ANIMAL MODELS AND THERAPEUTIC MOLECULES

20230157264 · 2023-05-25

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention discloses methods for the generation of chimaeric human—non-human antibodies and chimaeric antibody chains, antibodies and antibody chains so produced, and derivatives thereof including fully humanised antibodies; compositions comprising said antibodies, antibody chains and derivatives, as well as cells, non-human mammals and vectors, suitable for use in said methods.

    Claims

    1. A method of obtaining nucleic acid encoding the human variable region of an antigen-specific antibody or antigen binding fragment thereof, the method comprising identifying and/or copying nucleic acid encoding a human variable heavy chain region of said antigen-specific antibody and/or nucleic acid encoding a human variable light chain region of said antigen-specific antibody from a B cell or hybridoma cell thereof, of a mouse contacted with said antigen, wherein the germline of said mouse comprises: (i) an IgH locus comprising one or more human variable heavy (VH) gene segments, one or more human D gene segments, and one or more human joining heavy (JH) gene segments at an endogenous IgH locus upstream of an enhancer and a constant (C) region comprising an endogenous IgH C gene segment, and/or (ii) an IgL locus comprising four or more human variable light (VL) gene segments and one or more human joining light (JL) gene segments at an endogenous IgL locus upstream of an IgL constant region comprising an endogenous IgL C gene segment, wherein said IgH locus comprises in 5′ to 3′ orientation said one or more human VH gene segments, said one or more human D gene segments, and said one or more human JH gene segments, an enhancer, and said C region, wherein said intronic DNA comprises in 5′ to 3′ orientation JC intronic DNA of a human IgH locus and JC intronic DNA of a mouse IgH locus, wherein said one or more J.sub.H gene segments comprises a 3′ human J.sub.H gene segment, wherein said 3′ human J.sub.H gene segment is less than 2 kb upstream of said mouse JC intronic DNA, wherein said human JC intronic DNA comprises human JC intronic DNA contiguous in a human IgH locus with said 3′ human J.sub.H gene segment, wherein said mouse JC intronic DNA comprises less than a complete JC intron of a mouse IgH locus, wherein in the germline of the mouse, said human gene segments in each said Ig locus of (i) and (ii) are unrearranged and operably linked to a constant gene segment thereof so that the mouse is capable of producing an antibody heavy chain comprising a human variable domain generated by recombination of a said one or more human J.sub.H gene segments with a said one or more D gene segments and a said one or more V H segments, and an antibody light chain comprising a human variable domain generated by recombination of a said human VL gene segment with a said one or more human JL segments, wherein said one or more human VH gene segments of the IgH locus of (i) comprise one or more human VH gene segments selected from the group consisting of VH3-23*04, VH7-4-1*01, VH4-4*02, VH1-3*01, VH13-13*01, VH3-7*01, VH3-20*d01 and VH3-9*01; and wherein said four or more human VL gene segments of the IgL chain locus of (ii) comprise four or more human Vκ gene segments selected from the group consisting of VK4-1*01, VK2-28*01, VK1D-13*d01, VK1-12*01, VK1D-12*02, VK3-20*01, VK1-17*01, VK1D-39*01, VK3-11*01, VK1 D-16*01 and VK1-9*d01.

    2. The method according to claim 1, further comprising modifying the nucleic acid of said B cell or hybridoma cell thereof, of said mouse contacted with said antigen such that said antigen-specific antibody encoded by said nucleic acid comprises a human constant region operably linked to said human VH and/or human VL domain, the method comprising replacing the nucleic acid encoding the endogenous constant region of the antigen-specific antibody or fragment thereof, with nucleic acid encoding a human constant region, thereby producing a fully humanised antibody or antigen binding fragment thereof.

    3. The method according to claim 1, wherein said one or more human JH gene segments of the heavy chain locus comprises human JH2*01 and/or human JH6*02.

    4. The method according to claim 1, wherein at least one of said one or more human VH gene segments is selected from the group consisting of VH3-23*04, VH7-4-1*01, VH4-4*02, VH 1-3*01, VH3-13*01, VH3-7*01 and VH3-20*d01.

    5. The method according to claim 1, wherein the antigen is a multi-subunit human protein, a bacterial cytotoxin or a protein expressed as a transmembrane protein on human cells.

    6. The method according to claim 1, wherein the antibody or antigen binding fragment thereof specifically binds a human target selected from: proprotein convertase PC9, proprotein convertase subtilisin kexin-9 (PCSK9), CD126, IL-4, IL-4 receptor, IL-6, IL-6 receptor, IL-13, IL-18 receptor, Erbb3, cell ASIC1, ANG2, GDF-8, angiopoietin ligand-2, delta-like protein ligand 4, immunoglobulin G1, PDGF ligand, PDGF receptor or NGF receptor, toxin A or toxin B of Clostridium di/ficile, relaxin, CD48, Cd20, glucagon receptor, protease activated receptor 2, TNF-Like ligand 1A (TL1A), angiopoietin related-2 (AR-2), angiopoietin-like protein 4, RANKL, angiopoietin-like protein 3 (ANGPTL3), delta-like ligand 4 (DLL4), big endothelin-1 (ET-1), activin A, receptor tyrosine kinases, for example human AR-1 and tyrosine kinase with Ig and EGF homology domains (TI E) and TIE-2 receptor.

    7. A method according to of claim 1, (a) wherein the heavy chain of the isolated antibody is encoded by a VH gene segment selected from the group consisting of human VH3-23*04 and human VH3-9*01, (b) wherein the heavy chain of the isolated antibody is encoded by a JH gene segment selected from the group consisting of human J H6*02, human J H6*01, J H2*01 and JH3*02, (c) wherein the light chain of the isolated antibody is encoded by a VK gene segment selected from the group consisting of human VK1 D-12*02, human VK1-12*01, human VK2-28*01 and human VK4-1*01, (d) wherein the light chain of the isolated antibody is encoded by a JK gene segment selected from the group consisting of human JK2*01 and human JK4*01.

    8. The method of claim 1, wherein the cell is a B-cell encoding an antibody that binds said antigen.

    9. The method of claim 2, wherein the nucleic acid is comprised by a host cell selected from a CHO, HEK293, Cos or yeast cell.

    10. The method of claim 9, wherein the antibody or antigen binding fragment thereof encoded by said nucleic acid is produced by expression from a CHO cell.

    11. The method of claim 1, further comprising formulating the nucleic acid with a pharmaceutically acceptable diluent, carrier, excipient or a drug, thereby producing a pharmaceutical composition.

    12. The method of claim 11, further comprising packaging said pharmaceutical composition in a sterile container.

    13. The method of claim 12, wherein said sterile container is selected from the group consisting of a vial, a tube, an Intravenous bag and a syringe.

    14. The method of claim 12, wherein said packaging comprising a label or instructions comprises a medicament batch number and/or a marketing authorization number, further optionally an EMA or FDA marketing authorization number.

    15. The method of claim 1, wherein the antibody or antigen binding fragment encoded by said nucleic acid comprises (a) a human heavy chain variable domain that is a recombinant of a human VH gene segment selected from the group consisting of VH3-23*04, VH7-4-1*01, VH4-4*02, VH1-3*01, VH3-13*01, VH3-7*01, VH3-20*d01 and VH3-9*01, a human J H gene segment and a human D gene segment; and/or (b) a human light chain variable domain is a recombinant of a human VL gene segment selected from the group consisting of VK4-1*01, VK2-28*01, VK1 D-13*d01, VK1-12*01, VK1 D-12*02, VK3-20*01, VK1-17*01, VK1 D-39*01, VK3-11*01, VK1 D-16*01 and V 1-9*d01 and a human J gene segment.

    16. The method of claim 15, wherein the human JH gene segment of claim 18(a) is selected from the group consisting of JH2*01, JH6*02, JH6*01 and JH3*02.

    17. The method of claim 15, wherein the human JL gene segment of claim 18(b) is selected from the group consisting of JK4*01 and JK2*01.

    18. The method of claim 15, wherein the antibody or antigen binding fragment thereof encoded by the nucleic acid comprises a heavy chain variable domain recombinant of claim 19 and a light chain variable domain recombinant of claim 20.

    19. The method of claim 15, wherein the antibody or antigen binding fragment thereof encoded by the nucleic acid comprises a human heavy chain variable domain recombinant of VH3-23*04 and JH2*01 and a human light chain variable domain recombinant of VK4-1*01 and JK2*01.

    20. The method of claim 15, wherein the antibody or antigen binding fragment thereof encoded by the nucleic acid comprises a human heavy chain variable domain recombinant of VH3-7*01 and JH6*02 and a human light chain variable domain recombinant of VK2-28*01 and JK4*01.

    21. The method of claim 1, said mouse being functional to form rearranged human VH, D and JH gene segments and to express mRNA transcripts encoding chimeric immunoglobulin heavy chain polypeptide comprising a human VH region and a mouse Cμ region, wherein said mouse comprises IgH mRNA transcripts comprising IgH-VDJCμ transcripts comprising rearranged human heavy chain V, D, and J gene segments and mouse Cμ and encoding chimeric IgH polypeptides, wherein each IgH-VDJCμ transcript encodes a human variable region comprising a CDR-H3, wherein said IgH-VDJCμ transcripts comprise transcripts encoding a human variable region comprising a CDR-H3 length of 17 amino acids and transcripts encoding human variable region comprising a CDR-H3 length of 18 amino acids, wherein the mean frequency of the group consisting of said transcripts encoding CDR-H3 lengths of 17 and 18 amino acids present in said IgH-VDJCμ transcripts of said mouse is between 5% and 10%.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0869] FIG. 1, part 1 illustrates the first and second BACs used for insertion into mouse endogenous light chain loci. The human DNA in each BAC is shown. Part 2 of FIG. 1 shows the insertion point of human lambda Ig locus DNA into the mouse endogenous kappa chain locus. Part 3 of FIG. 1 shows the insertion point of human lambda Ig locus DNA into the mouse endogenous lambda chain locus.

    [0870] FIG. 2 shows the results of FACS analysis to determine mouse and human Cλ expression (and thus correspondingly mouse and human variable region expression) in B220.sup.+ splenic B cells from P1 homozygous mice (P1/P1) compared to wild-type mice (WT).

    [0871] FIG. 3A shows the results of FACS analysis to determine mouse Cκ and Cλ expression in B220.sup.+ splenic B cells from P2 homozygous mice (P2/P2) compared to wild-type mice (WT). No detectable mouse Cκ expression was seen.

    [0872] FIG. 3B shows the results of FACS analysis to determine human Cλ expression (and thus correspondingly human variable region expression) in B220.sup.+ splenic B cells from P2 homozygous mice (P2/P2) compared to wild-type mice (WT).

    [0873] FIG. 4 shows human Vλ usage in P2 homozygous mice (P2/P2) and typical Vλ usage in humans (inset).

    [0874] FIG. 5 shows human Jλ usage in P2 homozygous mice (P2/P2) and typical Jλ usage in humans (inset).

    [0875] FIG. 6 shows Vλ usage is very high in P2 homozygous mice (P2/P2).

    [0876] FIG. 7 shows the distribution of mouse Vκ and human Vλ gene segment usage from the chimaeric kappa locus in P2 homozygous mice (P2/P2).

    [0877] FIG. 8 illustrates RSS arrangement in the lambda and kappa loci.

    [0878] FIG. 9A shows the results of FACS analysis to determine mouse and human Cλ expression (and thus correspondingly mouse and human variable region expression) in B220.sup.+ splenic B cells from L2 homozygous mice in which endogenous kappa chain expression has been inactivated (L2/L2; KA/KA) compared to mice having no human lambda DNA inserted and in which endogenous kappa chain expression has been inactivated (KA/KA). Very high human Vλ usage was seen in the L2/L2; KA/KA) mice, almost to the exclusion of mouse Vλ use.

    [0879] FIG. 9B: Splenic B-Cell Compartment Analysis. This figure shows the results of FACS analysis on splenic B-cells from transgenic L2/L2; KA/KA mice (L2 homozygotes; homozygous for human lambda gene segment insertion into endogenous lambda loci; endogenous kappa chain expression having been inactivated) compared with splenic B-cells from mice expressing only mouse antibodies (KA/KA mice). The results show that the splenic B-cell compartments in the mice of the invention are normal (i.e., equivalent to the compartments of mice expressing only mouse antibody chains).

