Genetically encoded tyrosine sulfation of proteins in eukaryotes
12435327 ยท 2025-10-07
Assignee
Inventors
Cpc classification
International classification
Abstract
An engineered tyrosyl-tRNA synthetase/tRNA pair that co-translationally incorporates O-sulfotyrosine in response to UAG codons in E. coli and mammalian cells is described herein. This platform enables recombinant expression of eukaryotic proteins homogeneously sulfated at chosen sites.
Claims
1. A composition comprising a variant E. coli tyrosyl-tRNA synthetase (EcTyr-RS) wherein the variant EcTyr-RS preferentially aminoacylates an E. coli tyrosyl-tRNA (EctRNA.sup.tyr) with a sulfotyrosine analog over the naturally-occurring tyrosine amino acid, wherein the variant EcTyr-RS comprises an amino acid sequence selected from the group consisting of: SEQ ID NOS: 4-9.
2. The composition of claim 1, wherein the sulfotyrosyl analog is O-sulfotyrosine.
3. A cell comprising a variant E. coli tyrosyl tRNA synthetase (EcTyr-RS), wherein the variant EcTyr-RS preferentially aminoacylates an E. coli tyrosyl tRNA with a sulfotyrosine analog over the naturally-occurring tyrosine amino acid, and an orthogonal E. coli tyrosyl tRNA (Ec-tRNA.sup.Tyr) as a pair, wherein the variant EcTyr-RS comprises an amino acid sequence selected from the group consisting of: SEQ ID NOS: 4-9.
4. The cell of claim 3, wherein the Ec-tRNA.sup.Tyr comprises the polynucleotide sequence SEQ ID NO: 10, wherein the tRNA has an anti-codon loop comprising a sequence that specifically binds to a selector sequence of an mRNA, wherein the selector is an amber codon.
5. The cell of claim 3, wherein the cell is an E. coli cell or a eukaryotic cell.
6. The cell of claim 5, wherein the eukaryotic cell is a mammalian cell.
7. The E. coli cell of claim 5, wherein the E. coli is the ATMY4 strain of E. coli cell.
8. A kit for producing a protein or peptide of interest in a cell, wherein the protein or peptide comprises one, or more sulfotyrosine analogs, the kit comprising: a. a container containing a polynucleotide sequence encoding an Ec-tRNA.sup.Tyr that recognizes an amber selector codon in a nucleic acid of interest in the cell; and b. a container containing a variant E. coli tyrosyl tRNA synthetase that preferentially aminoacylates the Ec-tRNA.sup.Tyr with a sulfotyrosyl analog, wherein the EcTry-RS comprises an amino acid sequence selected from the group consisting of: SEQ ID NOS: 4-9.
9. The kit of claim 8, wherein the kit further comprises one, or more, sulfotyrosyl analogs.
10. The kit of claim 9, wherein the sulfotyrosyl analog is O-sulfotyrosine.
11. A method of site-specifically incorporating one, or more, suflotyrosine residues into a protein or peptide produced in a cell, the method comprising, a. culturing the cell in a culture medium under conditions suitable for growth, wherein the cell comprises a nucleotide sequence that encodes a protein or peptide of interest with one, or more, amber selector codons at specific sites in the protein or peptide, wherein the cell also comprises a nucleotide sequence encoding an Ec-tRNA.sup.tyr that recognizes the amber selector codon, and wherein the cell further comprises a nucleotide sequence encoding a variant E. coli tyrosyl-tRNA synthetase of claim 2, and b. contacting the cell culture medium with one, or more, sulfotyrosine amino acid residues under conditions suitable for incorporation of the one, or more, sulfotyrosine residues into the protein or peptide at the sites of the selector codon(s), thereby producing the protein or peptide of interest with one, or more site-specifically incorporated sulfotyrosine residues.
