MEASUREMENT OF NITROGEN FIXATION AND INCORPORATION
20250369878 ยท 2025-12-04
Inventors
- Kent Wood (Berkeley, CA, US)
- Russell Brown (Berkeley, CA, US)
- Jeremy Gage (Berkeley, CA, US)
- Rikke Rasmussen (Berkeley, CA, US)
- Paul Raine (Berkeley, CA, US)
- Sarah BLOCH (Berkeley, CA, US)
- Alvin TAMSIR (Berkeley, CA, US)
- Karsten TEMME (Berkeley, CA, US)
- Bilge Ozaydin Eskiyenenturk (Berkeley, CA, US)
Cpc classification
A01G29/00
HUMAN NECESSITIES
Y02A40/25
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A01N63/20
HUMAN NECESSITIES
A01G9/18
HUMAN NECESSITIES
A01H1/12
HUMAN NECESSITIES
International classification
A01N63/20
HUMAN NECESSITIES
A01G7/04
HUMAN NECESSITIES
A01G9/18
HUMAN NECESSITIES
A01G9/24
HUMAN NECESSITIES
G01N33/00
PHYSICS
A01H1/00
HUMAN NECESSITIES
Abstract
Systems for plant culture include a chamber featuring one or more walls enclosing a spatial volume internal to the chamber, where the one or more walls include a surface for supporting a plant within the enclosed spatial volume, a gas delivery apparatus with at least one gas source, a nutrient delivery apparatus with a reservoir, a sampling apparatus connected to a port formed in the one or more walls, and a controller configured so that during operation of the system, the controller activates the nutrient delivery apparatus to deliver an aqueous growth medium to the plant, and activates the gas delivery apparatus to deliver into the enclosed spatial volume a mixture of isotopically-substituted gases. Also provided are methods of use of the system for measuring nitrogen in a plant and for identifying microbes capable of providing fixed nitrogen to a plant.
Claims
1. A method of identifying a nitrogen-fixing bacterial strain, the method comprising: inoculating a test plant or a seed of a test plant with a composition comprising at least one bacterium of a candidate bacterial strain; positioning the test plant in a support medium within an enclosed chamber of a plant culture system; positioning a reference plant in a support medium within the enclosed chamber; adjusting a composition of a nitrogen gas mixture within the chamber so that a ratio of at least two nitrogen isotopes is different from a naturally occurring atmospheric ratio of the isotopes; growing the test and reference plants over a growth period within the enclosed chamber; determining relative amounts of nitrogen isotopes in test and reference plant tissues; and identifying the candidate bacterial strain as a nitrogen-fixing bacterial strain or a non-nitrogen-fixing bacterial strain based on the relative amounts of at least one nitrogen isotope in the test and reference plant tissues.
2. The method of claim 1, wherein the reference plant and a seed of the reference plant are not inoculated with a bacterium of the candidate bacterial strain.
3. The method of claim 1, wherein adjusting the composition of nitrogen gas comprises activating a gas delivery apparatus of the plant culture system to deliver nitrogen gas comprising a ratio of the at least two nitrogen isotopes that differs from a naturally occurring ratio of the at least two isotopes in atmospheric nitrogen gas.
4. The method of claim 1, wherein the at least two nitrogen isotopes comprise .sup.15N and .sup.14N.
5. The method of claim 1, wherein the at least two nitrogen isotopes comprise .sup.13N and .sup.14N.
6. The method of claim 1, wherein the at least two nitrogen isotopes comprise .sup.15N, .sup.14N, and .sup.13N.
7. The method of claim 3, wherein the delivered nitrogen gas comprises at least 20 atom % .sup.15N.
8. The method of claim 7, wherein the delivered nitrogen gas comprises at least 50 atom % .sup.15N.
9. The method of claim 7, wherein the delivered nitrogen gas comprises at least 90 atom % .sup.15N.
10. The method of claim 1, wherein following adjustment of the composition of the nitrogen gas mixture, the nitrogen gas mixture comprises at least 0.1 atom % .sup.15N or .sup.13N.
11. The method of claim 10, wherein the nitrogen gas mixture comprises at least 0.3 atom % .sup.15N or .sup.13N.
12. The method of claim 10, wherein the nitrogen gas mixture comprises at least 0.5 atom % .sup.15N or .sup.13N.
13. The method of claim 1, wherein the growth period comprises at least 7 days.
14. The method of claim 1, wherein the test and reference plant tissues each comprise root tissue.
15. The method of claim 1, wherein the test and reference plant tissues each comprise newly emerged whorl tissue.
16. The method of claim 1, wherein the test and reference plant tissues each comprises top-collared leaf tissue.
17. The method of claim 1, further comprising: harvesting the test and reference plant tissues from the test and reference plants; drying the harvested test and reference plant tissues for a drying time; grinding the dried, harvested tissues to form respective test and reference powders; and analyzing the test and reference powers to determine the relative amounts of nitrogen isotopes in the test and reference plant tissues.
18. The method of claim 1, further comprising, if a seed of the test plant is inoculated with the composition comprising the at least one bacterium of the candidate bacterial strain, depositing the seed in a support medium to induce germination of the seed to form the test plant.
19. The method of claim 18, further comprising, following formation of the test plant, withholding growth medium from the test plant for an initial period of at least 7 days following germination.
20. The method of claim 19, further comprising, following the initial period, delivering a growth medium to the test plant.
21. The method of claim 20, wherein the growth medium comprises a modified Hoaglund's solution.
22. The method of claim 18, further comprising positioning the test plant within the enclosed chamber of a plant culture system at a time at least 14 days following germination of the seed.
23. The method of claim 18, further comprising positioning the test plant within the enclosed chamber of a plant culture system at a time at least 21 days following germination of the seed.
24. The method of claim 1, further comprising, during growth of the test and reference plants over the growth period: measuring a humidity within the enclosed chamber of the plant culture system; and activating at least one of a humidifier and a de-humidifier to adjust the humidity according to a humidity reference value for the test and reference plants.
25. The method of claim 1, further comprising, during growth of the test and reference plants over the growth period: measuring an oxygen concentration within the enclosed chamber of the plant culture system; and activating a gas removal apparatus of the plant culture system to adjust the oxygen concentration according to a reference value for the test and reference plants.
26. The method of claim 1, further comprising, during growth of the test and reference plants over the growth period: measuring a carbon dioxide concentration within the enclosed chamber of the plant culture system; and activating a carbon dioxide gas source to adjust the carbon dioxide concentration according to a reference value for the test and reference plants.
27. The method of claim 1, further comprising, during growth of the test and reference plants over the growth period, adjusting a temperature within the enclosed chamber of the plant culture system by selectively activating at least one of a heating element and a cooling element of the system according to one or more temperature reference values for the test and reference plants.
28. The method of claim 1, further comprising, during growth of the test and reference plants over the growth period, activating one or more light sources of the plant culture system to deliver light to the test and reference plants according to a illumination reference information for the test and reference plants.
29. The method of claim 1, further comprising determining a relative measurement of nitrogen fixation by the at least one bacterium of the candidate strain.
30. The method of claim 29, wherein determining the relative measurement of nitrogen fixation comprises: activating an acetylene gas source to deliver a quantity of acetylene to a portion of the support medium in which the test plant is supported; after an exposure interval, measuring an amount of ethylene generated by the at least one bacterium from the quantity of acetylene; and determining a rate of acetylene reduction by the at least one bacterium based on the amount of ethylene generated.
Description
DESCRIPTION OF DRAWINGS
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163] Like reference symbols in the various drawings indicate like elements.
DETAILED DESCRIPTION
Introduction
[0164] Biological nitrogen fixation (BNF) is a process by which plant-associated microbes such as bacteria are believed to be able to provide nitrogen to host plants. Nitrogen is an important nutrient that influences plant growth. In particular, nitrogen is present in both amino acids and chlorophyll pigments, and a wide variety of biological processes, including plant-based protein synthesis and photosynthesis, therefore depend on the availability of nitrogen. When adequate soluble nitrogen is not available in a plant's growth medium, vegetative growth may be retarded and fruit production attenuated.
[0165] Typically, fixation of atmospheric nitrogen gas to yield soluble ammonia occurs via naturally occurring microbes such as bacteria. Nitrogenases present in the bacteria catalyze atmospheric nitrogen reduction. Significant research activity is currently directed to engineering improved microbes that enhance reductive conversion of atmospheric nitrogen to ammonia. An important aspect of this activity is measurement of nitrogen incorporation in plant tissues, and evaluation of engineered microbe strains for their nitrogen fixing activity.
Regulation of Nitrogen Fixation
[0166] In some cases, nitrogen fixation pathway may act as a target for genetic engineering and optimization. One trait that may be targeted for regulation is nitrogen fixation. Nitrogen fertilizer is the largest operational expense on a farm and the biggest driver of higher yields in row crops like corn and wheat. While some endophytes have the genetics necessary for fixing nitrogen in pure culture, the fundamental technical challenge is that wild-type endophytes of cereals and grasses stop fixing nitrogen in fertilized fields. The application of chemical fertilizers and residual nitrogen levels in field soils signal the microbe to shut down the biochemical pathway for nitrogen fixation.
[0167] Changes to the transcriptional and post-translational levels of components of the nitrogen fixation regulatory network may be beneficial to the development of a microbe capable of fixing and transferring nitrogen to corn in the presence of fertilizer.
[0168] In order to utilize elemental nitrogen (N) for chemical synthesis, life forms combine nitrogen gas (N2) available in the atmosphere with hydrogen in a process known as nitrogen fixation. Because of the energy-intensive nature of biological nitrogen fixation, diazotrophs (bacteria and archaea that fix atmospheric nitrogen gas) have evolved sophisticated and tight regulation of the nif gene cluster in response to environmental oxygen and available nitrogen. Nif genes encode enzymes involved in nitrogen fixation (such as the nitrogenase complex) and proteins that regulate nitrogen fixation. Shamseldin (2013. Global J. Biotechnol. Biochem. 8(4):84-94) discloses detailed descriptions of nif genes and their products, and is incorporated herein by reference. Described herein are methods of producing a plant with an improved trait comprising isolating bacteria from a first plant, introducing a genetic variation into a gene of the isolated bacteria to increase nitrogen fixation, exposing a second plant to the variant bacteria, isolating bacteria from the second plant having an improved trait relative to the first plant, and repeating the steps with bacteria isolated from the second plant.
[0169] In Proteobacteria, regulation of nitrogen fixation centers around the 54-dependent enhancer-binding protein NifA, the positive transcriptional regulator of the nif cluster. Intracellular levels of active NifA are controlled by two key factors: transcription of the nifLA operon, and inhibition of NifA activity by protein-protein interaction with NifL. Both of these processes are responsive to intracellular glutamine levels via the PII protein signaling cascade. This cascade is mediated by GlnD, which directly senses glutamine and catalyzes the uridylylation or deuridylylation of two PII regulatory proteinsGlnB and GlnKin response the absence or presence, respectively, of bound glutamine. Under conditions of nitrogen excess, unmodified GlnB signals the deactivation of the nifLA promoter. However, under conditions of nitrogen limitation, GlnB is post-translationally modified, which inhibits its activity and leads to transcription of the nifLA operon. In this way, nifLA transcription is tightly controlled in response to environmental nitrogen via the PII protein signaling cascade. On the post-translational level of NifA regulation, GlnK inhibits the NifL/NifA interaction in a matter dependent on the overall level of free GlnK within the cell.
[0170] NifA is transcribed from the nifLA operon, whose promoter is activated by phosphorylated NtrC, another 54-dependent regulator. The phosphorylation state of NtrC is mediated by the histidine kinase NtrB, which interacts with deuridylylated GlnB but not uridylylated GlnB. Under conditions of nitrogen excess, a high intracellular level of glutamine leads to deuridylylation of GlnB, which then interacts with NtrB to deactivate its phosphorylation activity and activate its phosphatase activity, resulting in dephosphorylation of NtrC and the deactivation of the nifLA promoter. However, under conditions of nitrogen limitation, a low level of intracellular glutamine results in uridylylation of GlnB, which inhibits its interaction with NtrB and allows the phosphorylation of NtrC and transcription of the nifLA operon. In this way, nifLA expression is tightly controlled in response to environmental nitrogen via the PII protein signaling cascade. nifA, ntrB, ntrC, and glnB, are all genes that can be mutated in the methods described herein. These processes may also be responsive to intracellular or extracellular levels of ammonia, urea or nitrates.
[0171] The activity of NifA is also regulated post-translationally in response to environmental nitrogen, most typically through NifL-mediated inhibition of NifA activity. In general, the interaction of NifL and NifA is influenced by the PII protein signaling cascade via GlnK, although the nature of the interactions between GlnK and NifL/NifA varies significantly between diazotrophs. In Klebsiella pneumoniae, both forms of GlnK inhibit the NifL/NifA interaction, and the interaction between GlnK and NifL/NifA is determined by the overall level of free GlnK within the cell. Under nitrogen-excess conditions, deuridylylated GlnK interacts with the ammonium transporter AmtB, which serves to both block ammonium uptake by AmtB and sequester GlnK to the membrane, allowing inhibition of NifA by NifL. On the other hand, in Azotobacter vinelandii, interaction with deuridylylated GlnK is required for the NifL/NifA interaction and NifA inhibition, while uridylylation of GlnK inhibits its interaction with NifL. In diazotrophs lacking the nifL gene, there is evidence that NifA activity is inhibited directly by interaction with the deuridylylated forms of both GlnK and GlnB under nitrogen-excess conditions. In some bacteria the Nif cluster may be regulated by glnR, and further in some cases this may comprise negative regulation.
[0172] Regardless of the mechanism, post-translational inhibition of NifA is an important regulator of the nif cluster in most known diazotrophs. Additionally, nifL, amtB, glnK, and glnR are genes that can be mutated in the methods described herein.
[0173] In addition to regulating the transcription of the nif gene cluster, many diazotrophs have evolved a mechanism for the direct post-translational modification and inhibition of the nitrogenase enzyme itself, known as nitrogenase shutoff. This is mediated by ADPribosylation of the Fe protein (NifH) under nitrogen-excess conditions, which disrupts its interaction with the MoFe protein complex (NifDK) and abolishes nitrogenase activity. DraT catalyzes the ADPribosylation of the Fe protein and shutoff of nitrogenase, while DraG catalyzes the removal of ADP-ribose and reactivation of nitrogenase. As with nifLA transcription and NifA inhibition, nitrogenase shutoff is also regulated via the PII protein signaling cascade. Under nitrogen-excess conditions, deuridylylated GlnB interacts with and activates DraT, while deuridylylated GlnK interacts with both DraG and AmtB to form a complex, sequestering DraG to the membrane. Under nitrogen-limiting conditions, the uridylylated forms of GlnB and GlnK do not interact with DraT and DraG, respectively, leading to the inactivation of DraT and the diffusion of DraG to the Fe protein, where it removes the ADP-ribose and activates nitrogenase. The methods described herein also contemplate introducing genetic variation into the nifH, nifD, nifK, and draT genes.
[0174] Although some endophytes have the ability to fix nitrogen in vitro, often the genetics are silenced in the field by high levels of exogenous chemical fertilizers. One can decouple the sensing of exogenous nitrogen from expression of the nitrogenase enzyme to facilitate field-based nitrogen fixation. Improving the integral of nitrogenase activity across time further serves to augment the production of nitrogen for utilization by the crop. Specific targets for genetic variation to facilitate field-based nitrogen fixation using the methods described herein include one or more genes selected from the group consisting of nifA, nifL, ntrB, ntrC, glnA, glnB, glnK, draT, amtB, glnD, glnE, nifJ, nifH, nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB, and nifQ.
