Transgenic bacteria with expanded amino acid usage and nucleic acid molecules for use in the same

11661618 · 2023-05-30

Assignee

Inventors

Cpc classification

International classification

Abstract

Recombinant bacterial cells are provided that comprise a stable non-canonical amino acid translation pathway. In some aspects, the bacteria comprise nucleic acids encoding a non-canonical amino acid translation pathway (e.g., a tRNA for incorporation of a non-canonical amino acid, such selenocysteine); a marker polypeptide that includes the non-canonical amino acid. Recombinant tRNA and selection marker coding sequences are likewise provided.

Claims

1. A recombinant tRNA at least 95% identical to SEQ ID NO: 21 and having one of the following sets of features: (i) a G at position 8, a U at position 67, a U at position 82, a G at position 83, and a C at position 84 of SEQ ID NO: 21; (ii) a U at position 67, a U at position 82, and a G at position 83 of SEQ ID NO: 21; or (iii) a U at position 67, an A at position 68, a deletion at position 82, an A at position 83, and a U at position 84 of SEQ ID NO: 21.

2. The recombinant tRNA of claim 1, wherein the tRNA has a G at position 8, a U at position 67, a C at position 68, a U at position 82, a G at position 83, and a C at position 84 of SEQ ID NO: 21.

3. The recombinant tRNA of claim 2, wherein the tRNA is encoded by a nucleic acid molecule of SEQ ID NO: 18.

4. The recombinant tRNA of claim 1, wherein the tRNA has a C at position 8, a U at position 67, a C at position 68, a U at position 82, a G at position 83, and a G at position 84 of SEQ ID NO: 21.

5. The recombinant tRNA of claim 4, wherein the tRNA is encoded by a nucleic acid molecule of SEQ ID NO: 19.

6. The recombinant tRNA of claim 1, wherein the tRNA has a C at position 8, a U at position 67, an A at position 68, a deletion at position 82, an A at position 83, and a U at position 84 of SEQ ID NO: 21.

7. The recombinant tRNA of claim 6, wherein the tRNA is encoded by a nucleic acid molecule of SEQ ID NO: 20.

8. A transgenic bacterial cell comprising a nucleic acid encoding the recombinant tRNA of claim 1, wherein the transgenic the bacterial cell expresses SelA, wherein the transgenic bacterial cell is a transgenic Escherichia coli cell.

9. The transgenic bacterial cell of claim 8, further comprising a nucleic acid molecule encoding an enzyme for synthesis of selenocysteine.

10. The transgenic bacterial cell of claim 8, wherein the cell has been engineered to lack endogenous Amber codons.

11. A population of transgenic bacterial cells in accordance with claim 8.

12. A method of producing a recombinant polypeptide comprising at least one selenocysteine, the method comprising: (i) obtaining a bacterial cell of claim 8 and an expression cassette encoding the recombinant polypeptide; (ii) transforming the bacterial cell with the expression cassette; and (iii) incubating the bacterial cell under conditions that allow expression of the recombinant polypeptide.

13. The method of claim 12, further comprising (iv) isolating the expressed recombinant polypeptide.

14. A recombinant DNA molecule encoding the recombinant tRNA of claim 1.

15. A transgenic bacterial cell comprising a recombinant DNA of claim 14, wherein the transgenic the bacterial cell expresses SelA, wherein the transgenic bacterial cell is a transgenic Escherichia coli cell.

16. The transgenic bacterial cell of claim 15, further comprising a nucleic acid molecule encoding an enzyme for synthesis of selenocysteine.

17. The transgenic bacterial cell of claim 15, wherein the cell has been engineered to lack endogenous Amber codons.

18. A population of transgenic bacterial cells in accordance with claim 15.

19. A method of producing a recombinant polypeptide comprising at least one selenocysteine, the method comprising: (i) obtaining a bacterial cell of claim 15 and an expression cassette encoding the recombinant polypeptide; (ii) transforming the bacterial cell with the expression cassette; and (iii) incubating the bacterial cell under conditions that allow expression of the recombinant polypeptide.

20. The method of claim 19, further comprising (iv) isolating the expressed recombinant polypeptide.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

(2) FIGS. 1a-1c—Selection of tRNAs capable of canonical incorporation of selenocysteine. (1a) Representation of the NMC-A β-lactamase from Enterobacter cloacae (PDB: 1BUE) showing the engineered selenyl-sulfhydryl bond between residues 69 and 238 and its proximity to the catalytic site. (1b) Validation of a β-lactamase reporter capable of discriminating serine from selenocysteine. Three NMC-A variants, C69X (TAG), C69 and C69S (clockwise from left), were constructed to determine the threshold for selection (<50 μg.Math.mL.sup.−1). These approximate the following outcomes during selection: Termination at the amber stop codon due to inefficient interaction with EF-Tu, impaired interaction with SelA promoting incorporation of serine, and efficient interactions with both SelA and EF-Tu resulting in incorporation of selenocysteine. (1c) Representation of E. coli tRNA.sup.SecCUA and the evolved antideterminant sequence (SEQ ID NO: 21). The antideterminant library is shown expanded on the right and the CUA anticodon is shown at the bottom of the figure.

