Hangtaimycin derivatives and their preparation methods and application

Abstract

The embodiment of the present invention discloses Hangtaimycin derivatives and their preparation and application. Hangtaimycin derivatives are obtained by fermentation of Streptomyces spectabilis CCTCC M2017417 and its genetically knockout mutant strain in SFMR medium, with further isolation, purification, and alcoholysis. Through screening, Hangtaimycin derivatives showed excellent anti-inflammatory and analgesic, anti-tumor, liver injury protection, cell membrane protection, and drug addiction prevention activities, providing new drug leads for developing related drugs.

Claims

1. A Hangtaimycin derivative, comprising Hangtaimycin A or Hangtaimycin B, wherein the Hangtaimycin A and the Hangtaimycin B are alcoholysis derivatives, whose chemical structures are as following: ##STR00002##

2. An anti-inflammatory swelling drug, comprising the Hangtaimycin A and/or the Hangtaimycin B, wherein the Hangtaimycin A and the Hangtaimycin B are the alcoholysis derivatives according to claim 1.

3. An analgesic drug used for a treatment of inflammatory pain, comprising the Hangtaimycin B, wherein the Hangtaimycin B is the alcoholysis derivative according to claim 1.

4. An anti-tumor drug used for inhibiting tumor growth, comprising the Hangtaimycin A and/or the Hangtaimycin B, wherein the Hangtaimycin A and the Hangtaimycin B are the alcoholysis derivatives according to claim 1.

5. A liver injury protective drug, comprising the Hangtaimycin A and/or the Hangtaimycin B, wherein the Hangtaimycin A and the Hangtaimycin B are the alcoholysis derivatives according to claim 1.

6. A drug for preventing and treating drug addiction, used for preventing and treating addiction of morphine and cocaine drugs, comprising the Hangtaimycin A and/or the Hangtaimycin B, wherein the Hangtaimycin A and the Hangtaimycin B are the alcoholysis derivatives according to claim 1.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1. The chemical structural formula of HTM and its alcoholysis derivatives (HTM and HTMP: HTM derivatives, HTMA and HTMB: HTM alcoholysis derivatives);

(2) FIG. 2. Recombinant plasmid for the gene knockout mutant strain htmP construction;

(3) FIG. 3A and FIG. 3B. Schematic diagram and validation result of the gene knockout mutant strain htmP construction;

(4) FIG. 4A, FIG. 4B, FIG. 4C and FIG. 4D. HPLC results of the fermentation extracts of the gene knockout mutant strain htmP (* means no HTM was detected by HPLC);

(5) FIG. 5. ESI-HRMS spectrum of HTMP;

(6) FIG. 6. .sup.1H NMR spectrum of HTMP;

(7) FIG. 7. .sup.13C NMR spectrum of HTMP;

(8) FIG. 8. .sup.1H-.sup.1H COSY spectrum of HTMP;

(9) FIG. 9. HSQC spectrum of HTMP;

(10) FIG. 10. HMBC spectrum of HTMP;

(11) FIG. 11. .sup.1H-.sup.1H ROESY spectrum of HTMP;

(12) FIG. 12. ESI-HRMS spectrum of HTMA;

(13) FIG. 13. .sup.1H NMR spectrum of HTMA;

(14) FIG. 14. .sup.13C NMR spectrum of HTMA;

(15) FIG. 15. .sup.1H-.sup.1H COSY spectrum of HTMA;

(16) FIG. 16. HSQC spectrum of HTMA;

(17) FIG. 17. HMBC spectrum of HTMA;

(18) FIG. 18. .sup.1H-.sup.1H ROESY spectrum of HTMA;

(19) FIG. 19. ESI-HRMS spectrum of HTMB;

(20) FIG. 20. .sup.1H NMR spectrum of HTMB;

(21) FIG. 21. .sup.13C NMR spectrum of HTMB;

(22) FIG. 22. .sup.1H-.sup.1H COSY spectrum of HTMB;

(23) FIG. 23. HSQC spectrum of HTMB;

(24) FIG. 24. HMBC spectrum of HTMB;

(25) FIG. 25. .sup.1H-.sup.1H ROESY spectrum of HTMB;

(26) FIG. 26. Anti-liver injury activity cell test of HTMA, HTMAB, HTMP;

(27) Anti-liver injury activity of HTMA. FIG. 27A: Alanine aminotransferase, ALT; FIG. 27B: Aspartate aminotransferase, AST; FIG. 27C: Lactate dehydrogenase, LDH. High (HH), medium (MH), low (LH) dose of HTMA; Obeticholic acid (OBC); Silymarin(S);

(28) Anti-cholestasis activity of HTMA. FIG. 28A: Total bile acids, TBA; FIG. 28B: Direct bilirubin, DBIL; FIG. 28C: Total bilirubin, TBIL; FIG. 28D: -glutamyl transferase, GGT; FIG. 28E: Alkaline phosphatase, ALP. High (HH), medium (MH), low (LH) dose of HTMA; Obeticholic acid (OBC); Silymarin(S);

(29) HE staining on rat liver tissue (FIG. 29A: control; FIG. 29B: model);

(30) HE staining on rat liver tissue testing anti-liver injury activity of HTMA (FIG. 30A: model; FIG. 30B: OBC; FIG. 30C: S; FIG. 30D: LH; FIG. 30E: MH; FIG. 30F: HH);