[0175] An additional target for genetic variation to facilitate field-based nitrogen fixation using the methods described herein is the NifA protein. The NifA protein is typically the activator for expression of nitrogen fixation genes. Increasing the production of NifA (either constitutively or during high ammonia condition) circumvents the native ammonia-sensing pathway. In addition, reducing the production of NifL proteins, a known inhibitor of NifA, also leads to an increased level of freely active NifA. In addition, increasing the transcription level of the nifAL operon (either constitutively or during high ammonia condition) also leads to an overall higher level of NifA proteins. Elevated level of nifAL expression is achieved by altering the promoter itself or by reducing the expression of NtrB (part of ntrB and ntrC signaling cascade that originally would result in the shutoff of nifAL operon during high nitrogen condition). High level of NifA achieved by these or any other methods described herein increases the nitrogen fixation activity of the endophytes.
[0176] Another target for genetic variation to facilitate field-based nitrogen fixation using the methods described herein is the GlnD/GlnB/GlnK PII signaling cascade. The intracellular glutamine level is sensed through the GlnD/GlnB/GlnK PII signaling cascade. Active site mutations in GlnD that abolish the uridylyl-removing activity of GlnD disrupt the nitrogen-sensing cascade. In addition, reduction of the GlnB concentration short circuits the glutamine-sensing cascade. These mutations trick the cells into perceiving a nitrogen-limited state, thereby increasing the nitrogen fixation level activity. These processes may also be responsive to intracellular or extracellular levels of ammonia, urea or nitrates.
[0177] The amtB protein is also a target for genetic variation to facilitate field-based nitrogen fixation using the methods described herein. Ammonia uptake from the environment can be reduced by decreasing the expression level of amtB protein. Without intracellular ammonia, the endophyte is not able to sense the high level of ammonia, preventing the down-regulation of nitrogen fixation genes. Any ammonia that manages to get into the intracellular compartment is converted into glutamine. Intracellular glutamine level is the major currency of nitrogen sensing. Decreasing the intracellular glutamine level prevents the cells from sensing high ammonium levels in the environment. This effect can be achieved by increasing the expression level of glutaminase, an enzyme that converts glutamine into glutamate. In addition, intracellular glutamine can also be reduced by decreasing glutamine synthase (an enzyme that converts ammonia into glutamine). In diazotrophs, fixed ammonia is quickly assimilated into glutamine and glutamate to be used for cellular processes. Disruptions to ammonia assimilation may enable diversion of fixed nitrogen to be exported from the cell as ammonia. The fixed ammonia is predominantly assimilated into glutamine by glutamine synthetase (GS), encoded by glnA, and subsequently into glutamine by glutamine oxoglutarate aminotransferase (GOGAT). In some examples, glnS encodes a glutamine synthetase. GS is regulated post-translationally by GS adenylyl transferase (GlnE), a bi-functional enzyme encoded by glnE that catalyzes both the adenylylation and de-adenylylation of GS through activity of its adenylyl-transferase (AT) and adenylyl-removing (AR) domains, respectively. Under nitrogen limiting conditions, glnA is expressed, and GlnE's AR domain de-adynylylates GS, allowing it to be active. Under conditions of nitrogen excess, glnA expression is turned off, and GlnE's AT domain is activated allosterically by glutamine, causing the adenylylation and deactivation of GS.
[0178] Furthermore, the draT gene may also be a target for genetic variation to facilitate field-based nitrogen fixation using the methods described herein. Once nitrogen fixing enzymes are produced by the cell, nitrogenase shut-off represents another level in which cell downregulates fixation activity in high nitrogen condition. This shut-off could be removed by decreasing the expression level of DraT.
[0179] Methods for imparting new microbial phenotypes can be performed at the transcriptional, translational, and post-translational levels. The transcriptional level includes changes at the promoter (such as changing sigma factor affinity or binding sites for transcription factors, including deletion of all or a portion of the promoter) or changing transcription terminators and attenuators. The translational level includes changes at the ribosome binding sites and changing mRNA degradation signals. The post-translational level includes mutating an enzyme's active site and changing protein-protein interactions. These changes can be achieved in a multitude of ways. Reduction of expression level (or complete abolishment) can be achieved by swapping the native ribosome binding site (RBS) or promoter with another with lower strength/efficiency. ATG start sites can be swapped to a GTG, TTG, or CTG start codon, which results in reduction in translational activity of the coding region. Complete abolishment of expression can be done by knocking out (deleting) the coding region of a gene. Frameshifting the open reading frame (ORF) likely will result in a premature stop codon along the ORF, thereby creating a non-functional truncated product. Insertion of in-frame stop codons will also similarly create a non-functional truncated product. Addition of a degradation tag at the N or C terminal can also be done to reduce the effective concentration of a particular gene.
[0180] Conversely, expression level of the genes described herein can be achieved by using a stronger promoter. To ensure high promoter activity during high nitrogen level condition (or any other condition), a transcription profile of the whole genome in a high nitrogen level condition could be obtained and active promoters with a desired transcription level can be chosen from that dataset to replace the weak promoter. Weak start codons can be swapped out with an ATG start codon for better translation initiation efficiency. Weak ribosomal binding sites (RBS) can also be swapped out with a different RBS with higher translation initiation efficiency. In addition, site-specific mutagenesis can also be performed to alter the activity of an enzyme.
[0181] Increasing the level of nitrogen fixation that occurs in a plant can lead to a reduction in the amount of chemical fertilizer needed for crop production and reduce greenhouse gas emissions (e.g., nitrous oxide).
Measurement of Nitrogen Incorporation
[0182] Most studies to date have relied on proxy or short term measurements to determine whether fixed nitrogen produced by plant-associated microbes is incorporated by plant tissues. Such techniques include, for example, .sup.15N dilution measurements in which .sup.15N depletion in nitrogen gas is measured and is adopted as a representation of nitrogen-reducing activity of particular microbes. These techniques also include acetylene reduction measurements, in which the rate of acetylene reduction to ethylene by particular microbes is adopted as a representation of the microbes' nitrogenase activity.
[0183] The present disclosure features systems and methods for measuring nitrogen incorporation by plant tissues. When the parent plants are inoculated with naturally-occurring or engineered nitrogen-fixing microbes, measurements of nitrogen incorporation can be used directly assess the nitrogen fixing activity of the microbes. In particular, the systems and methods described can adjust ratios of different nitrogen isotopes in the nitrogen gas environment of the plants, so that nitrogen present in plant tissues following a growth cycle can be attributed more directly to microbe-mediated nitrogen fixation. Further, the systems and methods can be used to investigate the provision of fixed nitrogen to different plant tissues, and can provide periodic measurements of nitrogen incorporation at different stages of a growth cycle.
Plant Growth and Measurement Systems
[0184]
[0185] Chamber 102 can include any number of walls suitable for enclosing spatial volume 104, and the wall(a)s can define any shape for chamber 102. In some embodiments, for example, the wall(s) define a cubic or rectangular prismatic shape for chamber 102. In certain embodiments, the wall(s) define a spherical or elliptical shape for chamber 102. More generally, the wall(s) can define any regular or irregular shape for chamber 102.
[0186] As shown in
[0187] In certain embodiments, as shown in
[0188] In general, the enclosed spatial volume 104 of chamber 102 can be selected as desired to accommodate one or more plants and gases delivered to the plants. In some embodiments, for example, the enclosed spatial volume can be 100 L or more (e.g., 200 L or more, 300 L or more, 400 L or more, 500 L or more, 600 L or more, 700 L or more, 800 L or more, 900 L or more, 1000 L or more, 1500 L or more, 2000 L or more, 2500 L or more, 3000 L or more, 4000 L or more, 5000 L or more, 7000 L or more, 10,000 L or more, 15,000 L or more, 20,000 L or more, 30,000 L or more, 50,000 L or more, or even more).
[0189] In some embodiments, chamber 102 is relatively airtight, such that a leakage rate of gases from chamber 102 is relatively small. For example, when chamber 102 is filled with a gas such as nitrogen at a pressure of 1.5 atmospheres (e.g., 152 kPa), a leakage rate of the gas from the chamber can be less than 0.5 L/day (e.g., less than 0.3 L/day, less than 0.1 L/day, less than 0.05 L/day, less than 0.01 L/day, less than 0.005 L/day, less than 0.001 L/day). More generally, when chamber 102 is filled with a gas such as nitrogen at a pressure p at a first time, the gas pressure within the chamber at a second time at least 7 days after the first time can be 0.70p or more (e.g., 0.80p or more, 0.85p or more, 0.90p or more, 0.95p or more, 0.98p or more, 0.99p or more, 0.999p or more, 0.9999p or more, or even more).
[0190] The walls of chamber 102 can generally be formed from a variety of materials including, but not limited to, various plastics and metals. Mating walls can be joined by bonding, welding, clamping, and other processes to form wall joints. A variety of structural supporting members can be used to reinforce the walls of chamber 102, and such members can be formed of the same or different materials than the walls.
[0191] During operation of system 100, controller 110 activates the gas delivery apparatus 106 to deliver one or more gases into the enclosed spatial volume 104 of chamber 102. Gas delivery apparatus 106 can be implemented in different ways. In some embodiments, gas delivery apparatus 106 is positioned within chamber 102. Alternatively, in certain embodiments, gas delivery apparatus 106 (or a portion thereof) is positioned external to chamber 102. Gas delivery apparatus 106 can include one or more gas sources 106b, one or more conduits 106c, and one or more valves 106d. As shown in
[0192]
[0193] In general, gas delivery apparatus 106 can include any number of gas sources 106b (e.g., one or more gas sources, two or more gas sources, three or more gas sources, four or more gas sources, five or more gas sources, six or more gas sources, seven or more gas sources, eight or more gas sources, nine or more gas sources, ten or more gas sources, or even more gas sources).
[0194] In some embodiments, gas delivery apparatus 106 includes one or more sources of nitrogen gas. In certain embodiments, at least one nitrogen gas source delivers nitrogen gas for which a ratio of isotopes corresponds approximately to atmospheric nitrogen gas, to with 5% of the ideal value of the isotopic ratio for atmospheric nitrogen gas. In general, the nitrogen isotopes .sup.15N and .sup.14N are present in atmospheric nitrogen gas at relative percentages of 0.366% and 99.634%, and so the isotopic ratio .sup.15N/.sup.14N for atmospheric nitrogen gas is 0.00367.
[0195] In some embodiments, at least one nitrogen gas source delivers nitrogen gas that is enriched in .sup.15N relative to .sup.14N, such that the .sup.15N/.sup.14N ratio for the nitrogen gas is greater than the .sup.15N/.sup.14N ratio for atmospheric nitrogen gas. In some embodiments, for example, the .sup.15N/.sup.14N ratio in the nitrogen gas can be 0.005 or more (e.g., 0.007 or more, 0.01 or more, 0.05 or more, 0.1 or more, 0.5 or more, 1.0 or more, 2.0 or more, 3.0 or more, 4.0 or more, 5.0 or more, 7.0 or more, 10.0 or more, 15.0 or more, 20.0 or more, 25.0 or more, 30.0 or more, 35.0 or more, 40.0 or more, 45.0 or more, 50.0 or more, or even more).
[0196] In certain embodiments, at least one nitrogen gas source delivers nitrogen gas that is enriched in .sup.15N relative to .sup.14N, such that such that the abundance of .sup.15N in the nitrogen gas is at least 30 atom % or more (e.g., at least 40 atom % or more, at least 50 atom % or more, at least 60 atom % or more, at least 70 atom % or more, at least 80 atom % or more, at least 90 atom % or more, at least 95 atom % or more, at least 98 atom % or more, at least 99 atom % or more, at least 99.5 atom % or more, at least 99.9 atom % or more, at least 99.99 atom % or more).
[0197] In some embodiments, controller 110 can adjust an isotopic ratio of .sup.15N to .sup.14N in chamber 102 by activating the gas delivery apparatus 106 to deliver a mixture of nitrogen gases into chamber 102. The mixture can include, for example, atmospheric nitrogen gas and one or more nitrogen gases enriched in .sup.15N relative to .sup.14N. Following delivery of the nitrogen gases into chamber 102, an abundance of .sup.15N in the gas mixture can be 0.05 atom % or more (e.g., 0.1 atom % or more, 0.2 atom % or more, 0.3 atom % or more, 0.5 atom % or more, 0.7 atom % or more, 1.0 atom % or more, 2.0 atom % or more, 3.0 atom % or more, 5.0 atom % or more, 7.0 atom % or more, 10.0 atom % or more, or even more).
[0198] In general, the nitrogen isotope .sup.13N is not present in atmospheric nitrogen gas, as it is unstable. Accordingly, the isotopic ratio .sup.13N/.sup.14N for atmospheric nitrogen gas is 0. In some embodiments, at least one nitrogen gas source delivers nitrogen gas that is enriched in .sup.13N relative to .sup.14N, such that the .sup.13N/.sup.14N ratio for the nitrogen gas is greater than the .sup.13N/.sup.14N ratio for atmospheric nitrogen gas (i.e., greater than zero). In some embodiments, for example, the .sup.13N/.sup.14N ratio in the nitrogen gas can be 0.005 or more (e.g., 0.007 or more, 0.01 or more, 0.05 or more, 0.1 or more, 0.5 or more, 1.0 or more, 2.0 or more, 3.0 or more, 4.0 or more, 5.0 or more, 7.0 or more, 10.0 or more, 15.0 or more, 20.0 or more, 25.0 or more, 30.0 or more, 35.0 or more, 40.0 or more, 45.0 or more, 50.0 or more, or even more).
[0199] In certain embodiments, at least one nitrogen gas source delivers nitrogen gas that is enriched in .sup.13N relative to .sup.14N, such that such that the abundance of .sup.15N in the nitrogen gas is at least 5 atom % or more (e.g., at least 10 atom % or more, at least 15 atom % or more, at least 20 atom % or more, at least 30 atom % or more, at least 40 atom % or more, at least 50 atom % or more, at least 60 atom % or more, at least 70 atom % or more, at least 80 atom % or more, at least 90 atom % or more, or even more).
[0200] In some embodiments, controller 110 can adjust an isotopic ratio of .sup.13N to .sup.14N in chamber 102 by activating the gas delivery apparatus 106 to deliver a mixture of nitrogen gases into chamber 102. The mixture can include, for example, atmospheric nitrogen gas and one or more nitrogen gases enriched in .sup.13N relative to .sup.14N. Following delivery of the nitrogen gases into chamber 102, an abundance of .sup.13N in the gas mixture can be 0.05 atom % or more (e.g., 0.1 atom % or more, 0.2 atom % or more, 0.3 atom % or more, 0.5 atom % or more, 0.7 atom % or more, 1.0 atom % or more, 2.0 atom % or more, 3.0 atom % or more, 5.0 atom % or more, 7.0 atom % or more, 10.0 atom % or more, or even more).
[0201] In some embodiments, gas delivery apparatus 106 includes one or more sources of carbon dioxide gas. As carbon dioxide is an essential nutrient for plant growth, controller 110 can be configured to deliver carbon dioxide to the enclosed spatial volume 104 of chamber 102 by activating valve 106d. For a gas delivery apparatus 106 configured as shown in
[0202] Returning to
[0203] In some embodiments, nutrient delivery apparatus 108 can be positioned within the enclosed spatial volume 104 of chamber 102. Alternatively, in certain embodiments, nutrient delivery apparatus 108 (or a portion thereof) is positioned external to chamber 102 and connected to a port formed in the one or more walls of chamber 102.