(3) FIGS. 2a-2b—Activity of tRNA.sup.sec variants in canonical translation. (2a) NMC-A β-lactamase reporter assay. From top row: Wild type NMC-A β-lactamase, NMC-A C69S, NMC-A C69X with tRNA.sup.SecCUA, NMC-A C69X with tRNA.sup.secUx, NMC-A C69X with tRNA.sup.SecUx and inactive SelA, NMC-A C69X with tRNA.sup.SecUG containing a strong EF-Tu binding sequence and NMC-A C69X with tRNA.sup.UTu. The observed dynamic range of the selection exceeds 20 fold. (2b) Reduction of benzyl viologen by E. coli formate dehydrogenase H confirms selenocysteine is incorporated by the tRNA.sup.SecUx. Plate layout is identical to (2a) with FdhH, FdhH U140S and FdhH U140TAG reporters replacing the NMC-A reporter.

(4) FIGS. 3a-3d—Intact mass and 193 nm UVPD results are shown for DHFR and seleno-DHFR produced using tRNA.sup.SecUx. For the sequence information shown, disulfide-bound cysteines are shaded in gray as are selenocysteine positions. When selenocysteine is located at position 39, it forms a selenyl-sulfhydryl bond with the cysteine at position 85. The slash marks represent the cleavage sites that lead to different N-terminal and C-terminal ions. (3a) Expanded region of the deconvoluted mass spectrum of DHFR with serine at position 39 (expected average mass m/z 19331.72). (3b) Expanded region of the deconvoluted mass spectrum of DHFR with selenocysteine incorporated at position 39 using tRNA.sup.SecUx (expected average mass m/z 19392.66). (3c) UVPD fragmentation map of DHFR P39S obtained for the 20+ charge state (SEQ ID NO: 11, encoded by a DNA sequence of SEQ ID NO: 10). (3d) UVPD fragmentation map of DHFR with selenocysteine at position 39, 18+ charge state (SEQ ID NO: 13, encoded by a DNA sequence of SEQ ID NO: 12).

(5) FIG. 4—Activity of tRNA.sup.SecUx in canonical translation in an E. coli strain lacking release factor 1. NMC-A β-lactamase reporter assay. From top row: Wild type NMC-A β-lactamase, NMC-A C69S, NMC-A C69X with tRNA.sup.SecCUA NMC-A C69X with tRNA.sup.SecUx, NMC-A C69X with tRNA.sup.SecUx and inactive SelA, NMC-A C69X C238X with tRNA.sup.SecUx and NMC-A C69X with tRNA.sup.UTu. Use of the prfA minus E. coli strain dramatically enhances selenocysteine incorporation and β-lactamase activity. Incorporation of selenocysteine at both positions 69 and 238 also results in strong β-lactamase activity indicating efficient formation of a di selenide bond.

(6) FIGS. 5a-5e—Intact mass and 193 nm UVPD results are shown for recombinant DHFR and seleno-DHFR produced using tRNA.sup.UTu. For the sequences shown on the right, covalently bonded cysteine residues are shaded in gray as is the selenocysteine. When selenocysteine is located at position 39, it forms a selenyl-sulfhydryl bond with cysteine at position 85. The slash marks represent the cleavage sites that lead to different N-terminal and C-terminal ions. (a) Expanded region of the deconvoluted mass spectrum of DHFR with serine at position 39 (expected average mass m/z 19331.72). (b) Expanded region of the deconvoluted mass spectrum of seleno-DHFR with selenocysteine incorporated at position 39 produced using tRNA.sup.UTu (expected average mass m/z 19392.66). (c) UVPD fragmentation map of DHFR obtained for the 20+ charge state (SEQ ID NO: 11, encoded by a DNA sequence of SEQ ID NO: 10). (d) and (e) UVPD fragmentation maps of DHFR with serine or selenocysteine at position 39, 20+ charge state (d, depicts SEQ ID NO: 11, e, depicts SEQ ID NO: 13). Due to their similar masses, DHFR containing serine and DHFR containing selenocysteine were co-isolated (20+ charge state) for UVPD, and thus (d) shows the fragment map corresponding to serine-containing DHFR and (e) shows the fragment map corresponding to selenocysteine-containing DHFR.

(7) FIGS. 6a-6e—Intact mass and 193 nm UVPD results for recombinant azurin and seleno-azurin produced using tRNA.sup.SecUx. For the sequences shown on the right, disulfide-bound cysteine residues are shaded in gray as are selenocysteine positions. The slash marks represent the cleavage sites that lead to different N-terminal and C-terminal ions. (a) Expanded region of the deconvoluted mass spectrum of azurin with serine at position 112 (expected average mass m/z 14750.54). (b) Expanded region of the deconvoluted mass spectrum of azurin with selenocysteine incorporated at position 112 produced using tRNA.sup.SecUx (expected average mass m/z 14813.50). (c) UVPD fragmentation map of azurin obtained for the 17+ charge state (SEQ ID NO: 15, encoded by the DNA of SEQ ID NO: 14). (d) and (e) UVPD fragmentation maps of azurin produced using tRNA.sup.SecUx, (d, depicts SEQ ID NO: 11, e, is SEQ ID NO: 17, encoded by the DNA of SEQ ID NO: 17). Due to their similar masses, azurin and seleno-azurin were co-isolated (17+ charge state) for UVPD fragmentation where (d) shows the fragment map corresponding to serine-containing azurin (serine at position 112) and (e) shows the fragment map corresponding to seleno-azurin (selenocysteine at position 112).

(8) FIGS. 7a-7c—Deconvoluted full scan mass spectra for seleno-DHFR and seleno-azurin. All protein variants observable for each selenoprotein are shown in the above deconvoluted spectra. (a) Seleno-DHFR produced using tRNA.sup.SecUx. (b) Seleno-DHFR produced using tRNA.sup.UTu. (c) Seleno-azurin produced using tRNA.sup.SecUx.