(31) FIG. 31. HTMA protects the cell membrane of HepG2 (DiO: cell membrane; DAPI: nuclear; Merge: cell membrane and nuclear);

(32) Results of anti-inflammatory effects for HTM, HTMA, HTMB, and HTMP (FIG. 32A: Changes in thickness of inflammatory tissue swelling after administration of HTM; FIG. 32B: Changes in thickness of anti-inflammatory tissue swelling after administration of HTMP; FIG. 32C: Changes in thickness of inflammatory tissue swelling after administration of HTMA; FIG. 32D: Changes in thickness of inflammatory tissue swelling after administration of HTMB; FIG. 32E: Changes in thickness of inflammatory tissue swelling after administration of the positive drug rapamycin; FIG. 32F: Structural interrelationships of the four compounds HTM, HTMP, HTMA, HTMB and summary of changes in the thickness of inflammatory tissue swelling in the blank and model groups given HTM, HTMP, HTMA, HTMB, respectively. Saline was the blank group and carrageenan gum was the model group, **P<0.05);

(33) FIG. 33. Results of HE staining tests for anti-inflammatory effects of HTMA and HTMB;

(34) FIG. 34. Results of anti-inflammatory effects on leukocyte of HTMA and HTMB;

(35) FIG. 35. Anti-inflammatory and analgesic effects results of HTMB;

(36) FIG. 36. Results of HTMB on drug addiction prevention;

(37) FIG. 37A and FIG. 37B. Results of HTMB treatment on drug addiction (Pre-C: baseline value; Post-C: CPP score; Post-T1: test value at day 1 after exposure; Post-T7: test value at day 7 after exposure);

(38) FIG. 38. Antioxidant activity of HTM, HTMA, HTMB, and HTMP;

(39) FIG. 39. Antitumor activity of HTM, HTMA, HTMB, and HTMP.

DESCRIPTION OF EMBODIMENTS

(40) The following is a further detailed explanation of the technical solution of the embodiment of the present invention in conjunction with examples and accompanying figures.

(41) The gene knockout mutant strain htmP in the following examples has been deposited in the China Center for Type Culture Collection (CCTCC, address: Wuhan University, Wuhan, China) on Jun. 13, 2022, with the classification name of Streptomyces spectabilis htmP and the deposit number of CCTCC M2022874.

Example 1. The Construction of the Gene Knockout Mutant Strain htmP

(42) (1) According to the nucleotide sequence of HTM biosynthetic gene cluster, two homologous recombination fragments of 1936 bp and 2236 bp were amplified by PCR using two pairs of primers (Table 1) designed, respectively, upstream and downstream of the cytochrome P450 encoding gene htmP in HTM biosynthetic gene cluster. The PCR reaction system and conditions are as following: dH.sub.2O, 48 L 2Phanta Max Buffer, 25 L dNTP Mix (10 mM each), 1 L Upstream primer (10 M), 2 L downstream primer (10 M), 2 L Phanta Max Super-Fidelity DNA Polymerase, 1 L Template DNA, 2 L 95 C., 3 minutes 95 C., 30 seconds; 58 C., 30 seconds; 72 C., 90 seconds (30 cycles) 72 C., 5 minutes

(43) (2) The shuttle vector pYH7 of Escherichia coli and Streptomyces was digested with restriction endonucleases of NdeI and HindIII, and a DNA fragment about 9 kb containing the initial replication site of conjugation transfer and the ampicillin resistance gene were obtained as vectors. The two homologous arms were spliced with Gibson method to obtain the htmP in-frame knockout recombinant plasmid pWHUP450 (FIG. 2).

(44) (3) The recombinant plasmid pWHUP450 was transferred into E. coli DH10B and cultured overnight at 37 C. Selected positive monoclonal clones of the plate were extracted for plasmids, and performed enzyme digestion and sequencing verification.

(45) (4) The verified correct recombinant plasmid pWHUP450 was transferred into E. coli ET12567/pUZ8002 strain. The E. coli ET12567/pUZ8002 monoclonal transformant containing the recombinant plasmid were inoculated into 5 mL 2TY liquid culture medium (tryptone 1.6%, yeast extract 1%, 0.5% NaCl) contained kanamycin (50 g/mL) and apramycin (25 g/mL). After overnight cultivation at 37 C., they were further inoculated with 10% inoculum to 5 mL 2TY culture medium containing antibiotic kanamycin (25 g/mL) and apramycin (12.5 g/mL) and incubate at 37 C. for another 3 hours.

(46) (5) After incubation in TSBY liquid medium (sucrose 10.5%, yeast extract 0.5%, soybean extract 0.5%) for 48 hours, the mycelium of Streptomyces spectabilis CCTCC M2017417 were washed with 2TY liquid culture medium twice, also E. coli ET12567/pUZ8002 cell containing recombinant plasmid were washed twice with 2TY liquid medium, then 100 L mycelium and 100 L E. coli ET12567/pUZ8002 were mixed well and applied on ABB13 solid culture medium (soluble starch 0.5%, soy peptone 0.5%, calcium carbonate 0.3%, 3-(N-morpholine) propionic acid 0.21%, thiamine hydrochloride 0.001%, ferrous sulfate heptahydrate 0.0012%, agar 2%). After incubation at 28 C. for 12 hours, 1 mL of antibiotic containing nalidixic acid (25 g/mL) and apramycin (35 g/mL) were added on the surface of the culture medium. After this, the stain was cultured on 28 C. for 57 days, then the conjugated transfer could be observed.