    [0880] FIG. 10: B-cell development and markers in the bone marrow and splenic compartments.

    [0881] FIG. 11A: Splenic B-Cell Compartment Analysis. This figure shows the results of FACS analysis on splenic B-cells from transgenic S1F/HA, KA/+ mice of the invention expressing heavy chain variable regions which are all human (where endogenous heavy chain expression has been inactivated by inversion), compared with splenic B-cells from mice expressing only mouse antibodies. The results show that the splenic B-cell compartments in the mice of the invention are normal (i.e., equivalent to the compartments of mice expressing only mouse antibody chains). [0882] S1F/HA, +/KA=(i) S1F—first endogenous heavy chain allele has one human heavy chain locus DNA insertion, endogenous mouse VDJ region has been inactivated by inversion and movement upstream on the chromosome; (ii) HA—second endogenous heavy chain allele has been inactivated (by insertion of an endogenous interrupting sequence); (iii)+—first endogenous kappa allele is a wild-type kappa allele; and (iv) KA—the second endogenous kappa allele has been inactivated (by insertion of an endogenous interrupting sequence). This arrangement encodes exclusively for heavy chains from the first endogenous heavy chain allele.

    [0883] FIG. 11B: Splenic B-Cell Compartment Analysis. This figure shows the results of FACS analysis on splenic B-cells from transgenic S1F/HA, K2/KA mice of the invention expressing heavy chain variable regions which are all human (where endogenous heavy chain expression has been inactivated by inversion) and human kappa chain variable regions, compared with splenic B-cells from +/HA, K2/KA mice. The results show that the splenic B-cell compartments in the mice of the invention are normal. [0884] S1F/HA, K2/KA=(i) K2—the first endogenous kappa allele has two kappa chain locus DNA insertions between the most 3′ endogenous Jκ and the mouse Cκ, providing an insertion of 14 human Vκ and Jκ1-Jκ5; and (ii) KA—the second endogenous kappa allele has been inactivated (by insertion of an endogenous interrupting sequence). This arrangement encodes exclusively for heavy chains comprising human variable regions and substantially kappa light chains from the first endogenous kappa allele. [0885] +/HA, K2/KA—this arrangement encodes for mouse heavy chains and human kappa chains.

    [0886] FIG. 12A: Bone marrow B progenitor compartment analysis. This figure shows the results of FACS analysis on bone marrow (BM) B-cells from transgenic S1F/HA, KA/+ mice of the invention expressing heavy chain variable regions which are all human (where endogenous heavy chain expression has been inactivated by inversion), compared with BM B-cells from mice expressing only mouse antibodies. The results show that the BM B-cell compartments in the mice of the invention are normal (i.e., equivalent to the compartments of mice expressing only mouse antibody chains).

    [0887] FIG. 12B: Bone marrow B progenitor compartment analysis. This figure shows the results of FACS analysis on bone marrow (BM) B-cells from transgenic S1F/HA, K2/KA mice of the invention expressing heavy chain variable regions which are all human (where endogenous heavy chain expression has been inactivated by inversion) and human kappa chain variable regions, compared with BM B-cells from +/HA, K2/KA mice. The results show that the BM B-cell compartments in the mice of the invention are normal.

    [0888] FIG. 13: shows Ig quantification for subtype and total Ig in various mice:

    S1F/HA, KA/+=(i) S1F—first endogenous heavy chain allele has one human heavy chain locus DNA insertion, endogenous mouse VDJ region has been inactivated by inversion and movement upstream on the chromosome; (ii) HA—second endogenous heavy chain allele has been inactivated (by insertion of an endogenous interrupting sequence); (iii) KA—the first endogenous kappa allele has been inactivated (by insertion of an endogenous interrupting sequence); and (iv)+—second endogenous kappa allele is a wild-type kappa allele. This arrangement encodes exclusively for heavy chains from the first endogenous heavy chain allele. [0889] S1F/HA, K2/KA=(i) K2—the first endogenous kappa allele has two kappa chain locus DNA insertions between the most 3′ endogenous Jκ and the mouse Cκ, providing an insertion of 14 human Vκ and Jκ1-Jκ5; and (ii) KA—the second endogenous kappa allele has been inactivated (by insertion of an endogenous interrupting sequence). This arrangement encodes exclusively for heavy chains comprising human variable regions and substantially kappa light chains from the first endogenous kappa allele. [0890] +/HA, K2/+—this arrangement encodes for mouse heavy chains and both mouse and human kappa chains. [0891] +/HA, +/KA—this arrangement encodes for mouse heavy and kappa chains.

    [0892] In this figure, “Sum Ig” is the sum of IgG and IgM isotypes.

    [0893] FIG. 14: shows Ig quantification for subtype and total Ig in various mice:

    [0894] S1F/HA, K2/KA (n=15) and 12 mice expressing only mouse antibody chains (+/HA, +/KA (n=6) and wild-type mice (WT; n=6)).

    DETAILED DESCRIPTION OF THE INVENTION

    [0895] It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine study, numerous equivalents to the specific procedures described herein.

    [0896] Such equivalents are considered to be within the scope of this invention and are covered by the claims.

    [0897] The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” The use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and/or.” Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.

    [0898] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps

    [0899] The term “or combinations thereof” as used herein refers to all permutations and combinations of the listed items preceding the term. For example, “A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.

    [0900] As a source of antibody gene segment sequences, the skilled person will also be aware of the following available databases and resources (including updates thereof) the contents of which are incorporated herein by reference:

    [0901] The Kabat Database (G. Johnson and T. T.Wu, 2002; World Wide Web (www) kabatdatabase.com). Created by E. A. Kabat and T. T. Wu in 1966, the Kabat database publishes aligned sequences of antibodies, T-cell receptors, major histocompatibility complex (MHC) class I and II molecules, and other proteins of immunological interest. A searchable interface is provided by the Seqhuntll tool, and a range of utilities is available for sequence alignment, sequence subgroup classification, and the generation of variability plots. See also Kabat, E. A., Wu, T. T., Perry, H., Gottesman, K., and Foeller, C. (1991) Sequences of Proteins of ImmunologicalInterest, 5th ed., NIH Publication No. 91-3242, Bethesda, Md., which is incorporated herein by reference, in particular with reference to human gene segments for use in the present invention.

    [0902] KabatMan (A. C. R. Martin, 2002; World Wide Web (www) bioinf.org.uk/abs/simkab.html). This is a web interface to make simple queries to the Kabat sequence database.

    [0903] IMGT (the International ImMunoGeneTics Information Systems; M.-P. Lefranc, 2002; World Wide Web (www) imgt.cines.fr). IMGT is an integrated information system that specializes in antibodies, T cell receptors, and MHC molecules of all vertebrate species.

    [0904] It provides a common portal to standardized data that include nucleotide and protein sequences, oligonucleotide primers, gene maps, genetic polymorphisms, specificities, and two-dimensional (2D) and three-dimensional (3D) structures. IMGT includes three sequence databases (IMGT/LIGM-DB, IMGT/MHC-DB, IMGT/PRIMERDB), one genome database (IMGT/GENE-DB), one 3D structure database (IMGT/3Dstructure-DB), and a range of web resources (“/MGT Marie-Paule page”) and interactive tools.

    [0905] V-BASE (I. M. Tomlinson, 2002; World Wide Web (www) mrc-cpe.cam.ac.uk/vbase). V-BASE is a comprehensive directory of all human antibody germline variable region sequences compiled from more than one thousand published sequences. It includes a version of the alignment software DNAPLOT (developed by Hans-Helmar Althaus and Werner Müller) that allows the assignment of rearranged antibody V genes to their closest germline gene segments.

    [0906] Antibodles-Structure and Sequence (A. C. R. Martin, 2002; World Wide Web (www) bioinf.org.uk/abs). This page summarizes useful information on antibody structure and sequence. It provides a query interface to the Kabat antibody sequence data, general information on antibodies, crystal structures, and links to other antibody-related information. It also distributes an automated summary of all antibody structures deposited in the Protein Databank (PDB). Of particular interest is a thorough description and comparison of the various numbering schemes for antibody variable regions.

    [0907] AAAAA (A Ho's Amazing Atlas of Antibody Anatomy; A. Honegger, 2001; World Wide Web (www) unizh.ch/-antibody). This resource includes tools for structural analysis, modeling, and engineering. It adopts a unifying scheme for comprehensive structural alignment of antibody and T-cell-receptor sequences, and includes Excel macros for antibody analysis and graphical representation.

    [0908] WAM (Web Antibody Modeling; N. Whitelegg and A. R. Rees, 2001; World Wide Web (www) antibody.bath.ac.uk). Hosted by the Centre for Protein Analysis and Design at the University of Bath, United Kingdom. Based on the AbM package (formerly marketed by Oxford Molecular) to construct 3D models of antibody Fv sequences using a combination of established theoretical methods, this site also includes the latest antibody structural information.

    [0909] Mike's Immunoglobulin Structure/Function Page (M. R. Clark, 2001; World Wide Web (www) path.cam.ac.uk/˜mrc7/mikeimages.html) These pages provide educational materials on immunoglobulin structure and function, and are illustrated by many colour images, models, and animations. Additional information is available on antibody humanization and Mike Clark's Therapeutic Antibody Human Homology Project, which aims to correlate clinical efficacy and anti-immunoglobulin responses with variable region sequences of therapeutic antibodies.

    [0910] The Antibody Resource Page (The Antibody Resource Page, 2000; World Wide Web (www) antibodyresource.com). This site describes itself as the “complete guide to antibody research and suppliers.” Links to amino acid sequencing tools, nucleotide antibody sequencing tools, and hybridoma/cell-culture databases are provided.

    [0911] Humanization bYDesign (J. Saldanha, 2000; World Wide Web (www) people.cryst.bbk.ac.uk/-ubcg07s). This resource provides an overview on antibody humanization technology. The most useful feature is a searchable database (by sequence and text) of more than 40 published humanized antibodies including information on design issues, framework choice, framework back-mutations, and binding affinity of the humanized constructs.

    [0912] See also Antibody Engineering Methods and Protocols, Ed. Benny K C Lo, Methods in Molecular Biology™, Human Press. Also at World Wide Web (www) blogsua.com/pdf/antibody-engineering-methods-and-protocolsantibody-engineering-methods-and-protocols.pdf

    [0913] Any part of this disclosure may be read in combination with any other part of the disclosure, unless otherwise apparent from the context.

    [0914] All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

    [0915] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the invention, and are not intended to limit the scope of what the inventors regard as their invention.

    EXAMPLES

    Example 1

    High Human Lambda Variable RegIon Expression In Transgenic MIce Comprising Human Lambda Gene Segments Inserted Into Endogenous Kappa Locus

    [0916] Insertion of human lambda gene segments from a 1.sup.st IGL BAC to the IGK locus of mouse AB2.1 ES cells (Baylor College of Medicine) was performed to create a chimaeric light chain allele denoted the P1 allele (FIG. 1). The inserted human sequence corresponds to the sequence of human chromosome 22 from position 23217291 to position 23327884 and comprises functional lambda gene segments Vλ3-1, Jλ11-CAl1, Jλ2-Cλ2, Jλ3-Cλ3, Jλ6-Cλ6 and Jλ7-Cλ7 (the alleles of Table 13). The insertion was made between positions 70674755 and 706747756 on mouse chromosome 6, which is upstream of the mouse Cκ region and 3′Eκ (i.e., within 100 kb of the endogenous light chain enhancer) as shown in FIG. 1. The mouse Vκ and Jκ gene segments were retained in the chimaeric locus, immediately upstream of the inserted human lambda DNA. The mouse lambda loci were left intact. Mice homozygous for the chimaeric P1 locus were generated from the ES cells using standard procedures.

    [0917] A second type of mice were produced (P2 mice) in which more human functional Vλ gene segments were inserted upstream (5′) of human Vλ3-1 by the sequential insertion of the BAC1 human DNA and then BAC2 DNA to create the P2 allele (the alleles of table 14). The inserted human sequence from BAC2 corresponds to the sequence of human chromosome 22 from position 23064876 to position 23217287 and comprises functional lambda gene segments Vλ2-18, Vλ3-16, V2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8 and Vλ4-3. Mice homozygous for the chimaeric P2 locus were generated from the ES cells using standard procedures.