12. The method of claim 11, wherein the E. coli tyrosyl tRNA nucleotide sequence comprises SEQ ID NO: 10.
13. The method of claim 11, wherein the sulfotyrosine analog is O-sulfotyrosine.
14. The method of claim 11, wherein the cell is an E. coli cell or a eukaryotic cell.
15. The method of claim 14, wherein the cell is a mammalian cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) In the accompanying drawings, reference characters refer to the same parts throughout the different views. The drawings are not necessarily to scale; emphasis has instead been placed upon illustrating the principles of the invention. Of the drawings:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(19) The genetic code expansion technology offers an elegant solution to challenges of producing sulfonated proteins by enabling co-translation site-specific incorporation of modified amino acid residues such as O-sulfatyrosine (sTyr) in response to a repurposed nonsense codon (
(20) The E. coli derived tyrosyl-tRNA synthetase (EcTyrRS)/tRNA pair represents a promising platform to this end, as it has already been established for ncAA mutagenesis in eukaryotes. However, the repertoire of ncAAs genetically encoded using this platform has been significantly limited relative to its M. jannaschii derived counterpart (
(21) A library of EcTyrRS mutants encoded in the pBK vector (pBK-EcYRS1) was constructed by randomizing six active site residues (Y37 to FLIMVSTAYHCG (SEQ ID NO: 2), L71 to NBT, N126 to NSPTACGDH (SEQ ID NO: 3), D182 to NST, F183 to NNK, L186 to NNK) surrounding the phenolic hydroxyl of the bound tyrosine substrate (
(22) To evaluate the sulfotyrosine incorporation efficiency of the EcTyrRS mutants the VGL and VGM (SEQ ID NO. 4 and 5, respectively) variants were were individually co-transformed (encoded in the pBK plasmid) with a pEvolT5-sfGFP-151-TAG reporter plasmid in ATMY4 E. coli strain (encodes two genomic copies of tRNAEcTyrCUA). These cells expressed sfGFP only in the presence of sTyr upon induction with IPTG (
(23) Next, it was explored if these mutant EcTyrRS/tRNA pairs can be used in mammalian cells for co-translational sTyr incorporation. A mammalian expression plasmid pB1U-Sulfo-16xtYR-TAG was created that expresses the VGL or the VGM EcTyrRS as well as 16 copies of the tRNA.sup.EcTyr.sub.CUA. Co-transfection of this plasmids with pAcBac1-EGFP-39-TAG led to robust expression of EGFP in the presence of sTyr, while significantly reduced reporter expression was observed in its absence (
(24) The platform of the present invention should allow facile expression of native eukaryotic proteins homogeneously sulfated at native sites. The present invention sought to demonstrate this using human heparin cofactor II (HCII) as a model system. HCII, a large secreted glycoprotein, is a serine protease inhibitor (serpin) that irreversibly inhibits thrombin, a key player in executing blood coagulation. This anticoagulant activity of HCII is triggered by glycosaminoglycans (GAGs) such as heparin. In the absence of GAGs, the acidic N-terminal domain (AND) of HCII binds its glycosoaminoglycan binding domain (GBD), resulting in an auto-inhibited state (
(25) In addition to 60-sTyr-73-sTyr, we also expressed and purified HCII mutants 60-Phe-73-Phe (to prevent sulfation), 60-sTyr-73-Phe, and 60-Phe-73-sTyr (
(26) Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments and examples are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever
EXAMPLES
Materials and Methods
(27) General Biological Reagents, Strains, and Protocols
(28) Using E. coli strain DH10B (Life Technologies) was used for plasmid propagation and cloning. E. coli strains were cultured on LB-agar plates with appropriate antibiotic concentrations as follows: 95 g/mL spectinomycin, 50 g/mL chloramphenicol, 30 g/mL kanamycin. Phusion high fidelity DNA polymerase (Thermo-Fischer) was used for PCR amplifications and restriction enzymes were obtained from New England Biolabs. DNA oligonucleotides were purchased from Integrated DNA Technologies, while Sanger sequencing was performed by Eton Bio. Engineered E. coli strain ATMY3 (contains one genomic copy of tRNA.sup.EcTyr.sub.CUA; no genomic EcTyrRS) was used as the selection host for the directed evolution of EcTyrRS. Engineered E. coli strain ATMY4 (contains two genomic copies of tRNA.sup.EcTyr.sub.CUA; no genomic EcTyrRS) was used as the expression host for expressing recombinant proteins incorporating sTyr.
(29) HEK293T cell line was purchased from ATCC (ATCC CRL-3216) and maintained in DMEM (high glucose) supplemented with 10% FBS and Penicillin/Streptomycin. Cells were grown in a 37 C. 100% humidity, 5% CO.sub.2.