(47) (6) Obtained conjugated transfers were conduct relaxation culture at 28 C. onto the ABB13 solid medium. After 57 days, obvious single colony could be observed.

(48) (7) The single bacterial colonies were separately cultured to the ABB13 solid medium plates containing the antibiotic apramycin (35 g/ml) and no antibiotics simultaneously. The strains that grow on plates on no antibiotics plates but do not grow on plates containing antibiotic apramycin after 57 days were the candidate target strains, and their genomic DNA were extract, and then perform PCR validation with the design primers (upstream and downstream regions of the knockout DNA) (Table 2). The verified correct strain is named as htmP (FIG. 3A and FIG. 3B).

(49) TABLE-US-00001 TABLE1 PrimerandnucleotidesequenceforconstructionhtmPin-frameknockout recombinantplasmid Primers Nucleotidesequence(5-3) Number P450-P-L-up TCAAGGCGAATACTTCATATGGTCCTCAACCGCACCGAGT SEQ1 ACACCC P450-P-L-Re CAACCCCTTCACCTGGAACGGCCGCATCAACG SEQ2 P450-P-R-up CGTTCCAGGTGAAGGGGTTGAACAGCGGTATCTGC SEQ3 P450-P-R-Re GACCTGCAGGCATGCAAGCTTCCGTGATCGTGCGGTACGT SEQ4 GAGGT

(50) TABLE-US-00002 TABLE2 PrimersandnucleotidesequencesforverificationofhtmP in-frameknockoutmutantstrain Primers Nucleotidesequence(5-3) Number P450-P-confirm-up CGGCTCCTTCGTCAACTTCCT SEQ5 P450-P-confirm-re CTCCTGCTCTCATCCTGGTCAC SEQ6

Example 2. Efficient Preparation Method for HTMP

(51) (1) Fermentation

(52) 1) The htmP in-frame knockout mutant strain (htmP) were cultured on the ABB13 solid culture medium plates. Firstly, taken approximately a size of 1 cm.sup.2 cultured stain on the ABB13 solid culture medium plate into 200 mL TSBY liquid medium and incubate at 28 C. and 220 rpm for 20 hours to prepare seed solution.

(53) 2) Inoculate the above seed liquid with 2% inoculation amount into 10 L SFMR fermentation medium, and further incubated at 28 C. and 220 rpm for 4 days to prepare a fermentation medium.

(54) (2) Extraction

(55) 1) The fermentation broth and the mycelium and macroporous resin were separated through a sieve (100-200 mesh).

(56) 2) The mycelium and macroporous resin were extracted three times with 8 L ethyl acetate, and the ethyl acetate phase was combined and subjected to vacuum distillation concentration to obtain approximately 7.8 g of extract.

(57) (3) Separation

(58) 1) The concentrated extracts were subjected to normal phase silica gel column chromatography, with chloroform/acetonitrile as the eluent. Gradient elution was performed from 100:0 to 50:50 by volume, and the fraction eluted with chloroform/acetonitrile in a volume ratio of 70:30 to 50:50 was collected.

(59) 2) The above fractions containing the target substance are then subjected to ODS reverse phase medium pressure liquid chromatography (S-50 m, 12 nm, 26300 mm, flow rate 13 mL/min), gradient elution from 0:100 to 100:0 by volume was conducted with acetonitrile/water eluent.

(60) 3) The above fractions containing the target substance were finally subjected to high-performance liquid chromatography (ODS-A, 25010 mm, 5 m, YMC, flow rate of 3 mL/min) and eluted with acetonitrile in a gradient of 45% to 55% volume fraction, and collected compound with a retention time at 20.8 minute.

(61) (4) Identification

(62) The high-resolution mass spectrometry results of the compound obtained from htmP, showed that the molecular weight of this intermediate (C.sub.50H.sub.61N.sub.7O.sub.10), which was only one oxygen atom less than that of HTM (C.sub.50H.sub.61N.sub.7O.sub.11). By comparing and analyzing the nuclear magnetic spectrum data, it was found that the hypomethoxy nuclear magnetic resonance signal of HTM .sub.H 5.36, dd (13.2, 7.2) and .sub.C 73.4 is replaced with a methylene nuclear magnetic resonance signal of .sub.H 3.39, dd (13.2, 7.2) and .sub.C 42.5 in this intermediate, suggesting that it should be a methylene group at the C-42 methoxy position relative to HTM and identified as HTMP (Table 3).