    [0918] FACS analysis of splenic B cells from the P1 and P2 homozygotes was performed to assess lambda versus kappa expression and human lambda versus mouse lambda expression in the transgenic mice.

    [0919] Standard 5′-RACE was carried out to analyse RNA transcripts from the light chain loci in P2 homozygotes.

    [0920] Light Chain Expression & FACS Analysis

    [0921] To obtain a single cell suspension from spleen, the spleen was gently passage through a 30 μm cell strainer. Single cells were resuspended in Phosphate-Buffered Saline (PBS) supplemented with 3% heat inactivated foetal calf serum (FCS).

    [0922] The following antibodies were used for staining:

    [0923] Rat anti-mouse lambda (mCλ) phycoerythrin (PE) antibody (Southern Biotech), rat anti-mouse kappa (mCκ) (BD Pharmingen, clone 187.1) fluorescein isothiocyanate (FITC), anti-human lambda (hCλ) (eBioscience, clone 1-155-2) phycoerythrin (PE), anti-B220/CD45R (eBioscience, clone RA3-6B2) allophycocyanin (APC). NB: light chains bearing human Cλ was expected to have variable regions derived from the rearrangement of inserted human Vλ and human Jλ. Light chains bearing mouse Cλ was expected to have variable regions derived from the rearrangement of mouse Vλ and Jλ from the endogenous lambda loci.

    [0924] 5×10.sup.6 cells were added to individual tubes, spun down to remove excess of fluid, and resuspended in fresh 100p of PBS+3% FCS. To each individual tube the following antibodies were added:

    [0925] For staining of mA versus mK 1 μl of each antibody was added in addition to 1 μl of B220/CD45R antibody. For detection of B cells expressing human lambda light chain, the mA antibody was substituted with hA antibody. Cells were incubated in the dark at 6° C. for 15 minutes followed by several washes with fresh PBS+3% FCS to remove unbound antibody. Cells were analysed using fluorescence-activated cell sorting (FACS) analyser from Miltenyi Biotech.

    [0926] Alive spleenocytes were gated using side scatter (SSC) and forward scatter (FSC). Within the SSC and FSC gated population, a subpopulation of B220/CD45R (mouse B-cells) was detected using the APC fluorochrome. Single positive B220/CD45R population was further subdivided into a cell bearing either mA or hA PE fluorochrome in conjunction with mK FITC fluorochrome. The percentage of each population was calculated using a gating system.

    [0927] Surprisingly, FACS analysis of splenic B cells from the P1 homozygotes showed no detectable mouse Cκ expression (FIG. 2), indicating that insertion of the human lambda locus DNA from BAC1 interrupts expression of the endogenous IGK chain.

    [0928] The strong expression of endogenous Cλ and weak expression of human Cλ in the splenic B cells grouped by FACS analysis (mouse Cλ: human Cλ=65:32) in these mice suggest that inserted human IGL sequence, although interrupts the IGK activity, cannot totally compete with the endogenous IGL genes.

    [0929] The FACS analysis again surprisingly showed no detectable mouse Cκ expression in the P2 homozygotes (FIGS. 3A & B). However, the human Cλ greatly predominates in expressed B cells grouped as mouse or human Cλ following FACS analysis (mouse Cλ: human Cλ=15:80 corresponding to a ratio of 15 mouse lambda variable regions: 80 human lambda variable regions, i.e., 84% human lambda variable regions with reference to the grouped B-cells—which corresponds to 80% of total B-cells) from the P2 homozygotes. While not wishing to be bound by any theory, we suggest that the inserted human lambda locus sequence from the 2.sup.nd BAC provides some advantages to compete with endogenous lambda gene segment rearrangement or expression.

    [0930] We analysed human Vλ and Jλ usage in the P2 homozygotes. See FIG. 4 which shows the human Vλ usage in P2 homozygotes. The observed usage was similar to that seen in humans (as per J Mol Biol. 1997 Apr. 25; 268(1):69-77; “The creation of diversity in the human immunoglobulin V(lambda) repertoire”; Ignatovich O et al. Further, the human Jλ usage was similar to that seen in humans (FIG. 5). The Vλ versus Vκ usage analysis of human Cλ transcripts by sequencing of non-bias 5′-RACE (rapid amplification of cDNA ends) PCR clones showed that among 278 clone sequences, only one used Vκ for rearrangement to Jλ (human Jλ), and all others (277 clones) used human Vλ (FIGS. 6 & 7; Vλ2-5 was detected at the RNA transcript level, but this is a pseudogene which is usually not picked up by usage a the protein level). While not wishing to be bound by any theory, we suggest that the retained mouse Vκ gene segments essentially cannot efficiently rearrange with the inserted human Jλ gene segments because they have the same type of RSSs (recombination signal sequences; see explanation below) and are incompatible for rearrangement (FIG. 8). This result also indicates that the inactivation of the endogenous IGK activity and predominate expression of the inserted human lambda sequence can be achieved without further modification of the IGK locus, for example, deletion or inversion of endogenous kappa loci gene segments is not necessary, which greatly simplifies the generation of useful transgenic mice expressing light chains bearing human lambda variable regions (i.e., variable regions produced by recombination of human Vλ and Jλ gene segments).

    [0931] The arrangement of recombination signal sequences (RSSs) that mediate V(D)J recombination in vivo is discussed, e.g., in Cell. 2002 April; 109 Suppl:S45-55; “The mechanism and regulation of chromosomal V(D)J recombination”; Bassing C H, Swat W, Alt F W (the disclosure of which is incorporated herein by reference). Two types of RSS element have been identified: a one-turn RSS (12-RSS) and a two-turn RSS (23-RSS). In natural VJ recombination in the lambda light chain locus, recombination is effected between a two-turn RSS that lies 3′ of a V lambda and a one-turn RSS that lies 5′ of a J lambda, the RSSs being in opposite orientation. In natural VJ recombination in the kappa light chain locus, recombination if effected between a one-turn RSS that lies 3′ of a V kappa and a two-turn RSS that lies 5′ of a J kappa, the RSSs being in opposite orientation. Thus, generally a two-turn RSS is compatible with a one-turn RSS in the opposite orientation.

    [0932] Thus, the inventors have demonstrated how to (i) inactivate endogenous kappa chain expression by insertion of human lambda gene segments into the kappa locus; and (ii) how to achieve very high human lambda variable region expression (thus providing useful light chain repertoires for selection against target antigen)—even in the presence of endogenous lambda and kappa V gene segments. Thus, the inventors have shown how to significantly remove (lambda) or totally remove (kappa) V gene segment competition and thus endogenous light chain expression by the insertion of at least the functional human lambda gene segments comprised by BACs 1 and 2. In this example a very high level of human lambda variable region expression was surprisingly achieved (84% of total lambda chains and total light chains as explained above).

    Example 2

    High Human Lambda Variable Region Expression In Transgenic Mice Comprising Human Lambda Gene Segments Inserted Into Endogenous Lambda Locus

    [0933] Insertion of human lambda gene segments from the 1.sup.st and 2.sup.nd IGL BACs to the lambda locus of mouse AB2.1 ES cells (Baylor College of Medicine) was performed to create a lambda light chain allele denoted the L2 allele (FIG. 1). The inserted human sequence corresponds to the sequence of human chromosome 22 from position 23064876 to position 23327884 and comprises functional lambda gene segments Vλ2-18, Vλ3-16, V2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, Jλ1-Cλ1, Jλ2-Cλ2, Jλ3-Cλ3, Jλ6-Cλ6 and Jλ7-Cλ7. The insertion was made between positions 19047551 and 19047556 on mouse chromosome 16, which is upstream of the mouse Cλ region and between Eλ4-10 and Eλ3-1 (i.e., within 100 kb of the endogenous light chain enhancers) as shown in FIG. 1. The mouse Vλ and Jλ gene segments were retained in the locus, immediately upstream of the inserted human lambda DNA. The mouse kappa loci were inactivated to prevent kappa chain expression. Mice homozygous for the L2 locus were generated from the ES cells using standard procedures.

    [0934] Using a similar method to that of Example 1, FACS analysis of splenic B cells from the L2 homozygotes was performed to assess lambda versus kappa expression and human lambda versus mouse lambda expression in the transgenic mice.

    Light Chain Expression & FACS Analysis

    [0935] The FACS analysis of splenic B-cells in L2 homozygotes under the IGK knockout background (in which Vκ and Jκ gene segments have been retained) surprisingly showed that expression of human Cλ greatly predominates in B-cells grouped as mouse or human Cλ following FACS analysis (mouse Cλ: human Cλ=5:93 corresponding to a ratio of 5 mouse lambda variable regions: 93 human lambda variable regions, i.e., 95% human lambda variable regions with reference to the grouped B-cells—which corresponds to 93% of total B-cells) (FIG. 9A), demonstrating that inserted human IGA gene segments within the endogenous IGA locus can outcompete the endogenous IGA gene segment rearrangement or expression.

    [0936] Thus, the inventors have demonstrated how to achieve very high human lambda variable region expression (thus providing useful light chain repertoires for selection against target antigen)—even in the presence of endogenous lambda and kappa V gene segments. Thus, the inventors have shown how to significantly remove endogenous lambda V gene segment competition and thus endogenous lambda light chain expression by the insertion of at least the functional human lambda gene segments comprised by BACs 1 and 2. In this example a very high level of human lambda variable region expression was surprisingly achieved (95% of total lambda chains and total light chains as explained above).

    [0937] These data indicate that mice carrying either P (Example 1) or L (Example 2) alleles produced by targeted insertion of the functional gene segments provided by BAC1 and BAC2 can function in rearrangement and expression in mature B cells. These two types of alleles are very useful for providing transgenic mice that produce human Ig lambda chains for therapeutic antibody discovery and as research tools.

    [0938] Transgenic Mice of the Invention Expressing Human Lambda Variable Regions Develop Normal Splenic Compartments

    [0939] In spleen, B cells are characterized as immature (T1 and T2) and mature (M) based on the levels of cell surface markers, IgM and IgD. T1 cells have high IgM and low IgD. T2 cells have medium levels of both them. M cells have low IgM but high IgD (FIG. 10). See also J Exp Med. 1999 Jul. 5; 190(1):75-89; “B cell development in the spleen takes place in discrete steps and is determined by the quality of B cell receptor-derived signals”; Loder F et al.

    [0940] Using methods similar to those described in Example 3 below, splenic B-cells from the animals were scored for IgD and IgM expression using FACS. We compared control mice KA/KA (in which endogenous kappa chain expression has been inactivated, but not endogenous lambda chain expression) with L2/L2;KA/KA mice (L2 homozyotes). The L2 homozygotes surprisingly showed comparable splenic B-cell compartments to the control mice (FIG. 9B).

    Example 3

    Assessment of B-Cell and Ig Development In Transgenic Mice of the Invention

    [0941] We observed normal Ig subtype expression & B-cell development in transgenic mice of the invention expressing antibodies with human heavy chain variable regions substantially in the absence of endogenous heavy and kappa chain expression.

    [0942] Using ES cells and the RMCE genomic manipulation methods described above, mice were constructed with combinations of the following Ig locus alleles:—

    [0943] S1F/HA, +/KA=(i) S1F—first endogenous heavy chain allele has one human heavy chain locus DNA insertion, endogenous mouse VDJ region has been inactivated by inversion and movement upstream on the chromosome (see the description above, where this allele is referred to as S1.sup.inv1); (ii) HA—second endogenous heavy chain allele has been inactivated (by insertion of an endogenous interrupting sequence); (iii)+—first endogenous kappa allele is a wild-type kappa allele and (iv) KA—the second endogenous kappa allele has been inactivated (by insertion of an endogenous interrupting sequence). This arrangement encodes exclusively for heavy chains from the first endogenous heavy chain allele.

    [0944] S1F/HA, K2/KA=(i) K2—the first endogenous kappa allele has two kappa chain locus DNA insertions between the most 3′ endogenous Jκ and the mouse Cκ, providing an insertion of 14 human Vκ and Jκ1-Jκ5; and (ii) KA—the second endogenous kappa allele has been inactivated (by insertion of an endogenous interrupting sequence). This arrangement encodes exclusively for heavy chains comprising human variable regions and substantially kappa light chains from the first endogenous kappa allele.