[0204] Nutrient delivery apparatus can include a variety of components. In some embodiments, for example, nutrient delivery apparatus includes one or more reservoirs 108b configured to store an aqueous growth medium. Nutrient delivery apparatus 108 can optionally include one or more conduits 108c for delivering the growth medium to plant 150 (e.g., to a soil 160 in which the roots of plant 150 are positioned). In certain embodiments, nutrient delivery apparatus 108 includes one or more valves 108d connected to controller 110. To regulate delivery of the growth medium from reservoir 108b to plant 150, controller 110 opens valve 108d, allowing the growth medium to flow from reservoir 108b through conduit(s) 108c.
[0205] In some embodiments, to facilitate flow of the growth medium, nutrient delivery apparatus 108 can include a flow mechanism 108e. Flow mechanism 108e can optionally be connected to controller 110, and controller 110 can activate flow mechanism 108e to deliver growth medium from reservoir 108b through conduit(s) 108c to plant 150. Flow mechanism 108e can be implemented in a variety of ways. In some embodiments, for example, flow mechanism 108e can include one or more of a wide variety of different types of pumps. In certain embodiments, flow mechanism 108e can include a pressure reducing device or apparatus, such as a reduced-pressure source (e.g., a vacuum source).
[0206] In general, nutrient delivery apparatus 108 can be configured to deliver a variety of different aqueous growth media. Examples of such media include, but are not limited to, modified Hoaglund's solutions at varying concentrations.
[0207] In some embodiments, one or more reservoirs in nutrient delivery apparatus 108 are configured to contain one or more additional nutrient media, and controller 110 can be configured to deliver to the one or more additional nutrient media to plant 150 in the same manner described above for the growth medium. Delivery of the nutrient media can also be performed by controller 110 according to reference information (e.g., a set of growth conditions) for plant 150.
[0208] In some embodiments, system 100 includes a gas detector 114 connected to controller 110 via a control line 114a. In general, gas detector 114 is configured to generate a measurement signal in response to the presence of one or more different gas species within chamber 102. Gas detector 114 can be configured to detect a single type of gas, multiple types of gases, and one or more different properties of the gas(es).
[0209] In certain embodiments, for example, gas detector 114 includes a detector configured to generate a measurement signal representing a ratio of abundances of different isotopes of nitrogen in chamber 102. For example, gas detector 114 can be configured to measure the abundances of one or more of .sup.15N, .sup.14N, and .sup.13N in chamber 102. Gas detector 114 can optionally be configured to generate measurement signals representing the measured abundances and/or measurement signals representing isotopic ratios of the abundances of nitrogen isotopes including, but not limited to, signals representing the isotopic ratios .sup.15N/.sup.14N and/or .sup.13N/.sup.14N.
[0210] Controller 110 can be configured to regulate delivery of one or more gases (e.g., nitrogen gas(es)) into chamber 102 based on the measurement signals generated by gas detector 114. For example, if the measured .sup.15N/.sup.14N ratio is too low relative to a reference value for this ratio, controller 110 activates gas delivery apparatus 106 to deliver one or more nitrogen gases that are enriched in .sup.15N relative to .sup.14N, as discussed above. As another example, if the measured .sup.13N/.sup.14N ratio is too low relative to a reference value for this ratio, controller 110 activates gas delivery apparatus 106 to deliver one or more nitrogen gases that are enriched in .sup.13N relative to .sup.14N, as discussed above. If either of the measured values of these ratios are too larger relative to reference values for the ratios, controller 110 activates gas delivery apparatus 106 to deliver nitrogen gas that is relatively depleted in .sup.15N and/or .sup.13N (e.g., nitrogen gas with atmospheric relative isotope abundances).
[0211]
[0212] A wide variety of different mass analyzers 114d can be used in gas detector 114. Examples of such analyzers include, but are not limited to, isotope ratio mass spectrometry analyzers, as described for example in Rodrigues et al., Comprehensive Analytical Chemistry 60: 77-99 (2013), the entire contents of which are incorporated by reference herein.
[0213] In some embodiments, gas detector 114 can be implemented as an isotope ratio infrared spectrometry detector. Isotope ratio infrared spectrometry detectors typically include a light source (e.g., an infrared laser source) and a detector configured to measure absorption of the light generated by the source by a sample (e.g., a gas sample from chamber 102). Isotope ratio infrared spectrometry detectors are described for example in Hippler et al., Mass and Isotope Selective Infrared Spectroscopy, Handbook of High-Resolution Spectroscopy, Vol. 2, Chapter 28, pp. 1069-1118 (2011), the entire contents of which are incorporated herein by reference.
[0214] In some embodiments, gas detector 114 includes a detector configured to generate a measurement signal representing an amount or concentration of oxygen gas in chamber 102.
[0215] Oxygen gas is produced as a by-product of the growth of plant 150 in chamber 102, and detection of oxygen gas can be important to ensure that suitable growth conditions are maintained during a growth cycle of plant 150.
[0216] Suitable detectors for oxygen include mass spectrometry detectors and infrared spectrometry detectors, as described above. A wide variety of additional detectors for oxygen can also be used, including potentiometric detectors, amperometric detectors, paramagnetic detectors, and spectroscopic detectors. Examples of such detectors are described in Shuk, Oxygen Gas Sensising Technologies Application: A Comprehensive Review, Sensors for Everyday Life, pp. 81-107 (2016), the entire contents of which are incorporated herein by reference. Suitable oxygen detectors are available commercially from Honeywell Corp. (Charlotte, NC), for example.
[0217] In some embodiments, gas detector 114 includes a detector configured to generate a measurement signal representing an amount or concentration of carbon dioxide gas in chamber 102. Detection of carbon dioxide gas can be important to ensure that sufficient quantities of carbon dioxide are available to sustain the growth of plant 150. Typically, when the measured concentration of carbon dioxide in chamber 102 is less than a reference value for plant 150, controller 110 can activate gas delivery apparatus 106 to deliver additional carbon dioxide gas into chamber 102 to maintain a suitable growth environment for plant 150.
[0218] A variety of different carbon dioxide detectors can be used in gas detector 114. Examples of such detectors include, but are not limited to, infrared absorption detectors and chemical sensors. Various examples of suitable carbon dioxide detectors are described in Mills, Optical Sensors for Carbon Dioxide and Their Applications, Sensors for Environment, Health and Security, pp. 347-370 (2009), the entire contents of which are incorporated herein by reference. Carbon dioxide sensors are available commercially from Mettler Toledo (Columbus, OH), for example.
[0219] In some embodiments, gas detector 114 includes a detector configured to generate a measurement signal representing an amount or concentration of nitrous oxide gas in chamber 102. Nitrous oxide generation can, in some circumstances, accompany nitrogen fixation by soil-based microbes, as described for example in Zhong et al., Nitrous oxide emissions associated with nitrogen fixation by grain legumes, Soil Biology and Biochemistry 41(11): 2283-2291 (2009), the entire contents of which are incorporated herein by reference. Accordingly, measurements of nitrous oxide amounts or concentrations in chamber 102 can be used to determine whether microbes present in soil 160 are actively fixing nitrogen in chamber 102. In particular, controller 110 can receive one or more measurements of the amount or concentration of nitrous oxide in chamber 102, and determine (e.g., via comparison to reference information) an extent or rate of nitrogen fixation within the chamber. By measuring nitrous oxide amounts or concentrations associated with multiple plants in chamber 102, controller 110 can determine relative nitrogen fixation rates for microbes associated with each of the plants. Suitable nitrous oxide detectors for use in gas detector 114 include, but are not limited to, infrared spectrometric detectors, including non-dispersive infrared absorbance detectors. Nitrous oxide detectors are available commercially from Unisense A/S (Aarhus, Denmark).
[0220] In some embodiments, nitrous oxide detectors can be mounted in proximity to plant 150 to measure an amount or concentration of nitrous oxide generated by microbes in soil 160. Mounting such detectors in this manner is particularly useful where chamber 102 includes multiple plants, and individual nitrous oxide amounts or concentrations are measured for the microbes associated with each plant.
[0221] In general, system 100 can include one or more (e.g., two or more, three or more, four or more, five or more, six or more, eight or more, ten or more, or even more) nitrous oxide detectors. In some embodiments, system 100 includes a nitrous oxide detector 176 on a support structure 178 associated with each plant 150 in chamber 102.
[0222] In some embodiments, gas detector 114 includes a detector configured to generate a measurement signal representing an amount or concentration of ammonia in chamber 102. Biological nitrogen fixation generates ammonia from gaseous nitrogen. Accordingly, measurements of ammonia amounts or concentrations in chamber 102 can be used to determine whether microbes present in soil 160 are actively fixing nitrogen in chamber 102. In particular, controller 110 can receive one or more measurements of the amount or concentration of ammonia in chamber 102, and determine (e.g., via comparison to reference information) an extent or rate of nitrogen fixation within the chamber. By measuring ammonia amounts or concentrations associated with multiple plants in chamber 102, controller 110 can determine relative nitrogen fixation rates for microbes associated with each of the plants. Suitable ammonia detectors for use in gas detector 114 include, but are not limited to, infrared spectrometric detectors and chemical detectors. Examples of such detectors are described in Timmer et al., Ammonia sensors and their applicationsa review, Sensors and Actuators B: Chemical 107(2): 666-677 (2005), the entire contents of which are incorporated herein by reference. Ammonia detectors are available commercially from Sensidyne, LP (St. Petersburg, FL), for example.
[0223] As discussed above in connection with nitrous oxide, in some embodiments, ammonia detectors can be mounted in proximity to plant 150 to measure an amount or concentration of ammonia generated by microbes in soil 160. Mounting such detectors in this manner is particularly useful where chamber 102 includes multiple plants, and individual ammonia amounts or concentrations are measured for the microbes associated with each plant.
[0224] In general, system 100 can include one or more (e.g., two or more, three or more, four or more, five or more, six or more, eight or more, ten or more, or even more) ammonia detectors. In some embodiments, system 100 includes an ammonia detector 180 on a support structure 178 associated with each plant 150 in chamber 102.
[0225] Returning to
[0226] In some embodiments, gas removal apparatus 116 is positioned within the enclosed spatial volume 104 of chamber 102. Alternatively, in certain embodiments, gas removal apparatus 116 is positioned external to chamber 102, and is connected to a port 116b formed in one or more walls of chamber 102.
[0227] Gas removal apparatus 116 can be implemented in various ways. In some embodiments, for example, gas removal apparatus 116 includes a pump with an inlet in fluid communication with port 116b, and an outlet that is not in fluid communication with chamber 102. Activation of the pump draws gas from chamber 102 into the pump through port 116b, and vents the gas through the pump outlet external to chamber 102.
[0228] In some embodiments, gas removal apparatus 116 includes one or more devices that are configured to specifically remove one or more certain types of gases from chamber 102. For example, in certain embodiments, gas removal apparatus 116 can be implemented as a gas exchanger, with one or more in-line gas scrubbing devices.
[0229] As described above, oxygen is a by-product of the growth of plant 150, and in some embodiments, gas removal apparatus 116 can include an oxygen scrubber. Controller 110 can selectively activate the oxygen scrubber to adjust the oxygen gas concentration in chamber 102, i.e., by removing some or all of the oxygen gas in the chamber. Suitable oxygen scrubbers are available commercially from Chromatography Research Supplies, Inc. (Louisville, KY).
[0230] In some embodiments, controller 110 activates gas removal apparatus 116 periodically to adjust the concentrations of one or more gases in chamber 102. Alternatively, or in addition, in certain embodiments, controller 110 activates gas removal apparatus 116 based on measurement signals from gas detector 114, e.g., when amounts or concentrations of one or more gases exceed corresponding reference values for plant 150.
[0231] In some embodiments, system 100 includes a temperature regulation apparatus 118 connected to controller 110 via control line 118a. The temperature regulation apparatus can include a temperature sensor 118d that generates a measurement signal representing a temperature within chamber 102.
[0232] Temperature regulation apparatus 118 can also include one or more heating elements 118b and one or more cooling elements 118c. Controller 110 can be configured to regulate the temperature within chamber 102 by selectively activating heating and/or cooling elements. Specifically, after receiving a measurement signal from temperature sensor 118d, controller 110 is configure to compare the measured temperature value to one or more reference temperature values for plant 150. If the measured temperature is too high based on the comparison, controller 110 activates one or more cooling elements 118c to reduce the chamber temperature. Alternatively, if the measured temperature is too low based on the comparison, controller 110 activates one or more heating elements 118b to increase the chamber temperature.
[0233] In some embodiments, the reference temperature values include representative daytime and nighttime temperature values, and controller 110 compares the measured temperature to appropriate daytime and nighttime temperature values, based on the time of the temperature measurement, before adjusting the chamber temperature. In this manner, controller 110 can implement both daytime and nighttime environmental conditions for plant 150.
[0234] The heating and cooling elements can be implemented in a variety of ways in temperature regulation apparatus 118. In some embodiments, for example, heating elements 118b can be implemented as resistive and/or infrared heating elements, activated by controller 110.
[0235] In certain embodiments, cooling elements 18c can be implemented as heat exchangers.
[0236] During operation of cooling element 118c, chamber gas 172 enters inlet 118f, drawn in by fan 118g. The chamber gas 172 passes through gas flow path 118h and emerges as gas 174 from exhaust fan 118g. At the same time, fan 118i circulates external air 118j across the enclosed gas flow path 118h. As external air 118j is circulated, heat exchange occurs between external air 118j and chamber gas 172, transferring heat energy from chamber gas 172 to external air 118j. As a result, chamber gas 172 is cooled, and air 174 is returned to chamber 102 at a lower temperature than chamber gas 172. External air 118j is heated, and is exhausted through port 118k as waste air 118l.
[0237] Returning to
[0238] In certain embodiments, controller 110 is configured to adjust the amounts of gas delivered to chamber 102 based on altitude measurements provided by altitude sensor 120. During operation of system 100, controller 110 delivers gases to chamber 102 according to reference information (e.g., a set of growth conditions) for plant 150. The reference information includes concentrations of gases such as nitrogen and carbon dioxide, and controller 110 activates gas delivery apparatus 106 and (if necessary) gas removal apparatus 116 to ensure that appropriate concentrations of these gases are maintained during the growth cycle of plant 150 in chamber 102. To account for growing conditions at different altitudes, however, controller 110 can adjust the amounts or concentrations of one or more gases in chamber 102 based on the measured altitude information described above.
[0239] Returning to
[0240] Any of a wide variety of different light-generating elements can be used in light source 122. Suitable elements for use in light source 122 include, but are not limited to, metal halide light sources, halogen light sources, fluorescent sources, incandescent sources, and light-emitting diode (LED) sources.
[0241] In some embodiments, system 100 includes a humidity control apparatus 124 connected to controller 110 via control line 124a. Humidity control apparatus 124 includes a humidity sensor 124b configured to generate a measurement signal that represents a humidity within the enclosed spatial volume 104 of chamber 102. Humidity control apparatus 124 also optionally includes a humidifier 124c and/or a de-humidifier 124d connected to a port formed in the one or more walls of chamber 102. Controller 110 receives the humidity measurement signal from humidity sensor 124b and can selectively activate humidifier 124c and/or de-humidifier 124d if the chamber humidity is too low or too high, respectively, relative to a reference humidity value for plant 150. Typically, the reference humidity value is part of reference information (e.g., a set of growth conditions) for plant 150.
[0242] In some embodiments, system 100 includes a growth monitoring apparatus 126 connected to controller 110 via control line 126a. In general, growth monitoring apparatus 126 is configured to generate a measurement signal that includes information about the growth of plant 150 within chamber 102. Controller 110 receives the information and can execute a variety of control functions based on the information.