(9) FIGS. 8a-8b—Intact masses for GPx-1 U49S and GPx-1 U49. (a) Expanded region of the deconvoluted mass spectrum of GPx-1 with serine at codon 49 (expected average mass m/z 24055.06) (b) Expanded region of the deconvoluted mass spectrum of GPx-1 with selenocysteine at codon 49 (expected average mass m/z 24116.21).

(10) FIG. 9—Purification of GPx-1 U49. Combined SDS PAGE gel showing purification of recombinant GPx-1 U49 containing selenocysteine. Lanes 1-7 represent cell lysate, Ni-NTA waste fraction, 20 mM imidazole fraction, 50 mM imidazole fraction, 500 mM imidazole elution, Q sepharose unbound fraction and Q sepharose 750 mM NaCl fraction respectively. Lanes 1-5 and 6-7 represent different gels. The expected MW of the GPx-1 U49 monomer is 24 kDa.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

I. The Present Embodiments

(11) The use of non-canonical amino acids in proteins offers the possibility of polypeptides having greatly expanded functionality that could be exploited for wide range of applications. For example, by incorporation of selenocysteine into polypeptides it may be possible to develop enzymes having enhanced levels of stability or activity and to produce highly active therapeutic polypeptides. However, these approaches have, to date, been hampered by the inability to produce organisms that stability retain translation pathways that predictable and reliably incorporate selenocysteine into encoded polypeptides. Studies detailed herein demonstrate a stable system for selection of tRNA molecules that can incorporate selenocysteine and for production of polypeptides that incorporate selenocysteine positions. Importantly, this system can be easily moved from one organism to another with-out the need of re-engineering.

II. Examples

(12) The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Example 1—Selection of tRNAs

(13) A method of genetic selection capable of discriminating different levels of selenocysteine incorporation was developed. To specifically ‘addict’ a reporter protein to selenocysteine rather than serine, the NMC-A β-lactamase from Enterobacter cloacae was used. This enzyme has high sequence similarity to the SME-1 β-lactamase from Serratia marcescens, an enzyme that has previously been shown to require a disulfide bond adjacent to the active site serine residue for activity, but that confers a significant fitness cost on E. coli..sup.16 First, a C69S mutant was constructed of NMC-A, which failed to confer resistance to ampicillin (MIC<50 μg.Math.mL.sup.−1), indicating that the disulfide bond was essential for activity (FIG. 1b). Then cysteine 69 was replaced with an amber stop codon (X69; FIG. 1a) for library selection, hypothesizing that the incorporation of selenocysteine and the formation of a selenyl-sulfhydryl bond would restore activity. (Swarén et al., 1998)

(14) To eliminate any crosstalk between the tRNA.sup.Sec library and the endogenous selenocysteine incorporation machinery, the selA, selB and selC genes (encoding SelA, SelB and tRNA.sup.Sec respectively) were deleted from E. coli DH10B (designated DHΔabc). Cells containing the reporter plasmid pNMC-A C69X and the accessory plasmid pRSF-eSelA (expressing SelA) were transformed with plasmid pMB1-ZU containing the tRNA.sup.Sec antideterminant library. Transformants were plated on media containing a gradient of ampicillin concentrations for selection of mutants capable of selenocysteine-specific suppression. The single colonies that arose covered a range of ampicillin concentrations. Some 12 colonies from each plate were sequenced and revealed three distinct tRNA.sup.Sec mutants: G.sub.7-C.sub.66:U.sub.49-G.sub.65:C.sub.50-U.sub.64 (GGAAGATG.sub.7GTCGTCTCCGGTGAGGCGGCTGGACTCTAAATCCAGTTGGGGCCGCC AGCGGTCCCGGT.sub.49C.sub.50AGGTTCGACTCCTT.sub.64G.sub.65C.sub.66ATCTTCCGCCA; SEQ ID NO: 18), C.sub.7-G.sub.66:U.sub.49-G.sub.65:C.sub.50-U.sub.64 (GGAAGATC.sub.7GTCGTCTCCGGTGAGGCGGCTGGACTCTAAATCCAGTTGGGGCCGCC AGCGGTCCCGGT.sub.49C.sub.50AGGTTCGACTCCTT.sub.64G.sub.65G.sub.66ATCTTCCGCCA; SEQ ID NO: 19) and C.sub.7-U.sub.66:U.sub.49-A.sub.65:A.sub.50-Δ.sub.64 (GGAAGATC.sub.7GTCGTCTCCGGTGAGGCGGCTGGACTCTAAATCCAGTTGGGGCCGCC AGCGGTCCCGGT.sub.49A.sub.50AGGTTCGACTCCTA.sub.65T.sub.66ATCTTCCGCCA; SEQ ID NO: 20) (where underlined bases represent changes from the parental antideterminant sequence). Of these tRNA.sup.Sec variants, only G.sub.7-C.sub.66:U.sub.49-G.sub.65:C.sub.50-U.sub.64 was detected at the two highest ampicillin concentration (200 and 250 μg.Math.ml.sup.−1).