    +/HA, K2/KA—this arrangement encodes for mouse heavy chains and human kappa chains.
    +/HA, +/KA—this arrangement encodes for mouse heavy and kappa chains—the mice only produce mouse heavy and light chains.

    [0945] In bone marrow, B progenitor populations are characterized based their surface markers, B220 and CD43. PreProB cells carry germline IGH and IGK/L configuration and have low B220 and high CD43 on their cell surface. ProB cells start to initiate VDJ recombination in the IGH locus and carry medium levels of both B220 and CD43. PreB cells carry rearranged IGH VDJ locus and start to initiate light chain VJ rearrangement, and have high B220 but low CD43. In spleen, B cells are characterized as immature (T1 and T2) and mature (M) based on the levels of cell surface markers, IgM and IgD. T1 cells have high IgM and low IgD. T2 cells have medium levels of both them. M cells have low IgM but high IgD (FIG. 10). See also J Exp Med. 1991 May 1; 173(5):1213-25; “Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow”; Hardy R R et al and J Exp Med. 1999 Jul. 5; 190(1):75-89; “B cell development in the spleen takes place in discrete steps and is determined by the quality of B cell receptor-derived signals”; Loder F et al.

    Transgenic Mice of the Invention Develop Normal Splenic and BM Compartments

    (a) Analysis of the Splenic Compartment

    [0946] For each mouse, to obtain a single cell suspension from spleen, the spleen was gently passaged through a 30 μm cell strainer. Single cells were resuspended in Phosphate-Buffered Saline (PBS) supplemented with 3% heat inactivated foetal calf serum (FCS). 5×10.sup.6 cells were added to individual tubes, spun down to remove excess of fluid and resuspended in fresh 100p of PBS+3% FCS. To each individual tube the following antibodies were added: anti-B220/CD45R (eBioscience, clone RA3-6B2) allophycocyanin (APC), antibody against IgD receptor conjugated with phycoerythrin (PE) (eBioscience, clone 11-26) and antibody against IgM receptor conjugated with fluorescein isothiocyanate (FITC) (eBioscience, clone 11/41).

    [0947] For staining of IgM vs IgD, 5×10.sup.6 cells were used for each staining. To each vial containing splenocytes a cocktail of antibodies was added consisting of: anti-IgD (PE), anti-IgM (FITC) and anti-B220/CD45R (APC). Cells were incubated at 6° C. for 15 minutes, washed to remove excess unbound antibodies and analysed using a fluorescence-activated cell sorting (FACS) analyser from Miltenyi Biotech. B-cells were gated as B220.sup.HIGH IgM.sup.HIGH IgD.sup.LOW (i.e., B220.sup.+IgM.sup.+IgD.sup.−) for T1 population, B220.sup.HIGH IgM.sup.HIGH IgD.sup.HIGH (B220.sup.+IgM.sup.+IgD.sup.+) for T2 population and B220.sup.HIGH IgM.sup.LOW IgD.sup.HIGH (B220.sup.+IgM.sup.− IgD.sup.+) for M population. Percentage of cells was calculated using gating system. We used gates to identify and define subsets of cell populations on plots with logarithmic scale. Before gates are applied a single stain antibody for each fluorochrome is used to discriminate between a positive (high intensity fluorochrome) and negative (no detectable intensity fluorchrome) population. Gates are applied based on fluorochrome intensities in the same manner to all samples. The single stains were:

    IgD-PE

    IgM-FITC

    B220-APC

    [0948] Alive spleenocytes were gated using side scatter (SSC) and forward scatter (FSC). Within the SSC and FSC gated population, a subpopulation of B220/CD45R positive cells (mouse B-cells) was detected using the APC fluorochrome. The single positive B220/CD45R population was further subdivided into a cell bearing either IgM fluorescein isothiocyanate (FITC) or IgD fluorochrome in conjunction with mK FITC fluorochrome. The percentage of each population was calculated using gating system. The splenic B-Cell compartments in the mice of the invention are normal (i.e., equivalent to the compartments of mice expressing only mouse antibody chains).

    (b) Bone marrow B progenitor analysis

    [0949] To obtain a single cell suspension from bone marrow for each mouse, the femur and tibia were flushed with Phosphate-Buffered Saline (PBS) supplemented with 3% heat inactivated foetal calf serum (FCS). Cells were further passage through a 30 μm cell strainer to remove bone pieces or cell clumps. Cells were resuspended in cold PBS supplemented with 3% serum. 2×10.sup.6 cells were added to individual tubes, spun down to remove excess of buffer, and resuspended in fresh 100 μl of PBS+3% FCS. To each individual tube the following antibodies were added: anti-Leukosialin (CD43) fluorescein isothiocyanate (FITC) (eBioscience, clone eBioR2/60) and anti-B220/CD45R (eBioscience, clone RA3-6B2) allophycocyanin (APC). Cells were incubated in the dark at 6° C. for 15 minutes followed by several washes with fresh PBS+3% FCS to remove unbound antibody. Cells were analysed using a fluorescence-activated cell sorting (FACS) analyser from Miltenyi Biotech. Alive bone marrow cells were gated using side scatter (SSC) and forward scatter (FSC). We used gates to identify and define subsets of cell populations on plots with logarithmic scale. Before gates are applied a single stain antibody for each fluorochrome is used to discriminate between a positive (high intensity fluorochrome) and negative (no detectable intensity fluorchrome) population. Gates are applied based on fluorochrome intensities in the same manner to all samples. The single stains were:

    B220-APC

    CD43-FITC

    [0950] Within the alive population a double population of B220/CD45R and CD43 positive cells was identified as a pre-B, pro-B and pre-pro B cells. The splenic B-Cell compartments in the mice of the invention are normal (i.e., equivalent to the compartments of mice expressing only mouse antibody chains).

    Transgenic Mice of the Invention Develop Normal Ig Expression

    [0951] Quantification of serum IgM and IgG

    [0952] 96-well NUNC plates were coated initially with a capture antibody (goat anti-mouse Fab antibody at 1 μg/ml) overnight at 4° C.). The IgG plates used anti-Fab, (M4155 Sigma) and the IgM plates used anti-Fab (OBT1527 AbD Serotec). Following three washes with phosphate buffer saline (PBS) containing 0.1% v/v Tween20, plates were blocked with 200 μl of PBS containing 1% w/v bovine serum albumin (BSA) for 1 hour at room temperature (RT). The plates were washed three times as above and then 50 μl of standards (control mouse isotype antibodies, IgG1 (M9269 Sigma), IgG2a (M9144 Sigma), IgG2b (M8894 sigma), IgM (M3795 Sigma) or serum samples diluted in PBS with 0.1% BSA were added to each well, and incubated for 1 hour at RT. After washing three times as above 100 μl of detection antibody (goat anti-mouse isotype specific antibody-horseradish peroxidase conjugated, 1/10000 in PBS with 0.1% Tween) (anti-mouse IgG1 (STAR132P AbD Serotec), anti-mouse IgG2a (STAR133P AdD Serotec), anti-mouse IgG2b (STAR134P AbD Serotec) and anti-mouse IgM (ab97230 Abcam) were added into each well and incubated for 1 hour at RT. The plates were washed three times as above and developed using tetramethylbenzidine substrate (TMB, Sigma) for 4-5 minutes in the dark at RT. Development was stopped by adding 50 μl/well of 1 M sulfuric acid. The plates were read with a Biotek Synergy HT plate reader at 450 nm.

    Conclusion:

    [0953] Inversion of endogenous V.sub.H-D-J.sub.H following the human IGH BAC insertion results in inactivation of rearrangement of endogenous V.sub.H to inserted human D-J.sub.H. The inventors observed, however, that surprisingly the inactivation of endogenous heavy chain expression does not change the ratio of B-cells in the splenic compartment (FIG. 11) or bone marrow B progenitor compartment (FIG. 12) and the immunoglobulin levels in serum are normal and the correct Ig subtypes are expressed (FIG. 13). This was shown in mice expressing human heavy chain variable regions with mouse light chains (FIGS. 11A and 12A) as well as in mice expressing both human heavy chain variable regions and human light chain variable regions (FIGS. 11B and 12B). These data demonstrate that inserted human IGH gene segments (an insertion of at least human V.sub.H gene segments V.sub.H2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1, and all the human D and J.sub.H gene segments D1-1, 2-2, 3-3, 4-4, 5-5, 6-6, 1-7, 2-8, 3-9, 5-12, 6-13, 2-15, 3-16, 4-17, 6-19, 1-20, 2-21, 3-22, 6-25, 1-26 and 7-27; and J1, J2, J3, J4, J5 and J6) are fully functional in the aspect of rearrangement, BCR signalling and B cell maturation. Functionality is retained also when human light chain VJ gene segments are inserted to provide transgenic light chains, as per the insertion used to create the K2 allele. This insertion is an insertion comprising human gene segments Vκ2-24, Vκ3-20, Vκ1-17, Vκ1-16, Vκ3-15, Vκ1-13, Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8, Vκ1-6, Vκ1-5, Vκ5-2, Vκ4-1, Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5. Greater than 90% of the antibodies expressed by the S1F/HA; K2/KA mice comprised human heavy chain variable regions and human kappa light chain variable regions. These mice are, therefore, very useful for the selection of antibodies having human variable regions that specifically bind human antigen following immunisation of the mice with such antigen. Following isolation of such an antibody, the skilled person can replace the mouse constant regions with human constant regions using conventional techniques to arrive at totally human antibodies which are useful as drug candidates for administration to humans (optionally following mutation or adaptation to produce a further derivative, e.g., with Fc enhancement or inactivation or following conjugation to a toxic payload or reporter or label or other active moiety).

    [0954] A further experiment was carried out to assess the IgG and IgM levels and relative proportions in transgenic mice of the invention that express antibodies that have human heavy and light (kappa) variable regions (S1F/HA, K2/KA mice; n=15). These were compared against 12 mice expressing only mouse antibody chains (+/HA, +/KA (n=6) and wild-type mice (WT; n=6)). The results are tabulated below (Table 19) and shown in FIG. 14.

    [0955] It can be seen that the mice of the invention, in which essentially all heavy chain variable regions are human heavy chain variable regions, expressed normal proportions of IgM and IgG subtypes, and also total IgG relative to IgM was normal.

    TABLE-US-00019 TABLE 19 IgG1 IgG2a IgG2b IgM Total IgG + IgM (μg/mL) (μg/mL) (μg/mL) (μg/mL) (μg/mL) KMCB22.1a 30.5 38.3 49.9 1.7 224.4 1.8 343.1 S1F/HA, K2/KA KMCB 19.1d 103.6 181.2 85.6 1.9 351.7 1.10 722.1 S1F/HA, K2/KA KMCB 19.1 h 191.4 456.6 383.3 1.11 643.2 1.12 1674.6 S1F/HA, K2/KA KMCB 20.1a 53.6 384.4 249.7 1.13 427.1 1.14 1114.7 S1F/HA, K2/KA KMCB 20.1c 87.3 167.0 125.7 1.15 422.1 1.16 802.1 S1F/HA, K2/KA KMCB 20.1f 55.4 177.2 95.6 1.17 295.7 1.18 623.9 S1F/HA, K2/KA KMCB 22.1f 61.1 56.3 111.4 1.19 245.8 1.20 474.5 S1F/HA, K2/KA KMCB23.1C 71.4 70.7 80.5 1.21 585.4 1.22 808.0 S1F/HA, K2/KA KMCB23.1d 65.4 148.7 187.4 1.23 255.4 1.24 657.0 S1F/HA, K2/KA KMCB24.1f 60.0 56.6 150.5 1.25 294.8 1.26 561.9 S1F/HA, K2/KA KMCB13.1a 101.2 200.5 269.8 1.27 144.1 1.28 715.7 S1F/HA, K2/KA KMCB13.1d 124.5 117.5 246.6 1.29 183.2 1.30 671.9 S1F/HA, K2/KA KMCB17.1f 58.3 174.2 1.31 116.2 1.32 218.1 1.33 566.8 S1F/HA, K2/KA KMCB14.1a 51.9 46.5 27.9 1.34 222.2 1.35 348.6 S1F/HA, K2/KA KMCB14.1b 11.5 54.2 48.5 1.36 194.4 1.37 308.6 S1F/HA, K2/KA KMCB19.1e +/HA, +/KA 233.0 6.7 465.6 1.38 420.9 1.39 1126.3 KMCB19.1f +/HA, +/KA 154.3 4.6 610.2 1.40 435.7 1.41 1204.8 KMCB19.1l +/HA, +/KA 113.5 1.1 246.8 1.42 374.6 1.43 736.0 KMCB20.1e +/HA, +/KA 561.0 4.3 614.3 1.44 482.1 1.45 1661.7 KMCB13.1e +/HA, +/KA 439.3 17.1 584.1 1.46 196.9 1.47 1237.3 KMCB14.1c +/HA, +/KA 93.4 1.3 112.0 1.48 106.8 1.49 313.6 KMWT 1.3c WT 212.9 155.2 104.6 1.50 233.7 1.51 706.4 KMWT 1.3d WT 297.1 203.2 144.6 1.52 248.6 1.53 893.5 KMWT 1.3e WT 143.1 174.2 619.1 1.54 251.8 1.55 1188.2 KMWT 1.3f WT 218.8 86.8 256.1 1.56 294.8 1.57 856.4 KMWT 1.3b WT 150.2 114.2 114.7 1.58 225.6 1.59 604.7 KMWT 3.1e WT 125.9 335.5 174.6 1.60 248.9 1.61 884.9

    Example 4

    Assessment of Kappa: Lambda Ratio & Splenic B-cell Compartments In Transgenic Mice of the Invention

    [0956] Mice comprising the following genomes were obtained.