[0243]
[0244] In some embodiments, detector 126c is configured to detect light emitted from plant 150 (or portions thereof) in three distinct spectral bands, the three bands having local maxima in the red (between 635 nm and 700 nm), green (between 520 nm and 560 nm), and blue (between 450 nm and 490 nm) regions of the electromagnetic spectrum. Controller 110 can use the detected light measurements to determine a measure of growth of plant 150.
[0245] More generally, detector 126c can be configured to detect light emitted from plant 150 (or portions thereof) in multiple distinct spectral bands, each having a different local maximum spectral wavelength. Light can be detected by detector 126 in three or more (e.g., four or more, five or more, six or more, seven or more, eight or more, ten or more, or even more) distinct spectral bands, and controller 110 can use the detected light measurements to determine a measure of growth of plant 150.
[0246] In some embodiments, detector 126c is configured to measure a hyperspectral image of plant 150 (or a portion thereof) by measuring the spectral intensity of the emitted light as a function of wavelength or frequency for multiple pixels within the image. Each wavelength of frequency of measurement in the hyperspectral image corresponds to a different wavelength band with a different local maximum wavelength or frequency. Controller 110 can use the hyperspectral image information to determine a measure of growth of plant 150.
[0247] In certain embodiments, detector 126c is configured to measure emitted light in one or more infrared spectral regions or bands. The regions can include the near-IR (e.g., 800 nm to 1400 nm) and/or the short-wavelength IR (e.g., 1400 nm to 3000 nm). Image and/or non-image information measured in one or more of the foregoing spectral regions can be used by controller 110 to determine a measure of growth of plant 150.
[0248] In some embodiments, detector 126c is configured to measure fluorescence emission from plant 150 (or a portion thereof). Detector 126c can obtain one or more fluorescence images of plant 150, or can measure fluorescence intensity in a non-spatially resolved manner. Controller 110 can use the fluorescence image information and/or the fluorescence measurements to determine a measure of growth of plant 150.
[0249] In certain embodiments, source 126b and detector 126c are implemented as a laser scanner that is configured to direct incident light to the surface of plant 150 (or portions thereof) and detect reflected light from plant 150 to obtain image information (e.g., a topographical map) of plant 150. For example, by projecting a pattern of structured light onto the surface of plant 150 and measuring images of the distorted patterns on the surfaces of plant 150, the topographical structure of the surfaces of plant 150 can be calculated by controller 110. Alternatively, the laser scanner can be used to track positions of one or more features of plant 150, including leaf features (e.g., tip positions and dimensions). Controller 110 can use the laser scanning information to determine a measure of growth of plant 150.
[0250] Returning to
[0251] In certain embodiments, sensor 126d can be implemented as a scale. More generally, sensor 126d can be implemented as a touch-sensitive sensor that generates a measurement signal that includes information about the force applied to the sensor when plant 150 (or portions thereof) are in contact with the sensor.
[0252] In some embodiments, system 100 can include a soil moisture detector 128 connected to controller 110 via control line 128a. Soil moisture detector 128 is configured to generate a measurement signal that includes information about a percentage of water in soil 160 within chamber 102. Soil moisture detector 128 can be implemented in various ways. In some embodiments, soil moisture detector 128 includes a probe 128b that contacts soil 160, and generates a measurement signal. In certain embodiments, soil moisture detector 128 is implemented as a scale that generates a measurement signal representing the mass of soil 160, from which controller 110 can determine the percentage of water in soil 160.
[0253] In some embodiments, system 100 can include one or more auxiliary sensors 136 connected to controller 110 via control lines 136a. In general, the auxiliary sensors can be chemical sensors that each generate a measurement signal in response to the presence of one or more chemical species (e.g., analytes) in chamber 102. Each of the auxiliary sensors can correspond to any of the types of sensors described above, or to other types of sensors. Auxiliary sensors 136 can be dedicated to the detection of chemical species that include, but are not limited to, amounts or concentrations of ammonia, amounts of nitrate ions and/or nitrate salts, amounts or concentrations of nitrous oxide, and amounts or concentrations of carbon dioxide.
[0254] In certain embodiments, system 100 can include a fluid removal mechanism 130 connected to controller 110 via control line 130a. Fluid removal mechanism 130 includes a conduit 130b connected to or extending through a port formed in one or more walls of chamber 102. Controller 110 can activate fluid removal mechanism 130 to extract a variety of fluids from chamber 102, including gases and liquids.
[0255]
[0256] In some embodiments, conduit 130b is configured to extract a fluid directly from plant 150. For example, conduit 130b can be terminated with a syringe that penetrates a tissue of plant 150 to extract a fluid from the tissue. In some embodiments, conduit 130b is configured to extract a fluid directly from soil 160. For example, conduit 130b can be positioned directly in soil 160 to capture a portion of the growth medium delivered to plant 150 by the nutrient delivery apparatus.
[0257] In certain embodiments, fluid removal mechanism 130 can include, or can be connected to, a fluid analysis apparatus. The fluid analysis apparatus can be implemented in various ways. For example, the fluid analysis apparatus can optionally include a mass spectrometry detector 130d that analyzes components of the fluid extracted through conduit 130b. Alternatively, or in addition, the fluid analysis apparatus can optionally include a light source 130e and a detector 130f configured to detect light emitted from the extracted fluid in response to illumination light generated by light source 130e. Information obtained from the fluid analysis apparatus can be transmitted to controller 110.
[0258] Returning to
[0259] As an alternative sampling apparatus 112, in some embodiments, sampling apparatus 112 can be implemented as a cover connected through a sealing mechanism to a port formed in one or more walls of chamber 102. Any of the above sealing mechanisms can generally be used to connect the cover to the port, as can other sealing mechanisms such as fasteners, hinges, magnetic couplers, and electrostatic fasteners.
[0260] In some embodiments, system 100 includes one or more gloves 134 connected through sealing members to one or more ports formed in the walls of chamber 102. A user of system 100 can insert his or her hands into gloves 134, allowing the user to manipulate plants and other objects within chamber 102, without opening chamber 102. The sealing members used to connected gloves 134 to ports in the walls of chamber 102 can include any of the different types of sealing members discussed above.
[0261] In some embodiments, sampling apparatus can be used to perform one or more assays on the tissue of plant 150. For example, plant tissue can be extracted from chamber 102 via sampling apparatus 112 for purposes of evaluating the colonization ability of microbes with which the plant was inoculated. To test for the colonization ability of the microbes, the extracted plant tissue is assayed to test for the presence of nucleic acids in the plant tissue that are characteristic of the microbes. By extracting and testing a variety of plant tissues, the colonization ability of the microbes can be assessed.
[0262] As an alternative to the foregoing procedure, the colonization ability of the microbes can be determined without excising plant tissue using the growth monitoring apparatus 126. For example, for microbes that express a fluorophore (such as a fluorescence protein), the growth monitoring apparatus 126 can be used to detect fluorescence emission from the fluorophore. By imaging fluorescence emission from a variety of plant tissues within chamber 102, the colonization ability of the microbes can be assessed.
[0263] In some embodiments, system 100 can include an inoculation mechanism 132 connected to controller 110 via control line 132a. Inoculation mechanism 132 is configured to deliver an inoculation composition to plant 150 within the enclosed spatial volume 104 of chamber 102.
[0264]
[0265] During operation, controller 110 activates pump 132c and valve 132d of the metering mechanism to deliver a metered volume of the inoculation composition into conduit 132e. Port 132g is generally configured to be selectively opened and closed to connect conduits 132e and 132h. Controller 110 activates port 132g to selectively open the port and allow the metered volume of inoculation composition to flow through conduit 132 and out of syringe 132f, delivering the inoculation composition to plant 150.
[0266] In some embodiments, system 100 is configured to perform an acetylene reduction assay to assess the nitrogen-fixing ability of microbes associated with plant 150. Gas delivery apparatus 106 can include a source of acetylene gas 106b, and system 100 can include an auxiliary sensor 136 configured to detect ethylene gas by generating a measurement signal representing an amount or concentration of ethylene gas in proximity to the sensor.
[0267] To perform the acetylene reduction assay, controller 110 activates the gas delivery apparatus 106 to deliver a quantity of acetylene gas to soil 160 in which plant 150 is positioned. After a measurement time elapses, controller 110 activates the auxiliary ethylene sensor 136 to measure an amount of ethylene generated by the microbes in soil 160. Controller 110 then determines the rate of acetylene reduction based on the amount of ethylene generated and the elapsed measurement time.
[0268] As discussed above in connection with nitrous oxide measurements, acetylene reduction assays can be performed in parallel for multiple plants 150 in chamber 102 by activating multiple ethylene sensors 136 in chamber 102, where each of the ethylene sensors 136 is associated with a different plant. To associate individual sensors with specific plants, the sensors can be positioned on support structures (e.g., support structures 178, as shown in
[0269]
[0270] The memory 404 can store executable instructions for processor 402, information about parameters of the system such as excitation and detection wavelengths, and measured spectral image information. The storage device 406 can be a computer-readable medium, such as a floppy disk device, a hard disk device, an optical disk device, or a tape device, a flash memory or other similar solid state memory device, or an array of devices, including devices in a storage area network or other configurations. The storage device 406 can store instructions that can be executed by processor 402 described above, and any of the other information that can be stored by memory 404.
[0271] In some embodiments, controller 110 can include a graphics processing unit to display graphical information (e.g., using a GUI or text interface) on an external input/output device, such as display 416. The graphical information can be displayed by a display device (e.g., a CRT (cathode ray tube) or LCD (liquid crystal display) monitor) for displaying any of the information, such as measured and calculated spectra and images, disclosed herein. A user can use input devices (e.g., keyboard, pointing device, touch screen, speech recognition device) to provide input to controller 110.
[0272] A user of system 100 can provide a variety of different types of instructions and information to controller 110 via input devices. The instructions and information can include, for example, reference information such as: growth conditions for plant(s) 150; reference information and values for quantities such as isotope abundances in plant tissues to which controller 110 can compare measured values; reference values and ranges for various environmental parameters and conditions in chamber 102 that are maintained by controller 110 such as, but not limited to, temperatures, humidities, soil moisture percentages, nutrient and growth medium delivery schedules, gas concentrations, altitude-based calibrations and adjustments, and illumination schedules; and calibration information and reference values associated with various assays, including reference concentrations of any of the species described herein in connection with extracted fluids, calibration information for performing any of the assays described herein, and calibration information used by controller 110 to calibrate any of the detectors and sensors described herein. Controller 110 can use any of these various types of information to perform the methods and functions described herein. It should also be noted that any of these types of information can be stored (e.g., in storage device 406) and recalled when needed by controller 110.
[0273] The methods disclosed herein can be implemented by controller 110 by executing instructions in one or more computer programs that are executable and/or interpretable by the controller 110. These computer programs (also known as programs, software, software applications or code) include machine instructions for a programmable processor, and can be implemented in a high-level procedural and/or object-oriented programming language, and/or in assembly/machine language. For example, computer programs can contain the instructions that can be stored in memory 404, in storage unit 406, and/or on a tangible, computer-readable medium, and executed by processor 402 as described above. As used herein, the term computer-readable medium refers to any computer program product, apparatus and/or device (e.g., magnetic discs, optical disks, memory, Programmable Logic Devices (PLDs), ASICs, and electronic circuitry) used to provide machine instructions and/or data to a programmable processor, including a machine-readable medium that receives machine instructions.
Detecting Nitrogen Incorporation and Identifying Nitrogen-Fixing Microbes
[0274] The systems described herein can be used to perform a variety of assays and determinations in semi-automated or fully automated fashion. For example, in some embodiments, the systems can be used to detect nitrogen incorporation in a plant.
[0275] In a first step 202, a test plant (e.g., plant 150) is positioned in a support medium (e.g., soil 160) within the enclosed spatial volume 104 of chamber 102. Next, as described above, controller 110 activates the gas delivery apparatus 106 to adjust a composition of a nitrogen gas mixture within chamber 102 so that the abundance ratio of at least two nitrogen isotopes is different from the naturally occurring atmospheric ratio of the two isotopes (i.e., the ratio of the isotopes in atmospheric nitrogen gas). As discussed previously, the nitrogen isotopes can be, for example, .sup.15N and .sup.14N, or .sup.13N and .sup.14N, or .sup.15N and .sup.13N and .sup.14N, and the adjustment can include increasing the relative abundance of either .sup.15N or .sup.13N, as these nitrogen isotopes are effectives used to label plant tissues in which nitrogen incorporation occurs.
[0276] After adjustment of the nitrogen gas composition, controller 110 actives the nutrient delivery apparatus 108 to deliver an aqueous growth medium to the test plant to cause growth of the test plant over a growth period. Controller 110 can also maintain suitable growth conditions for the test plant (e.g., defined in reference information for the test plant) by selectively activating the gas delivery apparatus 106, gas removal apparatus 116, temperature regulation apparatus 118, light source 122, and humidity control apparatus 124 in response to corresponding measurements of various conditions within chamber 102 discussed previously.
[0277] In general, the growth period can be selected as desired. For example, in some embodiments, the growth period is at least 7 days (e.g., at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 21 days, at least 24 days, at least 27 days, at least 30 days). In certain embodiments, the growth period is 50 days or less (e.g., 45 days or less, 40 days or less, 35 days or less, 30 days or less, 25 days or less, 20 days or less, 18 days or less, 16 days or less, 14 days or less, 12 days or less, 10 days or less).
[0278] Next, in step 208, an isotope analysis of test plant tissue is performed to determine relative amounts of the at least two nitrogen isotopes from step 204 in the test plant tissue. The isotope analysis can be performed in various ways. In some embodiments, for example, the isotope analysis is performed by harvesting plant tissue, drying the harvested plant tissue, grinding the dried tissue into a powder, and performing a mass spectrometric analysis of the power to determine relative abundances of the at least two isotopes.
[0279] Alternatively, in some embodiments, the isotope analysis of the test plant tissue is performed within chamber 102, without harvesting the test plant tissue. As discussed above, system 100 can include a gas detector 114 that includes an isotope ratio infrared spectrometry detector, which can detect amounts or concentrations of different nitrogen isotopes via infrared absorption measurements directly on intact tissue. The isotope ratio infrared spectrometry detector yields measurements of the relative amounts (e.g., abundances) of each of the nitrogen isotopes in the test plant tissue.
[0280] Performing isotope analysis via isotope ratio infrared spectroscopy generally does not damage plant tissue or interrupt growth cycles, and as a result, can be advantageous for performing periodic assessment of nitrogen incorporation in plant tissue. That is, isotope analysis can be performed repeatedly, at specific periodic intervals or at irregular times, to assay nitrogen incorporation as a function of time during the test plant's growth cycle. Between repeated measurements, controller 110 can selectively activate gas delivery apparatus 106 to adjust the composition of the nitrogen gas mixture in the chamber, e.g., to maintain the initial adjusted composition.
[0281] Next, in step 210, controller 110 compares the relative amounts of the nitrogen isotopes in the test plant tissue to reference information to determine whether nitrogen incorporation has occurred in the test plant tissue as a result of biological nitrogen fixation. Typically, the reference information corresponds to an expected ratio of the isotope abundances in the test plant tissue in the absence of biological nitrogen fixation by microbes in soil 160. When an increase in the abundance of the lower abundance isotope is measured (relative to the expected abundance), controller 110 determines that nitrogen incorporation has been enhanced due to the nitrogen-fixing activity of soil microbes.
