucose is metabolized to give not only lactic acid, but also ethanol, acetic acid, and carbon dioxide. Through such heterolactic fermentation, ethanol or acetic acid is synthesized from acetylphosphate that is generated by phosphoketolase.

(23) More specifically, as phosphoketolase genes, as shown in FIG. 3, phosphoketolase genes derived from various microorganisms can be used. In addition, Table 1 below shows the relationship between numbers assigned in the molecular phylogenetic tree shown in FIG. 3 and microorganisms.

(24) TABLE-US-00001 TABLE 1 1 Bifidobacterium_animalis 2 Bifidobacterium_longum 3 Bifidobacterium_adolescentis 4 Bifidobacterium_pullorum 5 Lactobacillus_plantarum_1 6 Lactobacillus_plantarum_2 7 Lactobacillus_pentosus 8 Lactobacillus_sakei 9 Lactobacillus_salivarius 10 Lactobacillus_reuteri 11 Lactobacillus_johnsonii 12 Lactobacillus_casei 13 Bacillus_coagulans 14 Leuconostoc_mesenteroides_1 15 Leuconostoc_mesenteroides_2 16 Streptococcus_gordonii 17 Clostridium_acetobutylicum 18 Clostridium_butyricum 19 Mycoplasma_agalactiae 20 Cellulomonas_flavigena 21 Methylobacterium_populi 22 Mycobacterium_gilvum 23 Mycobacterium_vanbaalenii 24 Nitrosococcus_oceani 25 Synechococcus_sp. 26 Rhizobium_leguminosarum 27 Nocardioides_sp. 28 Anabaena_variabilis 29 Bacteroides_capillosus 30 Marinobacter_aquaeolei 31 Acidovorax_sp. 32 Pseudamonas_aeruginosa 33 Maricaulis_maris 34 Cyanothece_sp. 35 Mariprofundus_ferrooxydans 36 Nostoc_punctiforme 37 Aspergullus_oryzae_1 38 Aspergullus_oryzae_2 39 Aspergullus_nidulans 40 Aspergillus_fumigatus_1 41 Aspergillus_fumigatus_2 42 Cryptococcus_neoformans_1 43 Cryptococcus_neoformans_2 44 Penicillium_chrysogenum 45 Neosartorya_fischeri_1 46 Neosartorya_fischeri_2 47 Aspergillus_niger_1 48 Aspergillus_niger_2 49 Aspergillus_terreus 50 Aspergillus_clavatus 51 Sclerotinia_sclerotiorum 52 Botryotinia_fuckeliana 53 Phaeosphaeria_nodorum 54 Pyrenophora_tritici-repentis 55 Neurospora_crassa_1 56 Neurospora_crassa_2 57 Podospora_anserina 58 Magnaporthe_grisea 59 Ustilago_maydis

(25) As phosphoketolase genes, phosphoketolase genes classified within the broken-line frame of the molecular phylogenetic tree shown in FIG. 3 are preferably used. Phosphoketolase genes classified in the group are mainly derived from lactic acid bacteria or bifidobacteria having metabolic pathways for heterolactic fermentation. Further specifically, as phosphoketolase genes classified within the broken-line frame of the molecular phylogenetic tree shown in FIG. 3, genes derived from microorganisms belonging to the genus Bifidobacterium that are bifidobacteria, microorganisms belonging to the genus Lactobacillus that are lactic acid bacteria, or microorganisms belonging to the genus Leuconostoc are preferably used. Further specifically, as a phosphoketolase gene classified within the broken-line frame of the molecular phylogenetic tree shown in FIG. 3, a gene encoding phosphoketolase comprising the amino acid sequence shown in any one of SEQ ID NOS: 1 to 19 can be used. The amino acid sequence of SEQ ID NO: 1 is the amino acid sequence encoded by a Bifidobacterium animalis-derived phosphoketolase gene. The amino acid sequences shown in SEQ ID NOS: 2 to 19 are the amino acid sequences encoded by phosphoketolase genes derived from Bifidobacterium longum, Bifidobacterium adolescentis, Bifidobacterium pullorum, Lactobacillus plantarum, Lactobacillus plantarum, Lactobacillus pentosus, Lactobacillus sakei, Lactobacillus salivarius, Lactobacillus reuteri, Lactobacillus johnsonii, Lactobacillus casei, Bacillus coagulans, Leuconostoc mesenteroides, Leuconostoc mesenteroides, Streptococcus gordonii, Clostridium acetobutylicum, Clostridium butyricum, and Mycoplasma agalactiae, respectively.

(26) Specifically, in the present invention, a phosphoketolase gene encoding the amino acid sequence of any one of SEQ ID NOS: 1 to 19 is preferably used. In particular, as phosphoketolase genes, Bifidobacterium animalis (SEQ ID NO: 1), Bifidobacterium longum (SEQ ID NO: 2), Bifidobacterium adolescentis (SEQ ID NO: 3), and Bifidobacterium pullorum (SEQ ID NO: 4) are most preferably used.

(27) Furthermore, a phosphoketolase gene may consist of a polynucleotide encoding a protein that consists of an amino acid sequence having a deletion, a substitution, an addition, or an insertion of 1 or several amino acids with respect to the amino acid sequence of any one of SEQ ID NOS: 1 to 19 and has phosphoketolase activity. Here, the term several amino acids refers to, for example, 2 to 100, preferably 2 to 80, more preferably 2 to 55, and further preferably 2 to 15 amino acids.

(28) Furthermore, a phosphoketolase gene may consist of a polynucleotide encoding a protein that consists of an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more, and further preferably 98% or more sequence similarity with respect to the amino acid sequence of any one of SEQ ID NOS: 1 to 19, and has phosphoketolase activity. Here, the term sequence similarity refers to a value that is calculated to represent similarlity between two amino acid sequences when sequence similarity search software such as BLAST, PSI-BLAST, or HMMER is used with default settings.

(29) Here, the term phosphoketolase activity refers to activity to convert xylulose-5-phosphate to acetylphosphate. Therefore, whether or not a predetermined protein has phosphoketolase activity can be determined based on the amount of acetylphosphate synthesized, using a reaction solution containing xylulose-5-phosphate as a substrate (e.g., JOURNAL OF BACTERIOLOGY, Vol. 183, No. 9, May 2001, p. 2929-2936).

(30) The recombinant yeast according to the present invention can increase the amount of acetylphosphate synthesized because of the presence of a phosphoketolase gene introduced, by enhancing the expression of an enzyme gene involved in the pentose phosphate system shown in FIG. 2. As a result, it can increase the amount of synthesized acetic acid. Examples of genes to be subjected to enhancement of expression in the pentose phosphate system shown in FIG. 2 include, but are not particularly limited to, a glucose-6-phosphate dehydrogenase gene and a ribulose-5-phosphate-3-epimerase gene. Moreover, the expression of either one of or both of these genes may be enhanced.

(31) Furthermore, an endogenous glucose-6-phosphate dehydrogenase gene of Saccharomyces cerevisiae is known as a ZWF1 gene. Also, an endogenous ribulose-5-phosphate-3-epimerase gene of Saccharomyces cerevisiae is known as an RPE1 gene. Endogenous glucose-6-phosphate dehydrogenase genes or ribulose-5-phosphate-3-epimerase genes are known for yeast other than Saccharomyces cerevisiae and can be specified referring to the existing databases such as Genbank, DDBJ, and EMBL.

(32) Here, the expression gene expression is enhanced refers to significant improvement in activity of an enzyme to be encoded by a subject gene, and is meant to include a significant increase in the expression level of such a gene. An example of a technique for enhancing gene expression is a technique for significantly increasing the expression level of the relevant gene. Examples of a technique for increasing the expression level of a specific gene include, but are not particularly limited to, a technique that involves modifying the expression control region of an endogenous gene of a chromosome and a technique that involves introducing a vector having the relevant gene located downstream of a promoter with high activity.