    [0957] WT/WT=wild-type;

    [0958] KA/KA=each endogenous kappa allele has been inactivated; and the endogenous lambda loci are left intact;

    [0959] K3F/K3F=each endogenous kappa allele has three kappa chain locus DNA insertions between the 3′ most endogenous Jκ and the mouse Cκ, providing insertion of human V gene segments V.sub.K2-40, Vκ1-39, Vκ1-33, Vκ2-30, Vκ2-29, Vκ2-28, Vκ1-27, Vκ2-24, Vκ3-20, Vκ1-17, Vκ1-16, Vκ3-15, Vκ1-13, Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8, Vκ1-6, Vκ1-5, Vκ5-2 and Vκ4-1 and human J gene segments Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5 (the human V gene segments being 5′ of the human J gene segments); each endogenous kappa VJ has been inactivated by inversion and movement upstream on the chromosome; and the endogenous lambda loci are left intact;

    [0960] L2/L2=as described in Example 2 (L2 homozygotes where human lambda variable region DNA has been inserted into the endogenous lambda loci; the endogenous kappa loci are left intact);

    [0961] L2/L2;KA/KA=as L2/L2 but the endogenous kappa alleles have been inactivated (by insertion of an endogenous interrupting sequence=KA);

    [0962] L3/L3;KA/KA=as L2/L2;KA/KA but supplemented by a third human lambda variable region DNA insertion 5′ of the second lambda DNA insertion in the endogenous lambda loci such that the following human lambda gene segments are inserted between 3′ most endogenous Jλ and the mouse Cλ: human V gene segments Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3 and Vλ3-1, human J and C gene segments Jλ1-Cλ1, Jλ2-Cλ2, Jλ3-Cλ3, Jλ6-Cλ6 and Jλ7-Cλ7 (non-functional segments Jλ4-Cλ4, Jλ5-Cλ5 were also included), thus providing an insertion corresponding to coordinates 22886217 to 23327884 of human chromosome 22 inserted immediately after position 19047551 on mouse chromosome 16;

    [0963] S3F/HA;KA/KA;L3/L3=first endogenous heavy chain allele has three human heavy chain variable region DNA insertions between the 3′ most endogenous J.sub.H and the E.sub.μ, providing insertion of human gene segments V.sub.H2-26, V.sub.H1-24, V.sub.H3-23, V.sub.H3-21, V.sub.H3-20, VH1-18, V.sub.H.sup.3-15, VH3-13, V.sub.H.sup.3-11, VH3-9, VH1-8, VH3-7, V.sub.H.sup.2-5, VH7-4-1, VH4-4, VH1-3, V.sub.H1-2, V.sub.H6-1, D1-1, D2-2, D3-9, D3-10, D4-11, D5-12, D6-13, D1-14, D2-15, D3-16, D4-17, D5-18, D6-19, D1-20, D2-21, D3-22, D4-23, D5-24, D6-25, D1-26, D7-27, J.sub.H1, J.sub.H2, J.sub.H3, J.sub.H4, J.sub.H5 and J.sub.H6 (in the order: human V gene segments, human D gene segments and human J gene segments); the endogenous heavy chain VDJ sequence has been inactivated by inversion and movement upstream on the chromosome; and the endogenous lambda loci are left intact; the second endogenous heavy chain allele has been inactivated by insertion of an endogenous interrupting sequence=HA); the endogenous kappa alleles have been inactivated (=KA/KA); and the endogenous lambda alleles have been modified by insertion of human lambda variable region DNA (=L3/L3);

    [0964] P2/WT=P2 allele (human lambda variable region DNA as described in Example 1) at one endogenous kappa locus; the other endogenous kappa locus left intact; both endogenous lambda loci left intact;

    [0965] P2/P2=see Example 14; both endogenous lambda loci left intact;

    [0966] P2/K2=P2 allele at one endogenous kappa locus; the other endogenous kappa locus having two DNA insertions between the 3′ most endogenous Jκ and the mouse Cκ, providing insertion of human V gene segments Vκ2-24, Vκ3-20, Vκ1-17, Vκ1-16, Vκ3-15, Vκ1-13, Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8, Vκ1-6, Vκ1-5, Vκ5-2 and Vκ4-1 and human J gene segments Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5 (the human V gene segments being 5′ of the human J gene segments); both endogenous lambda loci left intact;

    [0967] P3/K3F=as one endogenous kappa locus having an insertion between the following human lambda gene segments are inserted between the 3′ most endogenous Jκ and the mouse Cκ, providing insertion of human V gene segments Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3 and Vλ3-1, human J and C gene segments Jλ1-Cλ1, Jλ2-Cλ2, Jλ3-Cλ3, Jλ6-Cλ6 and Jλ7-Cλ7 (non functional segments Jλ4-Cλ4, JAS-CAS were also included), thus providing an insertion corresponding to coordinates 22886217 to 23327884 of human chromosome 22 inserted immediately after position 70674755 on mouse chromosome 6; the other endogenous kappa locus having the K3F allele described above (human V and J kappa gene segments inserted); both endogenous lambda loci left intact;

    [0968] P2/P2; L2/WT=As P2/P2 but wherein one endogenous lambda locus has the L2 allele (human lambda V and J gene segments inserted) and the other endogenous lambda locus is wild-type; and

    [0969] P2/P2; L2/L2=homozygous for P2 and L2 alleles at endogenous kappa and lambda loci respectively.

    [0970] FACS analysis of splenic B-cells (as described above) was carried out and proportions of light chain expression were determined. We also determined the proportions of T1, T2 and mature (M) splenic B-cells and compared with wild-type mice, in order to assess whether or not we obtained normal splenic B-cell compartments in the transgenic mice. The results are shown in Tables 20 and 21. We also assessed the proportion of B220 positive cells as an indication of the proportion of B-cells in the splenic cell samples.

    TABLE-US-00020 TABLE 20 Comparisons With Mice With Human Lambda Variable Region Inserts At Endogenous Lambda Locus IGL percentage 1.1 1.2 Splenic B-cell compartment Genotype B220 mIGκ mIGλ 1.3 hIGλ T1 T2 M WT/WT (n = 2)   20% .sup. 90% 3.80% 1.4 1.5 16% 1.6 16.5 1.7 57.50%   KA/KA (n = 2) 13.60% 0.28% 68.50%  1.8  0% 1.9 33% 1.10    9% 1.11 41% K3F/K3F (n = 2)   20% .sup. 83%   7% 1.12 1.13 16% 1.14 15.50% 1.15 58% L2/L2 (n = 2) 17.80% 91.60%  1.60% 1.16 6.50%.sup.  1.17 21.50%   1.18   10% 1.19 50% L2/L2; KA/KA  9.10%   0%   5% 1.20 93% 1.21 28% 1.22    7% 1.23 44% (n = 1) L3/L3; KA/KA 16.90% 0.10% 4.50% 1.24 93.20%   1.25 17.40%   1.26 13.10% 1.27 53.90%   (n = 2) S3F/HA; KA/K;   19% 0.20% 3.80% 1.28 98% 1.29 15.50%   1.30   19% 1.31 53.20%   L3/L3 (n = 1)

    TABLE-US-00021 TABLE 21 Mice With Human Lambda Variable Region Inserts At Endogenous Kappa Locus IGL Percentage Splenic B-cell compartment Genotype B220 1.1 mIGκ 1.2 mIGλ 1.3 hIGλ T1 T2 M P2/WT (n = 2) N.D .sup. 90% 4.20% 1.4  6.55% 1.5 17.30% 1.6  8.90% 1.7 52.50% P2/P2 (n = 2) 14.80% 0.20% .sup. 15% 1.8   76% 1.9 27.50% 1.10   12% 1.11   42% P2/K2 (n = 2) 18.20% 78.80%  7.90% 1.12 15.60% 1.13 19.50% 1.114   12% 1.15   50% P3/K3F (n = 2) 18.40% 64.80%  11.60%  1.16 19.40% 1.17 11.80% 1.118 18.40% 1.19 56.10% P2/P2; L2/WT 20.40% 0.05% 8.50% 1.20   94% 1.21 13.10% 1.122 16.10% 1.23 59.90% (n = 2) P2/P2; L2/L2 12.70% 0.07% 5.10% 1.24 95.40% 1.25 13.40% 1.126 13.80% 1.27 57.30% (n = 2)

    Conclusions

    [0971] As demonstrated by L2/L2;KA/KA and L3/L3;KA/KA, the human lambda variable region DNA insertions at the endogenous lambda locus (with an endogenous kappa knockout) displayed predominate expression of light chains bearing human lambda variable regions (indicated by the expression of Cλ-positive chains at around 93%). This surprisingly occurs even though endogenous mouse lambda variable region DNA is still present, indicating that the inserted human lambda variable region DNA can outcompete endogenous IGA rearrangement.

    [0972] Furthermore, mice having the human V and J gene segments present in the homozygous L3 insertion produce B-cells (B220 positive cells) at a proportion that is similar to wild-type and additionally produce a normal proportion or percentage of mature splenic B-cells (i.e., similar to wild-type). This is confirmed not only by the L3/L3;KA/KA mice, but also was observed for S3F/HA;KA/KA;L3/L3, which also comprises a chimaeric (human-mouse) IgH locus.

    [0973] Also, we observed that mice having the human V and J gene segments present in the homozygous K3F insertion produce B-cells (B220 positive cells) at a proportion that is similar to wild-type and additionally produce a normal proportion or percentage of mature splenic B-cells (i.e., similar to wild-type).

    [0974] Mice having the human V and J gene segments present in the homozygous P2 insertion at the endogenous kappa locus showed high expression of light chains comprising human lambda variable regions (as indicated by an observed proportion of 76%). We could skew to an even higher percentage overall by combining insertion of human lambda V and J gene segments at both the endogenous kappa and lambda loci (see P2/P2; L2/WT at around 94% and P2/P2; L2/L2 at around 95%). Furthermore, mice comprising the human V and J gene segment arrangement of P2/P2; L2/L2 produce a normal proportion or percentage of mature splenic B-cells (i.e., similar to wild-type).

    [0975] When human lambda V and J gene segments were inserted at one endogenous kappa locus and the other endogenous kappa locus comprised an insertion of human kappa V and J gene segments, we obtained mice that could express light chains comprising lambda variable regions and also light chains comprising kappa variable regions. Surprisingly observed that we could raise the proportion of light chains comprising lambda variable regions above that seen in a wild-type mouse where only 5% or less of light chains typically comprise lambda variable regions. We observed a proportion of around 22% for the P2/K2 genotype and around 31% for the P3/K3F genotype. The proportion observed with the latter genotype approximates that seen in a human where typically around 60% of light chains comprise kappa variable regions and around 40% of light chains comprise lambda variable regions. Also in the P2/K2 and P3/K3F cases, the mice produced a normal proportion of B-cells as compared with wild-type mice. Furthermore, mice comprising the human V and J gene segment arrangement of P3/K3F produce a normal proportion or percentage of mature splenic B-cells (i.e., similar to wild-type).