[0282] As an example, when controller 110 adjusts the nitrogen gas mixture in chamber 102 to enrich the mixture in .sup.15N relative to .sup.14N, the abundances of .sup.15N and .sup.14N in the plant tissue are compared to reference information for the expected abundances of .sup.15N and .sup.14N in the plant tissue. If the measured abundance of .sup.15N in the plant tissue is larger than the expected abundance of .sup.15N in the plant tissue, controller 110 determines that nitrogen incorporation has occurred, and has been enhanced via biological nitrogen fixation by the microbes associated with the test plant relative to the extent of nitrogen incorporation that would occur in the absence of the microbes.
[0283] A variety of different plant tissues can be assayed using the methods described above. For example, plant tissues that can be examined to assess nitrogen incorporation include root tissue, newly emerged whorl tissue, top-collared leaf tissue, and other plant tissue.
[0284] In some embodiments, controller 110 obtains the reference isotope abundance information (i.e., the expected isotope abundances) from a storage unit containing previously measured reference information. Alternatively, in certain embodiments, the reference isotope abundance information is measured in chamber 102 during the assay. For example, a reference plant that has not been inoculated with a microbe composition can be placed in a support medium within chamber 102, and an aqueous growth medium delivered to the reference plant (i.e., the same growth medium delivered to the test plant) as described above in connection with steps 202 and 206. Isotope analysis is also performed on tissue(s) of the reference plant to determine relative abundances of nitrogen isotopes in the reference plant tissues in step 208. These isotope abundances for the reference plant tissues correspond to the reference information (i.e., the expected isotope abundances) that are used in step 210.
[0285] To assay the increase in nitrogen incorporation resulting from particular microbes, in some embodiments, the test plant (or a seed precursor of the test plant) can be inoculated with a composition that includes a bacterial suspension. The bacterial suspension can include, for example, one or more nitrogen-fixing bacteria. In general, inoculation can occur before or after the test plant (or a seed precursor of the test plant) is placed in chamber 102, and before or after the reference plant is placed in chamber 102. Various modes of inoculation can be used, and following inoculation, the nitrogen-fixing bacteria can be present in the support medium (e.g., soil 160) and/or in the tissues of the test plant.
[0286] It should also be noted that any of the other measurements or assays described herein can also be performed as part of the methods represented in
[0287] In some embodiments, the systems described herein can be used to identify a nitrogen-fixing bacterial strain.
[0288] Next, in step 304, the test and reference plants are positioned in support media within chamber 102, and in step 306, controller 110 adjusts the composition of the nitrogen gas mixture in chamber 102 so that a ratio of at least two nitrogen isotopes in the gas differs from the naturally occurring atmospheric ratio of the isotopes (i.e., their abundance ratio in atmospheric nitrogen gas). This step is performed in a manner similar to step 204 discussed above.
[0289] Then, in step 308, the test and reference plants are grown in chamber 102 over a growth period. To grow the test and reference plants, controller 110 activates nutrient delivery system 108 to deliver growth media to the plants, and adjusts various environmental growth conditions in the manner discussed above.
[0290] In general, the growth period can be selected as desired. For example, in some embodiments, the growth period is at least 7 days (e.g., at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 21 days, at least 24 days, at least 27 days, at least 30 days). In certain embodiments, the growth period is 50 days or less (e.g., 45 days or less, 40 days or less, 35 days or less, 30 days or less, 25 days or less, 20 days or less, 18 days or less, 16 days or less, 14 days or less, 12 days or less, 10 days or less).
[0291] In step 310, after the growth period, controller 110 determines relative amounts of nitrogen isotopes in test and reference plant tissues. This isotope analysis can be performed according to any of the methods described above. In particular, in some embodiments, test and reference plant tissues are harvested, dried, ground into powders, and the powders are analyzed by mass spectrometry to determine nitrogen isotope abundances in the tissues.
[0292] In certain embodiments, as discussed above, system 100 can include a gas detector 114 that includes an isotope ratio infrared spectrometry detector, which can detect amounts or concentrations of different nitrogen isotopes via infrared absorption measurements directly on intact tissue. The isotope ratio infrared spectrometry detector yields measurements of the relative amounts (e.g., abundances) of each of the nitrogen isotopes in the test and reference plant tissues. Using a detector of this type allows isotope abundance measurements to be made at periodic or regulator intervals, so that the ability of the candidate bacterial strain to perform nitrogen fixation can be assessed as a function of time, and under changing environmental conditions.
[0293] In step 312, controller compares the relative amounts of the nitrogen isotopes in the test and reference plant tissues. If the lower abundance isotope in the adjusted chamber nitrogen gas mixture (e.g., .sup.15N or .sup.13N) from step 306 is present at higher relative abundance in the test plant tissue than in the reference plant tissue, controller 110 identifies the candidate strain as a nitrogen-fixing bacterial strain. If the lower abundance isotope in the adjusted chamber nitrogen gas mixture (e.g., .sup.15N or .sup.13N) from step 306 is present at the same or lower relative abundance in the test plant tissue than in the reference plant tissue, controller 110 identifies the candidate strain as a non-nitrogen-fixing bacterial strain.
[0294] A variety of different test and reference plant tissues can be assayed using the methods described above. For example, the test and reference plant tissues that are analyzed can include root tissue, newly emerged whorl tissue, top-collared leaf tissue, and other plant tissue.
[0295] In some embodiments, as described above, a seed precursor of the test plant is inoculated with the candidate bacterial strain. In these circumstances, germination of the seed can be carried out external to chamber 102 to yield a test plant which is then positioned within chamber 102. To germinate the inoculated seed, the seed can be deposited in a support medium to induce germination, yielding the test plant. Following germination of the seed, growth medium can be withheld from the test plant for a period of 3 days or more (e.g., 5 days or more, 7 days or more, 10 days or more, 12 days or more, 14 days or more), and then delivered to the test plant following this initial period.
[0296] The time at which the test plant is positioned within chamber 102 following germination can generally be selected based on factors such as the size of the plant and the point(s) in the plant's growth cycle during which assessment of the nitrogen-fixing effectiveness of candidate bacterial strains is of interest. In some embodiments, for example, the test plant can be positioned within chamber 102 at least 10 days (e.g., at least 14 days, at least 16 days, at least 18 days, at least 21 days, at least 24 days, at least 27 days, at least 30 days) following germination of its precursor seed.
Genetic Regulation of Nitrogen Fixation
(1) NifA
[0297] In proteobacteria, regulation of nitrogen fixation centers on the 54-dependent enhancer-binding protein NifA, the positive transcriptional regulator of the nif cluster. NifA upregulates the nif gene complex and drives nitrogen fixation when there is insufficient fixed nitrogen available to the microbe. NifL inhibits NifA when there is sufficient fixed N available to the microbe. Intracellular levels of active NifA are controlled by two key factors: transcription of the nifLA operon, and inhibition of NifA activity by protein-protein interaction with NifL. Both of these processes are responsive to intracelluar glutamine levels via the PII protein signaling cascade. This cascade is mediated by GlnD, which directly senses glutamine and catalyzes the uridylylation or deuridylylation of two PII regulatory proteinsGlnB and GlnKin response the absence or presence, respectively, of bound glutamine. Under conditions of nitrogen excess, unmodified GlnB signals the deactivation of the nifLA promoter. However, under conditions of nitrogen limitation, GlnB is post-translationally modified, which inhibits its activity and leads to transcription of the nifLA operon. In this way, nifLA transcription is tightly controlled in response to environmental nitrogen via the PII protein signaling cascade. On the post-translational level of NifA regulation, GlnK inhibits the NifL/NifA interaction in a matter dependent on the overall level of free GlnK within the cell.
[0298] NifA is transcribed from the nifLA operon, whose promoter is activated by phosphorylated NtrC, another 54-dependent regulator. The phosphorylation state of NtrC is mediated by the histidine kinase NtrB, which interacts with deuridylylated GlnB but not uridylylated GlnB. Under conditions of nitrogen excess, a high intracellular level of glutamine leads to deuridylylation of GlnB, which then interacts with NtrB to deactivate its phosphorylation activity and activate its phosphatase activity, resulting in dephosphorylation of NtrC and the deactivation of the nifLA promoter. However, under conditions of nitrogen limitation, a low level of intracellular glutamine results in uridylylation of GlnB, which inhibits its interaction with NtrB and allows the phosphorylation of NtrC and transcription of the nifLA operon. In this way, nifLA expression is tightly controlled in response to environmental nitrogen via the PII protein signaling cascade. nifA, ntrB, ntrC, and glnB, are all genes that can be mutated in the methods described herein. These processes can also be responsive to intracellular levels of ammonia, urea or nitrates.
[0299] The activity of NifA is also regulated post-translationally in response to environmental nitrogen, most typically through NifL-mediated inhibition of NifA activity. In general, the interaction of NifL and NifA is influenced by the PII protein signaling cascade via GlnK, although the nature of the interactions between GlnK and NifL/NifA varies significantly between diazotrophs. In Klebsiella pneumoniae, both forms of GlnK inhibit the NifL/NifA interaction, and the interaction between GlnK and NifL/NifA is determined by the overall level of free GlnK within the cell. Under nitrogen-excess conditions, deuridylylated GlnK interacts with the ammonium transporter AmtB, which serves to both block ammonium uptake by AmtB and sequester GlnK to the membrane, allowing inhibition of NifA by NifL. On the other hand, in Azotobacter vinelandii, interaction with deuridylylated GlnK is required for the NifL/NifA interaction and NifA inhibition, while uridylylation of GlnK inhibits its interaction with NifL. In diazotrophs lacking the nifL gene, there is evidence that NifA activity is inhibited directly by interaction with the deuridylylated forms of both GlnK and GlnB under nitrogen-excess conditions. In some bacteria the Nif cluster can be regulated by glnR, which can comprise negative regulation. Regardless of the mechanism, post-translational inhibition of NifA is an important regulator of the nif cluster in most known diazotrophs. In some embodiments, one or more of nifL, amtB, glnK, and glnR can be mutated in the bacterial strains described herein.
[0300] Loss of NifL function can remove repression of NifA in nitrogen-limiting conditions. In some embodiments, at least one modification in a gene regulating nitrogen fixation or assimilation results in decreased expression of nifL. In some embodiments, at least one modification in a gene regulating nitrogen fixation or assimilation comprises a deletion of all or a portion of the coding sequence of the nifL gene. In some embodiments, at least one modification in a gene regulating nitrogen fixation or assimilation comprises a deletion of a portion of the coding sequence of the nifL gene. For example, a middle portion of the coding sequence of the nifL gene can be deleted. In some embodiments, the first 30 base pairs and the last 83 base pairs of the nifL coding sequence can be retained and the remaining base pairs can be deleted. In some embodiments, the deleted portion of the nifL coding sequence is replaced by a promoter, e.g., any of the promoters as described herein. For example, the promoter can be the infC gene promoter (PinfC, SEQ ID NO:1), the cspE gene promoter (SEQ ID NO:2 and SEQ ID NO:3), or the ompX gene promoter (Prm5; SEQ ID NO:4). For additional promoters see International Publication No. WO/2019/084059, which is incorporated herein by reference in its entirety. In some embodiments, the promoter has at least about 7000, about 7500, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or about 100% sequence identity to any one of SEQ TD Nos: 1-4.