(30) EcTyrRS Library Construction
(31) In the EcYRS1 library (pBK-EcYRS1), six residues were randomized as follows: Y37-FLIMVSTAYHCG (SEQ ID NO:2), L71-NBT, N126-NSPTACGDH (SEQ ID NO:3) D182-NST, F183-NNK, L186-NNK. A previously reported library (pBK-EcYRS1a) was used, which contains the desired Y37, D182, F183, and L186 randomizations, as the template to generate pBK-EcYRS1 by sequential overlap of extension PCR. Piece A was amplified with primers pBK seqT-F and EcYRS-L71-oR. Piece B was amplified with EcYRS-L71-NBT-F and EcYRS-N126-oR, and subsequently overlapped with piece A using terminal primers pBK seqT-F and EcYRS-N126oR to create piece AB. Lastly, piece C was amplified with EcYRS-N126x-F (x corresponds to nine different codons) and pBK MCS JIsqR for all desired N126 variants. Piece C variants were combined in equal distribution and were subsequently overlapped with piece AB to form the full length aaRS PCR product.
(32) After amplification, the aaRS PCR product was digested with NdeI/NcoI (NEB) and ligated by T4 DNA Ligase (NEB) into the pBK vector digested with the same restriction enzymes. The ligation mixture was ethanol precipitated with Yeast-tRNA (Ambion) and transformed into electrocompetent DH10B cells. Greater than 10.sup.8 transformants were obtained to ensure library coverage.
(33) Directed Evolution of EcTyrRS-SulfoY Variant in ATMY3
(34) Positive selection 1: The pBK-EcYRS1 library was transformed into ATMY3 containing the positive selection plasmid pRepTrip2.3P-EcQtR-2x. The pRep plasmid expresses a chloramphenicol acetyl transferase (CAT) reporter containing a Q98TAG, an ampicillin resistance gene containing a 3TAG, an arabinose inducible T7 RNA polyermase containing two TAG codons (site 8 and 14), a T7 promoted GFPuv, and two copies of the E. coli tRNA.sup.Gln expressed from its endogenous promoter. Approximately 910.sup.8 colony forming units were plated on LB+0.5 spectinomycin, tetracyclin, and kanamycin+0.02% arabinose+30 g/min ampicillin+30 or 50 g/mL, chloramphenicol in the presence of 1 mM sTyr for 18 hat 37 C. After 18 h, colonies from plates were harvested with 15 mL LB, centrifuged and selected pBK plasmid pool (pBK-EcYRS1a-P1) was purified via miniprep and isolated via gel purification.
(35) For Negative selection: The isolated plasmid was subsequently transformed into ATMY3 containing pNeg2-2xQtR (contains arabinose dependent barnase with 3TAG, 45TAG, and two copies of the E. coli tRNA.sup.Gln). Approximately 10.sup.8 cells were plated on LB-agar plates containing 0.5 spectinomycin, ampicillin, and kanamycin+0.02% arabinose in the absence of sTyr for 12 h at 37 C. After 12 h, colonies from plates were harvested with 15 mL LB, centrifuged and the pBK library subjected to one positive selection and one negative selection (pBK-EcYRS1a-P1N1) was purified via miniprep.
(36) Positive selection 2: pBK-EcYRS1a-P2N1 was subjected to a second round of positive selection (10.sup.6 cfu plated). 96 single colonies from the second round of positive selection plates containing 1 mM sTyr were picked into 500 L LB supplemented with spectinomycin, tetracyclin, kanamycin in a 96 deep-well plate and grown to confluence overnight. These overnight cultures were diluted 100 fold and 3 L were individually spot plated on LB-Agar plates containing spectinomycin, tetracyclin, kanamycin+0.02% arabinose and 30 or 50 g/mL chloramphenicol in the presence or absence of 1 mM sTyr. Eight pBK variants showing the most sTyr-dependent survival were picked for further characterization.
(37) Characterization of tRNA/aaRS Activity in E. coli Via sfGFP Reporter
(38) Preparation ATMY4 containing pEvolT5-sfGFP151TAG was transformed with pBK-EcTyrRS variants. Overnight starter cultures were diluted 100 fold in 10 mL LB containing required antibiotics and grown at 37 C. while shaking at 250 rpm in 50 mL flasks. Upon reaching 0.55 OD.sub.600, 1 mM final IPTG was added to induce protein expression. 1 mL aliquots of induced cultures were placed in 15 mL culture tubes with or without 1 mM sulfotyrosine and grown for 18-20 h at 30 C. Afterwards, cells were pelleted, resuspended in PBS, and diluted 10 fold. Dilutions were transferred to a 96-well clear bottom plate. Expression of full-length sfGFP was measured using the associated characteristic fluorescence by a SpectraMAX M5 (Molecular Devices) multimode plate reader (Ex. 488 nm; Em. 534 nm; 515 cutoff) and normalized with respect to OD.sub.600.