(33) Meanwhile, the recombinant yeast according to the present invention can increase the amount of acetyl-CoA synthesized by further introducing a phosphotransacetylase gene (PTA gene) or further enhancing an acetyl-CoA synthetase gene (ACS gene) as shown in FIG. 4, in addition to attenuation of a phosphofructokinase gene and introduction of a phosphoketolase gene.

(34) A phosphotransacetylase gene is not yeast's original gene and thus is introduced as a foreign gene. Examples of such a phosphotransacetylase gene are not particularly limited, and genes referred to as PTA genes in various bacteria are broadly applicable.

(35) More specifically, as phosphotransacetylase genes, as shown in FIG. 5, phosphotransacetylase genes derived from various microorganisms can be used. In addition, Table 2 below shows the relationship between numbers assigned in the molecular phylogenetic tree in FIG. 5 and microorganisms.

(36) TABLE-US-00002 TABLE 2 1 Bacillus_subtllis 2 Bacillus_amyloliquefaciens 3 Bacillus_licheniformis 4 Geobacillus_thermodenitrificans 5 Listeria_innocua 6 Staphylococcus_aureus 7 Lactococcus_lactis 8 Carnobacterium_sp. 9 Mycobacterium_vanbaalenii 10 Clostridium_perfringens 11 Enterococcus_faecalis 12 Leuconostoc_mesenteroides 13 Clostridium_acetobutylicum 14 Bifidobacterium_animalis_lactis 15 Corynebacterium_glutamicum 16 Escherichia_coli_K-12 17 Escherichia_coli_53638 18 Vibrio_vulnificus 19 Haemophilus somnus 20 Yersinia_pestis 21 Shigella_sonnei

(37) The origins of the following PTA genes are shown in FIG. 5 and Table 2. The amino acid sequence of a protein encoded by the Bacillus subtilis-derived PTA gene is shown in SEQ ID NO: 20, the amino acid sequence of a protein encoded by the Bacillus amyloliquefaciens-derived PTA gene is shown in SEQ ID NO: 21, the amino acid sequence of a protein encoded by the Bacillus licheniformis-derived PTA gene is shown in SEQ ID NO: 22, the amino acid sequence of a protein encoded by the Geobacillus thermodenitrificans-derived PTA gene is shown in SEQ ID NO: 23, the amino acid sequence of a protein encoded by the Listeria innocua-derived PTA gene is shown in SEQ ID NO: 24, the amino acid sequence of a protein encoded by the Staphylococcus aureus-derived PTA gene is shown in SEQ ID NO: 25, the amino acid sequence of a protein encoded by the Lactococcus lactis-derived PTA gene is shown in SEQ ID NO: 26, the amino acid sequence of a protein encoded by the Carnobacterium sp.-derived PTA gene is shown in SEQ ID NO: 27, the amino acid sequence of a protein encoded by the Mycobacterium vanbaalenii-derived PTA gene is shown in SEQ ID NO: 28, the amino acid sequence of a protein encoded by the Clostridium perfringens-derived PTA gene is shown in SEQ ID NO: 29, the amino acid sequence of a protein encoded by the Enterococcus faecalis-derived PTA gene is shown in SEQ ID NO: 30, the amino acid sequence of a protein encoded by the Leuconostoc mesenteroides-derived PTA gene is shown in SEQ ID NO: 31, the amino acid sequence of a protein encoded by the Clostridium acetobutylicum-derived PTA gene is shown in SEQ ID NO: 32, the amino acid sequence of a protein encoded by the Bifidobacterium animalis_lactis-derived PTA gene is shown in SEQ ID NO: 33, the amino acid sequence of a protein encoded by the Corynebacterium glutamicum-derived PTA gene is shown in SEQ ID NO: 34, the amino acid sequence of a protein encoded by the Escherichia coli K-12-derived PTA gene is shown in SEQ ID NO: 35, the amino acid sequence of a protein encoded by the Escherichia coli 53638-derived PTA gene is shown in SEQ ID NO: 36, the amino acid sequence of a protein encoded by the Vibrio vulnificus-derived PTA gene is shown in SEQ ID NO: 37, the amino acid sequence of a protein encoded by the Haemophilus somnus-derived PTA gene is shown in SEQ ID NO: 38, the amino acid sequence of a protein encoded by the Yersinia pestis-derived PTA gene is shown in SEQ ID NO: 39, and the amino acid sequence of a protein encoded by the Shigella sonnei-derived PTA gene is shown in SEQ ID NO: 40.

(38) In addition, the phosphotransacetylase gene may consist of a polynucleotide encoding a protein that consists of an amino acid sequence having a deletion, a substitution, an addition, or an insertion of 1 or several amino acids with respect to the amino acid sequence of any one of SEQ ID NOS: 20 to 40, and has phosphotransacetylase activity. Here, the term several amino acids refers to, for example, 2 to 35, preferably 2 to 25, more preferably 2 to 15, and further preferably 2 to 10 amino acids.

(39) Furthermore, the phosphotransacetylase gene may consist of a polynucleotide encoding a protein that consists of an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more, and further preferably 98% or more sequence similarity with respect to the amino acid sequence of any one of SEQ ID NOS: 20 to 40, and has phosphotransacetylase activity. Here, the term sequence similarity refers to a value that is calculated to represent similarity between two amino acid sequences when sequence similarity search software such as BLAST, PSI-BLAST, or HMMER is used with default settings.

(40) Here, the term phosphotransacetylase activity refers to activity to transfer CoA to acetylphosphate. Therefore, whether or not a predetermined protein has phosphotransacetylase activity can be determined based on the amount of acetyl-CoA synthesized using a reaction solution containing acetylphosphate and CoA.

(41) Furthermore, the acetyl-CoA synthetase gene shown in FIG. 4 is yeast's original gene. Hence, for enhancement of such an acetyl-CoA synthetase gene, a technique that involves modifying the expression control region of the relevant endogenous gene of a chromosome and a technique that involves introducing a vector having the relevant gene located downstream of a promoter having high activity are applicable. In addition, as endogenous acetyl-CoA synthetase genes of Saccharomyces cerevisiae, an ACS1 gene and an ACS2 gene are known. Endogenous acetyl-CoA synthetase genes of yeast other than Saccharomyces cerevisiae are also known and can be specified referring to existing databases such as Genbank, DDBJ, and EMBL.

(42) As described above, in the recombinant yeast according to the present invention, the amount of acetylphosphate synthesized; that is, the amount of acetic acid synthesized is significantly increased (FIG. 2) or the amount of acetyl-CoA synthesized is significantly increased (FIG. 4). Therefore, the recombinant yeast according to the present invention can be used when acetic acid or acetyl-CoA is a substance to be produced. Alternatively, the recombinant microorganism according to the present invention can be used as a host for further modification to enable production of another substance (in FIG. 4, denoted as a substance made from acetyl-CoA) using acetyl-CoA as a substrate.

(43) Specifically, examples of such a substance made from acetyl-CoA that can be synthesized include, but are not particularly limited to, butanol, alkane, propanol, fatty acid, fatty acid ester, acetone, acetoacetic acid, ethyl acetate, polyketide, amino acid, and terpenoid. When these are substances to be produced, the productivity thereof can be significantly improved using the recombinant yeast according to the present invention.

(44) When isopropanol is a substance to be produced, for example, with reference to APPLIED AND ENVIRONMENTAL MICROBIOLOGY, December 2007, p. 7814-7818, Vol. 73, No. 24, a gene to be further introduced into the recombinant microorganism according to the present invention can be specified. Furthermore, when polyketide is a substance to be produced, with reference to Proc. Natl. Acad. Sci. U.S.A., Vol. 95, pp. 505-509, January 1998, a gene to be further introduced into the recombinant microorganism according to the present invention can be specified. Moreover, when fatty acid is a substance to be produced, for example, with reference to Eur. J. Biochem. 112, p. 431-442 (1980) or MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, September 2004, p. 501-517, a gene (e.g., a FAS gene) to be further introduced to or enhanced in the recombinant microorganism according to the present invention can be specified. Furthermore, when alkane is a substance to be produced, a gene that is involved in aldehyde synthesis from fatty acid and further alkane synthesis from aldehyde and should be further introduced into the recombinant microorganism according to the present invention can be specified with reference to Science vol. 329 30 July pp. 559-562, for example.