TABLE-US-00001 SEQ ID Description NO Sequence PinfC 1 AGCGTCAGGTACCGGTCATGATTCACCGTGCGATTCTCGGTTCCCTGGAGCG CTTCATTGGCATCCTGACCGAAGAGTTCGCTGGCTTCTTCCCAACCTGGATTG CACCAGTGCAGGTAGTGGTCATGAATATTACCGATTCTCAGGCTGAATACGT TAACGAATTGACGCGTAAACTACAAAATGCGGGCATTCGTGTAAAAGCAGA CTTGAGAAATGAGAAGATTGGCTTTAAAATCCGCGAGCACACTTTACGTCGT GTCCCGTATATGTTGGTCTGTGGCGACAAAGAAGTCGAAGCCGGCAAAGTG GCCGTGCGCACCCGTCGCGGGAAAGACCTCGGCAGCATGGACGTAAGTGAA GTGATTGAGAAGCTGCAACAAGAGATTCGCAGCCGCAGTCTTCAACAACTG GAGGAATAAGGTATTAAAGGCGGAAAACGAGTTCAAACGGCACGTCCGAAT CGTATCAATGGCGAGATTCGCGCCCTGGAAGTTCGC cspE 2 GCCCGCTGACCGACCAGAACTTCCACCTTGGACTCGGCTATACCCTTGGCGT promoter GACGGCGCGCGATAACTGGGACTACATCCCCATTCCGGTGATCTTACCATTG GCGTCAATAGGTTACGGTCCGGCGACTTTCCAGATGACCTATATTCCCGGCA CCTACAATAACGGTAACGTTTACTTCGCCTGGGCTCGTATACAGTTTTAATTC GCTAAGTCTTAGCAATAAATGAGATAAGCGGTGTGTCTTGTGGAAAAACAA GGACTAAAGCGTTACCCACTAAAAAAGATAGCGACTTTTATCACTTTTTAGC AAAGTTGCACTGGACAAAAGGTACCACAATTGGTGTACTGATACTCGACAC AGCATTAGTGTCGATTTTTCATATAAAGGTAATTTTG cspE 3 GCCCGCTGACCGACCAGAACTTCCACCTTGGACTCGGCTATACCCTTGGCGT promoter GACGGCGCGCGATAACTGGGACTACATCCCCATTCCGGTGATCTTACCATTG GCGTCAATAGGTTACGGTCCGGCGACTTTCCAGATGACCTATATTCCCGGCA CCTACAATAACGGTAACGTTTACTTCGCCTGGGCTCGTATACAGTTTTAATTC GCTAAGTCTTAGCAATAAATGAGATAAGCGGTGTGTCTTGTGGAAAAACAA GGACTAAAGCGTTACCCACTAAAAAAGATAGCGACTTTTATCACTTTTTAGC AAAGTTGCACTGGACAAAAGGTACCACAATTGGTGTACTGATACTCGACAC AGCATTAGTGTCGATTTTTCATATAAAGGTAATTTTG Prm5 4 GGACATCATCGCGACAAACAATATTAATACCGGCAACCACACCGGCAATTT ACGAGACTGCGCAGGCATCCTTTCTCCCGTCAATTTCTGTCAAATAAAGTAA AAGAGGCAGTCTACTTGAATTACCCCCGGCTGGTTGAGCGTTTGTTGAAAAA AAGTAACTGAAAAATCCGTAGAATAGCGCCACTCTGATGGTTAATTAACCTA TTCAATTAAGAATTATCTGGATGAATGTGCCATTAAATGCGCAGCATAATGG TGCGTTGTGCGGGAAAACTGCTTTTTTTTGAAAGGGTTGGTCAGTAGCGGAA AC nifL::Prm5 ATGACCCTGAATATGATGATGGATGCCGGCGGACATCATCGCGACAAACAA TATTAATACCGGCAACCACACCGGCAATTTACGAGACTGCGCAGGCATCCTT TCTCCCGTCAATTTCTGTCAAATAAAGTAAAAGAGGCAGTCTACTTGAATTA CCCCCGGCTGGTTGAGCGTTTGTTGAAAAAAAGTAACTGAAAAATCCGTAG AATAGCGCCACTCTGATGGTTAATTAACCTATTCAATTAAGAATTATCTGGA TGAATGTGCCATTAAATGCGCAGCATAATGGTGCGTTGTGCGGGAAAACTGC TTTTTTTTGAAAGGGTTGGTCAGTAGCGGAAACAACTCACTTCACACCCCGA AGGGGGAAGTTGCCTGACCCTACGATTCCCGCTATTTCATTCACTGACCGGA GGTTCAAAATGACCCAGCGAACCGAGTCGGGTAATACCGTCTGGCGCTTCG ATTTGTCCCAGCAGTTCACTGCGATGCAGCGCATAAGCGTGGTACTCAGCCG GGCGACCGAGGTCGATCAGACGCTCCAGCAAGTGCTGTGCGTATTGCACAA TGACGCCTTTTTGCAGCACGGCATGATCTGTCTGTACGACAGCCAGCAGGCG ATTTTGAATATTGAAGCGTTGCAGGAAGCCGATCAGCAGTTAATCCCCGGCA GCTCGCAAATCCGCTATCGTCCGGGCGAAGGGCTGGTCGGGACGGTGCTTTC GCAGGGCCAATCATTAGTGCTGGCGCGCGTTGCTGACGATCAGCGCTTTCTT GACCGGCTCGGGTTGTATGATTACAACCTGCCGTTTATCGCCGTGCCGCTGA TAGGGCCAGATGCGCAGACTTTCGGTGTGCTGACGGCACAACCCATGGCGC GTTACGAAGAGCGATTACCCGCCTGCACCCGCTTTCTGGAAACGGTCGCTAA CCTGGTCGCGCAAACCGTGCGTTTGATGGCACCACCGGCAGTGCGCCCTTCC CCGCGCGCCGCCATAACACAGGCCGCCAGCCCGAAATCCTGCACGGCCTCA CGCGCATTTGGTTTTGAAAATATGGTCGGTAACAGTCCGGCGATGCGCCAGA CCATGGAGATTATCCGTCAGGTTTCGCGCTGGGACACCACCGTTCTGGTACG CGGCGAGAGTGGCACCGGCAAGGAGCTGATTGCCAACGCCATCCACCACCA TTCGCCGCGTGCCGGTGCGCCATTTGTGAAATTCAACTGTGCGGCGCTGCCG GACACACTGCTGGAAAGCGAATTGTTCGGTCACGAGAAAGGGGCATTTACC GGCGCGGTACGCCAGCGTAAAGGCCGTTTTGAGCTGGCCGATGGCGGCACG CTGTTTCTTGACGAGATCGGCGAGAGTAGCGCCTCGTTTCAGGCTAAGCTGC TGCGCATTTTGCAGGAAGGCGAAATGGAACGCGTCGGCGGCGACGAGACAT TGCAAGTGAATGTGCGCATTATTGCCGCGACGAACCGCAATCTTGAAGATGA AGTCCGGCTGGGGCACTTTCGCGAAGATCTCTATTATCGCCTGAATGTGATG CCCATCGCCCTGCCGCCACTACGCGAACGCCAGGAGGACATTGCCGAGCTG GCGCACTTTCTGGTGCGTAAAATCGCCCATAACCAGAGCCGTACGCTGCGCA TTAGCGAGGGCGCTATCCGCCTGCTGATGAGCTACAACTGGCCCGGTAATGT GCGCGAACTGGAAAACTGCCTTGAGCGCTCAGCGGTGATGTCGGAGAACGG TCTGATCGATCGGGATGTGATTTTGTTTAATCATCGCGACCAGCCAGCCAAA CCGCCAGTTATCAGCGTCTCGCATGATGATAACTGGCTCGATAACAACCTTG ACGAGCGCCAGCGGCTGATTGCGGCGCTGGAAAAAGCGGGATGGGTACAAG CCAAAGCCGCGCGCTTGCTGGGGATGACGCCGCGCCAGGTCGCCTATCGTAT TCAGACGATGGATATAACCCTGCCAAGGCTATAA
(2) GlnE
[0301] Decreasing the intracellular glutamine level can prevent the cells from sensing high ammonium levels in the environment. This effect can be achieved by increasing the expression level of glutaminase, an enzyme that converts glutamine into glutamate. In addition, intracellular glutamine can also be reduced by decreasing glutamine synthase (an enzyme that converts ammonia into glutamine). In diazotrophs, fixed ammonia is quickly assimilated into glutamine and glutamate to be used for cellular processes. Disruptions to ammonia assimilation can enable diversion of fixed nitrogen to be exported from the cell as ammonia. The fixed ammonia is predominantly assimilated into glutamine by glutamine synthetase (GS), encoded by glnA, and subsequently into glutamine by glutamine oxoglutarate aminotransferase (GOGAT). In some examples, glnS encodes a glutamine synthetase. GS is regulated post-translationally by GS adenylyl transferase (GlnE), a bi-functional enzyme encoded by glnE that catalyzes both the adenylylation and de-adenylylation of GS through activity of its adenylyl-transferase (AT) and adenylyl-removing (AR) domains, respectively. Under nitrogen limiting conditions, glnA is expressed, and GlnE's AR domain de-adenylates GS, allowing it to be active. Under conditions of nitrogen excess, glnA expression is turned off, and GlnE's AT domain is activated allosterically by glutamine, causing the adenylylation and deactivation of GS.
[0302] In some embodiments, modification of glnE can increase ammonium excretion. In some embodiments, a conserved aspartate-amino acid-aspartate (DXD) motif on AR domain of glnE can be changed. In some embodiments, changing a conserved DXD residue on AR domain of glnE can be used to remove de-adenylylation activity from glnE. In some embodiments, a D residue can be replaced on a DXD motif in the AR region of glnE. In some embodiments, the replacement of a D residue on a DXD motif in the AR region of glnE can leave the GlnB binding site intact so as to allow for regulation of adenylation activity while decreasing or preventing AR activity. In some embodiments, strains that can be utilized in this process of increasing ammonium excretion can include, but are not limited to, Rahnella aquatilis, Kosakonia sacchari, and Klebsiella variicola strains.
[0303] In some embodiments, at least one modification in a gene regulating nitrogen fixation or assimilation results in decreased adenylyl-removing activity of GlnE. In some embodiments, a modification in a gene regulating nitrogen fixation or assimilation comprises a deletion of a portion of the coding sequence of the glnE gene. For example, in some embodiments, 1290 base pairs following the ATG start codon of the glnE gene are deleted. In some embodiments, a deletion of a portion of the coding sequence of the glnE gene results in decreased adenylyl-removing activity of GlnE. In some embodiments, a modification in a gene regulating nitrogen fixation or assimilation results in a truncated GlnE protein lacking an adenylyl-removing (AR) domain. In some embodiments, the GlnE protein lacking the AR domain has a functional ATase domain.
(3) NtrC
[0304] In some embodiments, modification of glnA can be beneficial in increasing ammonium excretion. In some embodiments, modification of NtrC can be beneficial in modifying the level of GlnA protein in the cell. NtrC is the member of the two-component regulatory system NtrB/NtrC, which controls expression of the nitrogen-regulated (ntr) genes in response to nitrogen limitation. Under nitrogen limited conditions, PII signaling proteins initiate a phosphorylation cascade that leads to the phosphorylation of the aspartate (D54) residue of NtrC. The phosphorylated form of NtrC binds upstream of multiple nitrogen metabolism genes it regulates and activates their transcription. Changing aspartate residue to a more negatively charged amino acid residue, glutamate (D54E), led NtrC to behave like phosphorylated and constitutively activated the transcription of its downstream target genes (Klose et al 1993). On the other hand, changing aspartate to alanine (D54A), prohibited phosphorylation of this residue, and hence activation of NtrC, resulting in lack of transcriptional response even under nitrogen limited conditions. In some embodiments, modification of NtrC can be beneficial by preventing the phosphorylization of NtrC. Phosphorylated NtrC can lead to transcriptional activation of glnA. As such, modification of ntrC so as to prevent the phosphorylization of ntrC can be beneficial in decreasing transcription of glnA. In some embodiments, modification of NtrC can be achieved by replacing aspirate 54.
[0305] In some embodiments of the genetically engineered bacteria described herein, the NtrC binding site upstream of nifA is replaced by a constitutive promoter. This can remove NtrC for transcriptional activation of nifA. In some embodiments, the at least one modification in a gene regulating nitrogen fixation or assimilation comprises a mutation in the coding sequence of the ntrC gene. In some embodiments, at least one modification in a gene regulating nitrogen fixation or assimilation comprises changing the 161st nucleotide of the ntrC coding sequence from A to C (SEQ ID NO:6). In some embodiments, the mutation in the coding sequence of the ntrC gene encode NtrC protein comprising a D54A amino acid substitution. In some embodiments, the mutation in NtrcC results in increased ammonium excretion. In some embodiments, strains that can be utilized in this process of increasing ammonium excretion can include, but are not limited to, Rahnella aquatilis, Kosakonia sacchari, and Klebsiella variicola strains.
TABLE-US-00002 NtrCSequence SEQID Description NO Sequence Mutated 6 ATGCAACGAGGGATAGCCTGGATCGTTGATGACGATAGCTCCATCCGCTGGGT NtrC GCTTGAACGCGCGCTCACCGGAGCCGGCTTGAGCTGCACAACGTTCGAAAGC GGCAATGAGGTGCTAGATGCCCTCACCACCAAAACCCCGGATGTACTGCTGTC AGCTATCCGTATGCCGGGAATGGATGGTCTGGCGCTGCTCAAACAGATTAAGC AGCGTCATCCAATGCTTCCGGTCATCATAATGACCGCACATTCCGATCTGGAC GCTGCGGTCAGCGCTTATCAGCAAGGCGCGTTTGATTATCTGCCCAAACCTTT TGATATTGATGAAGCCGTCGCCCTGGTCGACCGGGCGATAAGCCACTATCAGG AGCAGCAACAGCCGCGAAATGCGCCAATAAGCAGCCCAACTGCCGACATCAT CGGCGAAGCGCCGGCAATGCAGGATGTCTTTCGCATTATTGGCCGTTTGTCGC GATCATCCATCAGCGTGCTGATTAATGGCGAATCCGGTACCGGTAAAGAGCTC GTCGCTCACGCCCTGCATCGTCATAGCCCACGTTCAAAAGCGCCGTTTATCGC ACTGAATATGGCGGCAATACCCAAAGACCTGATTGAGTCCGAGCTGTTCGGGC ATGAAAAAGGGGCCTTTACCGGCGCCAATACCGTCCGCCAGGGACGCTTCGA ACAGGCTGACGGCGGCACGCTATTCCTGGATGAAATTGGCGATATGCCGCTTG ATGTCCAGACTCGTCTGCTGCGCGTGCTGGCGGATGGCCAGTTTTATCGCGTG GGCGGTTACGCGCCGGTGAAGGTCGATGTGCGGATCATCGCCGCCACCCACC AGAACCTGGAACAGCGCGTGCAGGAGGGGAAATTCCGTGAAGATTTGTTCCA CCGCCTGAACGTGATCCGGGTGCATTTACCGCCGCTGCGCGAGCGCCGGGAA GATATTCCACGCCTGGCCCGCCATTTTCTGCAGATAGCCGCCCGCGAGCTCGG TGTTGAAGCCAAACAGCTGCATCCGGAAACGGAGACAGCGCTGACACGCCTG GCGTGGCCTGGCAACGTCCGTCAGCTGGAAAACACCTGTCGCTGGCTCACCGT CATGGCCGCCGGCCAGGAGGTACTGACGCAGGATCTGCCGAGCGAACTGTTT GAGACTACGGTTCCGGACAGCCCGACGCAGATGCAGCCCGACAGCTGGGCGA CGCTGCTGGGTCAGTGGGCCGATCGGGCGTTGCGATCCGGTCATCAAAACCTG CTCTCAGAAGCGCAACCCGAAATGGAGCGCACGCTGCTGACGACCGCCCTGC GCCATACCCAGGGGCACAAGCAGGAGGCTGCGCGTCTGCTGGGATGGGGTCG TAATACCCTGACGCGTAAGCTAAAAGAGCTGGGAATGGAGTAG
Generation of Microbe Populations
[0306] Microbes useful in methods and compositions disclosed herein can be obtained by extracting microbes from surfaces or tissues of native plants. Microbes can be obtained by grinding seeds to isolate microbes. Microbes can be obtained by planting seeds in diverse soil samples and recovering microbes from tissues. Additionally, microbes can be obtained by inoculating plants with exogenous microbes and determining which microbes appear in plant tissues. Non-limiting examples of plant tissues may include a seed, seedling, leaf, cutting, plant, bulb, or tuber.
[0307] A method of obtaining microbes may be through the isolation of bacteria from soils. Bacteria may be collected from various soil types. In some example, the soil can be characterized by traits such as high or low fertility, levels of moisture, levels of minerals, and various cropping practices. For example, the soil may be involved in a crop rotation where different crops are planted in the same soil in successive planting seasons. The sequential growth of different crops on the same soil may prevent disproportionate depletion of certain minerals. The bacteria can be isolated from the plants growing in the selected soils. The seedling plants can be harvested at 2-6 weeks of growth. For example, at least 400 isolates can be collected in a round of harvest. Soil and plant types reveal the plant phenotype as well as the conditions, which allow for the downstream enrichment of certain phenotypes.
[0308] Microbes can be isolated from plant tissues to assess microbial traits. The parameters for processing tissue samples may be varied to isolate different types of associative microbes, such as rhizospheric bacteria, epiphytes, or endophytes. The isolates can be cultured in nitrogen-free media to enrich for bacteria that perform nitrogen fixation. Alternatively, microbes can be obtained from global strain banks.
[0309] In planta analytics are performed to assess microbial traits. In some embodiments, the plant tissue can be processed for screening by high throughput processing for DNA and RNA. Additionally, non-invasive measurements can be used to assess plant characteristics, such as colonization. Measurements on wild microbes can be obtained on a plant-by-plant basis. Measurements on wild microbes can also be obtained in the field using medium throughput methods. Measurements can be done successively over time. Model plant system can be used including, but not limited to, Setaria.
[0310] Microbes in a plant system can be screened via transcriptional profiling of a microbe in a plant system. Examples of screening through transcriptional profiling are using methods of quantitative polymerase chain reaction (qPCR), molecular barcodes for transcript detection, Next Generation Sequencing, and microbe tagging with fluorescent markers. Impact factors can be measured to assess colonization in the greenhouse including, but not limited to, microbiome, abiotic factors, soil conditions, oxygen, moisture, temperature, inoculum conditions, and root localization. Nitrogen fixation can be assessed in bacteria by measuring .sup.15N gas/fertilizer (dilution) with IRMS or NanoSIMS as described herein NanoSIMS is high-resolution secondary ion mass spectrometry. The NanoSIMS technique is a way to investigate chemical activity from biological samples. The catalysis of reduction of oxidation reactions that drive the metabolism of microorganisms can be investigated at the cellular, subcellular, molecular and elemental level. NanoSIMS can provide high spatial resolution of greater than 0.1 m. NanoSIMS can detect the use of isotope tracers such as .sup.13C, .sup.15N, and .sup.18O. Therefore, NanoSIMS can be used to the chemical activity nitrogen in the cell.
[0311] One way of enriching a microbe population is according to genotype. For example, a polymerase chain reaction (PCR) assay with a targeted primer or specific primer. Primers designed for the nifH gene can be used to identity diazotrophs because diazotrophs express the nifH gene in the process of nitrogen fixation. A microbial population can also be enriched via single-cell culture-independent approaches and chemotaxis-guided isolation approaches. Alternatively, targeted isolation of microbes can be performed by culturing the microbes on selection media. Premeditated approaches to enriching microbial populations for desired traits can be guided by bioinformatics data and are described herein.