(63) TABLE-US-00003 TABLE 3 .sup.13C and .sup.1H NMR data of HTMP HTMP Position .sub.H, multi. (J in Hz) .sub.C, type 1 10.9, brs 2 6.9, d (2.4) 125.3, CH 3 107.3, C.sup. 4 7.32, d (8.4) 118.0, CH 5 6.92, t (7.2) 118.7, CH 6 7.02, t (7.2) 121.1, CH 7 7.29, d (8.4) 111.2, CH 8 136.2, C.sup. 9 127.1, C.sup. 10 3.23, m; 3.35, m .sup.26.4, CH.sub.2 11 4.7, dd (4.8, 4.2) 64.8, CH 12NCH.sub.3 2.94, s .sup.31.4, CH.sub.3 13 162.3, C.sup. 14 125.3, C.sup. 16 172.1, C.sup. 17 5.52, q (7.2) 129.8, CH 18 0.6, d (7.2) .sup.13.4, CH.sub.3 19 167, C 20 5.71, dd (8.4, 3.6) 55.8, CH 21 3.66, m 75.9, CH 21OCH.sub.3 3.18, s .sup.56.4, CH.sub.3 22 0.98, d (6.0) .sup.15.5, CH.sub.3 23 8.02, d (8.4) 24 164.3, C.sup. 25 135.8, C.sup. 26 5.5, s, 6.10 s .sup.105.9, CH.sub.2 27 9.28, s 28 164.7, C.sup. 29 6.27, d (15.0) 123.2, CH 30 7.09, dd (15.0, 10.2) 141.0, CH 31 6.22, (overlap) 128.9, CH 32 6.18, dt (15.0, 6.6) 142.3, CH 33 2.16, q (7.2) .sup.31.7, CH.sub.2 34 1.59, m .sup.25.0, CH.sub.2 35 2.26, t (7.2) .sup.35.3, CH.sub.2 36 164.0, CH 37 2.34, (overlap) .sup.30.3, CH.sub.2 38 4.46, m 75.5, CH 40 161.6, C.sup. 41 5.72, s 114.5, CH 42 3.39, dd (13.2, 7.2) .sup.42.5, CH.sub.2 43 8.07, d (7.2) 44 168.6, C.sup. 45 130.3, C.sup. 46 1.83, s .sup.12.8, CH.sub.3 47 6.14, d (9.0) 137.1, CH 48 4.64, m 42.4, CH 49 1.15, d (6.6) .sup.20.4, CH.sub.3 50 8.13, d (8.4) 51 164.6, C.sup. 52 5.56, d (11.4) 119.3, CH 53 6.35, t (11.4) 140.1, CH 54 7.48, dd (14.4, 12.0) 128.6, CH 55 5.94, m 137.1, CH 56 1.78, d (6.6) .sup.18.3, CH.sub.3

Example 3 Efficient Preparation Method for HTMA and HTMB

(64) (1) Fermentation

(65) 1) Streptomyces spectabilis CCTCC M2017417 (for the preparation of HTMA) and its gene knockout mutant strain htmP (for the preparation of HTMB), were cultured on the ABB13 solid culture medium plates. Firstly, a size of 1 cm.sup.2 cultured stain on the ABB13 solid culture medium plate were transferred into 200 mL TSBY liquid medium and incubate at the condition of 28 C. and 220 rpm for 36 hours to prepare seed solution.

(66) 2) Inoculate the above seed liquid with 2% inoculation amount into 10 L SFMR fermentation medium, and further incubated at 28 C. and 220 rpm for 108 hours to prepare a fermentation medium.

(67) (2) Extraction

(68) 1) The fermentation broth and the mycelium and macroporous resin were separated through a sieve (100-200 mesh).

(69) 2) The mycelium and macroporous resin were extracted with 10 L ethyl acetate three times, and the ethyl acetate phase was combined and subjected to vacuum distillation concentration to obtain approximately 8.4 g of extract.

(70) (3) Separation

(71) 1) The concentrated extract was subjected to normal phase silica gel column chromatography, with chloroform/methanol as the eluent. Gradient elution was performed from 100:0 to 80:20 (chloroform/methanol) by volume, and the fraction eluted with chloroform/methanol in a volume ratio of 96:4 to 94:6 was collected.

(72) 2) The above fractions containing the target substance are then subjected to ODS reverse phase medium pressure liquid chromatography (S-50 m, 12 nm, 26300 mm, flow rate 13 mL/min), using acetonitrile/water as eluent, gradient elution was performed from 0:100 to 100:0 (acetonitrile/water) by volume. The group containing the target substance was detected by HPLC and then dissolved in methanol, and alcoholized at 42 C. and 0.1% acetic acid for 72 hours.

(73) 3) The above fractions were finally subjected to high performance liquid chromatography (ODS-A, 25020 mm, 5 m, YMC, flow rate of 3 mL/min) and eluted with a gradient of 45% to 55% (acetonitrile/water by volume). The retention times of 18.8 minute (HTMA) and 21.2 minute (HTMB) were prepared from Streptomyces spectabilis CCTCC M2017417 and htmP respectively.