(45) Furthermore, the expression of an endogenous alcohol acetyltransferase gene (ATF1 gene) of yeast is further enhanced, so that the amount of ethyl acetate synthesized from acetyl-CoA can be increased. Specifically, when ethyl acetate is a substance to be produced, the expression of such an endogenous ATF1 gene is preferably enhanced.

(46) Also, as described above, when the expression of a predetermined gene is enhanced, an appropriate promoter with high transcriptional activity is used. Examples of such a promoter that can be used herein include, but are not particularly limited to, a glyceraldehyde-3-phosphate dehydrogenase gene (TDH3) promoter, a 3-phosphoglyceratekinase gene (PGK1) promoter, and a high osmotic pressure-responsive 7 gene (HOR7) promoter. Of these, a pyruvate decarboxylase gene (PDC1) promoter is preferred because of its high capacity to cause high-level expression of a gene of interest located downstream thereof. Furthermore, through the use of a gall promoter, a gal10 promoter, a heat shock protein promoter, a MF1 promoter, a PHO5 promoter, a GAP promoter, an ADH promoter, an AOX1 promoter, or the like, a gene downstream thereof can be strongly expressed.

(47) Also, as a method for introducing the above gene, any conventionally known technique that is known as a method for yeast transformation is applicable. Specifically, for example, gene introduction can be performed by a method described in an electroporation method Meth. Enzym., 194, p 182 (1990), a spheroplast method Proc. Natl. Acad. Sci. U.S.A., 75 p 1929 (1978), a lithium acetate method J. Bacteriology, 153, p 163 (1983), Proc. Natl. Acad. Sci. U.S.A., 75 p 1929 (1978), Methods in yeast genetics, 2000 Edition: A Cold Spring Harbor Laboratory Course Manual, or the like. Examples thereof are not limited to these methods.

(48) When a substance is produced using the above-explained recombinant yeast, the yeast is cultured in a medium containing an appropriate carbon source. More specifically, recombinant yeast pre-cultured according to a conventional method is cultured in a medium so as to cause it to produce a substance of interest. For example, when butanol, alkane, propanol, fatty acid, fatty acid ester, acetone, acetoacetic acid, acetic ester, polyketide, amino acid, and terpenoid are produced as substances of interest, these substances of interest are synthesized in a medium. Hence, after cells are separated from the medium by a means such as centrifugation, such substances can be isolated from the supernatant fraction. To isolate such substances from a supernatant fraction, for example, an organic solvent such as ethyl acetate or methanol is added to the supernatant fraction, and then the resultant is sufficiently stirred. An aqueous layer is separated from a solvent later, and then the substances can be extracted from the solvent layer.

EXAMPLES

(49) The present invention is hereafter described in greater detail with reference to the following examples, although the technical scope of the present invention is not limited thereto.

(50) In these examples, recombinant yeast was prepared by attenuating the endogenous phosphofructokinase gene of wild-type yeast or isopropanol-producing yeast and introducing a phosphoketolase gene into the yeast. Recombinant yeast was further prepared by introducing or enhancing other genes in addition to the aforementioned gene attenuation and gene introduction. These strains were then examined for acetic acid productivity, ethyl acetate productivity, and isopropanol productivity.

(51) [Materials and Methods]

(52) Hosts

(53) ECOS Competent E. coli JM109 (Nippon Gene Co., Ltd.), S. cerevisiae YPH499 (Stratagene) as wild-type yeast, and a #15-10 strain (disclosed in the reference example described later) as isopropanol-producing yeast were used.

(54) Plasmid

(55) <Preparation of pESCpgkgap-HIS>

(56) PCR was performed under the following conditions.

(57) (Primers)

(58) TABLE-US-00003 EcoRI-Pgap-F: (SEQIDNO:41) 5-CACGGAATTCCAGTTCGAGTTTATCATTATCAA-3 BamHI-Pgap-R: (SEQIDNO:42) 5-CTCTGGATCCTTTGTTTGTTTATGTGTGTTTATTC-3
(PCR Conditions) Template: 1 ng of pDI626 plasmid (see JP Patent Publication (Kokai) No. 2005-52046 A) Primer: 50 pmol primer DNA Reaction solution: 50 l of the solution containing 1 Pfu Ultra II reaction buffer (Stratagene), 10 nmol dNTP, and 1 l of Pfu Ultra II fusion HS DNA polymerase (Stratagene) Reaction: 95 degrees C. (2 minutes)(95 degrees C. (30 seconds), 55 degrees C. (30 seconds), 72 degrees C. (2 minutes))25 cycles72 degrees C. (3 minutes)4 degrees C. (stock)

(59) After PCR under the above conditions, a PCR product contained in the reaction solution was purified using a MinElute PCR purification kit (QIAGEN). Subsequently, the PCR product was digested with restriction enzymes Bam HI and EcoR I. Agarose gel electrophoresis was performed, a 686-bp fragment was excised, and the fragment was thus purified using a MiniElute Gel extraction kit (QIAGEN). Furthermore, the resultant was ligated to a pESC-HIS vector digested with restriction enzymes Bam HI and EcoR I. The thus obtained plasmid was designated as pESCgap-HIS.

(60) Next, PCR was performed under the following conditions.

(61) (Primers)

(62) TABLE-US-00004 MunI-Ppgk1-F: (SEQIDNO:43) 5-TAGGCAATTGCAAGAATTACTCGTGAGTAAGG-3 EcoRI-Ppgk1-R: (SEQIDNO:44) 5-ATAAGAATTCTGTTTTATATTTGTTGTAAAAAGTAG-3
(PCR Conditions) Template: pDI626PGK plasmid 1 ng Primer: 50 pmol primer DNA Reaction solution: 50 l of the solution containing 1 Pfu Ultra II reaction buffer (Stratagene), 10 nmol dNTP, and 1 l Pfu Ultra II fusion HS DNA polymerase (Stratagene) Reaction: 95 degrees C. (2 minutes)(95 degrees C. (30 seconds), 55 degrees C. (30 seconds), 72 degrees C. (2 minutes))25 cycles72 degrees C. (3 minutes)4 degrees C. (stock)

(63) After PCR under the above conditions, a PCR product contained in the reaction solution was purified using a MinElute PCR purification kit (QIAGEN). Subsequently, the PCR product was digested with restriction enzymes Mun I and EcoR I. Agarose gel electrophoresis was performed, a 718-bp fragment was excised, and the fragment was thus purified using a MiniElute Gel extraction kit (QIAGEN). Furthermore, the resultant was ligated to a pESCgap-HIS vector digested with a restriction enzyme EcoR I and then subjected to BAP treatment. The thus obtained plasmid was designated as pESCpgkgap-HIS.

(64) <Construction of pESCpgkgap-LEU>

(65) After digestion of the above pESCpgkgap-HIS with restriction enzymes Bam HI and Not I, a 1427-bp fragment was excised and ligated to a pESC-LEU vector (Stratagene) digested with restriction enzymes Bam HI and Not I in a similar manner.

(66) <Construction of pESCpgkgap-TRP>

(67) After digestion of the above pESCpgkgap-HIS with restriction enzymes Bam HI and Not I, a 1427-bp fragment was excised and then ligated to a pESC-TRP vector (Stratagene) digested with restriction enzymes Bam HI and Not I in a similar manner.

(68) <Construction of pESCpgkgap-URA>

(69) After digestion of the above pESCpgkgap-HIS with restriction enzymes Bam HI and Not I, a 1427-bp fragment was excised and then ligated to a pESC-URA vector (Stratagene) digested with restriction enzymes Bam HI and Not I in a similar manner.

(70) <Construction of Other Vectors>

(71) Upon construction of a pESC-HIS-ZWF1-RPE1 vector for enhancing the expression of a ZWF1 gene and a RPE1 gene, a pESC-Leu-PKT vector for introducing a PKT gene, a pESC-Leu-PKT-PTA vector for introducing the PKT gene and a PTA gene, a pESC-Trp-ATF1 vector for enhancing the expression of an ATF1 gene, and a vector for disrupting a PFK1 gene and a PFK2 gene, PCR was performed with the following composition under the following conditions. In addition, KOD-Plus-Ver.2 (TOYOBO) was used as DNA polymerase.