(15) The tRNA.sup.Sec variant containing the G.sub.7-C.sub.66:U.sub.49-G.sub.65:C.sub.50-U.sub.64 (SEQ ID NO: 18) antideterminant sequence was designated tRNA.sup.SecUx and was compared with the previously designed chimera (tRNA.sup.UTu) and with a tRNA.sup.Sec derivative designed to have an antideterminant region that should tightly bind EF-Tu (tRNA.sup.UG; FIG. 2a). The parental tRNA.sup.Sec containing a CUA anticodon and tRNA.sup.UG failed to produce active β-lactamase. The hybrid tRNA.sup.UTu incorporated selenocysteine and could grow on 75 μg.Math.ml.sup.−1. In contrast, expression of tRNA.sup.SecUx resulted in significantly higher β-lactamase activity (up to 400 μg.Math.ml.sup.−1), but only when co-expressed with SelA, confirming activity was selenocysteine dependent. To further confirm tRNA.sup.SecUx incorporated selenocysteine in response to amber stop codons, a standard colorimetric assay was employed based on the activity of the endogenous E. coli selenoprotein formate dehydrogenase H (FdhH) (FIG. 2b). FdhH is expressed under anaerobic conditions and catalyses the oxidation of formate to produce CO.sub.2 with the concomitant reduction of the electron acceptor benzyl viologen resulting in the development of a deep purple color..sup.18 Formate oxidation by FdhH is strictly dependent on the selenocysteine residue at position 140; the mutant FdhH U140S was completely inactive. Only tRNA.sup.SecUx and tRNA.sup.UTu when co-expressed with SelA produced active FdhH.

(16) The selected tRNA contained a non-standard sequence in the junction that normally interacts with EF-Tu. Given that neither the base of the acceptor stem nor the adjoining T-arm base pairs are believed to play a role in the interaction between tRNA.sup.Sec and SelA, the results suggest that the selected U:C leads to stronger binding to EF-Tu than the wild-type tRNA.sup.Sec sequence (Itoh et al., 2013). The unusual C50-U64 base pair is not predicted to bind strongly to EF-Tu based on models developed for canonical tRNAs (Schrader et al., 2011), and expression of a hybrid tRNA.sup.UG containing the strong EF-Tu binding region from the major E. coli tRNA.sup.Gly did not lead to the production of active β-lactamase, suggesting that the non-standard sequence was functionally important. Thus, it is possible that portions of the engineered tRNA.sup.Sec bind to EF-Tu differently than do canonical tRNAs, which would not necessarily be surprising given that tRNA.sup.Sec normally interacts with SelB (Li and Yarus, 1992).

(17) The development of engineered E. coli strains lacking the prfA gene encoding release factor 1 (RF1) has allowed efficient incorporation of a range of unnatural amino acids (Mukai et al., 2010; Lajoie et al., 2013), and the development of the genome-engineered ‘Amberless’ E. coli C321.ΔA (Lajoie et al., 2013) provided an excellent opportunity to determine whether proteins that efficiently incorporated selenocysteine could be expressed. The selA, selB and selC genes were deleted in C321.ΔA (designated strain RTΔA), and cells were transformed with the amber-containing NMC-A reporter and accessory plasmids (FIG. 4). β-lactamase activity was dramatically increased in RF1-deficient cells compared to prfA.sup.+ DHΔabc cells that still contain RF1. In addition, in a RF1-deficient background tRNA.sup.SecUx could now support the formation of a functional diselenide bond (via amber-mediated incorporation of two selenocysteine residues, U69 and U238; FIG. 4).

(18) To further enhance the efficiency of selenocysteine incorporation, a number of steps were taken to improve the levels of Sec-tRNA.sup.Sec relative to Ser-tRNA.sup.Sec, including increasing the level of SelA, decreasing the gene dose of tRNA.sup.SecUx, and co-expressing a phosphoseryl-tRNA.sup.Sec kinase (see Example 2 below). To monitor the efficiency of selenocysteine incorporation and demonstrate the possibilities for protein engineering, E. coli dihydrofolate reductase (DHFR) was produced containing an engineered non-essential selenyl-sulfhydryl bond (Villafranca et al., 1987). Top down mass spectrometry showed close to 100% selenocysteine incorporation with no detectable background corresponding to DHFR containing serine (FIG. 3a-d). The rationally designed tRNA.sup.Utu chimera was also observed to incorporate selenocysteine in DHFR containing a P39X substitution, but resulted in a much lower level of selenocysteine incorporation (38%) and significant serine incorporation (62%) (FIG. 4). No masses corresponding to the incorporation of other canonical amino acids were observed in the mass spectra (FIGS. 7a-7c). In order to further validate selenocysteine incorporation, the Pseudomonas aeruginosa metalloprotein azurin was also expressed with its essential cysteine (C112) replaced by selenocysteine and the human selenoprotein cellular glutathione peroxidase (GPx-1) (FIGS. 6a-6e and 8a-8b). For azurin, this chemical change had previously proven possible only through expressed protein ligation,.sup.22 the essential cysteine could now be biologically replaced with selenocysteine with good efficiency as measured by mass spectrometry of the intact protein.

Example 2—Methods

(19) Strain Construction

(20) The selAB and selC genes were deleted from E. coli DH10B using the lambda Red system adapted from Datsenko and Wanner (2000). Antibiotic resistance cassettes were excised using FLP recombinase to generate strain DHΔabc. Deletion of the entire fdhF open reading frame yielded strain DHΔabcF.

(21) E. coli C321ΔA was obtained from Addgene. A ˜12 kb genomic region containing lambda phage genes and the TEM-1 β-lactamase inserted during development of the strain (Lajoie et al., 2013) was removed to facilitate stable growth at 37° C. and restore sensitivity to β-lactam antibiotics. Subsequent deletion of the selAB and selC genes and excision of antibiotic resistance cassettes generated strain RTΔA. To improve recombinant protein production, deletion of the ion gene encoding the Lon protease and truncation of the me gene to remove 477 amino acids from the C-terminal of RNase E was performed, resulting in RTΔA.2.