(74) (4) Identification

(75) High-resolution mass spectrometry detection (FIG. 12 (HTMA) and FIG. 19 (HTMB)) and nuclear magnetic resonance spectroscopy identification (FIGS. 1318 (HTMA) and 2025 (HTMB)) were performed on HTMA and HTMB. The nuclear magnetic data attribution data is shown in Table 4. The molecular formula of HTMA was determined to be C.sub.51H.sub.66N.sub.7O.sub.12, m/z 968.4756 ([M+H].sup.+, theoretical values C.sub.51H.sub.66N.sub.7O.sub.12, 968.4764) by high-resolution mass spectrometry. .sup.1H spectrum shows that it contains 18 olefin proton signals, 5 amino/amide proton signals, and 8 methyl proton signals (including two oxygen-containing methyl groups at .sub.H 3.23, 3.57 and one nitrogen-containing methyl group methyl group at .sub.H 2.88), 5 methylene and 6 methylene proton signals. The remaining undisclosed signals in the .sup.1H spectrum was further attributed by combining .sup.13C-NMR and HSQC spectra. The results showed that HTMA contained 15 quaternary carbons, including 8 amide or ester carbonyls and 7 sp.sup.2 unsaturated quaternary carbons. The correlation signals of NH-1/H-2, H-4/H-5/H-6/H-7 in the .sup.1H-.sup.1H COSY spectrum, as well as the correlation signals of NH-1/C-3, C-9; H-2/C-3, C-8, and C-9; H-4/C-3, C-6, C-8, C-9; H-5/C-4, C-6, C-7, C-9; H-7/C-5, C-6, C-8, C-9 in the HMBC spectrum indicate the presence of a C-3 substituted indole structural unit in the compound. And the chemical shifts of the two amide carbonyls .sub.C167.8 (C-13), 171.2 (C-16), together with a separate methoxy signal at (.sub.H 3.57, .sub.C 51.8), as well as the signals of H3-18/C-17, C-14; H-17/C-13, C-14, C-18; H-11/C-3, C-10, C-16; NCH.sub.3/C-11, C-13 in the HMBC correlation, indicates the presence of ring opening dipeptide structural units. The relevant signals in .sup.1H-.sup.1H COSY and HMBC further classified the signals as six spin coupled fragments of C-20/C-21 (21-OCH3)/C-22; C-25/C-26; C-29/C-30/C-31/C-32/C-33/C-34/C-35; C-37/C-38/C-42; C-45/C-46/C-47/C-48/C-49; C-52/C-53/C-54/C-55/C-56. The HMBC correction of H-20/C-19, C-24; NH-23/C-19, C-20, C-24; NH-27/C-24, C-25, C-28, C-29; H-29/C-28; H-35/C-36, C-37, C-40, C-41; H-38/C-40, C-36; H-42/C-44; H-46/C-44, C-47; H-47/C-44, C-48, C-49; H-48/C-47, C-51; NH-50/C-48, C-51, C-52 further connect these spin coupled fragments into a long fragment of C19-C56. This long fragment is further connected to the dipeptide moiety through peptide bonds formed by C-19, which corresponds to its chemical shift of .sub.C 168.2 (C-19). The nuclear magnetic resonance data of the compound isolated from the gene knockout mutant strain htmP is very similar to that of HTMA, with the only difference being that one O atom is missing on high-resolution mass spectrometry, and its C42 hypomethoxy signal is replaced by a methylene signal. In summary, these two new compounds were identified and named as HTMA and HTMB respectively, their structural were shown in FIG. 1.

(76) TABLE-US-00004 TABLE 4 .sup.13C and .sup.1H NMR data of HTMA and HTMB HTMA HTMB .sub.H, multi. .sub.H, multi. Position (J in Hz) .sub.C, type (J in Hz) .sub.C, type 1 10.83, brs 10.84, d (18) 2 7.13, brs 123.5, CH 7.12, m 123.5, CH 3 109.8, C.sup. 109.8, C.sup. 4 7.53, d (7.2) 118.2, CH 7.54, d (1H, m) 118.1, CH 5 6.97, t (7.2) 118.3, CH 6.97, t (7.2) 118.4, CH 6 7.07, t (7.8) 120.9, CH 7.06, t (6.8) 121.0, CH 7 7.34, d (7.8) 111.4, CH 7.34, d (7.6) 111.4, CH 8 136.1, C.sup. 136.1, C.sup. 9 127.0, C.sup. 127, C 10 3.29, m; 3.09, m .sup.24.0, CH.sub.2 3.29, m; 3.09, m .sup.24, CH.sub.2 11 5.01, m 57.5, CH 5.03, m 57.5, CH 12NCH.sub.3 2.88, s .sup.34.4, CH.sub.3 2.90, s .sup.34.4, CH.sub.3 13 167.8, C.sup. 167.8, C.sup. 14 130.5, C.sup. 130.3, C.sup. 16 171.2, C.sup. 171.1, C.sup. 16OCH.sub.3 3.57, s .sup.51.8, CH.sub.3 3.59, s .sup.51.7, CH.sub.3 17 5.15, q (7.2) 119.5, CH 5.15, m 119.5, CH 18 1.62, m .sup.12.2, CH.sub.3 1.62, m .sup.12.2, CH.sub.3 19 168.2, C.sup. 168.1, C.sup. 20 4.52, m 57.4, CH 4.53, m 57.3, CH 21 3.74, m 76.1, CH 3.74, m 76.1, CH 21OCH.sub.3 3.23, s .sup.56.2, CH.sub.3 3.24, s .sup.56.2, CH.sub.3 22 1.12, d (6) .sup.15.7, CH.sub.3 1.11, d (6) .sup.15.7, CH.sub.3 23 8.11, d (8.4) 8.11, d (8.4) 24 164.4, C.sup. 164.4, C.sup. 25 136.2, C.sup. 136.2, C.sup. 26 5.51, d (14.4); .sup.104.7, CH.sub.2 5.51, m; 6.06, 1H, m .sup.104.7, CH.sub.2 6.07, d (14.4) 27 9.36, s 9.31, d 28 164.7, C.sup. 164.7, C.sup. 29 6.27, d (15.6) 123.1, CH 6.26, m 123.1, CH 30 7.09, dd (15.6, 10.8) 141.0, CH 7.08, m 141, CH 31 6.21, m 128.9, CH 6.21, m 128.9, CH 32 6.18, dt (15.0, 6.6) 142.3, CH 6.19, m 142.3, CH 33 2.16, q (7.2) .sup.31.7, CH.sub.2 2.15, m .sup.31.7, CH.sub.2 34 1.6, m .sup.25.1, CH.sub.2 1.58, m .sup.25, CH.sub.2 35 2.28, t (7.2) .sup.35.3, CH.sub.2 2.25, t (7.6) .sup.35.2, CH.sub.2 36 163.7, CH 164.0, CH 37 2.47, t (8) .sup.28.6, CH.sub.2 2.33, m .sup.30.2, CH.sub.2 38 4.37, m 77.2, CH 4.46, m 75.5, CH 40 161.6, C.sup. 161.6, C.sup. 41 5.74, s 114.6, CH 5.72, s 114.5 CH 42 5.35, m 73.3, CH 3.39, m .sup.42.4, CH.sub.2 43 8.22, d (8.4) 8.05, d (8.4) 44 168.3, C.sup. 168.6, C.sup. 45 130.5, C.sup. 130.3, C.sup. 46 1.83, s .sup.12.8, CH.sub.3 1.83, s .sup.12.8, CH.sub.3 47 6.13, d (7.8) 137.4, CH 6.14, m 137.1, CH 48 4.63, dd (14.4, 6.6) 42.4, CH 4.65, m 42.3, CH 49 1.16, d (6.6) .sup.20.3, CH.sub.3 1.14, d (6.8) .sup.20.4, CH.sub.3 50 8.14, d (7.8) 8.14, d (7.8) 51 164.6, C.sup. 164.3, C.sup. 52 5.57, d (11.4) 119.1, CH 5.57, d (11.2) 119.1, CH 53 6.35, t (11.4) 140.1, CH 6.35, t (11.2) 140.1, CH 54 7.49, m 128.6, CH 7.48, m 128.6, CH 55 5.94, m 136.9, CH 5.93, m 136.8, CH 56 1.78, d (6.6) .sup.18.3, CH.sub.3 1.78, d (6.8) .sup.18.3, CH.sub.3