(39) Purification of sfGFP-TAG from Bacterial Expression
(40) Protein expression was performed in 10 mL culture as described above (sfGFP151-TAG reporter assay). Afterwards, the cells were pelleted at 5000g, resuspended in lysis buffer [B-PER Bacterial Protein Extraction Reagent (Thermo Scientific), 1 Halt Protease Inhibitor Cocktail (Thermo Scientific), 0.01% Pierce Universal Nuclease (Thermo Scientific), and incubated for 10 min on ice. After incubation, the crude lysate was clarified at 22,000g. The full-length sfGFP containing a C-terminal 6 HisTag (SEQ ID NO: 33) was purified using HisPur Ni-NTA resin (Thermo Scientific) according to the manufacturers protocol. SDS-PAGE and Bradford analysis were used to assess protein purity, while the molecular weight was confirmed by ESI-MS (Agilent Technologies 1260 Infinity ESI-TOF).
(41) Site-Specific Incorporation of sTyr into Protein Expressed in Mammalian Cells
(42) HEK293T cells were maintained as described above. pB1U-SulfoA1-16xtYR-TAG (VGL) or pB1U-SulfoB7-16xtYR-TAG (VGM) contain 16 copies of alternating U6/H1 promoted E. coli tRNA.sup.Tyr.sub.CUA and UbiC promoted EcTyrRS mutants. pAcBac1-EGFP-39TAG was used as a reporter plasmid. 0.710.sup.6 cells per well were seeded one day prior to transfection in a 12 well plate. At 70% confluence, the transfection mixture (500 ng each of suppressor and reporter plasmid, 18 L DMEM, 3.5 L Sigma PEI (1 mg/mL), 10 min incubation prior to addition) was added to each well and gently mixed. A final concentration of 2 mM sTyr was added to the wells at the time of transfection. After 48 h, cells were harvested by centrifugation at 5000g and residual media was removed. 50 L lysis buffer (10 mL CellLytic M, 1 Halt Protease inhibitor, 0.01% Pierce universal nuclease) was added per well and incubated for 10 min. After incubation, cells were clarified by centrifugation and lysate was analyzed for fluorescence in the SpectraMAX M5 (Molecular Devices) under the same conditions as sfGFP.
(43) For purification and further charectrization, EGFP-39-sTyr was expressed in 10 cm dishes (8.510.sup.6 seeded 24 h prior to transfection). 5 g suppressor plasmid and 5 g reporter plasmid were incubated with 180 L DMEM (no FBS) and 40 L PEImax (Polysciences; 1 mg/mL). 2 mM sTyr and 2 mM Sodium Butyrate was added at the time of transfection. After 48 hr, cells were harvested at 5000g. 600 L lysis buffer (CellLytic M, 1 Halt protease inhibitor, 0.01% Pierce universal nuclease) was used to lyse the cells. After 10 min incubation, the lysate was clarified by centrifugation and the protein was purified using HisPur Ni-NTA resin (Thermo-Scientific). Purity and the molecular weight of the expressed protein was analyzed by SDS-PAGE and ESI-MS (Agilent Technologies 1260 Inifinity ESI-TOF).
(44) Anti-His and Anti-Sulfotyrosine Western Blot of GFP Reporters
(45) Western blot was used to confirm the presence of a polyhistidine tag (via anti-HisTag blot) and the presence of sulfotyrosine (via anti-sTyr blot) in reporter proteins expressed above. 500 ng each of purified wild-type or sTyr-incorporated mutant of sfGFP or EGFP reporter proteins were resolved by SDS-PAGE, and transferred to a PVDF membrane (Life Technologies) using a Trans-Blot Turbo Transfer System (BioRad) in Towbin Transfer Buffer (at 12V for 30 min, twice). After complete transfer, membrane was blocked in 10 mL 5% milk in TBST (HisBlot) or 10 mL Pierce Superblocker (Fisher Scientific) at 4 C. overnight with constant agitation. Membranes were subsequently incubated in 1:3000 anti-HisTag mouse mAb (Invitrogen, MA121315, in 5% milk TBST) or 1:6000 anti-Sulfotyrosine mouse mAb (Millipore Sigma, Clone: 1CA2, in Pierce Superblocker) overnight. Next, the membrane was washed six times, 10 min per wash, using TBST at room temperature. Afterwards, 1:6000 dilution of chicken anti-mouse secondary antibody (Invitrogen, SA1-72021, in 5% milk TBST) was incubated for 2 h at room temperature. The membrane was washed and activated using SuperSignal West Dura Kit (Fisher Scientific), The activated blot was imaged on the ChemiDoc MP imaging system (BioRad).