(72) TABLE-US-00005 TABLE 3 <Composition> 10 Buffer 5 ul 2.5 mM dNTP 5 ul 25 mM MgSO.sub.4 4 ul fwd primer 1.5 ul.sup. rev primer 1.5 ul.sup. Genome (100 ng/ul) 1 ul DNA polymerase 1 ul H.sub.2O 31 ul

(73) TABLE-US-00006 TABLE 4 <PCR conditions> 94 degrees C., 2 min > 98 degrees C. 10 sec, Tm-5 degrees C. 30 sec, 68 degrees C. 5 min (30) >68 degrees C. 5 min

(74) FIG. 6 shows a flow chart for construction of the pESC-HIS-ZWF1-RPE1 vector. FIG. 7 shows a flow chart for construction of the pESC-Leu-PKT vector and the pESC-Leu-PKT-PTA vector. FIG. 8 shows a flow chart for construction of the pESC-Trp-ATF1 vector. FIG. 9 shows a flow chart for construction of the vector for disrupting the PFK1 gene. FIG. 10 shows a flow chart for construction of the vector for disrupting the PFK2 gene. Primers used in the flow charts for vector construction shown in FIGS. 6-10 are listed in Table 5.

(75) TABLE-US-00007 TABLE5 Gene name Primer Nucleotidesequence ZWF1 G6PD-fwd cgcggatccgcggggcccATAAGGCAAGATGAGTGAAGGCCCC SEQIDNO:45 G6PD-rev ccgctcgagcgggtcgacGTGCTTGCATTTTTCTAATTATCCT SEQIDNO:46 RPE1 RPE1-fwd ggaattccgcggccgcAGGTAAACACACAAGAAAAAATGG SEQIDNO:47 RPE1-rev ccttaattaagggactagtcTAAGAAATGCCGCATATGTAC SEQIDNO:48 PFK1 PFK1-fwd tcccccgggggacgagctcgCTCAGTTTCTTCTTGAAATTTAGCATCGTG SEQIDNO:49 PFK1-rev tcccccgggggacgagctcgAAACGGAAAGAAAAAAGGCCGAC SEQIDNO:50 PFK1-Inf-fwd CTAGAGGATCCCCGGGTACCCTCAGTTTCTTCTTGAAATTTAGCATCGTG SEQIDNO:51 PFK1-Inf-rvs CGGCCAGTGAATTCGAGCTCAAACGGAAAGAAAAAAGGCCGAC SEQIDNO:52 PFK2 PFK2-fwd tcccccgggggacgagctcgTCCGGTCTTTATCTACCATTCATTTATTAC SEQIDNO:53 PFK2-rev tcccccgggggacgagctcgGGTTTCATGGGGTAGTACTTGTATTA SEQIDNO:54 PFK2-Inf-fwd CTAGAGGATCCCCGGGTACCTCCGGTCTTTATCTACCATTCATTTATTAC SEQIDNO:55 PFK2-Inf-rvs CGGCCAGTGAATTCGAGCTCGGTTTCATGGGGTAGTACTTGTATTA SEQIDNO:56 ATF1 ATF1-Inf-fwd tacgactcactatagggcccTTTGGCCTGGTATTGTCATC SEQIDNO:57 ATF1-Inf-rev tctgttccatgtcgacCGACGATTCTGACCCTTTC SEQIDNO:58 ACS1 ACS1-Inf-fwd GGGCCCGGGCGTCGACAGCAAAACCAAACATATCAA SEQIDNO:59 ACS1-Inf-rev ACCAAGCTTACTCGAGCACACGAAAAAAAAAAAGTCG SEQIDNO:60 ACS2 ACS2-Inf-fwd GGGCCCGGGCGTCGACTGTTATACACAAACAGAATA SEQIDNO:61 ACS2-Inf-rev ACCAAGCTTACTCGAGAGAAAAGGAGCGAAATTTTATC SEQIDNO:62

(76) In addition, PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN). Furthermore, in the flow charts for vector construction as shown in FIGS. 6 to 10, a Zero Blunt TOPO PCR cloning kit (Invitrogen) was used for TOPO cloning of PCR products. Also, pAUR135 was purchased from Takara Bio Inc. In the flow charts for vector construction as shown in FIGS. 6 to 10, DNA fragments were excised from agarose gel using a QIAquick Gel Extraction Kit (QIAGEN). In the flow charts for vector construction as shown in FIGS. 6 to 10, vectors were ligated to DNA fragments by ligation reaction using a Ligation-convenience Kit (Nippon Gene Co., Ltd.) or in-fusion reaction using an In-Fusion Dry-Down PCR Cloning Kit (Clontech).

(77) Furthermore, in the flow chart for vector construction as shown in FIG. 7, vectors denoted as pBSK-PKT and pBSK-PTA were constructed by synthesizing 5 types of PKT gene and 3 types of PTA gene, respectively, and then inserting them to the Sma I site of pBluescript IISK(+). In addition, these 5 types of PKT gene and 3 types of PTA gene were all optimized for codons for Saccharomyces cerevisiae.

(78) The 5 types of PKT gene were Bifidobacterium animalis subsp. lactis-derived phosphoketolase genes (SEQ ID NOS: 63 and 64), Aspergillus oryzae RIB40-derived phosphoketolase I genes (SEQ ID NOS: 65 and 66), Aspergillus oryzae RIB40-derived phosphoketolase II genes (SEQ ID NOS: 67 and 68), Nostoc punctiforme ATCC 29133-derived phosphoketolase genes (SEQ ID NOS: 69 and 70), and Marinobacter aquaeolei ATCC 700491-derived phosphoketolase genes (SEQ ID NOS: 71 and 72). Furthermore, the 3 types of PTA gene were Bacillus subtilis subsp. subtilis str.168-derived phosphate acetyltransferase genes (SEQ ID NOS: 73 and 74), Bifidobacterium animalis subsp. lactis AD011-derived phosphate acetyltransferase genes (SEQ ID NOS: 75 and 76), and Escherichia coli K-12 MG1655-derived phosphate acetyltransferase genes (SEQ ID NOS: 77 and 78).

(79) Transformation

(80) Escherichia coli was transformed according to the protocols included with ECOS Competent E. coli JM109 (Nippon Gene Co., Ltd.). Yeast was transformed according to the protocols included with a Frozen-EZ Yeast Transformation II Kit (Zymo Research). Yeast gene disruption using the vector for disrupting the PFK1 gene and the PFK2 gene was performed according to the protocols included with pAUR135DNA (Takara Bio Inc.).

(81) Acetic Acid Production Test

(82) A transformant was cultured as follows. After active colony formation in an SD-His, Leu agar medium, cells were inoculated to 2 ml of an SD-His, Leu medium in a 15-ml test tube and then cultured overnight at 30 degrees C. (Oriental Giken Inc. IFM, 130 rpm). The thus pre-cultured solution was inoculated to 100 ml of an SD-His, Leu medium in a 500-ml Erlenmeyer flask so that it accounted for 1% of the volume of the medium, and then cultured. The culture solution was centrifuged (6000g, 15 min, room temperature) and then 1 ml of the supernatant was introduced into a glass vial and thus designated as an analysis sample.

(83) Ethyl Acetate Production Test

(84) A transformant was cultured as follows. After active colony formation in an SD-His, Leu, Trp agar medium, cells were inoculated to 2 ml of an SD-His, Leu, Trp medium in a 15-ml test tube and then cultured overnight at 30 degrees C. (130 rpm). The thus pre-cultured solution was inoculated to 100 ml of an SD-His, Leu, Trp medium in a 500-ml Erlenmeyer flask so that it accounted for 1% thereof, and then cultured. The culture solution was centrifuged (6000g, 15 min, room temperature) and then 1 ml of the supernatant was introduced into a glass vial so that it was designated as an analysis sample.