Example 4. Cellular Assay for Hepatoprotective Activity of HTMA, HTMB and HTMP

(77) HepG2 cells were seeded into 24-well plates and kept at 37 C. in 5% CO.sub.2 in order to achieve 80% fusion. To evaluate the effects of HTMA, HTMB, and HTMP on aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activity, and compare the results with those of Silymarin (positive control) (FIG. 26), a cellular assay for hepatoprotective activity was carried out using a CCl.sub.4-induced liver injury cell model. The cells were treated with the compounds followed by ultrasound disruption and cell homogenization to prepare the cell homogenates for analysis.

(78) The results of the cellular assay for hepatoprotective activity using the liver injury cell model showed that compared with the blank control group, both ALT and AST levels significantly increased in the CCl.sub.4 group, indicating successful modeling. Compared with the CCl.sub.4 group, all three compounds, HTMA, HTMB, and HTMP, significantly reduced ALT and AST levels, suggesting that they have hepatoprotective activity.

Example 5. Animal Assay for Hepatoprotective Activity of HTMA

(79) Male Wistar rats weighing around 220 g were randomly divided into 7 groups with 12 rats in each group. After grouping, they were fed a standard diet under standard conditions and were orally gavaged continuously. The dosages of the positive control groups obeticholic acid and silymarin were 10 mg/kg and 5 mg/kg respectively. The HTMA group was divided into low, medium, and high-dose groups with doses of 2.5, 5, and 10 mg/kg. The control and model groups were orally gavaged with 0.5% sodium carboxymethyl cellulose (solvent) daily. After 7 days of gavage, the rats fasted for 12 hours. On the 8th day, their weight was measured, and all rats except for the control group were intraperitoneally injected with alpha-naphthyl isothiocyanate (50 mg/kg, dissolved in olive oil) to induce liver injury. The rats in the control group were intraperitoneally injected with the same amount of olive oil. After two more days of gavage and 12 hours of fasting, blood samples were taken to detect biochemical indicators reflecting the degree of liver cell damage (FIGS. 27A27C) and bile stasis (FIGS. 28A28E), and liver immunohistochemical detection was performed (FIGS. 29A, 29B and 30A30F).

(80) The results of the biochemical indicators testing showed that all indicators in the liver injury model group were significantly higher than those in the control group, indicating the success of the model induction. Compared with the liver injury model group, high-dose HTMA (HH) could significantly reduce the levels of ALT, AST, LDH, TBA, TBIL, GGT, and ALP, confirming that HTMA has an anti-liver injury and bile stasis effect. Medium and low dose HTMA (MH and LH), obeticholic acid (OBC), and silymarin(S) all significantly reduced LDH levels but their effects on other biochemical indicators were weaker than that of high-dose HTMA, indicating that high-dose HTMA has a stronger anti-bile stasis and liver injury effect.

(81) The immunohistochemistry test results showed that compared with the control group, the liver injury model group had mild overall tissue swelling, slight dilation of some liver sinuses, and a small amount of hepatocyte steatosis. The lipid droplets were located on one side of the cell nucleus, and there was fibrosis proliferation around the central vein with many inflammatory cells infiltrating, confirming the success of the model induction (FIG. 29A and FIG. 29B). Compared with the liver injury model group, all HTMA administration groups had normal liver portal structures, regular arrangement of liver cells into liver plates, radial arrangement of liver plates centered on the central vein, normal liver sinus size, occasional inflammatory cell infiltration around blood vessels, no edema or other pathological changes indicating that all doses of HTMA had a therapeutic effect on the pathological conditions of liver tissue damage (FIG. 30AFIG. 30F).