(46) Expression and Purification of Heparin Cofactor II (HCII)
(47) HEK293T cells were maintained as described above. pB3-SulfoRS-16xYtR-TAG-HCII contains the following three components: 16 copies of alternatingly H1/U6 promoted E. coli tyrosine tRNA.sub.CUA, a UbiC promoted EcTyrRS mutant, and HCII mutants under a CAG promoter. 10 cm dishes were seeded with 8.510.sup.6 cells 24 h prior to transfection. Afterwards, DMEM +FBS media was aspirated and replaced with DMEM without FBS. A transfection mixture (10 g pB3 plasmid, 180 L DMEM, 50 L PEI Max) was incubated for 10 min prior to addition. 2 mM sTyr and 2 mM sodium butyrate were added at the time of transfection. Since HCII is a secreted protein, the media was harvested on days 2 and 3 post transfection, stored at 4 C. for up to 2 days, and adherent HCII expressing cells were re-supplemented with DMEM (no FBS)+2 mM sTyr+2 mM sodium butyrate. Collected media containing overexpressed HCII (20 mL total per 10 cm plate) were pooled and subjected to purification.
(48) HCII containing media was centrifuged at 5,000g at 4 C. for 30 min to remove any residual debris. The supernatant was concentrated with Amicon 30 kDa MWCO centrifugal filters to approximately 2 mL. For concentrated media harvested from five 10 cm dishes, 1 mL Ni-NTA (Thermo-Scientific) resin was used for protein purification. Bound protein was washed with 50 mL of wash buffer containing PBS+45 mM imidazole. HCII was eluted with 10 mL elution buffer, concentrated down to 1 mL using a 30 kDa MWCO filter, and buffer exchanged into HNPN PEG buffer (20 mM HEPES, pH 7.4, 150 mM NaCl, 0.05% NaN.sub.3). Protein yields and purity were analyzed by Bradford, SDS-PAGE, anti-His tag dot blot, and tryptic/elastase mass spectrometry.
(49) Deglycosylation Assay of HCII
(50) PNGase F was purchased from Promega (V4831). 18 L (10 g, in 0.5 mM Tris-HCl, pH 7.8) purified recombinant HCII was incubated at 37 C. with or without 2 L PNGase for 18 hrs. After incubation, mixtures were resolved by SDS-PAGE and imaged via ChemiDoc imaging.
(51) Tryptic & Elastase Mass Spectrometry Characterization of HCII
(52) An in gel digestion was performed to prepare peptides for MS analysis. 1000-2000 ng HCII was resolved by SDS-PAGE. Gel was stained for 1 hr, and destained overnight. After destain, HCII bands were sliced and cut into approximately 1 mm.sup.2 pieces. Pieces were placed in microcentrifuge tubes containing 500 L 100 mM ammonium bicarbonate. Gel bands were frozen at 80 C. overnight in the 500 L ammonium bicarbonate. Gel bands were thawed, supernatant was removed, and gel bands were washed 1-2 for 15 min with 500 L 100 mM ammonium bicarbonate. After washes, supernatant was removed and 200 L 10 mM TCEP was added to completely cover gel bands. Samples were placed in a 60 C. water bath for 30 min. Samples were quickly spun and TCEP was aspirated. 200 L 55 mM iodoacetamide was added to cover the gel bands. Tubes were placed in the dark for 30 min at RT. Supernatant was removed and gel bands were washed 3 for 15 min in 500 L 50:50 acetonitrile:100 mM ammonium bicarbonate. After washes, supernatant was removed and 50 L acetonitrile was added to completely dehydrate the gel bands (turned opaque). Acetonitrile was removed and residual solvent was removed using a SpeedVac for 5 min.
(53) Sequencing grade trypsin (V5111) and neutrophil elastase (V1891) was purchased from Promega. Sample was resuspended in either trypsin (for 60 site) or trypsin+elastase (for 73 site). For trypsin, 200 ng trypsin (20 L, resuspended in 25 mM ammonium bicarbonate) was added to dehydrated gel slices. For trypsin+elastase, 300 ng (30 L, 25 mM ammonium bicarbonate) trypsin was added, immediately followed by 35 L elastase (30 ng, resuspended in double distilled water according to manufacturer protocol)+50 L 50 mM Tris-HCl. In both cases, enzymes were incubated with gel sample for 10 min before 200 L 50 mM ammonium bicarbonate was added and placed at 37 C. incubator overnight. Next, the supernatant was transferred to a clean tube and 100 L formic acid was added to the gel bands followed by a 15 min incubation at RT. The supernatant was aspirated and combined with the supernatant from the last step. Formic acid washes of the gel slices were repeated two more times. Next, 150 L acetonitrile was added to cover the gel slices, incubated at RT for 15 min, and combined with all previous washes. Acetonitrile washes were repeated two more times until bands became opaque. Lastly, the peptide sample (500 L consisting of the overnight incubation supernatant, formic acid washes, and acetonitrile washes) was evaporated down to 10 L using SpeedVac and stored at 80 C. until subjected to HPLC-MS analysis.