(85) Isopropanol Production Test

(86) A transformant was cultured as follows. After active colony formation in an SD-His, Leu, Ura, Trp agar medium, cells were inoculated to 2 ml of an SD-His, Leu, Ura, Trp medium in a 15-ml test tube and then cultured overnight at 30 degrees C. (130 rpm). The thus pre-cultured solution was inoculated to 50 ml of an SD-His, Leu, Ura, Trp medium in a 500-ml Erlenmeyer flask so that it accounted for 1% thereof, and then cultured. The culture solution was centrifuged (6000g, 15 min, room temperature) and then 1 ml of the supernatant was introduced into a glass vial so that it was designated as an analysis sample.

(87) GC Analysis Conditions

(88) Preparations used herein were acetic acid (NACALAI TESQUE, INC.), ethyl acetate (NACALAI TESQUE, INC.), and isopropanol (NACALAI TESQUE, INC.). The following analytical instrument and analysis conditions were employed for the acetic acid production test, the ethyl acetate production test and the isopropanol production test.

(89) TABLE-US-00008 TABLE 6 <Head space sampler analysis conditions> Head space sampler HP7694 (Hewlett-Packard) Zone Temp Oven 80 C. Loop 150 C. TR. LINE 200 C. Event Time GC CYCLE TIME 10 min Vial EQ TIME 15 min PRESSURIZ. TIME 0.50 min Loop Fill TIME 0.2 min Loop EQ TIME 0.2 min INJECT TIME 1.00 min Vial Prameter SHAKE HIGH Others Vial pressurization 15 psi Loop size 3 ml <GC-MS analysis conditions> GC/MS HP6890/5973 GC/MS system (Hewlett-Packard, Wilmington, DE) Column HP-INNOWAX (Agilent: 19091N-213) Inlet temperature 260 C. Detector temperature 260 C. Injection parameter Split ratio 1/20 Carrier gas Helium 1.0 ml/min Oven heating conditions 60 C. 1 min Heat at 25 C./min to 260 C. 260 C. 1 min
Yeast Metabolome Analysis by CE-TOFMS
<Pre-Treatment>

(90) Cells were cultured (30 degrees C.) in an SD-His, Leu, Ura, Trp medium and then sampling was performed so that the amount of the sample was 15 OD unit. Suction filtration of the resultant was immediately performed by filtration. Next, suction filtration was performed twice with 10 mL of Milli-Q water and then washing was performed. Yeast cells collected on the filter were immersed in 2 mL of methanol containing internal reference material (5 M) and then 1.6 mL of the resultant was transferred into a centrifugation tube. 1600 L of chloroform and 640 L of Milli-Q water were added to the tube and then it was stirred, followed by centrifugation (2,300g, 4 degrees C., 5 minutes). After centrifugation, aqueous phase was transferred to 6 ultrafiltration tubes (250 L each) (MILLIPORE, Ultrafree MC UFC3 LCC Centrifugal Filter Unit 5 KDa). The tubes were centrifuged (9,100g, 4 degrees C., 120 minutes) and thus ultrafiltration was performed. Each filtered fluid was solidified to dryness, dissolved again in 50 L of Milli-Q water, and then subjected to measurement.

(91) <Measurement>

(92) In this test, anionic metabolite (anion mode) measurement was performed under the following conditions (see references 1) to 3)). Apparatus: Agilent CE-TOFMS system (Agilent Technologies) Capillary: Fused silica capillary i.d. 50 m80 cm Measurement conditions: Run buffer: Anion Buffer Solution (p/n: H3302-1021) Rinse buffer: Anion Buffer Solution (p/n: H3302-1022) Sample injection: Pressure injection 50 mbar, 25 sec CE voltage: Positive, 30 kV MS ionization: ESI Negative MS capillary voltage: 3,500 V MS scan range: m/z 50-1,000 Sheath liquid: HMT Sheath Liquid (p/n: H3301-1020)
<References, Data> 1) T. Soga, D. N. Heiger: Amino acid analysis by capillary electrophoresis electrospray ionization mass spectrometry. Anal. Chem. 72: 1236-1241, 2000. 2) T. Soga, Y. Ueno, H. Naraoka, Y. Ohashi, M. Tomita et al.: Simultaneous determination of anionic intermediates for Bacillus subtilis metabolic pathways by capillary electrophoresis electrospray ionization mass spectrometry. Anal. Chem. 74: 2233-2239, 2002. 3) T. Soga, Y. Ohashi, Y. Ueno, H. Naraoka, M. Tomita et al.: Quantitative metabolome analysis using capillary electrophoresis mass spectrometry. J. Proteome Res. 2: 488-494, 2003. 4) http://vanted.ipk-gatersleben.de/
[Results]
Acetic Acid Production Test

(93) Yeast strains subjected to the acetic acid production test are listed in Table 7 and the test results are shown in FIG. 11.

(94) TABLE-US-00009 TABLE 7 Composition Wild-type PFK1 PFK2 strain (Dis- (Dis- ZWF1 RPE1 PKT(1) PKT(2) PKT(3) PKT(4) PKT(5) (YPH499) rupted) rupted) (Enhanced) (Enhanced) (Introduced) (Introduced) (Introduced) (Introduced) (Introduced) Control Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Sample 6 Sample 7 Sample 8

(95) In Table 7, PKT(1) denotes a Bifidobacterium animalis sub sp. lactis-derived phosphoketolase gene, PKT(2) denotes an Aspergillus oryzae RIB40-derived phosphoketolase I gene, PKT(3) denotes an Aspergillus oryzae RIB40-derived phosphoketolase II gene, PKT(4) denotes a Nostoc punctiforme ATCC 29133-derived phosphoketolase gene, and PKT(5) denotes a Marinobacter aquaeolei ATCC 700491-derived phosphoketolase gene.

(96) Based on the results shown in FIG. 11, it was revealed that attenuation of an endogenous phosphofructokinase gene of yeast as a host and introduction of a phosphoketolase gene into the yeast can enhance the flux toward the pentose phosphate system rather than toward the glycolytic system (FIG. 2), so that acetic acid can be produced at a high level. It was also revealed that as a phosphoketolase gene, the Bifidobacterium-derived gene, and particularly the Bifidobacterium animalis-derived gene, is excellent in acetic acid productivity. It was revealed based on the results that as phosphoketolase genes, phosphoketolase genes within the broken-line frame in the phylogenetic tree shown in FIG. 3 are preferable in terms of acetic acid productivity.

(97) Furthermore, it was revealed based on the results shown in FIG. 11 that when a phosphofructokinase gene is attenuated to weaken the flux toward the glycolytic system, both the PFK1 gene and the PFK2 gene are preferably disrupted. Moreover, it was revealed that through enhancement of enzyme genes involved in the pentose phosphate system (FIG. 2), the flux toward the pentose phosphate system (FIG. 2) can be further enhanced and acetic acid can be produced at an even higher level.

(98) Ethyl Acetate Production Test

(99) Yeast strains subjected to the ethyl acetate production test are listed in Table 8 and the test results are shown in FIG. 12.

(100) TABLE-US-00010 TABLE 8 Composition Wild-type PFK1 strain (Dis- ZWF1 RPE1 PKT PTA(1) PTA(2) PTA(3) ACS1 ACS2 ATF1 (YPH499) rupted) (Enhanced) (Enhanced) (Introduced) (Introduced) (Introduced) (Introduced) (Enhanced) (Enhanced) (Enhanced) Control Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Sample 6 Sample 7 Sample 8 Sample 9 Sample 10

(101) In Table 8, PTA(1) denotes a Bacillus subtilis sub sp. subtilis str.168-derived phosphate acetyltransferase gene, PTA(2) denotes a Bifidobacterium animalis sub sp. lactis AD011-derived phosphate acetyltransferase gene, and PTA(3) denotes an Escherichia coli K-12 MG1655-derived phosphate acetyltransferase gene. In addition, in this test, a Bifidobacterium animalis sub sp. lactis-derived phosphoketolase gene was used as a PKT gene.