Example 6. HTMA Protects the Cell Membrane of HepG2

(82) Well-growing HepG2 cells were plated into confocal dishes with 1 mL of cell suspension containing 510.sup.5 cells per dish. After 24 hours of incubation, pre-treat the cells with HTMA for 12 hours. The culture medium was removed from the confocal dish, then phenol red-free DMEM medium was added to the control group, 70% CCl.sub.4 injury fluid was added to the model and treatment groups. The dishes were placed in a 37 C. incubator for 1 hour to induce liver injury. After modeling, the culture medium was removed, the cells were rinsed with PBS, and fixed with 4% paraformaldehyde at room temperature for 10 minutes. Then the cells were rinsed with PBS three times, each time for 5 minutes. 10 M DiO was added to the dish and stained the cells at room temperature for 30 minutes. Then the cells were rinsed with PBS three times, each time for 5 minutes. DAPI was dropped to counterstain the cell nucleus, incubating it in the dark for 30 minutes, and then the cells were rinsed with PBS three times. The images of the cells were captured using a laser scanning confocal microscope (Leica TCS SP8). The experimental design includes two positive controls: silymarin(S) and obeticholic acid (OBC).

(83) According to the results shown in FIG. 31, the detection of the liver injury cell model showed that compared with the control group, the fluorescence-labeled cell membrane in the control group was relatively smooth and had a regular morphology. In contrast, the fluorescence-labeled cell membrane in the model group was rough, with many irregular protrusions and gaps, indicating that the cell membrane was damaged and the modeling was successful.

(84) Compared with the model group, the HTMA group had a more regular cell membrane morphology, with only occasional gaps present, but fewer than in the model group, indicating that HTMA has a protective effect on the cell membrane.

Example 7. The Anti-Inflammatory Effect of HTM and its Derivatives in Inflammatory Model Induced by Carrageenan

(85) Male Kunming mice weighing 1822 g were adaptively reared for 1 day, and then randomly divided into 10 groups (56 mice per group): the saline+solvent group, the saline+HTM group, the saline+HTMP group, the saline+HTMA group, the saline+HTMB group, the saline+rapamycin (250 nM) group, the carrageenan+solvent group, the carrageenan+HTM group, the carrageenan+HTMP group, the carrageenan+HTMA group, the carrageenan+HTMB group, and the carrageenan+rapamycin (250 nM) group. Where doses used for HTM, HTMP, HTMA, and HTMB were set at 1, 3, and 10 mg/mL, and their solutions all contained 5% DMSO. Experiments were designed based on previous studies (Zhang et al., 2018). Carrageenan was used to induce paw inflammation, and the experimental procedure was as follows:

(86) (1) The thickness of the right hind foot of mice was measured with a vernier caliper before the experiment, and the measurement site was marked.

(87) (2) The experimental group was then subcutaneously injected into the right hind paw with 10 L of different concentrations of compound solutions. The control group was injected with 10 L saline into the right hind paw.

(88) (3) After administration, the carrageenan group was injected subcutaneously with 30 L of 1% carrageenan solution into the right hind paw, and the other groups were injected with an equal volume of saline. The thickness of the right hind foot of each mouse was measured at the same site every 1 hour for the following 4 hours to observe the effect of the compounds on the change in foot thickness.

(89) The results showed (FIGS. 32A32F, 33 and 34) that, compared with the carrageenan+solvent group, the right hind foot thickness in the carrageenan+HTMP (10 mg/mL) group, the carrageenan+HTMA (10 mg/mL) group, and the carrageenan+HTMB (10 mg/mL) group was reduced after 4 hours of carrageenan injection (P<0.05). And the carrageenan+HTMB (10 mg/mL) group showed significant differences compared with the carrageenan+HTMP (10 mg/mL) group and the carrageenan+HTMA (10 mg/mL) group. Moreover, HE staining results showed that there was a statistical difference in the number of leukocytes per unit area between the carrageenan+HTMB (10 mg/mL) group and the carrageenan+solvent group relative to the control group (P<0.05). The above results indicated that HTMP, HTMA, and HTMB could improve the inflammation caused by carrageenan. Among them, HTMB showed the best results.

Example 8. The Effect of Analgesic of HTMB in the Writhing Test

(90) The writhing test: Male Balb/c mice weighting 1822 g were randomly divided into four groups (910 per group): the vehicle group (DMSO:saline=1:4, 1 ml/kg), the HTMB (1 mg/kg) group, the HTMB (3 mg/kg) group, and the HTMB (10 mg/kg) group. After tail vein administration for 30 minutes, mice were injected intraperitoneally with 10 mL/kg of freshly prepared 0.6% acetic acid (Rediet Tesfaye, et al. 2020), and the number of body twists of mice was observed and recorded within 20 minutes. The experimental results showed (FIG. 35) that the number of body twists in the HTMB (3 mg/kg) and HTMB (10 mg/kg) groups was significantly lower than that in the solvent group (P<0.05). It indicates that HTMB has an analgesic effect on acute inflammatory visceral pain caused by acetic acid.