(54) Digested peptides were analyzed by LC-MS using an LTQ Orbitrap XL mass spectrometer (Thermo Fisher) coupled to an EASY-nLC 1000 nanoLC (Thermo Fisher). 18 L of sample was loaded onto 100 m fused silica column with a 5 m tip packed with 10 cm of Aqua C18 reverse-phase resin (Phenomenex) using the EASY-nLC 1000 autosampler. Peptides were eluted with a gradient 0-55% buffer B in buffer A (buffer A: 95% water, 5% acetonitrile, 0.1% formic acid; buffer B; 20% water, 80% acetonitrile, 0.1% formic acid). The flow rate through the column was set to 400 nl/min and the spray voltage was set to 3.5 kV. One full MS scan (400-1800 MW) was followed by seven data dependent scans. For the data dependent scans, a mass list was used to target the predicted peptides with sTyr at residues 60 and 73. In the absence of a targeted peptide, data dependent scans were performed on the nth most intense ions in the MS1. MS1 spectra and total ion chromatograms were manually analyzed for peptide identification and presence of sulfation at each residue.
(55) HCII-Thrombin Activity Assay
(56) To calculate the second order rate constant of thrombin inhibition by HCII, thrombin was incubated with excess HCII under pseudo-first order conditions in the presence of different heparin concentrations (details below). The reaction was quenched after 1 minute and the residual thrombin activity (k.sub.inbibited) was measured using a chromogenic substrate. The pseudo-first order rate constant (k.sub.1) was calculated from this using the equation k.sub.1=ln(k.sub.inhib/k.sub.uninhib)/t, where k.sub.uninhib is the activity of thrombin in the absence of HCII inhibition under identical treatment. The second order inhibition rate constant (k.sub.2) was calculated from k.sub.1 using the equation k.sub.2=k.sub.1/[HCII] with units of M.sup.1min.sup.1. The second order rate constant at each heparin concentration was plotted against the corresponding heparin concentration.
(57) Concentrations of different HCII protein were measured by Bradford and normalized by anti-His dot-blot assay (blot intensities quantified via ChemiDoc imaging). Clear plastic 96 well plates were coated with 2 mg/mL ovalbumin (Fisher) for 1 hr at 37 C. Ovalbumin was removed by tapping the plate on a paper towel. A master mix of 2 mg/mL ovalbumin, 0-2 mg/mL heparin (Fisher), 0.6 nM -thrombin (Fisher) in HNPN (20 mM HEPES, pH 7.4, 150 mM NaCl, 0.05% NaN3) were incubated in the treated 96 wells for 1 min with 10 nM HCII. After 1 min, 10 L of a solution of 1 mg/mL polybrene was directly added to all wells using a multichannel pipet to quench the heparin-dependent inhibition of thrombin by HCII. The plates were spun down in a bucket centrifuge for 10 min at 3,500 rpm to precipitate the heparin/polybrene complex. 100 L supernatant was removed and 50 L 450 M ChromozymeTH (Sigma) substrate was added to measure the amount of residual thrombin activity by monitoring the absorbance on the SpectroMax plate reader at 405 nm for 1 hr in triplicate.