(102) As shown in FIG. 12, the control strain in which the ATF1 gene had been introduced into the wild-type strain (YPH499 strain) also exhibited more improved ethyl acetate productivity compared with that of the wild-type strain. However, it was understood that through attenuation of an endogenous phosphofructokinase gene of yeast as a host and introduction of a phosphoketolase gene into the host, in addition to further introduction of a phosphoacetyltransferase gene (PTA gene) or enhancement of an acetyl-CoA synthetase gene (ACS gene), ethyl acetate productivity was further improved compared with that of the control. It was demonstrated based on the results and the metabolic overview map shown in FIG. 4 that the amount of acetyl-CoA synthesized was significantly increased through attenuation of the endogenous phosphofructokinase gene and introduction of the phosphoketolase gene in addition to further introduction of the phosphoacetyltransferase gene (PTA gene) or enhancement of the acetyl-CoA synthetase gene (ACS gene). Moreover, it was demonstrated that the thus synthesized acetyl-CoA is accumulated extracellularly at a high level in the form of ethyl acetate by an ATF1 enzyme.

(103) In particular, as a phosphoacetyltransferase gene to be introduced, a Bacillus subtilis-derived gene is preferable in view of acetyl-CoA productivity. Also, it was revealed that as an acetyl-CoA synthetase gene to be enhanced, the ACS1 gene is more preferable than the ACS2 gene.

(104) Furthermore, it was revealed based on the results shown in FIG. 12 that when a phosphofructokinase gene is attenuated to weaken the flux toward the glycolytic system, both the PFK1 gene and the PFK2 gene are preferably disrupted. Moreover, it was revealed that through enhancement of enzyme genes involved in the pentose phosphate system (FIG. 2), the flux toward the pentose phosphate system (FIG. 2) can be increased more and ethyl acetate can be produced at an even higher level.

(105) Isopropanol Production Test

(106) Yeast strains subjected to the isopropanol production test are listed in Table 9 and the test results are shown in FIG. 13.

(107) TABLE-US-00011 TABLE 9 Composition Wild-type PFK1 ctfA, ctfB, strain (Dis- ZWF1 RPE1 PKT PTA(1) PTA(2) PTA(3) ACS1 ACS2 adc, ipdh (YPH499) rupted) (Enhanced) (Enhanced) (Introduced) (Introduced) (Introduced) (Introduced) (Enhanced) (Enhanced) (Introduced) Control Sample 1 Sample 2 Sample 3 Sample 4 Sample 5

(108) In Table 9, PTA genes (1) to (3) denote the same genes as in Table 8.

(109) As shown in FIG. 13, it was understood that the capacity to produce isopropanol can be imparted to yeast through introduction of a ctfA gene, a ctfB gene, an adc gene, and an ipdh gene into the wild-type strain (YPH499 strain). It was also understood that isopropanol productivity was significantly improved compared with that of the control through attenuation of the endogenous phosphofructokinase gene and introduction of the phosphoketolase gene, in addition to further introduction of the phosphoacetyltransferase gene (PTA gene) or enhancement of the acetyl-CoA synthetase gene (ACS gene).

(110) It was demonstrated based on the results and the metabolic overview map shown in FIG. 4 that the amount of acetyl-CoA synthesized was significantly increased through attenuation of the endogenous phosphofructokinase gene and introduction of the phosphoketolase gene, in addition to further introduction of the phosphoacetyltransferase gene (PTA gene) or enhancement of the acetyl-CoA synthetase gene (ACS gene). It was demonstrated that the thus synthesized acetyl-CoA is accumulated extracellularly at a high level as isopropanol because of ctfA, ctfB, adc, and ipdh.

(111) In particular, it was understood that as a phosphoacetyltransferase gene to be introduced, Bacillus subtilis-derived gene is preferable in view of acetyl-CoA productivity. Furthermore, it was revealed that as an acetyl-CoA synthetase gene to be enhanced, the ACS1 gene is more preferable than the ACS2 gene.

(112) Metabolome Analysis of Yeast by CE-TOFMS

(113) Metabolome analysis was conducted for: a wild-type strain (YPH499 strain); a strain (denoted as YPH499PFK/ZWF-RPE) prepared by attenuating an endogenous phosphofructokinase gene of the YPH499 strain and enhancing an enzyme gene involved in the pentose phosphate system (FIG. 2); and a strain (denoted as YPH499PFK/ZWF-RPE, PKT-PTA) prepared by attenuating the endogenous phosphofructokinase gene of the YPH499 strain, enhancing an enzyme gene involved in the pentose phosphate system (FIG. 2), and introducing a phosphoketolase gene and a phosphoacetyltransferase gene. FIG. 14 shows the results of the metabolome analysis.

(114) In FIG. 14, the amount of acetyl-CoA in the case of the YPH499 strain (wild-type strain) is found by adding up the amount resulting from the ethanol-mediated acetyl-CoA synthetic pathway and the amount resulting from the intramitochondrial acetyl-CoA synthetic pathway. In addition, in yeast's acetyl-CoA synthetic pathway, these two pathways, the ethanol-mediated acetyl-CoA synthetic pathway and the intramitochondrial acetyl-CoA synthetic pathway, are present.

(115) Meanwhile, in the case of the YPH499PFK/ZWF-RPE strain, the ethanol-mediated acetyl-CoA synthetic pathway becomes unfunctional. This is because NADP is consumed because of the presence of ZWF, and as a result, ALD2 catalyzing the reaction for conversion of aldehyde to acetic acid becomes unfunctional (see acetic acid productivity of the control strain in the acetic acid production test (FIG. 11)). Therefore, the amount of acetyl-CoA synthesized by the YPH499PFK/ZWF-RPE strain corresponds to the amount of acetyl-CoA generated via the intramitochondrial acetyl-CoA synthetic pathway. In addition, intramitochondrially synthesized acetyl-CoA is consumed within mitochondria, and thus it cannot be used as a raw material for substances such as ethyl acetate and isopropanol. Therefore, unless the amount of acetyl-CoA to be synthesized in the cytosol of yeast cells is increased, the amounts of substances to be synthesized using synthesized acetyl-CoA cannot be increased.

(116) The YPH499PFK/ZWF-RPE, PKT-PTA strain is a mutant strain prepared by introducing the PKT gene and the PTA gene into the YPH499PFK/ZWF-RPE strain, so as to construct a novel acetyl-CoA synthetic pathway (see FIG. 2 and FIG. 4). Therefore, the amount of acetyl-CoA synthesized via the above novel acetyl-CoA synthetic pathway can be evaluated by subtracting the amount of acetyl-CoA synthesized by the YPH499PFK/ZWF-RPE strain from the amount of acetyl-CoA synthesized by the YPH499PFK/ZWF-RPE, PKT-PTA strain. Specifically, it was concluded from the results shown in FIG. 14 that the amount of acetyl-CoA corresponding to 48 pmol (found by 6214=48 pmol) could be synthesized via the novel acetyl-CoA synthetic pathway.

Reference Example

(117) In the reference example, preparation of the isopropanol-producing yeast (#15-10) used in the above examples is described.

(118) Obtainment of Isopropanol Synthetic Gene

(119) The following 4 genes were cloned from the genome of Clostridium acetobutylicum ATCC824 strain to a pT7Blue vector. adc (Acetoacetic acid decarboxylase) ctfA (Butyrate-acetoacetate CoA-transferase subunit A) ctfB (Butyrate-acetoacetate CoA-transferase subunit B) thiA (Acetyl-CoA acetyltransferase)
Construction of pT7Blue-ADC

(120) PCR was performed under the following conditions.