(22) Reporter Plasmids

(23) All reporter plasmids were derived from pcat-pheS (Thyer et al., 2013). A 3281 bp fragment from pcat-pheS containing the 15A origin of replication and tetA gene conferring tetracycline resistance was ligated to an 1158 bp synthetic DNA fragment containing the bla.sub.SME-1 gene from Serratia marcescens encoding the SME-1 β-lactamase flanked by endogenous promoter and terminator sequences. This plasmid (pSME-1) was found to be highly toxic to E. coli host cells and was poorly maintained. Replacement of the bla.sub.SME-1 open reading frame with bla.sub.NMC-A from Enterobacter cloacae encoding the NMC-A β-lactamase which shares nearly 70% sequence identity (Majiduddin and Palzkill 2003) with SME-1 generated plasmid pNMC-A which did not exhibit any toxicity. pNMC-A variants with serine or amber codons at residues 69 and 238 were generated by QuikChange site directed mutagenesis.

(24) p15A-fdhF was constructed by ligating the pcat-pheS derived fragment with a 2886 bp fragment amplified from E. coli DH10B genomic DNA containing the fdhF gene, the endogenous promoter and terminator sequences and the upstream formate response elements (Schlensog et al., 1994). U140S and U140TAG variants were generated by QuikChange site directed mutagenesis.

(25) Accessory Plasmids

(26) The RSF1030 origin of replication and kan cassette were amplified by PCR as a 1563 bp fragment from pRSFDuet-1 (Novagen). A 1562 bp fragment containing the E. coli selA gene and 5′ region covering the endogenous promoter (Sawers et al., 1991) was amplified from E. coli DH10B genomic DNA. Assembly of the two fragments yielded plasmid pRSF-SelA. Replacement of the endogenous weakly active promoter with the strong constitutively active EM7 promoter and a canonical Shine-Dalgarno sequence resulted in plasmid pRSF-eSelA. SelA expression plasmids were validated by complementing E. coli DH10B deleted for selA (DHΔa) measured by benzyl viologen assay. Compared to pRSF-SelA, pRSF-eSelA induced a strong color change and this variant was used for all further experiments.

(27) pRSF-U-eSelA was constructed by the addition of NotI and NcoI restriction sites between the RSF1030 origin and selA promoter and subcloning of the NotI/NcoI fragment containing the selC gene from pMB1-ZU. pRSF-U-eSelA variants containing mutant tRNA.sup.Sec genes were constructed by enzymatic inverse PCR. tRNA.sup.Sec sequences are shown in Table 1. Plasmid pRSF-U-ΔSelA containing a truncated selA gene was generated by QuikChange site directed mutagenesis introducing TGA and TAA stop codons at positions 167 and 168 respectively.

(28) Table 1. Variant tRNA.sub.Sec sequences. Italics represents the anticodon and underline represents the antideterminant region.

(29) TABLE-US-00001 Variant tRNA Sequence tRNA.sup.SecCUA GGAAGATCGTCGTCTCCGGTGAGGCGGCTGGAC (SEQ ID NO: 1) TCTAAATCCAGTTGGGGCCGCCAGCGGTCCCGG GCAGGTTCGACTCCTGTGATCTTCCGCCA tRNA.sup.SecUx GGAAGATGGTCGTCTCCGGTGAGGCGGCTGGAC (SEQ ID NO: 2) TCTAAATCCAGTTGGGGCCGCCAGCGGTCCCGG TCAGGTTCGACTCCTTGCATCTTCCGCCA tRNA.sup.SecUG GGAAGATGGTCGTCTCCGGTGAGGCGGCTGGAC (SEQ ID NO: 3) TCTAAATCCAGTTGGGGCCGCCAGCGGTCCCGG CGAGGTTCGACTCCTCGTATCTTCCGCCA tRNA.sup.UTu GGAAGATGTGGCCGAGCGGTTGAAGGCACCGGT (SEQ ID NO: 4) CTCTAAAACCGGCGACCCGAAAGGGTTCCAGAG TTCGAATCTCTGCATCTTCCGCCA

(30) Plasmid pRSF-eSelAK for constitutive expression of both SelA and PSTK was constructed by insertion of a synthetic DNA fragment between the selA gene and the kan cassette adding a luxI terminator 3′ of selA and the Methanocaldococcus jannaschii pstK gene encoding O-phosphoseryl-tRNA.sup.Sec kinase (PSTK) codon optimized for expression in E. coli and flanked by the EM7 promoter and luxI terminator.

(31) Expression Plasmids

(32) All expression plasmids were derived from pRST.11 (Hughes and Ellington, 2010). For pDHFR-P39X-AU, the wrs1 gene was replaced with an operon controlled by the constitutive EM7 promoter containing the E. coli folA gene (amplified from DH10B genomic DNA) encoding dihydrofolate reductase with a C-terminal Strep II tag joined by a serine/alanine linker and the selA gene separated by the sequence TAGGAGGCAGATC (SEQ ID NO: 5) to provide a canonical Shine-Dalgarno sequence. Sc-tRNA.sup.Trp.sub.Amb was replaced by tRNA.sup.SecUx and tRNA.sup.UTu to express the tRNA.sup.Sec variants from the strong leuP promoter. TAG and AGC codons were introduced at position 39 by QuikChange site directed mutagenesis. pAz-C112X-AU was constructed similarly replacing the folA gene with a synthetic DNA fragment containing the azu gene from Pseudomonas aeruginosa encoding azurin codon optimized for expression in E. coli with a C-terminal His6-tag. TAG and AGC codons were introduced at position 112 by QuikChange site directed mutagenesis. pGPx-U49-AU was constructed by replacing the folA gene with a synthetic DNA fragment containing the human gpxl gene encoding cellular glutathione peroxidase (GPx-1) codon optimized for expression in E. coli with an N-terminal His6-tag.