(58) List of Oligonueleotides shown below in Table 1 (SEQ ID NOS: 17-32)
(59) TABLE-US-00001 PrimerName Sequence SEQID pBKseqT-F ATTACGCTGACTTGACGGGACGG NO:17 SEQID EcYRS-L71-oR CGCAACCGGCTTGTGGCCCGCCTGC NO:18 SEQID EcYRS-L71-NBT-F GCAGGCGGGCCACAAGCCGGTTGCG NO:19 nbtGTAGGCGGCGCGACGGGTCTGA TTG SEQID EcYRS-N126-oR GTTCGCCGCGATAGCAGAGTTTTC NO:20 SEQID EcYRS-N126x-F GAAAACTCTGCTATCGCGGCGAACn NO:21 nnTATGACTGGTTCGGCAATATGAA TGTGCTGAC SEQID pBKMCSJisqR GAGATCATGTAGGCCTGATAAGCGT NO:22 AGC SEQID EcYRS-NheI-F GCTAGCGCCACCATGGCAAGCA NO:23 SEQID EcYRS-XhoI-R aataatCTCGAGTTATTTCCAGCAA NO:24 ATCAGACAGTAATTCTTTTTACC SEQID HCII-SfiI-F TGGCAAAGAATTGGCCAAGGAGGCC NO:25 ACCATGAAACACTCATTAAACGCAC TTC SEQID 10xHis-TGA-SfiI-R TGGCGGCCGGCCAGGCCTCAATGAT NO:26 (1.0xHis GGTGGTGATGATGATGGTGATGATG disclosedasSEQ IDNO:34) SEQID HCII-79-Phe-R GTCGTCGTCTTCACTGAATATCTTC NO:27 TCCAGGTCCAGaaaGTCGTCGTCCT CCTCCCCC SEQID HCII-79-TAG-R GTCGTCGTCTTCACTGAATATCTTC NO:28 TCCAGGTCCAGctaGTCGTCGTCCT CCTCCCCC SEQID HCII-92-Phe-F CTGGACCTGGAGAAGATATTCAGTG NO:29 AAGACGACGACtttATCGACATCGT CGACAGTCTG SEQID HCII-92-TAG-F CTGGACCTGGAGAAGATATTCAGTG NO:30 AAGACGACGACtagATCGACATCGT CGACAGTCTG SEQID HCII-80-iF CTGGACCTGGAGAAGATATTCAGTG NO:31 AAGACGACGAC SEQID HCII-80-iR GTCGTCGTCTTCACTGAATATCTTC NO:32 TCCAGGTCCAG
Plasmid Content and Construction
(60) pB1U-Sulfo-16xtYR-TAG: EcTyrRS VGL and VGM variants were amplified from pBK with oligonucleotides EcYRS-NheI-F and ExYRS-XhoI-R and subcloned into pB1U-OMeYRS-16xtYR-TAG between NheI and XhoI.
(61) pB3-SulfoRS-16xYtR-TAG-HCII: pAcBac3 OMeYRS was used as a starting vector to construct this plasmid. pB3 (abbreviated pAcBac3) is identical to pB1u except it contains a CAG promoter upstream from an SfiI site as well as 4 additional tRNA cassette copies. OMeYRS was replaced with SulfoRS via NheI/XhoI as previously described in pB1U cloning description. The SfiI site was used to insert HCII. HCII-SfiI-F and 10His-TGA-SfiI-R (10His disclosed as SEQ ID NO: 34) were used to amplify HCII from pCMV-SerpinD1 (Origine, SC120039). Mutations were introduced via overlap extension (see primer list for 79, 92, and 80 overlap primers79 and 92 correspond to 60 and 73 sites, respectively). HCII insert and vector were digested with SfiI and ligated via traditional RE cloning.
(62) In summary, the present invention has developed a platform for site-specific incorporation of sTyr into proteins expressed in eukaryotic cells with high fidelity and efficiency, which would be a valuable tool for investigating the consequences of tyrosine sulfations found in the eukaryotic proteome. This platform can also be used to express therapeutically relevant proteins homogeneously modified with functionally important sulfations. Additionally, the ability to incorporate sTyr into virtually any site of any protein in eukaryotic cells offers intriguing opportunities for novel synthetic biology applications.