(121) Primers

(122) TABLE-US-00012 (SEQIDNO:79) adc-F: 5-ATGTTAAAGGATGAAGTAATTAAACAAATTAG-3 (SEQIDNO:80) adc-R: 5-TTACTTAAGATAATCATATATAACTTCAGCTC-3
Reaction Conditions Template: 0.4 g of Clostridium genomic DNA Primer: 50 pmol primer DNA Reaction solution: 50 l of the solution containing 1 Pfu Ultra II reaction buffer (Stratagene), 10 nmol dNTP, and 1 l of Pfu Ultra II fusion HS DNA polymerase (Stratagene) Reaction: 95 degrees C. (5 minutes)(95 degrees C. (30 seconds), 60 degrees C. (30 seconds), 72 degrees C. (2 minutes))30 cycles72 degrees C. (3 minutes)4 degrees C. (stock)

(123) The thus amplified 735-bp fragment was blunt-end cloned to a pT7Blue vector using a Perfectly Blunt Cloning Kit (Novagen). The cloned sequence was sequenced, thereby confirming that it was the adc sequence (CA-P0165) of the Clostridium acetobutylicum ATCC824 strain. The thus obtained plasmid was designated as pT7Blue-ADC.

(124) Construction of pT7Blue-CTFA

(125) PCR was performed under the following conditions.

(126) Primers

(127) TABLE-US-00013 ctfA-F: (SEQIDNO:81) 5-ATGAACTCTAAAATAATTAGATTTGAAAATTTAAGG-3 ctfA-R: (SEQIDNO:82) 5-TTATGCAGGCTCCTTTACTATATAATTTA-3
Reaction Conditions Template: 0.4 g of Clostridium genomic DNA Primer: 50 pmol primer DNA Reaction solution: 50 l of the solution containing 1 Pfu Ultra II reaction buffer (Stratagene), 10 nmol dNTP, and 1 l of Pfu Ultra II fusion HS DNA polymerase (Stratagene) Reaction: 95 degrees C. (5 minutes)(95 degrees C. (30 seconds), 60 degrees C. (30 seconds), 72 degrees C. (2 minutes)30 cycles72 degrees C. (3 minutes)4 degrees C. (stock)

(128) The thus amplified 657-bp fragment was cloned to a Perfectly Blunt Cloning Kit (Novagen) in a similar manner. The cloned sequence was sequenced, thereby confirming that it was the ctfA sequence (CA-P0163) of the Clostridium acetobutylicum ATCC824 strain. The thus obtained plasmid was designated as pT7Blue-CTFA.

(129) Construction of pT7Blue-CTFB

(130) PCR was performed under the following conditions.

(131) Primers

(132) TABLE-US-00014 (SEQIDNO:83) ctfB-F: 5-ATGATTAATGATAAAAACCTAGCGAAAG-3 (SEQIDNO:84) ctfB-R: 5-CTAAACAGCCATGGGTCTAAGTTC-3
Reaction Conditions Template: 0.4 g of Clostridium genomic DNA Primer: 50 pmol primer DNA Reaction solution: 50 l of the solution containing 1 Pfu Ultra II reaction buffer (Stratagene), 10 nmol dNTP, and 1 l of Pfu Ultra II fusion HS DNA polymerase (Stratagene) Reaction: 95 degrees C. (5 minutes)(95 degrees C. (30 seconds), 60 degrees C. (30 seconds), 72 degrees C. (2 minutes))30 cycles72 degrees C. (3 minutes)4 degrees C. (stock)

(133) The thus amplified 666-bp fragment was cloned using a Perfectly Blunt Cloning Kit (Novagen). The cloned sequence was sequenced, thereby confirming that it was the ctfB sequence (CA-P0164) of the Clostridium acetobutylicum ATCC824 strain. The thus obtained plasmid was designated as pT7Blue-CTFB.

(134) Construction of pDI626PGKpro

(135) PCR was performed under the following conditions.

(136) Primers

(137) TABLE-US-00015 SacI-Ppgk1FW: (SEQIDNO:85) 5-TAGGGAGCTCCAAGAATTACTCGTGAGTAAGG-3 SacII-Ppgk1RV: (SEQIDNO:86) 5-ATAACCGCGGTGTTTTATATTTGTTGTAAAAAGTAG-3
Reaction Conditions Template: 0.4 g of yeast YPH499 genomic DNA Primer: 50 pmol primer DNA Reaction solution: 50 l of the solution containing 1 Pfu Ultra II reaction buffer (Stratagene), 10 nmol dNTP, and 1 l of Pfu Ultra II fusion HS DNA polymerase (Stratagene) Reaction: 95 degrees C. (5 minutes)(95 degrees C. (30 seconds), 55 degrees C. (30 seconds), 72 degrees C. (2 minutes))25 cycles72 degrees C. (3 minutes)4 degrees C. (stock)

(138) After purification of the reaction solution using a MinElute PCR purification kit (QIAGEN), the resultant was digested with restriction enzymes Sac I and Sac II. Agarose gel electrophoresis was performed to excise a 712-bp fragment, and then it was purified using a MinElute Gel extraction kit (QIAGEN). The resultant was ligated to a pDI626GAP (APP. Env. Micro., 2009, 5536) vector digested with restriction enzymes Sac I and Sac II in a similar manner. The thus obtained sequence was sequenced, thereby confirming that a plasmid of interest had been constructed. The thus obtained plasmid was designated as pDI626PGKpro.

(139) Construction of pDI626PGK

(140) PCR was performed under the following conditions.

(141) Primers

(142) TABLE-US-00016 SalI-Tpgk1FW: (SEQIDNO:87) 5-TTAAGTCGACATTGAATTGAATTGAAATCGATAGATC-3 KpnI-Tpgk1RV2: (SEQIDNO:88) 5-TTAAGGTACCGCTTCAAGCTTACACAACAC-3
Reaction Conditions Template: 0.4 g of the genomic DNA of yeast YPH499 Primer: 50 pmol primer DNA Reaction solution: 50 l of the solution containing 1 Pfu Ultra II reaction buffer (Stratagene), 10 nmol dNTP, and 1 l of Pfu Ultra II fusion HS DNA polymerase (Stratagene) Reaction: 95 degrees C. (5 minutes)(95 degrees C. (30 seconds), 55 degrees C. (30 seconds), 72 degrees C. (2 minutes))25 cycles72 degrees C. (3 minutes)4 degrees C. (stock)

(143) After purification of the reaction solution using a MinElute PCR purification kit (QIAGEN), the resultant was digested with restriction enzymes Sal I and Kpn I. Agarose gel electrophoresis was performed to excise a 330-bp fragment, and then it was purified using a MinElute Gel extraction kit (QIAGEN). The resultant was ligated to a pDI626PGKpro vector digested with restriction enzymes Sal I and Kpn I. The thus obtained sequence was sequenced, thereby confirming that a plasmid of interest had been constructed. The thus obtained plasmid was designated as pDI626PGK.

(144) Construction of pDI626PGK-T

(145) pDI626PGK was digested with a restriction enzyme Sbf I, and then the reaction solution was purified using a MinElute PCR purification kit (QIAGEN). Subsequently, the resultant was blunt-ended using a Blunting kit (TaKaRaBIO), and then further digested with a restriction enzyme Kpn I. Agarose gel electrophoresis was performed to excise a 3650-bp fragment, and then it was purified using a MinElute Gel extraction kit (QIAGEN). Thus a vector for ligation thereof was constructed. Next, pRS524GAP (APP. Env. Micro., 2009, 5536) was digested with restriction enzymes PmaC I and Kpn I. Agarose gel electrophoresis was performed to excise a 765-bp fragment and then it was purified using a MinElute Gel extraction kit (QIAGEN), so as to prepare an insert. Ligation thereof was performed. Joints of the thus obtained sequence were sequenced, thereby confirming that a plasmid of interest had been constructed. The thus obtained plasmid was designated as pDI626PGK-T.

(146) Construction of pCR2.1-iPDH

(147) A DNA sequence optimized for Saccharomyces cerevisiae codons based on the Clostridium beijerinckii NRRL B593-derived adh: NADP-dependent alcohol dehydrogenase gene sequence registered in the GenBank (http://www.neb.nih.gov/Genbank/index.html) was synthesized (Operon). A vector portion is pCR2.1 (Invitrogen). In addition, the synthesized DNA sequence is shown in SEQ ID NO: 89, and the amino acid sequence encoded by a coding region contained in the synthesized DNA sequence is shown in SEQ ID NO: 90. The plasmid was designated as pCR2.1-iPDH.