(33) Library Construction and Selection

(34) A 1518 bp fragment encompassing the MB1 origin of replication and rop gene was amplified from pETDuet-1 (Novagen). This was assembled with a synthetic DNA fragment containing a codon optimized ble gene from Streptoalloteichus hindustans conferring Zeocin resistance flanked by the EM7 promoter and the endogenous terminator sequence and a MCS including NotI and NcoI sites to generate plasmid pMB1-Z. A 410 bp fragment including the selC gene and its promoter was amplified from E. coli DH10B genomic DNA with flanking NotI and NcoI sites and ligated into pMB1-Z to construct pMB1-ZU. Functionality of the selC gene was confirmed by complementing E. coli DH10B deleted for selC (DHΔc) as measured by benzyl viologen assay.

(35) The tRNA.sup.Sec antideterminant library was generated by enzymatic inverse PCR using oligonucleotide primers (Table 2) to randomize the six positions identified as the main antideterminant for EF-Tu binding. Following self ligation for 16 hours, DNA was ethanol precipitated with GlycoBlue (Ambion) and transformed by electroporation into E. coli DHΔabc containing the plasmids pNMC-A C69X and pRSF-eSelA. Transformants were diluted in 200 ml LB medium containing 12.5 μg.Math.mL.sup.−1 Zeocin, 6.25 μg.Math.mL.sup.−1 tetracycline and 25 μg.Math.mL.sup.−1 kanamycin and incubated overnight. Following overnight growth, cells were diluted 1/50 in LB medium containing 6.25 μg.Math.mL.sup.−1 Zeocin, 3.75 μg.Math.mL.sup.−1 tetracycline, 12.5 μg.Math.mL.sup.−1 kanamycin, 1 μM Na.sub.2SeO.sub.3 and 20 μg.Math.mL.sup.−1 L-cysteine and incubated for one hour. A series of 250 μl aliquots of cells were plated on LB agar containing 6.25 μg.Math.mL.sup.−1 Zeocin, 3.75 μg.Math.mL.sup.−1 tetracycline, 12.5 μg.Math.mL.sup.−1 kanamycin, 1 μM Na.sub.2SeO.sub.3 and 20 μg.Math.mL.sup.−1 L-cysteine and 50-300 μg.Math.mL.sup.−1 ampicillin in 50 μg.Math.mL.sup.−1 increments. After 20 hours at 37° C. individual colonies were observed on plates containing 50-200 μg.Math.mL.sup.−1 ampicillin. Plasmid DNA was isolated from a selection of colonies from all plates and tRNA.sup.Sec mutations determined by Sanger sequencing.

(36) Table 2. Oligonucleotide primers for library construction. Italics represents the bases randomized to generate the antideterminant library.

(37) TABLE-US-00002 Primer Sequence selClibfwd TGGACTGGTCTCCCAGTTGGGGCCGCCAGCGGTC (SEQ ID NO: 6) CCGGNNAGGTTCGACTCCTNNNATCTTCCGCCAA AATGC selClibrev GCTGGCGGTCTCaACTGGATTTAGAGTCCAGCCG (SEQ ID NO: 7) CCTCACCGGAGACGACNATCTTCCGCGCCTCG
Rephenotyping

(38) NotI/NcoI fragments containing tRNA.sup.SecUx were subcloned into pRSF-eSelA to generate pRSF-UX-eSelA. pRSF-U-eSelA variants described in Table 1 were transformed into E. coli DHΔabc containing the reporter plasmid pNMC-A C69TAG. DHΔabc cells containing pNMC-A and pRSFDuet-1 were used as a positive control. DHΔabc cells harboring pNMC-A C69S and pRSF-UX-eSelA, and pNMC-A C69TAG and pRSF-UX-ΔSelA were used as controls for selenocysteine dependent β-lactamase activity. Transformants were cultured overnight in LB medium containing 6.25 μg.Math.mL.sup.−1 tetracycline, 25 μg.Math.mL.sup.−1 kanamycin, 1 μM Na.sub.2SeO.sub.3 and 20 μg.Math.mL.sup.−1 L-cysteine. Following overnight growth, cells were diluted 1/10 in LB medium containing antibiotics, selenite and L-cysteine and incubated for three hours. Cultures were normalized to OD.sub.600=0.1 and 5 μl aliquots plated in triplicate on LB agar containing 3.75 μg.Math.mL-tetracycline, 12.5 μg.Math.mL.sup.−1 kanamycin, 1 μM Na.sub.2SeO.sub.3, 20 μg.Math.mL.sup.−1 L-cysteine and a gradient of ampicillin spanning 0, 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450 and 500 μg.Math.mL.sup.−1. Plates were incubated at 37° C. overnight. Identical assay conditions were used to repeat this experiment with E. coli RTΔA.