    Example 5

    [0976] Mouse were generated that comprised the specific IgH alleles listed in Table 3; and the specific IgL alleles listed in Tables 10 or 11. Mice were immunised with target antigens and antigen-specific antibodies were isolated. Antibodies were assessed for binding specificity, maturation (i.e., extent of junctional and somatic mutation versus germline gene segment sequences) and binding kinetics. Corresponding B-cells were also obtained and in some cases hybridomas produced that express the selected antibodies.

    [0977] Selected antibodies are summarised in Table 22. Binding kinetics of some of these were determined as follows.

    Binding Kinetics Determination

    [0978] An anti-mouse IgG capture surface was created on a GLM Biosensor™ chip by primary amine coupling using GE Healthcare anti-mouse IgG (BR-1008-38). Test antibodies as set out in Table 22 were captured on this surface and the respective antigen was passed over the captured Ab at the concentrations indicated. An injection of buffer (i.e. 0 nM of antigen) was used to double reference the binding curves, and the data was fitted to the 1:1 model inherent to the ProteOn XPR36™ analysis software. Regeneration of the capture surface was carried out using 10 mM glycine, pH1.7. The assay was run at 25° C. and using HBS-EP as running buffer.

    [0979] Target 1: a multi-subunit human protein

    [0980] Target 2: a bacterial cytotoxin

    [0981] Target 3: a different multi-subunit human protein

    [0982] Target 4: a protein expressed as a transmembrane protein on human cells

    Target 1 mAb1.1

    [0983] Single concentration TARGET 1 (256 nM), anti-mouse capture

    TABLE-US-00022 ka kd KD 3.85E+05 3.22E−05 83 pM

    [0984] (Apparent affinity since multi-subunit target)

    Target 2 mAb2.1

    [0985] TARGET 2 at 256, 64, 16, 4 and 1 nM; results of 3 experiments:—

    [0986] Experiment 1:

    TABLE-US-00023 ka kd KD 1.40E+04 1.83E−05 1.300 nM

    [0987] Experiment 2:

    TABLE-US-00024 ka kd KD 2.76E+04 3.23E−05 1.170

    [0988] Experiment 3:

    [0989] Couldn't resolve off-rate—indicating extremely tight binding beyond detectable limits.

    Target 3 mAb3.1

    [0990] TARGET 3 at 256, 64, 16, 4 and 1 nM

    TABLE-US-00025 ka kd KD 4.00E+05 2.34E−04 0.59 nM

    [0991] (Apparent affinity since multi-subunit target)

    Target 3 mAb3.2

    [0992] TARGET 3 at 256, 64, 16, 4 and 1 nM

    TABLE-US-00026 ka kd KD 3.86E+05 2.57E−04 0.67

    [0993] (Apparent affinity since multi-subunit target)

    [0994] Target 3 mAb3.3

    [0995] TARGET 3 at 256, 64, 16, 4 and 1 nM

    [0996] Unable to resolve Off-rate, extremely tight binding

    [0997] (Apparent affinity since multi-subunit target)

    [0998] In conclusion, the present invention provides for in vivo affinity-matured antibodies with human variable domains that can expressed in in vivo systems, and specifically bind target antigens with very good affinities, on and off-rates. The invention thus provides for antibodies that are useful for human medicine, as well as non-human vertebrates, cells (e.g., B-cells and hybridomas) for producing such antibodies.

    Example 6

    [0999] The S (heavy), K(kappa into kappa locus), L (lambda into lambda locus) and P (lambda into kappa locus) lines used to generate the data in the examples used the alleles of Tables 1 to 18 and demonstrated that such collections of alleles can produce the surprising results shown (e.g., good B cell compartments, high human lambda V region expression, desirable lambda:kappa ratio in a mouse and normal repertoire of IgH isotypes). The isolated antibodies were all based on the alleles listed in Table 1 to 18 above. All had V domains with mouse AID and TdT pattern mutation.

    Other Embodiments

    [1000] From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

    [1001] The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

    [1002] All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

    TABLE-US-00027 TABLE 22 Hybridoma Sequences knon- nonGerm- AAMuta- Germ- v d j .sup.1.28 lineAA.sup.1 .sup.1.29 tions.sup.2 1.30 kv 1.31 kj .sup.1.32 lineAA.sup.1 .sup.1.33 TARGET 1: mAb1.1 IGHV7- IGHD3- IGHJ6*02 1.34 2 1.35 0 1.36 IGKV2- 1.37 IGK 1.38 0 1.39 0 4-1*01 16*02 28*01 J4*1 mAb1.2 IGHV4- IGHD3- IGHJ6*02 1.40 3 1.41 0 1.42 IGKV1D- 1.43 IGK 1.44 0 1.42 0 4*02 10*01 13*d01 J4*1 TARGET 2: mAb2.1 IGHV1- IGHD3- IGHJ6*02 1.46 6 1.47 9 1.48 IGKV1- 1.49 IGK 1.50 1 3*01 10*01 12*01 J4*1 TARGET 3: mAb3.1 IGHV3- IGHD3- IGHJ6*02 1.52 3 1.53 5 1.54 IGKV1D- 1.55 IGK 1.56 0 13*01 9*01 12*02 J4*1 mAb3.2 IGHV3- IGHD3- IGHJ6*02 1.58 3 1.59 5 1.60 IGKV1D- 1.61 IGK 1.62 0 13*01 9*01 12*02 J4*1 mAb3.3 IGHV4- IGHD3- IGHJ6*02 1.64 2 1.65 7 1.66 IGKV1D- 1.67 IGK 1.68 3 4*02 10*01 13*d01 J4*1 BcellTech Sequences TARGET 1: knon- nonGerm- AAMuta- Germ- id v d j .sup.1.70 lineAA.sup.1 .sup.1.71 tions.sup.2 1.72 kv 1.73 kj .sup.1.74 lineAA.sup.1 mAb1.3 IGHV3- IGHD3- IGHJ6*02 1.76 5 1.77 0 1.78 IGKV3- 1.79 IGKJ4*1 1.80 0 13*01 10*01 20*01 TARGET 3: knon- nonGerm- AAMuta- Germ- id v d j .sup.1.82 lineAA.sup.1 .sup.1.83 tions.sup.2 1.84 kv 1.85 kj .sup.1.86 lineAA.sup.1 mAb3.4 IGHV3- IGHD3- IGHJ6*02 1.88 9 1.89 8 1.90 IGKV1- 1.91 IGKJ4*1 1.92 1 23*04 22*01 17*01 mAb3.5 IGHV3- IGHD3- IGHJ6*02 1.94 10 1.95 5 1.96 IGKV1- 1.97 IGKJ4*1 1.98 1 23*04 22*01 17*01 mAb3.6 IGHV3- IGHD3- IGHJ6*02 1.100 6 1.101 2 1.102 IGKV1D- 1.103 IGKJ4*1 1.104 2 7*01 9*01 39*01 mAb3.7 IGHV3- IGHD3- IGHJ6*02 1.106 9 1.107 5 1.108 IGKV1- 1.109 IGKJ4*1 1.110 1 23*04 22*01 17*01 mAb3.8 IGHV3- IGHD3- IGHJ6*02 1.112 7 1.113 6 1.114 IGKV1D- 1.115 IGKJ4*1 1.116 2 13*01 10*01 39*01 mAb3.9 IGHV3- IGHD3- IGHJ6*02 1.118 3 1.119 3 1.120 IGKV3- 1.121 IGKJ4*1 1.122 0 13*01 10*01 11*01 TARGET 4: knon- nonGerm- AAMuta- Germ- id v d j .sup.1.124 lineAA.sup.1 .sup.1.125 tions.sup.2 1.126 kv 1.27 kj .sup.1.128 lineAA.sup.1 mAb4.1 IGHV4- IGHD3- IGHJ6*02 1.130 7 1.131 7 1.132 IGKV1D- 1.133 IGKJ4*1 1.134 1 4*02 9*01 16*01 mAb4.2 IGHV3- IGHD3- IGHJ6*02 1.136 6 1.137 4 1.138 IGKV1- 1.139 IGKJ4*1 1.140 1 20*d01 10*01 9*d01 [All gene segments are human] .sup.1nonGermlineAA: number of non-germline amino acids introduced into VH-D or D-JH junctions or into VL-JL junctions .sup.2AAMutations: number of AA mutations in V and J region (CDRH3 or CDRL3 region exciuded)

    [1003] Sequences for examples of gene segments in accordance with the invention are set out below.