REFERENCES
(63) The references listed in this application are herein incorporated by reference in their entirety. 1 Moore, K. L. Protein tyrosine sulfation: a critical posttranslation modification in plants and animals. Proceedings of the National Academy of Sciences of the United States of America 106, 14741-14742, doi:10.1073/pnas.0908376106 (2009). 2 Seibert, C. & Sakmar, T. P. Toward a framework for sulfoproteomics: Synthesis and characterization of sulfotyrosine-containing peptides. Biopolymers 90, 459-477, doi:10.1002/bip.20821 (2008). 3 Stone, M. J., Chuang, S., Hou, X., Shoham, M. & Zhu, J. Z. Tyrosine sulfation: an increasingly recognised post-translational modification of secreted proteins. New biotechnology 25, 299-317 (2009). 4 Yang, Y. S. et al, Tyrosine sulfation as a protein post-translational modification, Molecules (Basel, Switzerland) 20, 2138-2164, doi:10.3390/molecules20022138 (2015). 5 Farzan, M. et al. Tyrosine sulfation of the amino terminus of CCR5 facilitates HIV-1 entry. Cell 96, 667-676 (1999). 6 Huang, C.-c. et al. Structural basis of tyrosine sulfation and VH-gene usage in antibodies that recognize the HIV type 1 coreceptor-binding site on gp120. Proceedings of the National Academy of Sciences of the United States of America 101, 2706-2711 (2004). 7 Li, X., Hitomi, J. & Liu, C. C. Characterization of a Sulfated Anti-HIV Antibody Using an Expanded Genetic Code. Biochemistry (2018). 8 Stone, M. J. & Payne, R. J. Homogeneous sulfopeptides and sulfoproteins: synthetic approaches and applications to characterize the effects of tyrosine sulfation on biochemical function. Accounts of chemical research 48, 2251-2261 (2015). 9 Thompson, R. E, et al. Tyrosine sulfation modulates activity of tick-derived thrombin inhibitors. Nature chemistry 9, 909 (2017). 10 Mikkelsen, J., Thomsen, J. & Ezban, M. Heterogeneity in the tyrosine sulfation Chinese hamster ovary cell produced recombinant FVIII. Biochemistry 30, 1533-1537 (1991). 11 Chin, J. W. Expanding and reprogramming the genetic code. Nature 550, 53 (2017). 12 Italia, J. S. et al. Expanding the genetic code of mammalian cells. Biochemical Society transactions 45, 555-562, doi:10.1042/bst20160336 (2017). 13 Young, D. D. & Schultz, P. G. Playing with the molecules of life. ACS chemical biology (2018). 14 Liu, C. C., Brustad, E., Liu, W. & Schultz, P. G. Crystal structure of a biosynthetic sulfo-hirudin complexed to thrombin. Journal of the American Chemical Society 129, 10648-10649 (2007). 15 Liu, C. C. & Schultz, P. G. Recombinant expression of selectively sulfated proteins in Escherichia coli. Nature biotechnology 24, 1436-1440, doi:10.1038/nbt1254 (2006). 16 Watson, E. E. et al, Mosquito-Derived Anophelin Sulfoproteins Are Potent Antithrombotics. ACS central science 4, 468-476 (2018). 17 Italia, J. S., Latour, C., Wrobel, C. J. & Chatterjee, A. Resurrecting the bacterial tyrosyl-tRNA synthetase/tRNA pair for expanding the genetic code of both E. coli and eukaryotes. Cell chemical biology 25, 1304-1312. e1305 (2018). 18 Chin, J. W. et al. An expanded eukaryotic genetic code. Science (New York, N.Y.) 301, 964-967, doi:10.1126/science.1084772 (2003). 19 Dumas, A., Lercher, L., Spicer, C. D. & Davis, B. G. Designing logical codon reassignmentExpanding the chemistry in biology. Chemical Science 6, 50-69 (2015). 20 Italia, J. S. et al. An orthogonalized platform for genetic code expansion in both bacteria and eukaryotes. Nature chemical biology 13, 446-450, doi:10.1038/nchembio.2312 (2017). 21 Tollefsen, D. M. Heparin cofactor II. Advances in experimental medicine and biology 425, 35-44 (1997). 22 Tollefsen, D. M. Heparin cofactor II modulates the response to vascular injury. Arteriosclerosis, thrombosis, and vascular biology 27, 454-460 (2007). 23 Hortin, G., Tollefsen, D. & Strauss, A. W. Identification of two sites of sulfation of human heparin cofactor II. Journal of Biological Chemistry 261, 15827-15830 (1986). 24 Ciaccia, A. V., Monroe, D. M. & Church, F. C. Arginine 200 of Heparin Cofactor II Promotes Intramolecular Interactions of the Acidic Domain IMPLICATION FOR THROMBIN INHIBITION. Journal of Biological Chemistry 272, 14074-14079 (1997). 25 Mitchell, J. W. & Church, F. C. Aspartic acid residues 72 and 75 and tyrosine-sulfate 73 of heparin cofactor II promote intramolecular interactions during glycosaminoglycan binding and thrombin inhibition. Journal of Biological Chemistry 277, 19823-19830 (2002). 26 Zheng, Y., Lewis Jr, T. L., Igo, P., Polleux, F. & Chatterjee, A. Virus-enabled optimization and delivery of the genetic machinery for efficient unnatural amino acid mutagenesis in mammalian cells and tissues. ACS synthetic biology 6, 13-18 (2016).
(64) While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.