(148) Construction of pDI626PGK-T-iPDH

(149) pCR2.1-iPDH was digested with restriction enzymes Sac II and Sal I to excise a 1080-bp fragment. The resultant was ligated to a pDI626PGK-T vector digested with restriction enzymes Sac II and Sal I in a similar manner. The obtained sequence was sequenced, thereby confirming that a plasmid of interest had been constructed. The thus obtained plasmid was designated as pDI626PGK-T-iPDH.

(150) Construction of pENT-ADC

(151) PCR was performed using pDI626-ADC as a template and the following primers.

(152) Primers

(153) TABLE-US-00017 08-189-adc-attB1-Fw: (SEQIDNO:91) 5-GGGGACAAGTTTGTACAAAAAAGCAGGCTCAGTTCGAGTTTATCATT ATC-3 08-189-adc-attB4-Rv: (SEQIDNO:92) 5-GGGGACAACTTTGTATAGAAAAGTTGGGTGGGCCGCAAATTAAAGCC TTC-3

(154) The thus obtained 1809-bp PCR product was introduced into a pDONR221 P1-P4 donor vector by gateway BP reaction. The obtained clone was sequenced, thereby confirming that no mutation was present in any part of the nucleotide sequence of the insert. The thus obtained plasmid was designated as pENT-ADC.

(155) Construction of pENT-CTFA

(156) PCR was performed using pDI626PGK-CTFA as a template and the following primers.

(157) TABLE-US-00018 08-189-ctfA-attB4r-Fw: (SEQIDNO:93) 5-GGGGACAACTTTTCTATACAAAGTTGGCTTCAAGCTTACACAACACG G-3 08-189-ctfA-attB3r-Rv: (SEQIDNO:94) 5-GGGGACAACTTTATTATACAAAGTTGTCAAGAATTACTCGTGAGTAA GG-3

(158) The obtained 1823-bp PCR product was introduced into a pDONR221 P4r-P3r donor vector by gateway BP reaction. The obtained clone was sequenced, thereby confirming that no mutation site was present in any part of the nucleotide sequence of the insert. The thus obtained plasmid was designated as pENT-CTFA.

(159) Construction of pDI626-CTFB

(160) pT7Blue-CTFB was digested with restriction enzymes BamH I and Sal I to excise a 771-bp fragment. The resultant was ligated to a pDI626 vector digested with restriction enzymes BamH I and Sal I in a similar manner. The obtained sequence was sequenced, thereby confirming that a plasmid of interest had been constructed. The thus obtained plasmid was designated as pDI626-CTFB(+A).

(161) PCR was performed under the following conditions using the following primers in order to correct mutation sites in primers.

(162) TABLE-US-00019 BamHI-ctfB-F: (SEQIDNO:95) 5-TAGTGGATCCGATGATTAATGATAAAAACC-3 pDI626MCS-seqF: (SEQIDNO:96) 5-CCTAGACTTCAGGTTGTCTAAC-3
Reaction Conditions Template: 1 ng of pDI626-CTFB(+A) Primer: 50 pmol primer DNA Reaction solution: 50 l of the solution containing 1 Pfu Ultra II reaction buffer (Stratagene), 10 nmol dNTP, and 1 l of Pfu Ultra II fusion HS DNA polymerase (Stratagene) Reaction: 95 degrees C. (2 minutes)(95 degrees C. (30 seconds), 55 degrees C. (30 seconds), 72 degrees C. (1 minutes)20 cycles72 degrees C. (3 minutes)4 degrees C. (stock)

(163) After purification of the reaction solution using a MinElute PCR purification kit (QIAGEN), the resultant was digested with restriction enzymes BamH I and Sal I. Agarose gel electrophoresis was performed to excise a 702-bp fragment and then it was purified using a MinElute Gel extraction kit (QIAGEN). The resultant was ligated to a pDI626 vector digested with restriction enzymes BamH I and Sal I. The thus obtained sequence was sequenced, thereby confirming that mutation sites had been corrected. The thus obtained plasmid was designated as pDI626-CTFB.

(164) Construction of pENT-CTFB

(165) PCR was performed using pDI626-CTFB as a template and the following primers.

(166) TABLE-US-00020 08-189-ctfB-attB3-Fw: (SEQIDNO:97) 5-GGGGACAACTTTGTATAATAAAGTTGGGCCGCAAATTAAAGCCTTC- 3 08-189-ctfB-attB2-Rv: (SEQIDNO:98) 5-GGGGACCACTTTGTACAAGAAAGCTGGGTACAGTTCGAGTTTATCAT TATC-3

(167) The thus obtained 1737-bp PCR product was introduced into a pDONR221 P3-P2 donor vector by gateway BP reaction. The obtained clone was sequenced, thereby confirming that no mutation site was present in any part of the nucleotide sequence of the insert. The thus obtained plasmid was designated as pENT-CTFB.

(168) Construction of pDEST626(2008)

(169) PCR was performed under the following conditions.

(170) Primers

(171) TABLE-US-00021 SacI-convA-F: (SEQIDNO:99) 5-TAGGGAGCTCATCACAAGTTTGTACAAAAAAGCTG-3 KpnI-convA-R: (SEQIDNO:100) 5-TTAAGGTACCATCACCACTTTGTACAAGAAAGC-3
Reaction Conditions Template: 0.5 ng of RfA (Invitrogen; Reading Frame Cassette A of Gateway Vector Conversion System) Primer: 50 pmol primer DNA Reaction solution: 50 l of the solution containing 1 Pfu Ultra II reaction buffer (Stratagene), 10 nmol dNTP, and 1 l Pfu Ultra II fusion HS DNA polymerase (Stratagene) Reaction: 95 degrees C. (2 minutes)(95 degrees C. (30 seconds), 55 degrees C. (30 seconds), 72 degrees C. (1 minute and 30 seconds)20 cycles72 degrees C. (3 minutes)4 degrees C. (stock)

(172) After purification of the reaction solution using a MinElute PCR purification kit (QIAGEN), the resultant was digested with restriction enzymes Sac I and Kpn I. Agarose gel electrophoresis was performed to excise a 1717-bp fragment. After purification using a MinElute Gel extraction kit (QIAGEN), the resultant was ligated to the pDI626GAP vector (APP. Env. Micro., 2009, 5536) digested with restriction enzymes Sac I and Kpn I. The obtained sequence was sequenced, thereby confirming that a plasmid of interest had been constructed.

(173) Construction of pEXP(Ura)-ADC-CTFA-CTFB

(174) The 3 obtained entry clones (pENT-ADC, pENT-CTFA, and pENT-CTFB) were incorporated into a pDEST626(2008) expression vector by Gateway LR reaction. The thus obtained clones were confirmed by PCR for insert size, thereby confirming correct recombination. Sequencing was performed, thereby confirming that no error was present in the sequence. The thus obtained plasmid was designated as pEXP(Ura)-ADC-CTFA-CTFB.

(175) Preparation of #3-17 Strain

(176) The pEXP(Ura)-ADC-CTFA-CTFB expression vector was cleaved and linearized with restriction enzymes Aat II and BssH II. After ethanol precipitation, the resultant was dissolved in 0.1 TE Buffer and then Saccharomyces cerevisiae YPH499 (Stratagene) was transformed using a Frozen EZ yeast transformation kit (Zymoresearch). The obtained clones were subjected to colony PCR, thereby confirming 25 clones into which adc, ctfA, and ctfB genes had been introduced. The strain with the highest acetone production amount was designated as #3-17.

(177) Preparation of #15-10 Strain

(178) The pDI626PGK-T-iPDH expression vector of the ipdh gene that was a synthetic gene expected to convert acetone to isopropanol was cleaved and linearized with restriction enzymes Aat II and BssH II. After ethanol precipitation, the resultant was dissolved in 0.1 TE Buffer, and then the #3-17 acetone-producing yeast was transformed using a Frozen EZ yeast transformation kit (Zymoresearch). The thus obtained 14 clones were subjected to colony PCR, thereby confirming 13 clones in which the ipdh gene had been introduced. The strain with the highest isopropanol production amount was designated as #15-10.