(39) Benzyl Viologen Assay

(40) E. coli DH10B cells containing pRSFDuet-1 and pcat-pheS were used as a positive control. DHΔabcF cells harboring p15A-fdhF U140S and pRSF-UX-eSelA, and p15A-fdhF U140X and pRSF-UX-ΔSelA were used as controls for selenocysteine dependent formate dehydrogenase activity. Transformants were grown overnight at 37° C. in LB medium supplemented with 12.5 μg.Math.mL.sup.1 tetracycline and 50 μg.Math.mL.sup.−1 kanamycin. Overnight cultures were diluted 1/20 in a final volume of 2 ml and incubated for three hours. Cultures were normalized to OD.sub.600=0.5 and 5 μl aliquots were dotted on LB agar plates containing 3.75 μg.Math.mL.sub.−1 tetracycline, 12.5 μg.Math.mL.sup.−1 kanamycin, 5 mM sodium formate, 10 μM Na.sub.2MoO.sub.4, 1 μM Na.sub.2SeO.sub.3 and 20 μg.Math.mL.sup.−1 L-cysteine. Plates were incubated at 37° C. for 3 h under aerobic conditions and then transferred to anaerobic conditions at 37° C. for 60 h. Upon removal from the anaerobic chamber, plates were immediately overlaid with agar containing 1 mg.Math.mL.sup.−1 benzyl viologen, 250 mM sodium formate and 25 mM KH.sub.2PO.sub.4 at pH 7.0. Plates were photographed within 1 h of overlaying.

(41) Optimization and Protein Purification

(42) Initial attempts to produce selenoproteins in E. coli strain RTΔA.2 used an accessory plasmid derived from pRSF-UX-eSelA in which the endogenous selC promoter was replaced with the highly active E. coli leuP promoter in combination with an expression plasmid containing the azu gene downstream of the strong tacI promoter. Mass spectrometry of the initial selenoprotein samples revealed almost exclusive incorporation of serine at the amber codon and a number of optimizations were made to increase the ratio of Sec-tRNA.sup.Sec to Ser-tRNA.sup.Sec, thought to be the main driver of incorporation efficiency. To increase the SelA to tRNA.sup.Sec ratio, expression of tRNA.sup.Sec variants was reduced by shifting the leuP cassette to the lower copy expression plasmid containing the MB1 origin of replication and adding a second selA gene downstream of the target selenoprotein. In addition, to prevent rapid depletion of the Sec-tRNA.sup.Sec pool following induction, the tacI promoter driving selenoprotein expression was replaced by the constitutive EM7 promoter. These changes generated expression plasmids pDHFR-P39X-AU and pAz-C112X-AU.

(43) To further reduce the pool of Ser-tRNA.sup.Sec available to participate in canonical translation, the pstK gene encoding O-phosphoseryl-tRNA.sup.Sec kinase was added to the accessory plasmid pRSF-eSelA to yield pRSF-eSelAK. PSTK has previously been reported (Aldag et al., 2013) to increase selenocysteine incorporation with tRNA.sup.UTu by generating Sep-tRNA.sup.Sec, an efficient substrate for SelA but poorly recognised by E. coli EF-Tu (Park et al., 2011). In conjunction, the selenium concentration in the medium was increased and L-cysteine omitted for selenoprotein production.

(44) RTΔA.2 transformants containing pDHFR-P39X-AU and pRSF-eSelAK were cultured ON in LB medium containing 100 μg.Math.mL.sub.−1 ampicillin, 50 μg.Math.mL.sub.−1 kanamycin and 1 μM Na.sub.2SeO.sub.3. Overnight cultures were diluted 1/500 in a final volume of 2 L LB medium containing 50 μg.Math.mL.sup.−1 ampicillin, 25 μg.Math.mL.sup.−1 kanamycin and 5 μM Na.sub.2SeO.sub.3 and incubated with agitation for 24 hours at 37° C. Cells were harvested by centrifugation at 8000×g for 10 min and resuspended in 20 mL of wash buffer (100 mM Tris, 150 mM NaCl, 1 mM EDTA at pH 8.0) with protease inhibitor cocktail (complete, mini EDTA free, Roche) and lysozyme at 1 mg.Math.mL.sup.−1. Following a 20 min incubation at 4° C. cells were lysed by sonication (Model 500, Fisher Scientific) and clarified by three times by centrifugation at 35000×g for 30 min. Lysate was passed through a 0.2 μm filter and seleno-DHFR recovered using Strep-Tactin affinity chromatography following the manufacturer's instructions (GE Healthcare). Eluate was concentrated to 3 mL and dialyzed against 50 mM NH.sub.4Ac pH 6.5 prior to the isolation of seleno-DHFR by size exclusion FPLC (ÄKTA, GE Healthcare). Seleno-DHFR was produced using tRNA.sup.SecUx with a yield of 68 μg.Math.L.sup.−1 and 100% incorporation efficiency. Seleno-DHFR was produced using tRNA.sup.UTu with a yield of 131 μg.Math.L.sup.−1 and 38.1% incorporation efficiency. DHFR containing serine at position 39 was produced with a yield of 225 μg.Math.L.sup.−1.

(45) RTΔA.2 transformants containing pAz-C112X-AU and pRSF-eSelAK were cultured as described previously with the exception that 20 μM Na.sub.2SeO.sub.3 was added for the 24 hour incubation. Cells were harvested by centrifugation and the periplasmic fraction isolated. Briefly, cell pellets were resuspended in 50 mL of 100 mM Tris and 0.75 M sucrose at pH 7.5. Following addition of lysozyme to 1 mg.Math.mL.sup.−1 and protease inhibitor cocktail cells were gently agitated for 20 min at 4° C. 50 mL of 1 mM EDTA was added and samples incubated again for 20 minutes. EDTA was neutralized by addition of 3.5 mL 0.5M MgCl.sub.2 during a further 20 min incubation. Spheroblasts were removed by centrifugation at 35000×g for 30 min, the periplasmic fraction passed through a 0.2 μm filter and mixed with imidazole stock solution to a final concentration of 20 mM. Seleno-azurin was recovered by IMAC using Ni-NTA resin and gravity flow columns. Eluate was concentrated and dialyzed against 50 mM NH.sub.4Ac pH 6.5 prior to the isolation of seleno-azurin by size exclusion FPLC. Seleno-azurin was produced using tRNA.sup.SecUx with a yield of 50 μg.Math.L.sup.−1 and greater than 76% incorporation efficiency. This value likely under represents the actual level of selenocysteine incorporation as seleno-azurin was observed to form higher molecular weight complexes during and after purification, resulting in loss during size exclusion chromatography. No aggregation was observed for azurin samples containing only serine.