    TABLE-US-00028 IGLC7*01 ggtcagcccaaggctgccccctcggtcactctgtt cccaccctcctctgaggagcttcaagccaacaagg ccacactggtgtgtctcgtaagtgacttctacccg ggagccgtgacagtggcctggaaggcagatggcag ccccgtcaaggtgggagtggagaccaccaaaccct ccaaacaaagcaacaacaagtatgcggccagcagc tacctgagcctgacgcccgagcagtggaagtccca cagaagctacagctgccgggtcacgcatgaaggga gcaccgtggagaagacagtggcccctgcagaatgc tct IGLJ7*01 tgctgtgttcggaggaggcacccagctgaccgtcc tcg IGLC6*01 ggtcagcccaaggctgccccatcggtcactctgtt cccgccctcctctgaggagcttcaagccaacaagg ccacactggtgtgcctgatcagtgacttctacccg ggagctgtgaaagtggcctggaaggcagatggcag ccccgtcaacacgggagtggagaccaccacaccct ccaaacagagcaacaacaagtacgcggccagcagc tacctgagcctgacgcctgagcagtggaagtccca cagaagctacagctgccaggtcacgcatgaaggga gcaccgtggagaagacagtggcccctgcagaatgt tca IGLC6*04 gtcagcccaaggctgccccatcggtcactctgttc ccgccctcctctgaggagcttcaagccaacaaggc cacactggtgtgcctgatcagtgacttctacccgg gagctgtgaaagtggcctggaaggcagatggcagc cccgtcaacacgggagtggagaccaccacaccctc caaacagagcaacaacaagtacgcggccagcagct agctacctgagcctgacgcctgagcagtggaagtc ccacagaagctacagttgccaggtcacgcatgaag ggagcaccgtggagaagacagtggcccctgcagaa tgctct IGLJ6*01 taatgtgttcggcagtggcaccaaggtgaccgtcc tcg IGLC3*03 ggtcagcccaaggctgccccctcggtcactctgtt cccaccctcctctgaggagcttcaagccaacaagg ccacactggtgtgtctcataagtgacttctacccg ggagccgtgacagtggcctggaaggcagatagcag ccccgtcaaggcgggagtggagaccaccacaccct ccaaacaaagcaacaacaagtacgcggccagcagc tacctgagcctgacgcctgagcagtggaagtccca caaaagctacagctgccaggtcacgcatgaaggga gcaccgtggagaagacagtggcccctacagaatgt tca IGLJ3*02 ttgggtgttcggcggagggaccaagctgaccgtcc tag IGLC2*02 ggtcagcccaaggctgccccctcggtcactctgtt cccgccctcctctgaggagcttcaagccaacaagg ccacactggtgtgtctcataagtgacttctacccg ggagccgtgacagtggcctggaaggcagatagcag ccccgtcaaggcgggagtggagaccaccacaccct ccaaacaaagcaacaacaagtacgcggccagcagc tatctgagcctgacgcctgagcagtggaagtccca cagaagctacagctgccaggtcacgcatgaaggga gcaccgtggagaagacagtggcccctacagaatgt tca IGLJ2*01 tgtggtattcggcggagggaccaagctgaccgtcc tag IGLC1*02 ggtcagcccaaggccaaccccactgtcactctgtt cccgccctcctctgaggagctccaagccaacaagg ccacactagtgtgtctgatcagtgacttctacccg ggagctgtgacagtggcctggaaggcagatggcag ccccgtcaaggcgggagtggagaccaccaaaccct ccaaacagagcaacaacaagtacgcggccagcagc tacctgagcctgacgcccgagcagtggaagtccca cagaagctacagctgccaggtcacgcatgaaggga gcaccgtggagaagacagtggcccctacagaatgt tca IGLJ1*01 ttatgtcttcggaactgggaccaaggtcaccgtcc tag IGLV3-1*01 gatccgtggcctcctatgagctgactcagccaccc tcagtgtccgtgtccccaggacagacagccagcat cacctgctctggagataaattgggggataaatatg cttgctggtatcagcagaagccaggccagtcccct gtgctggtcatctatcaagatagcaagcggccctc agggatccctgagcgattctctggctccaactctg ggaacacagccactctgaccatcagcgggacccag gctatggatgaggctgactattactgtcaggcgtg ggacagcagcactgca IGLV4-3*01 ctgcctgtgctgactcagcccccgtctgcatctgc cttgctgggagcctcgatcaagctcacctgcaccc taagcagtgagcacagcacctacaccatcgaatgg tatcaacagagaccagggaggtccccccagtatat aatgaaggttaagagtgatggcagccacagcaagg gggacgggatccccgatcgcttcatgggctccagt tctggggctgaccgctacctcaccttctccaacct ccagtctgacgatgaggctgagtatcactgtggag agagccacacgattgatggccaagtcggttgagc IGLV2-8*01 cagtctgccctgactcagcctccctccgcgtccgg gtctcctggacagtcagtcaccatctcctgcactg gaaccagcagtgacgttggtggttataactatgtc tcctggtaccaacagcacccaggcaaagcccccaa actcatgatttatgaggtcagtaagcggccctcag gggtccctgatcgcttctctggctccaagtctggc aacacggcctccctgaccgtctctgggctccaggc tgaggatgaggctgattattactgcagctcatatg caggcagcaacaatttc IGLV3-9*01 tcctatgagctgactcagccactctcagtgtcagt ggccctgggacagacggccaggattacctgtgggg gaaacaacattggaagtaaaaatgtgcactggtac cagcagaagccaggccaggcccctgtgctggtcat ctatagggatagcaaccggccctctgggatccctg agcgattctctggctccaactcggggaacacggcc accctgaccatcagcagagcccaagccggggatga ggctgactattactgtcaggtgtgggacagcagca ctgca IGLV3-10*01 tcctatgagctgacacagccaccctcggtgtcagt gtccccaggacaaacggccaggatcacctgctctg gagatgcattgccaaaaaaatatgcttattggtac cagcagaagtcaggccaggcccctgtgctggtcat ctatgaggacagcaaacgaccctccgggatccctg agagattctctggctccagctcagggacaatggcc accttgactatcagtggggcccaggtggaggatga agctgactactactgttactcaacagacagcagtg gtaatcatag IGLV2-11*01 cagtctgccctgactcagcctcgctcagtgtccgg gtctcctggacagtcagtcaccatctcctgcactg gaaccagcagtgatgttggtggttataactatgtc tcctggtaccaacagcacccaggcaaagcccccaa actcatgatttatgatgtcagtaagcggccctcag gggtccctgatcgcttctctggctccaagtctggc aacacggcctccctgaccatctctgggctccaggc tgaggatgaggctgattattactgctgctcatatg caggcagctacactttc IGLV3-12*02 tcctatgagctgactcagccacactcagtgtcagt ggccacagcacagatggccaggatcacctgtgggg gaaacaacattggaagtaaagctgtgcactggtac cagcaaaagccaggccaggaccctgtgctggtcat ctatagcgatagcaaccggccctcagggatccctg agcgattctctggctccaacccagggaacaccgcc accctaaccatcagcaggatcgaggctggggatga ggctgactattactgtcaggtgtgggacagtagta gtgatcatcc IGLV2-14*01 cagtctgccctgactcagcctgcctccgtgtctgg gtctcctggacagtcgatcaccatctcctgcactg gaaccagcagtgacgttggtggttataactatgtc tcctggtaccaacagcacccaggcaaagcccccaa actcatgatttatgaggtcagtaatcggccctcag gggtttctaatcgcttctctggctccaagtctggc aacacggcctccctgaccatctctgggctccaggc tgaggacgaggctgattattactgcagctcatata caagcagcagcactctc IGLV3-16*01 tcctatgagctgacacagccaccctcggtgtcagt gtccctaggacagatggccaggatcacctgctctg gagaagcattgccaaaaaaatatgcttattggtac cagcagaagccaggccagttccctgtgctggtgat atataaagacagcgagaggccctcagggatccctg agcgattctctggctccagctcagggacaatagtc acattgaccatcagtggagtccaggcagaagacga ggctgactattactgtctatcagcagacagcagtg gtacttatcc IGLV2-18*01 cagtctgccctgactcagcctccctccgtgtccgg gtctcctggacagtcagtcaccatctcctgcactg gaaccagcagtgacgttggtagttataaccgtgtc tcctggtaccagcagcccccaggcacagcccccaa actcatgatttatgaggtcagtaatcggccctcag gggtccctgatcgcttctctgggtccaagtctggc aacacggcctccctgaccatctctgggctccaggc tgaggacgaggctgattattactgcagcttatata caagcagcagcactttc IGLV3-19*01 tcttctgagctgactcaggaccctgctgtgtctgt ggccttgggacagacagtcaggatcacatgccaag gagacagcctcagaagctattatgcaagctggtac cagcagaagccaggacaggcccctgtacttgtcat ctatggtaaaaacaaccggccctcagggatcccag accgattctctggctccagctcaggaaacacagct tccttgaccatcactggggctcaggcggaagatga ggctgactattactgtaactcccgggacagcagtg gtaaccatct IGLV3-21*01 tcctatgtgctgactcagccaccctcagtgtcagt ggccccaggaaagacggccaggattacctgtgggg gaaacaacattggaagtaaaagtgtgcactggtac cagcagaagccaggccaggcccctgtgctggtcat ctattatgatagcgaccggccctcagggatccctg agcgattctctggctccaactctgggaacacggcc accctgaccatcagcagggtcgaagccggggatga ggccgactattactgtcaggtgtgggacagtagta gtgatcatcc IGLV3-21*d01 tcctatgtgctgactcagccaccctcagtgtcagt ggccccaggaaagacggccaggattacctgtgggg gaaacaacattggaagtaaaagtgtgcactggtac cagcagaagccaggccaggcccctgtgctggtcat ctattatgatagcgaccggccctcagggatccctg agcgattctctggctccaactctgggaacacggcc accctgaccatcagcagggtcgaagccggggatga ggccgactattactgtcaggtgtgggatagtagta gtgatcatcc IGLV3-22*d01 tcctatgagctgacacagctaccctcggtgtcagt gtccccaggacagaaagccaggatcacctgctctg gagatgtactggggaaaaattatgctgactggtac cagcagaagccaggccaggtctgatatacgagttg gtgatatacgaagatagtgagcggtaccctggaat ccctgaacgattctctgggtccacctcagggaaca cgaccaccctgaccatcagcagggtcctgaccgaa gacgaggctgactattactgtttgtctgggaatga ggacaatcc IGLV3-22*01 tcctatgagctgacacagctaccctcggtgtcagt gtccccaggacagacagccaggatcacctgctctg gagatgtactgggggaaaattatgctgactggtac cagcagaagccaggccaggcccctgagttggtgat atacgaagatagtgagcggtaccctggaatccctg aacgattctctgggtccacctcagggaacacgacc accctgaccatcagcagggtcctgaccgaagacga ggctgactattactgtttgtctggggatgaggaca atcc IGLV2-23*d02 cagtctgccctgactcagcctgcctccgtgtctgg gtctcctggacagtcgatcaccatctcctgcactg gaaccagcagtgatgttggtggttataactatgtc tcctggtaccaacagcacccaggcaaagcccccaa actcatgatttatgatgtcagtaagcggccctcag gggtttctaatcgcttctctggctccaagtctggc aacacggcctccctgacaatctctgggctccaggc tgaggacgaggctgattattactgctgctcatatg caggtagtagcactttc IGLV2-23*02 cagtctgccctgactcagcctgcctccgtgtctgg gtctcctggacagtcgatcaccatctcctgcactg gaaccagcagtgatgttgggagttataaccttgtc tcctggtaccaacagcacccaggcaaagcccccaa actcatgatttatgaggtcagtaagcggccctcag gggtttctaatcgcttctctggctccaagtctggc aacacggcctccctgacaatctctgggctccaggc tgaggacgaggctgattattactgctgctcatatg caggtagtagcactttc IGLV3-25*d03 tcctatgagctgacacagccaccctcggtgtcagt gtccccaggacagacggccaggatcacctgctctg cagatgcattgccaaagcaatatgcttattggtac cagcagaagccaggccaggcccctgtgctggtgat atataaagacagtgagaggccctcagggatccctg agcgattctctggctccagctcagggacaacagtc acgttgaccatcagtggagtccaggcagaagacga ggctgactattactgtcaatcagcagacagcagt ggtacttatcc IGLV3-25*01 tcctatgagctgatgcagccaccctcggtgtcagt gtccccaggacagacggccaggatcacctgctctg gagatgcattgccaaagcaatatgcttattggtac cagcagaagccaggccaggcccctgtgctggtgat atataaagacagtgagaggccctcagggatccctg agcgattctctggctccagctcagggacaacagtc acgttgaccatcagtggagtccaggcagaagatga ggctgactattactgtcaatcagcagacagcagtg gtacttatcc IGLV3-27*01 tcctatgagctgacacagccatcctcagtgtcagt gtctccgggacagacagccaggatcacctgctcag gagatgtactggcaaaaaaatatgctcggtggttc cagcagaagccaggccaggcccctgtgctggtgat ttataaagacagtgagcggccctcagggatccctg agcgattctccggctccagctcagggaccacagtc accttgaccatcagcggggcccaggttgaggatga ggctgactattactgttactctgcggctgacaaca atct IGLV1-36*01|Homo sapiens cagtctgtgctgactcagccaccctcggtgtctga agcccccaggcagagggtcaccatctcctgttctg gaagcagctccaacatcggaaataatgctgtaaac tggtaccagcagctcccaggaaaggctcccaaact cctcatctattatgatgatctgctgccctcagggg tctctgaccgattctctggctccaagtctggcacc tcagcctccctggccatcagtgggctccagtctga ggatgaggctgattattactgtgcagcatgggatg acagcctgaatggtcc IGLV5-37*01|Homo sapiens cagcctgtgctgactcagccaccttcctcctccgc atctcctggagaatccgccagactcacctgcacct tgcccagtgacatcaatgttggtagctacaacata tactggtaccagcagaagccagggagccctcccag gtatctcctgtactactactcagactcagataagg gccagggctctggagtccccagccgcttctctgga tccaaagatgcttcagccaatacagggattttact