Example 9. The Effect of HTMB for Prevention and Treatment on Drug Addiction

(91) Conditioned place preference (CPP) experiments: Morphine, an opioid representative, and cocaine, a euphoric representative, were used to establish a model of addiction. On the first day, the baseline was assessed by placing the rats in the center compartment of the CPP apparatus and allowing ad libitum access to all compartments for 15 minutes. And then, male SD rats were divided into the saline+morphine group, the HTMB (3 mg/kg)+morphine group, the saline+cocaine group, and the HTMB (3 mg/kg, i.p.)+cocaine group. The rats were exposed to CPP training from day 2 to 9. On the 10th day, the channel between the three boxes was opened, and the rats were allowed to move freely in the three boxes for 15 minutes for the CPP test.

(92) The results showed that there was a difference in CPP scores in the saline+morphine group and the HTMB+morphine group (P<0.05), indicating that HTMB could inhibit morphine-induced CPP.

(93) Drug reward memory reconsolidation: Morphine, an opioid representative, and cocaine, a euphoric representative, were used to establish model addiction. On the first day, baseline was assessed by placing the rats in the center compartment of the CPP apparatus and allowing ad libitum access to all compartments for 15 minutes. And then, male SD rats were divided into the saline+morphine group, the HTMB (3 mg/kg)+morphine group, the saline+cocaine group, and the HTMB (3 mg/kg, i.p.)+cocaine group. The rats were exposed to CPP training from day 2 to 9. On the 10th day, the channel between the three boxes was opened, and the rats were allowed to move freely in the three boxes for 15 minutes for the CPP test. On the 11th day, the CPP expressing rats screened for CPP formation were divided into four groups: the group I (morphine+saline), the group II (morphine+3 mg/kg HTMB), the group III (cocaine+saline), and the group IV (cocaine+3 mg/kg HTMB). After exposure to drug-paired box for 10 minutes, groups I and III were injected with saline (1 ml/kg, i.p.), and the groups II and IV were injected with HTMB (3 mg/kg, i.p.). 24 hours after injection, we defined this as 1 day of activation of the reward memory. The CPP scores were measured on the 7th day after reward memory activation. The results showed that there was a significant difference in CPP scores between the groups I and II (P<0.05), and there was a significant difference in CPP scores between the groups III and IV (P<0.05). These results suggest that HTM could inhibit morphine and cocaine reward memory reconsolidation in rats.

(94) The above experimental results (FIGS. 36, 37A and 37B) indicate that HTMB has the effect of preventing and treating drug addiction.

Example 10. Determination for Antioxidant Activity of HTM and its Derivatives

(95) In this experiment, a 0.1 mM DPPH solution was prepared with ethanol, and each sample solution/dispersion was separately mixed with the DPPH solution in order to dilute it into a reaction product with a concentration gradient of 150 g/mL to evaluate the concentration-dependent antioxidant potential. The reaction product was measured for its absorbance (A.sub.S) at 517 nm using an ultraviolet-visible spectrophotometer, and its antioxidant activity was measured using DPPH removal as an indicator. The percentage of DPPH free radical scavenging is calculated by the following formula:

(96) $\mathrm{Scavenging}\mathrm{activity}=\left[\left(A_0-A_S\right)/A_0\right]100$

(97) A.sub.S is the absorbance of the sample and A.sub.0 is the absorbance of the control (only DPPH solution).

(98) These results show that HTM, HTMB, and HTMP have antioxidant capacity, while HTMA does not (FIG. 38).

Example 11. Determination for Antitumor Activity of HTM and its Derivatives

(99) In a 96-well microplate, 100 L of culture medium was put in each well and inoculate four cell strains with a fusion degree of 80% at a density of 810.sup.3 cells. Cells were grown at 37 C., CO.sub.2 (5%) and air (95%). Each 96-well plate was placed with a concentration gradient of 0100 g/mL of test compounds HTM, HTMA, HTMB, and HTMP. After 24 hours of incubation, the medium was removed, and 0.5 mg/mL MTT solution was added to each medium with cells and continue to incubate the cells for 4 hours at 37 C. Then 100 L of DMSO was added to dissolve formazan crystals. Finally, absorbance was measured at 570 nm using a microplate reader (Bioteck EON, USA). The viability of the cells was calculated as the percentage of cell viability compared to vehicle control-treated cells, which were arbitrarily assigned as 100% viability. Each independent experiment was repeated five times. (*P<0.05, **P<0.01, ***P<0.001)

(100) $\mathrm{Cell}\mathrm{survival}\mathrm{rate}\left(\%\right)=(\mathrm{The}\mathrm{absorbance}\mathrm{of}\mathrm{experimental}\mathrm{group}-\mathrm{The}\mathrm{absorbance}\mathrm{of}\mathrm{blank}\mathrm{group}/\left(\mathrm{The}\mathrm{absorbance}\mathrm{of}\mathrm{control}\mathrm{group}-\mathrm{The}\mathrm{absorbance}\mathrm{of}\mathrm{blank}\mathrm{group}\right)100\%.$

(101) The results (FIG. 39) showed that HTMP had strong anti-cancer activity. At a concentration of 50 g/mL, HTMP significantly inhibited the survival rate of bladder cancer, renal cancer, liver cancer, and breast cancer (P<0.01). At a concentration of 50 g/mL, HTM and HTMB both significantly inhibited the survival rate of bladder cancer, renal cancer, and breast cancer (bladder cancer, P<0.01; renal cancer, P<0.01; breast cancer, P<0.05). At a concentration of 50 g/mL, HTMA significantly inhibited the survival rate of bladder cancer and breast cancer (P<0.01).