Enriching for Microbes with Nitrogen Fixation Capabilities Using Bioinformatics
[0312] Bioinformatic tools can be used to identify and isolate plant growth promoting rhizobacteria (PGPRs), which are selected based on their ability to perform nitrogen fixation. Microbes with high nitrogen fixing ability can promote favorable traits in plants. Bioinformatic modes of analysis for the identification of PGPRs include, but are not limited to, genomics, metagenomics, targeted isolation, gene sequencing, transcriptome sequencing, and modeling.
[0313] Genomics analysis can be used to identify PGPRs and confirm the presence of mutations with methods of Next Generation Sequencing as described herein and microbe version control.
[0314] Metagenomics can be used to identify and isolate PGPR using a prediction algorithm for colonization. Metadata can also be used to identify the presence of an engineered strain in environmental and greenhouse samples.
[0315] Transcriptomic sequencing can be used to predict genotypes leading to PGPR phenotypes. Additionally, transcriptomic data is used to identify promoters for altering gene expression. Transcriptomic data can be analyzed in conjunction with the Whole Genome Sequence (WGS) to generate models of metabolism and gene regulatory networks.
Domestication of Microbes
[0316] Microbes isolated from nature can undergo a domestication process wherein the microbes are converted to a form that is genetically trackable and identifiable. One way to domesticate a microbe is to engineer it with antibiotic resistance. The process of engineering antibiotic resistance can begin by determining the antibiotic sensitivity in the wild type microbial strain. If the bacteria are sensitive to the antibiotic, then the antibiotic can be a good candidate for antibiotic resistance engineering. Subsequently, an antibiotic resistant gene or a counterselectable suicide vector can be incorporated into the genome of a microbe using recombineering methods. A counterselectable suicide vector may consist of a deletion of the gene of interest, a selectable marker, and the counterselectable marker sacB. Counterselection can be used to exchange native microbial DNA sequences with antibiotic resistant genes. A medium throughput method can be used to evaluate multiple microbes simultaneously allowing for parallel domestication.
[0317] Alternative methods of domestication include the use of homing nucleases to prevent the suicide vector sequences from looping out or from obtaining intervening vector sequences.
[0318] DNA vectors can be introduced into bacteria via several methods including electroporation and chemical transformations. A standard library of vectors can be used for transformations. An example of a method of gene editing is CRISPR preceded by Cas9 testing to ensure activity of Cas9 in the microbes.
Non-Transgenic Engineering of Microbes
[0319] A microbial population with favorable traits can be obtained via directed evolution. Direct evolution is an approach wherein the process of natural selection is mimicked to evolve proteins or nucleic acids towards a user-defined goal. An example of direct evolution is when random mutations are introduced into a microbial population, the microbes with the most favorable traits are selected, and the growth of the selected microbes is continued. The most favorable traits in growth promoting rhizobacteria (PGPRs) may be in nitrogen fixation. The method of directed evolution may be iterative and adaptive based on the selection process after each iteration.
[0320] Plant growth promoting rhizobacteria (PGPRs) with high capability of nitrogen fixation can be generated. The evolution of PGPRs can be carried out via the introduction of genetic variation. Genetic variation can be introduced via polymerase chain reaction mutagenesis, oligonucleotide-directed mutagenesis, saturation mutagenesis, fragment shuffling mutagenesis, homologous recombination, CRISPR/Cas9 systems, chemical mutagenesis, and combinations thereof. These approaches can introduce random mutations into the microbial population. For example, mutants can be generated using synthetic DNA or RNA via oligonucleotide-directed mutagenesis. Mutants can be generated using tools contained on plasmids, which are later cured.
[0321] Genes of interest can be identified using libraries from other species with improved traits including, but not limited to, improved PGPR properties, improved colonization of cereals, increased oxygen sensitivity, increased nitrogen fixation, and increased ammonia excretion.
[0322] Intrageneric genes can be designed based on these libraries using software such as Geneious or Platypus design software. Mutations can be designed with the aid of machine learning. Mutations can be designed with the aid of a metabolic model. Automated design of the mutation can be done using a la Platypus and will guide RNAs for Cas-directed mutagenesis.
[0323] The intra-generic genes can be transferred into the host microbe. Additionally, reporter systems can also be transferred to the microbe. The reporter systems characterize promoters, determine the transformation success, screen mutants, and act as negative screening tools.
[0324] The microbes carrying the mutation can be cultured via serial passaging. A microbial colony contains a single variant of the microbe. Microbial colonies are screened with the aid of an automated colony picker and liquid handler. Mutants with gene duplication and increased copy number express a higher genotype of the desired trait.
Selection of Plant Growth Promoting Microbes Based on Nitrogen Fixation
[0325] The microbial colonies can be screened using various assays to assess nitrogen fixation. One way to measure nitrogen fixation is via a single fermentative assay, which measures nitrogen excretion. An alternative method is the acetylene reduction assay (ARA) with in-line sampling over time. ARA can be performed in high throughput plates of microtube arrays. ARA can be performed with live plants and plant tissues. The media formulation and media oxygen concentration can be varied in ARA assays. Another method of screening microbial variants is by using biosensors. The use of NanoSIMS and Raman microspectroscopy can be used to investigate the activity of the microbes. In some cases, bacteria can also be cultured and expanded using methods of fermentation in bioreactors. The bioreactors are designed to improve robustness of bacteria growth and to decrease the sensitivity of bacteria to oxygen. Medium to high TP plate-based microfermentors are used to evaluate oxygen sensitivity, nutritional needs, nitrogen fixation, and nitrogen excretion. The bacteria can also be co-cultured with competitive or beneficial microbes to elucidate cryptic pathways. Flow cytometry can be used to screen for bacteria that produce high levels of nitrogen using chemical, colorimetric, or fluorescent indicators. The bacteria may be cultured in the presence or absence of a nitrogen source. For example, the bacteria may be cultured with glutamine, ammonia, urea or nitrates.
Guided Microbial Remodeling
[0326] Guided microbial remodeling is a method to systematically identify and improve the role of species within the crop microbiome. In some aspects, and according to a particular methodology of grouping/categorization, the method comprises three steps: 1) selection of candidate species by mapping plant-microbe interactions and predicting regulatory networks linked to a particular phenotype, 2) pragmatic and predictable improvement of microbial phenotypes through intra-species crossing of regulatory networks and gene clusters within a microbe's genome, and 3) screening and selection of new microbial genotypes that produce desired crop phenotypes.
[0327] To systematically assess the improvement of strains, a model is created that links colonization dynamics of the microbial community to genetic activity by key species. The model is used to predict genetic targets for non-intergeneric genetic remodeling (i.e. engineering the genetic architecture of the microbe in a non-transgenic fashion).
[0328] Rational improvement of the crop microbiome may be used to increase soil biodiversity, tune impact of keystone species, and/or alter timing and expression of important metabolic pathways.
[0329] To this end, the inventors have developed a platform to identify and improve the role of strains within the crop microbiome. In some aspects, the inventors call this process microbial breeding.
[0330] The aforementioned Guided Microbial Remodeling process will be further elaborated upon in the Examples, for instance in Example 1, entitled: Guided Microbial RemodelingA Platform for the Rational Improvement of Microbial Species for Agriculture.
Serial Passage
[0331] Production of bacteria to improve plant traits (e.g., nitrogen fixation) can be achieved through serial passage. The production of these bacteria can be done by selecting plants, which have a particular improved trait that is influenced by the microbial flora, in addition to identifying bacteria and/or compositions that are capable of imparting one or more improved traits to one or more plants. One method of producing a bacteria to improve a plant trait includes the steps of: (a) isolating bacteria from tissue or soil of a first plant; (b) introducing a genetic variation into one or more of the bacteria to produce one or more variant bacteria; (c) exposing a plurality of plants to the variant bacteria; (d) isolating bacteria from tissue or soil of one of the plurality of plants, wherein the plant from which the bacteria is isolated has an improved trait relative to other plants in the plurality of plants; and (e) repeating steps (b) to (d) with bacteria isolated from the plant with an improved trait (step (d)). Steps (b) to (d) can be repeated any number of times (e.g., once, twice, three times, four times, five times, ten times, or more) until the improved trait in a plant reaches a desired level. Further, the plurality of plants can be more than two plants, such as 10 to 20 plants, or 20 or more, 50 or more, 100 or more, 300 or more, 500 or more, or 1000 or more plants.
[0332] In addition to obtaining a plant with an improved trait, a bacterial population comprising bacteria comprising one or more genetic variations introduced into one or more genes (e.g., genes regulating nitrogen fixation) is obtained. By repeating the steps described above, a population of bacteria can be obtained that include the most appropriate members of the population that correlate with a plant trait of interest. The bacteria in this population can be identified and their beneficial properties determined, such as by genetic and/or phenotypic analysis. Genetic analysis may occur of isolated bacteria in step (a). Phenotypic and/or genotypic information may be obtained using techniques including: high through-put screening of chemical components of plant origin, sequencing techniques including high throughput sequencing of genetic material, differential display techniques (including DDRT-PCR, and DD-PCR), nucleic acid microarray techniques, RNA-sequencing (Whole Transcriptome Shotgun Sequencing), and qRT-PCR (quantitative real time PCR).
[0333] Information gained can be used to obtain community profiling information on the identity and activity of bacteria present, such as phylogenetic analysis or microarray-based screening of nucleic acids coding for components of rRNA operons or other taxonomically informative loci. Examples of taxonomically informative loci include 16S rRNA gene, 23S rRNA gene, 5S rRNA gene, 5.8S rRNA gene, 12S rRNA gene, 18S rRNA gene, 28S rRNA gene, gyrB gene, rpoB gene, fusA gene, recA gene, coxl gene, nifD gene. Example processes of taxonomic profiling to determine taxa present in a population are described in US 2014/0155283. Bacterial identification may comprise characterizing activity of one or more genes or one or more signaling pathways, such as genes associated with the nitrogen fixation pathway. Synergistic interactions (where two components, by virtue of their combination, increase a desired effect by more than an additive amount) between different bacterial species may also be present in the bacterial populations.
Genetic VariationLocations and Sources of Genomic Alteration
[0334] The genetic variation may be a gene selected from the group consisting of: nifA, nifL, ntrB, ntrC, glnA, glnB, glnK, draT, amtB, glnD, glnE, nifJ, nifH, nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB, and nifQ. The genetic variation may be a variation in a gene encoding a protein with functionality selected from the group consisting of: glutamine synthetase, glutaminase, glutamine synthetase adenylyltransferase, transcriptional activator, antitranscriptional activator, pyruvate flavodoxin oxidoreductase, flavodoxin, and NAD+-dinitrogenreductase aDP-D-ribosyltransferase. The genetic variation may be a mutation that results in one or more of: increased expression or activity of NifA or glutaminase; decreased expression or activity of NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, AmtB; decreased adenylyl removing activity of GlnE; or decreased uridylyl-removing activity of GlnD. The genetic variation may be a variation in a gene selected from the group consisting of: bcsii, bcsiii, yjbE, fhaB, pehA, otsB, treZ, glsA2, and combinations thereof. In some embodiments, a genetic variation may be a variation in any of the genes described throughout this disclosure.
[0335] Introducing a genetic variation may comprise insertion and/or deletion of one or more nucleotides at a target site, such as 1, 2, 3, 4, 5, 10, 25, 50, 100, 250, 500, or more nucleotides. The genetic variation introduced into one or more bacteria of the methods disclosed herein may be a knock-out mutation (e.g. deletion of a promoter, insertion or deletion to produce a premature stop codon, deletion of an entire gene), or it may be elimination or abolishment of activity of a protein domain (e.g. point mutation affecting an active site, or deletion of a portion of a gene encoding the relevant portion of the protein product), or it may alter or abolish a regulatory sequence of a target gene. One or more regulatory sequences may also be inserted, including heterologous regulatory sequences and regulatory sequences found within a genome of a bacterial species or genus corresponding to the bacteria into which the genetic variation is introduced.
[0336] Moreover, regulatory sequences may be selected based on the expression level of a gene in a bacterial culture or within a plant tissue. The genetic variation may be a pre-determined genetic variation that is specifically introduced to a target site. The genetic variation may be a random mutation within the target site. The genetic variation may be an insertion or deletion of one or more nucleotides. In some cases, a plurality of different genetic variations (e.g. 2, 3, 4, 5, 10, or more) are introduced into one or more of the isolated bacteria before exposing the bacteria to plants for assessing trait improvement. The plurality of genetic variations can be any of the above types, the same or different types, and in any combination. In some cases, a plurality of different genetic variations are introduced serially, introducing a first genetic variation after a first isolation step, a second genetic variation after a second isolation step, and so forth so as to accumulate a plurality of genetic variations in bacteria imparting progressively improved traits on the associated plants.
Genetic VariationMethods of Introducing Genomic Alteration
[0337] In general, the term genetic variation refers to any change introduced into a polynucleotide sequence relative to a reference polynucleotide, such as a reference genome or portion thereof, or reference gene or portion thereof. A genetic variation may be referred to as a mutation, and a sequence or organism comprising a genetic variation may be referred to as a genetic variant or mutant. Genetic variations can have any number of effects, such as the increase or decrease of some biological activity, including gene expression, metabolism, and cell signaling. Genetic variations can be specifically introduced to a target site, or introduced randomly. A variety of molecular tools and methods are available for introducing genetic variation. For example, genetic variation can be introduced via polymerase chain reaction mutagenesis, oligonucleotide-directed mutagenesis, saturation mutagenesis, fragment shuffling mutagenesis, homologous recombination, recombineering, lambda red mediated recombination, CRISPR/Cas9 systems, chemical mutagenesis, and combinations thereof. Chemical methods of introducing genetic variation include exposure of DNA to a chemical mutagen, e.g., ethyl methanesulfonate (EMS), methyl methanesulfonate (MMS), N-nitrosourea (EN U), N-methyl-N-nitro-N-nitrosoguanidine, 4-nitroquinoline N-oxide, diethylsulfate, benzopyrene, cyclophosphamide, bleomycin, triethylmelamine, acrylamide monomer, nitrogen mustard, vincristine, diepoxyalkanes (for example, diepoxybutane), ICR-170, formaldehyde, procarbazine hydrochloride, ethylene oxide, dimethylnitrosamine, 7,12 dimethylbenz(a)anthracene, chlorambucil, hexamethylphosphoramide, bisulfan, and the like. Radiation mutation-inducing agents include ultraviolet radiation, -irradiation, X-rays, and fast neutron bombardment. Genetic variation can also be introduced into a nucleic acid using, e.g., trimethylpsoralen with ultraviolet light. Random or targeted insertion of a mobile DNA element, e.g., a transposable element, is another suitable method for generating genetic variation. Genetic variations can be introduced into a nucleic acid during amplification in a cell-free in vitro system, e.g., using a polymerase chain reaction (PCR) technique such as error-prone PCR. Genetic variations can be introduced into a nucleic acid in vitro using DNA shuffling techniques (e.g., exon shuffling, domain swapping, and the like). Genetic variations can also be introduced into a nucleic acid as a result of a deficiency in a DNA repair enzyme in a cell, e.g., the presence in a cell of a mutant gene encoding a mutant DNA repair enzyme is expected to generate a high frequency of mutations (i.e., about 1 mutation/100 genes-1 mutation/10,000 genes) in the genome of the cell. Examples of genes encoding DNA repair enzymes include but are not limited to Mut H, Mut S, Mut L, and Mut U, and the homologs thereof in other species (e.g., MSH 1 6, PMS 1 2, MLH 1, GTBP, ERCC-1, and the like). Example descriptions of various methods for introducing genetic variations are provided in e.g., Stemple (2004) Nature 5:1-7; Chiang et al. (1993) PCR Methods Appl 2(3): 210-217; Stemmer (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751; and U.S. Pat. Nos. 6,033,861, and 6,773,900.