catctccgggctccagtctgaggatgaggctgact attactgtatgatttggccaagcaatgcttct IGLV5-39*01|Homo sapiens cagcctgtgctgactcagccaacctccctctcagc atctcctggagcatcagccagattcacctgcacct tgcgcagtggcatcaatgttggtacctacaggata tactggtaccagcagaagccagggagtcttccccg gtatctcctgaggtacaaatcagactcagataagc agcagggctctggagtccccagccgcttctctgga tccaaagatgcttcaaccaatgcaggccttttact catctctgggctccagtctgaagatgaggctgact attactgtgccatttggtacagcag cacttct IGLV1-40*01|Homo sapiens cagtctgtgctgacgcagccgccctcagtgtctgg ggccccagggcagagggtcaccatctcctgcactg ggagcagctccaacatcggggcaggttatgatgta cactggtaccagcagcttccaggaacagcccccaa actcctcatctatggtaacagcaatcggccctcag gggtccctgaccgattctctggctccaagtctggc acctcagcctccctggccatcactgggctccaggc tgaggatgaggctgattattactgccagtcctatg acagcagcctgagtggttc >|IGLV7-43*01|Homo sapiens cagactgtggtgactcaggagccctcactgactgt gtccccaggagggacagtcactctcacctgtgctt ccagcactggagcagtcaccagtggttactatcca aactggttccagcagaaacctggacaagcacccag ggcactgatttatagtacaagcaacaaacactcct ggacccctgcccggttctcaggctccctccttggg ggcaaagctgccctgacactgtcaggtgtgcagcc tgaggacgaggctgagtattactgcctgctctact atggtggtgctcag >IGLV1-44*01|Homo sapiens cagtctgtgctgactcagccaccctcagcgtctgg gacccccgggcagagggtcaccatctcttgttctg gaagcagctccaacatcggaagtaatactgtaaac tggtaccagcagctcccaggaacggcccccaaact cctcatctatagtaataatcagcggccctcagggg tccctgaccgattctctggctccaagtctggcacc tcagcctccctggccatcagtgggctccagtctga ggatgaggctgattattactgtgcagcatgggatg acagcctgaatggtcc |IGLV5-45*03|Homo sapiens caggctgtgctgactcagccgtcttccctctctgc atctcctggagcatcagccagtctcacctgcacct tgcgcagtggcatcaatgttggtacctacaggata tactggtaccagcagaagccagggagtcctcccca gtatctcctgaggtacaaatcagactcagataagc agcagggctctggagtccccagccgcttctctgga tccaaagatgcttcggccaatgcagggattttact catctctgggctccagtctgaggatgaggctgact attactgtatgatttggcacagcagcgcttct >|IGLV7-46*01|Homo sapiens caggctgtggtgactcaggagccctcactgactgt gtccccaggagggacagtcactctcacctgtggct ccagcactggagctgtcaccagtggtcattatccc tactggttccagcagaagcctggccaagcccccag gacactgatttatgatacaagcaacaaacactcct ggacacctgcccggttctcaggctccctccttggg ggcaaagctgccctgaccctttcgggtgcgcagcc tgaggatgaggctgagtattactgcttgctctcct atagtggtgctcgg >|IGLV1-47*01|Homo sapiens cagtctgtgctgactcagccaccctcagcgtctgg gacccccgggcagagggtcaccatctcttgttctg gaagcagctccaacatcggaagtaattatgtatac tggtaccagcagctcccaggaacggcccccaaact cctcatctataggaataatcagcggccctcagggg tccctgaccgattctctggctccaagtctggcacc tcagcctccctggccatcagtgggctccggtccga ggatgaggctgattattactgtgcagcatgggatg acagcctgagtggtcc >|IGLV9-49*01 cagcctgtgctgactcagccaccttctgcatcagc ctccctgggagcctcggtcacactcacctgcaccc tgagcagcggctacagtaattataaagtggactgg taccagcagagaccagggaagggcccccggtttgt gatgcgagtgggcactggtgggattgtgggatcca agggggatggcatccctgatcgcttctcagtcttg ggctcaggcctgaatcggtacctgaccatcaagaa catccaggaagaggatgagagtgactaccactgtg gggcagaccatggcagtgggagcaacttcgtgtaa cc >|IGLV1-51*01 cagtctgtgttgacgcagccgccctcagtgtctgc ggccccaggacagaaggtcaccatctcctgctctg gaagcagctccaacattgggaataattatgtatcc tggtaccagcagctcccaggaacagcccccaaact cctcatttatgacaataataagcgaccctcaggga ttcctgaccgattctctggctccaagtctggcacg tcagccaccctgggcatcaccggactccagactgg ggacgaggccgattattactgcggaacatgggata gcagcctgagtgctgg >|IGLV5-52*01 cagcctgtgctgactcagccatcttcccattctgc atcttctggagcatcagtcagactcacctgcatgc tgagcagtggcttcagtgttggggacttctggata aggtggtaccaacaaaagccagggaaccctccccg gtatctcctgtactaccactcagactccaataagg gccaaggctctggagttcccagccgcttctctgga tccaacgatgcatcagccaatgcagggattctgcg tatctctgggctccagcctgaggatgaggctgact attactgtggtacatggcacagcaactctaagact ca >|IGLV10-54*02 caggcagggctgactcagccaccctcggtgtccaa gggcttgagacagaccgccacactcacctgcactg ggaacagcaacattgttggcaaccaaggagcagct tggctgcagcagcaccagggccaccctcccaaact cctatcctacaggaataacaaccggccctcaggga tctcagagagattctctgcatccaggtcaggaaac acagcctccctgaccattactggactccagcctga ggacgaggctgactattactgctcagcattggaca gcagcctcagtgctca >|IGLV6-57*01 aattttatgctgactcagccccactctgtgtcgga gtctccggggaagacggtaaccatctcctgcaccc gcagcagtggcagcattgccagcaactatgtgcag tggtaccagcagcgcccgggcagttcccccaccac tgtgatctatgaggataaccaaagaccctctgggg tccctgatcggttctctggctccatcgacagctcc tccaactctgcctccctcaccatctctggactgaa gactgaggacgaggctgactactactgtcagtctt atgatagcagcaatca >|IGLV4-60*d03 cagcctgtgctgactcaatcatcctctgcctctgc ttccctgggatcctcggtcaagctcacctgcactc tgagcagtgggcacagtagctacatcatcgcatgg catcagcagcagccagggaaggcccctcggtactt gatgaagcttgaaggtagtggaagctacaacaagg ggagcggagttcctgatcgcttctcaggctccagc tctgtggctgaccgctacctcaccatctccaacct ccagtctgaggatgaggctgattattactgtgaga cctgggacagtaacactca >other|IGLV4-60*03 cagcctgtgctgactcaatcatcctctgcctctgc ttccctgggatcctcggtcaagctcacctgcactc tgagcagtgggcacagtagctacatcatcgcatgg catcagcagcagccagggaaggcccctcggtactt gatgaagcttgaaggtagtggaagctacaacaagg ggagcggagttcctgatcgcttctcaggctccagc tctggggctgaccgctacctcaccatctccaacct ccagtctgaggatgaggctgattattactgtgaga cctgggacagtaacaCt >|IGLV8-61*01 cagactgtggtgacccaggagccatcgttctcagt gtcccctggagggacagtcacactcacttgtggct tgagctctggctcagtctctactagttactacccc agctggtaccagcagaccccaggccaggctccacg cacgctcatctacagcacaaacactcgctcttctg gggtccctgatcgcttctctggctccatccttggg aacaaagctgccctcaccatcacgggggcccaggc agatgatgaatctgattattactgtgtgctgtata tgggtagtggcatttc >|IGLV4-69*01 cagcttgtgctgactcaatcgccctctgcctctgc ctccctgggagcctcggtcaagctcacctgcactc tgagcagtgggcacagcagctacgccatcgcatgg catcagcagcagccagagaagggccctcggtactt gatgaagcttaacagtgatggcagccacagcaagg gggacgggatccctgatcgcttctcaggctccagc tctggggctgagcgctacctcaccatctccagcct ccagtctgaggatgaggctgactattactgtcaga cctggggcactggcattca >|IGHV3-20*d01 gaggtgcagctggtggagtctgggggaggtgtggt acggcctggggggtccctgagactctcctgtgcag cctctggattcacctttgatgattatggcatgagc tgggtccgccaagctccagggaaggggctggagtg ggtctctggtattaattggaatggtggtagcacag gttatgcagactctgtgaagggccgattcaccatc tccagagacaacgccaagaactccctgtatctgca aatgaacagtctgagagccgaggacacggccttgt attactgtgcgagaga >|IGHV1-24*d01 caggtccagctggtacagtctggggctgaggtgaa gaagcctggggcctcagtgaaggtctcctgcaagg tttccggatacaccctcactgaattatccatgcac tgggtgcgacaggctcctggaaaagggcttgagtg gatgggaggttttgatcctgaagatggtgaaacaa tctacgcacagaagttccagggcagagtcaccatg accgaggacacatctacagacacagcctacatgga cctgagcagcctgagatctgaggacacggccgtgt attactgtgcaacaga >|IGHV2-26*d01 caggtcaccttgaaggagtctggtcctgtgctggt gaaacccacagagaccctcacgctgacctgcaccg tctctgggttctcactcagcaatgctagaatgggt gtgagctggatccatcagcccccagggaaggccct ggagtggcttgcacacattttttcgaatgacgaaa aatcctacagcacatctctgaagagcaggctcacc atctccaaggacacctccaaaagccaggtggtcct taccatgaccaatatggaccctgtggacacagcca catattactgtgcacggatac >|IGKV5-2*d01 gaaacgacactcacgcagtctccagcattcatgtc agcgactccaggagacaaagtcaacatctcctgca aagccagccaagacattgatgatgatatgaactgg taccaacagaaaccaggagaagctgctattttcat tattcaagaagctactactctcgttcctggaatct cacctcgattcagtggcagcgggtatggaacagat tttaccctcacaattaataacatagaatctgagga tgctgcatattacttctgtctacaacatgataatt tccctct >|IGKV1-9*d01 gacatccagttgacccagtctccatccttcctgtc tgcatctgtaggagacagagtcaccatcacttgct gggccagtcagggcattagcagttatttagcctgg tatcagcaaaaaccagggaaagcccctaagctcct gatctatgctgcatccactttgcaaagtggggtcc catcaaggttcagcggcagtggatctgggacagaa ttcactctcacaatcagcagcctgcagcctgaaga ttttgcaacttattactgtcaacagcttaatagtt accctcc >|IGKV1 D-8*d01 gccatctggatgacccagtctccatccttactctc tgcatctacaggagacagagtcaccatcagttgtc ggatgagtcagggcattagcagttatttagcctgg tatcagcaaaaaccagggaaagcccctgagctcct gatctatgctgcatccactttgcaaagtggggtcc catcaaggttcagtggcagtggatctgggacagat ttcactctcaccatcagctgcctgcagtctgaaga ttttgcaacttattactgtcaacagtattatagtt tccctcc >|IGKV3D-11*d01 gaaattgtgttgacacagtctccagccaccctgtc tttgtctccaggggaaagagccaccctctcctgca gggccagtcagagtgttagcagctacttagcctgg taccagcagaaacctggccaggctcccaggctcct catctatgatgcatccaacagggccactggcatcc cagccaggttcagtggcagtgggcctgggacagac ttcactctcaccatcagcagcctagagcctgaaga ttttgcagtttattactgtcagcagcgtagcaact ggcatcc >|IGKV1 D-13*d01 gccatccagttgacccagtctccatcctccctgtc tgcatctgtaggagacagagtcaccatcacttgcc gggcaagtcagggcattagcagtgctttagcctgg tatcagcagaaaccagggaaagctcctaagctcct gatctatgatgcctccagtttggaaagtggggtcc catcaaggttcagcggcagtggatctgggacagat ttcactctcaccatcagcagcctgcagcctgaaga ttttgcaacttattactgtcaacagtttaatagtt accctca >|IGKV3D-15*d01 gaaatagtgatgacgcagtctccagccaccctgtc tgtgtctccaggggaaagagccaccctctcctgca gggccagtcagagtgttagcagcaacttagcctgg taccagcagaaacctggccaggctcccaggctcct catctatggtgcatccatcagggccactggcatcc cagccaggttcagtggcagtgggtctgggacagag ttcactctcaccatcagcatcctgcagtctgaaga ttttgcagtttattactgtcagcagtataataact ggcctcctcc >|IGKV2D-26*d01 gagattgtgatgacccagactccactctccttgtc tatcacccctggagagcaggcctccatgtcctgca ggtctagtcagagcctcctgcatagtgatggatac acctatttgtattggtttctgcagaaagccaggcc agtctccacgctcctgatctatgaagtttccaacc ggttctctggagtgccagataggttcagtggcagc gggtcagggacagatttcacactgaaaatcagccg ggtggaggctgaggattttggagtttattactgca tgcaagatgcacaagatcctcc >V.sub.K2D-26*d02 V region sequence: gagattgtgatgacccagactccactctccttgtc tatcacccctggagagcaggcctccatgtcctgca ggtctagtcagagcctcctgcatagtgatggatac acctatttgtattggtttctgcagaaagccaggcc agtctccacgctcctgatctatgaagtttccaacc ggttctctggagtgccagataggttcagtggcagc gggtcagggacagatttcacactgaaaatcagccg ggtggaggctgaggattttggagtttattactgca tgcaagatgcacaagatcctcc >|IGKV2D-28*d01 gatattgtgatgactcagcctccactctccctgcc cgtcacccctggagagccggcctccatctcctgca ggtctagtcagagcctcctgcatagtaatggatac aactatttggattggtacctgcagaagccagggca gtctccacagctcctgatctatttgggttctaatc gggcctccggggtccctgacaggttcagtggcagt ggatcaggcacagattttacactgaaaatcagcag agtggaggctgaggatgttggggtttattactgca tgcaagctctacaaactcctcc