(46) RTΔA.2 transformants containing pGPx-U49-AU and pRSF-eSelAK were cultured as described previously for azurin. Cells were harvested by centrifugation and resuspended in 50 mL of buffer (50 mM Potassium Phosphate, 150 mM NaCl, 10% glycerol, 1 mM DTT at pH 8.0) and lysozyme at 1 mg.Math.mL.sup.−1. Cells were lysed by sonication and clarified prior to GPx-1 recovery by IMAC. Eluate was concentrated and dialyzed against 100 mM phosphate buffer pH 8.0, 0.1% Tween 20 and 1 mM DTT followed by isolation of GPx-1 by anion exchange chromatography (Q HP column). GPx-1 was produced with a yield of 500 μg.Math.L.sup.−1 and close to 100% selenocysteine incorporation efficiency.

(47) Mass Spectrometry

(48) Intact protein samples were analyzed using methods described previously (Ellefson et al., 2014). Azurin, DHFR and GPx-1 samples were buffer exchanged into LC-MS grade water using 10 kDa molecular weight cutoff filters. Once the buffer exchange was complete the samples were diluted to 20 μM in a methanol/water/formic acid (50/49/1) solution. After dilution, protein solutions were infused into an Orbitrap Elite mass spectrometer (Thermo Fisher Scientific Instruments, Bremen, Germany) at a rate of 3 μL.Math.min.sup.−1 via electrospray ionization. In order to confirm the incorporation of selenocysteine, intact mass analysis was carried out at 240 k resolution and averaging 20 scans. Characterization of the protein sequences was undertaken by ultraviolet photodissociation (UVPD) using a 193 nm excimer laser (Coherent, Inc.) which was interfaced to the Orbitrap mass spectrometer as described previously (Shaw et al., 2013). For each UVPD spectrum, two laser pulses of 2.5 mJ were used and 250 scans were averaged. MS1 spectra were deconvoluted using the Xtract deconvolution algorithm (Thermo Fisher Scientific). UVPD mass spectra were also deconvoluted using Xtract and then analyzed using ProsightPC 3.0. Proteins containing selenocysteine were searched by adding a modification of 62.9216 Da to the serine at position 112 for azurin or 61.9146 Da for the serine at position 39 for DHFR (with subtraction of one hydrogen atom from the DHFR modification because a selenyl-sulfhydryl bond is formed when selenocysteine is present). Incorporation efficiencies were calculated by dividing the area of the modified protein peak by the summed areas of the unmodified protein peak and the modified protein peak. The peak area used for each protein was the sum of the integrated areas of the five most abundant peaks from each isotope cluster.

(49) All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

REFERENCES

(50) The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. Aldag, et al., Angew Chem Int Ed Engl 2013, 52, 1441. Armishaw, et al., J Biol Chem 2006, 281, 14136. Arner, et al., J Mol Biol 1999, 292, 1003. Baron and Bock, J Biol Chem 1991, 266, 20375. Clark, et al., Methods Enzymol 2009, 462, 97. Copeland, P. R. Genome Biol 2005, 6, 27. Datsenko and Wanner, Proc Natl Acad Sci USA 2000, 97, 6640. Ellefson, et al. Nat Biotechnol 2014, 32, 97. Hughes and Ellington, Nucleic Acids Res 2010, 38, 6813. Isaacs, et al., Science 2011, 333, 348. Itoh, et al., Science 2013, 340, 75. Lajoie, et al., Science 2013, 342, 357. Leibundgut, et al., Embo J 2005, 24, 11. Li and Yarus, J Mol Biol 1992, 223, 9. Majiduddin and Palzkill, Antimicrob Agents Chemother 2003, 47, 1062. Mansell, et al., Embo J 2001, 20, 7284. Mukai, et al., Nucleic Acids Res 2010, 38, 8188. Paleskava, et al., J Biol Chem 2010, 285, 3014. Park, et al. Science 2011, 333, 1151. Rudinger, et al., EMBO J. 1996, 15, 650. Sawers, et al., J Bacteriol 1991, 173, 4983. Schlensog et al., J Biol Chem 1994, 269, 19590. Schrader and Uhlenbeck, Nucleic Acids Res 2011, 39, 9746. Shaw, et al. J Am Chem Soc 2013, 135, 12646. Shchedrina, et al., Proc Natl Acad Sci USA 2007, 104, 13919. Suppmann, et al., Embo J 1999, 18, 2284. Swarén, et al., J Biol Chem 1998, 273, 26714. Thyer, et al., J Am Chem Soc 2013, 135, 2. Villafranca, et al., Biochemistry 1987, 26, 2182. Wang and Schultz, Chem Biol 2001, 8, 883. Yoshizawa, et al., Nat Struct Mol Biol 2005, 12, 198. Yuan, et al., FEBS Lett 2010, 584, 342. Zinoni, et al., Proc Natl Acad Sci USA 1987, 84, 3156.