[0338] Genetic variations introduced into microbes may be classified as transgenic, cisgenic, intragenomic, intrageneric, intergeneric, synthetic, evolved, rearranged, or SNPs.
[0339] Genetic variation may be introduced into numerous metabolic pathways within microbes to elicit improvements in the traits described above. Representative pathways include sulfur uptake pathways, glycogen biosynthesis, the glutamine regulation pathway, the molybdenum uptake pathway, the nitrogen fixation pathway, ammonia assimilation, ammonia excretion or secretion, Nitrogen uptake, glutamine biosynthesis, colonization pathways, annamox, phosphate solubilization, organic acid transport, organic acid production, agglutinins production, reactive oxygen radical scavenging genes, Indole Acetic Acid biosynthesis, trehalose biosynthesis, plant cell wall degrading enzymes or pathways, root attachment genes, exopolysaccharide secretion, glutamate synthase pathway, iron uptake pathways, siderophore pathway, chitinase pathway, ACC deaminase, glutathione biosynthesis, phosphorous signaling genes, quorum quenching pathway, cytochrome pathways, hemoglobin pathway, bacterial hemoglobin-like pathway, small RNA rsmZ, rhizobitoxine biosynthesis, lapA adhesion protein, AHL quorum sensing pathway, phenazine biosynthesis, cyclic lipopeptide biosynthesis, and antibiotic production.
[0340] CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats)/CRISPR associated (Cas) systems can be used to introduce desired mutations. CRISPR/Cas9 provide bacteria and archaea with adaptive immunity against viruses and plasmids by using CRISPR RNAs (crRNAs) to guide the silencing of invading nucleic acids. The Cas9 protein (or functional equivalent and/or variant thereof, i.e., Cas9-like protein) naturally contains DNA endonuclease activity that depends on the association of the protein with two naturally occurring or synthetic RNA molecules called crRNA and tracrRNA (also called guide RNAs). In some cases, the two molecules are covalently link to form a single molecule (also called a single guide RNA (sgRNA). Thus, the Cas9 or Cas9-like protein associates with a DNA-targeting RNA (which term encompasses both the two-molecule guide RNA configuration and the single-molecule guide RNA configuration), which activates the Cas9 or Cas9-like protein and guides the protein to a target nucleic acid sequence. If the Cas9 or Cas9-like protein retains its natural enzymatic function, it will cleave target DNA to create a double-stranded break, which can lead to genome alteration (i.e., editing: deletion, insertion (when a donor polynucleotide is present), replacement, etc.), thereby altering gene expression. Some variants of Cas9 (which variants are encompassed by the term Cas9-like) have been altered such that they have a decreased DNA cleaving activity (in some cases, they cleave a single strand instead of both strands of the target DNA, while in other cases, they have severely reduced to no DNA cleavage activity). Further exemplary descriptions of CRISPR systems for introducing genetic variation can be found in, e.g. U.S. Pat. No. 8,795,965.
[0341] As a cyclic amplification technique, polymerase chain reaction (PCR) mutagenesis uses mutagenic primers to introduce desired mutations. PCR is performed by cycles of denaturation, annealing, and extension. After amplification by PCR, selection of mutated DNA and removal of parental plasmid DNA can be accomplished by: 1) replacement of dCTP by hydroxymethylated-dCTP during PCR, followed by digestion with restriction enzymes to remove non-hydroxymethylated parent DNA only; 2) simultaneous mutagenesis of both an antibiotic resistance gene and the studied gene changing the plasmid to a different antibiotic resistance, the new antibiotic resistance facilitating the selection of the desired mutation thereafter; 3) after introducing a desired mutation, digestion of the parent methylated template DNA by restriction enzyme Dpnl which cleaves only methylated DNA, by which the mutagenized unmethylated chains are recovered; or 4) circularization of the mutated PCR products in an additional ligation reaction to increase the transformation efficiency of mutated DNA. Further description of exemplary methods can be found in e.g. U.S. Pat. Nos. 7,132,265, 6,713,285, 6,673,610, 6,391,548, 5,789,166, 5,780,270, 5,354,670, 5,071,743, and US 2010/0267147.
[0342] Oligonucleotide-directed mutagenesis, also called site-directed mutagenesis, typically utilizes a synthetic DNA primer. This synthetic primer contains the desired mutation and is complementary to the template DNA around the mutation site so that it can hybridize with the DNA in the gene of interest. The mutation may be a single base change (a point mutation), multiple base changes, deletion, or insertion, or a combination of these. The single-strand primer is then extended using a DNA polymerase, which copies the rest of the gene. The gene thus copied contains the mutated site, and may then be introduced into a host cell as a vector and cloned. Finally, mutants can be selected by DNA sequencing to check that they contain the desired mutation.
[0343] Genetic variations can be introduced using error-prone PCR. In this technique the gene of interest is amplified using a DNA polymerase under conditions that are deficient in the fidelity of replication of sequence. The result is that the amplification products contain at least one error in the sequence. When a gene is amplified and the resulting product(s) of the reaction contain one or more alterations in sequence when compared to the template molecule, the resulting products are mutagenized as compared to the template. Another means of introducing random mutations is exposing cells to a chemical mutagen, such as nitrosoguanidine or ethyl methanesulfonate (Nestmann, Mutat Res 1975 June; 28(3):323-30), and the vector containing the gene is then isolated from the host.
[0344] Saturation mutagenesis is another form of random mutagenesis, in which one tries to generate all or nearly all possible mutations at a specific site, or narrow region of a gene. In a general sense, saturation mutagenesis is comprised of mutagenizing a complete set of mutagenic cassettes (wherein each cassette is, for example, 1-500 bases in length) in defined polynucleotide sequence to be mutagenized (wherein the sequence to be mutagenized is, for example, from 15 to 100,000 bases in length). Therefore, a group of mutations (e.g. ranging from 1 to 100 mutations) is introduced into each cassette to be mutagenized. A grouping of mutations to be introduced into one cassette can be different or the same from a second grouping of mutations to be introduced into a second cassette during the application of one round of saturation mutagenesis. Such groupings are exemplified by deletions, additions, groupings of particular codons, and groupings of particular nucleotide cassettes.
[0345] Fragment shuffling mutagenesis, also called DNA shuffling, is a way to rapidly propagate beneficial mutations. In an example of a shuffling process, DNAse is used to fragment a set of parent genes into pieces of e.g. about 50-100 bp in length. This is then followed by a polymerase chain reaction (PCR) without primersDNA fragments with sufficient overlapping homologous sequence will anneal to each other and are then be extended by DNA polymerase. Several rounds of this PCR extension are allowed to occur, after some of the DNA molecules reach the size of the parental genes. These genes can then be amplified with another PCR, this time with the addition of primers that are designed to complement the ends of the strands. The primers may have additional sequences added to their 5 ends, such as sequences for restriction enzyme recognition sites needed for ligation into a cloning vector. Further examples of shuffling techniques are provided in US 2005/0266541.
[0346] Homologous recombination mutagenesis involves recombination between an exogenous DNA fragment and the targeted polynucleotide sequence. After a double-stranded break occurs, sections of DNA around the 5 ends of the break are cut away in a process called resection. In the strand invasion step that follows, an overhanging 3 end of the broken DNA molecule then invades a similar or identical DNA molecule that is not broken. The method can be used to delete a gene, remove exons, add a gene, and introduce point mutations. Homologous recombination mutagenesis can be permanent or conditional. Typically, a recombination template is also provided. A recombination template may be a component of another vector, contained in a separate vector, or provided as a separate polynucleotide. In some embodiments, a recombination template is designed to serve as a template in homologous recombination, such as within or near a target sequence nicked or cleaved by a site-specific nuclease. A template polynucleotide may be of any suitable length, such as about or more than about 10, 15, 20, 25, 50, 75, 100, 150, 200, 500, 1000, or more nucleotides in length. In some embodiments, the template polynucleotide is complementary to a portion of a polynucleotide comprising the target sequence.
[0347] When optimally aligned, a template polynucleotide might overlap with one or more nucleotides of a target sequences (e.g. about or more than about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or more nucleotides). In some embodiments, when a template sequence and a polynucleotide comprising a target sequence are optimally aligned, the nearest nucleotide of the template polynucleotide is within about 1, 5, 10, 15, 20, 25, 50, 75, 100, 200, 300, 400, 500, 1000, 5000, 10000, or more nucleotides from the target sequence. Non-limiting examples of site-directed nucleases useful in methods of homologous recombination include zinc finger nucleases, CRISPR nucleases, TALE nucleases, and meganuclease. For a further description of the use of such nucleases, see e.g. U.S. Pat. No. 8,795,965 and US 2014/0301990.
[0348] Mutagens that create primarily point mutations and short deletions, insertions, transversions, and/or transitions, including chemical mutagens or radiation, may be used to create genetic variations. Mutagens include, but are not limited to, ethyl methanesulfonate, methylmethane sulfonate, N-ethyl-N-nitrosurea, triethylmelamine, N-methyl-N-nitrosourea, procarbazine, chlorambucil, cyclophosphamide, diethyl sulfate, acrylamide monomer, melphalan, nitrogen mustard, vincristine, dimethylnitrosamine, N-methyl-N-nitro-Nitrosoguanidine, nitrosoguanidine, 2-aminopurine, 7,12 dimethyl-benz(a)anthracene, ethylene oxide, hexamethylphosphoramide, bisulfan, diepoxyalkanes (diepoxyoctane, diepoxybutane, and the like), 2-methoxy-6-chloro-9[3-(ethyl-2-chloro-ethyl)aminopropylamino]acridine dihydrochloride and formaldehyde.
[0349] Introducing genetic variation may be an incomplete process, such that some bacteria in a treated population of bacteria carry a desired mutation while others do not. In some cases, it is desirable to apply a selection pressure so as to enrich for bacteria carrying a desired genetic variation. Traditionally, selection for successful genetic variants involved selection for or against some functionality imparted or abolished by the genetic variation, such as in the case of inserting antibiotic resistance gene or abolishing a metabolic activity capable of converting a non-lethal compound into a lethal metabolite. It is also possible to apply a selection pressure based on a polynucleotide sequence itself, such that only a desired genetic variation need be introduced (e.g., without also requiring a selectable marker). In this case, the selection pressure can comprise cleaving genomes lacking the genetic variation introduced to a target site, such that selection is effectively directed against the reference sequence into which the genetic variation is sought to be introduced. Typically, cleavage occurs within 100 nucleotides of the target site (e.g. within 75, 50, 25, 10, or fewer nucleotides from the target site, including cleavage at or within the target site).
[0350] Cleaving may be directed by a site-specific nuclease selected from the group consisting of a Zinc Finger nuclease, a CRISPR nuclease, a TALE nuclease (TALEN), and a meganuclease. Such a process is similar to processes for enhancing homologous recombination at a target site, except that no template for homologous recombination is provided. As a result, bacteria lacking the desired genetic variation are more likely to undergo cleavage that, left unrepaired, results in cell death. Bacteria surviving selection may then be isolated for use in exposing to plants for assessing conferral of an improved trait.
[0351] A CRISPR nuclease may be used as the site-specific nuclease to direct cleavage to a target site. An improved selection of mutated microbes can be obtained by using Cas9 to kill nonmutated cells. Plants are then inoculated with the mutated microbes to re-confirm symbiosis and create evolutionary pressure to select for efficient symbionts. Microbes can then be re-isolated from plant tissues. CRISPR nuclease systems employed for selection against non-variants can employ similar elements to those described above with respect to introducing genetic variation, except that no template for homologous recombination is provided. Cleavage directed to the target site thus enhances death of affected cells.
[0352] Other options for specifically inducing cleavage at a target site are available, such as zinc finger nucleases, TALE nuclease (TALEN) systems, and meganuclease. Zinc-finger nucleases (ZFNs) are artificial DNA endonucleases generated by fusing a zinc finger DNA binding domain to a DNA cleavage domain. ZFNs can be engineered to target desired DNA sequences and this enables zinc-finger nucleases to cleave unique target sequences. When introduced into a cell, ZFNs can be used to edit target DNA in the cell (e.g., the cell's genome) by inducing double stranded breaks. Transcription activator-like effector nucleases (TALENs) are artificial DNA endonucleases generated by fusing a TAL (Transcription activator-like) effector DNA binding domain to a DNA cleavage domain. TALENS can be quickly engineered to bind practically any desired DNA sequence and when introduced into a cell, TALENs can be used to edit target DNA in the cell (e.g., the cell's genome) by inducing double strand breaks. Meganucleases (homing endonuclease) are endodeoxyribonucleases characterized by a large recognition site (doublestranded DNA sequences of 12 to 40 base pairs. Meganucleases can be used to replace, eliminate or modify sequences in a highly targeted way. By modifying their recognition sequence through protein engineering, the targeted sequence can be changed.
Genetic VariationMethods of Identification
[0353] The microbes of the present disclosure may be identified by one or more genetic modifications or alterations, which have been introduced into said microbe. One method by which said genetic modification or alteration can be identified is via reference to a SEQ ID NO that contains a portion of the microbe's genomic sequence that is sufficient to identify the genetic modification or alteration.
[0354] Further, in the case of microbes that have not had a genetic modification or alteration (e.g. a wild type, WT) introduced into their genomes, the disclosure can utilize 16S nucleic acid sequences to identify said microbes. A 16S nucleic acid sequence is an example of a molecular marker or genetic marker, which refers to an indicator that is used in methods for visualizing differences in characteristics of nucleic acid sequences. Examples of other such indicators are restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNPs), insertion mutations, microsatellite markers (SSRs), sequence-characterized amplified regions (SCARs), cleaved amplified polymorphic sequence (CAPS) markers or isozyme markers or combinations of the markers described herein which defines a specific genetic and chromosomal location. Markers further include polynucleotide sequences encoding 16S or 18S rRNA, and internal transcribed spacer (ITS) sequences, which are sequences found between small-subunit and large-subunit rRNA genes that have proven to be especially useful in elucidating relationships or distinctions when compared against one another. Furthermore, the disclosure utilizes unique sequences found in genes of interest (e.g. nif H,D,K,L,A, glnE, amtB, etc.) to identify microbes disclosed herein.
Improvement of Traits
[0355] Methods of the present disclosure may be employed to introduce or improve one or more of a variety of desirable traits. Examples of traits that may introduced or improved include: root biomass, root length, height, shoot length, leaf number, water use efficiency, overall biomass, yield, fruit size, grain size, photosynthesis rate, tolerance to drought, heat tolerance, salt tolerance, resistance to nematode stress, resistance to a fungal pathogen, resistance to a bacterial pathogen, resistance to a viral pathogen, level of a metabolite, and proteome expression. The desirable traits, including height, overall biomass, root and/or shoot biomass, seed germination, seedling survival, photosynthetic efficiency, transpiration rate, seed/fruit number or mass, plant grain or fruit yield, leaf chlorophyll content, photosynthetic rate, root length, or any combination thereof, can be used to measure growth, and compared with the growth rate of reference agricultural plants (e.g., plants without the improved traits) grown under identical conditions.
[0356] A preferred trait to be introduced or improved is nitrogen fixation, as described herein. A second preferred trait to be introduced or improved is colonization potential, as described herein. In some cases, a plant resulting from the methods described herein exhibits a difference in the trait that is at least about 5% greater, for example at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 75%, at least about 80%, at least about 80%, at least about 90%, or at least 100%, at least about 200%, at least about 300%, at least about 400% or greater than a reference agricultural plant grown under the same conditions in the soil. In additional examples, a plant resulting from the methods described herein exhibits a difference in the trait that is at least about 5% greater, for example at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 75%, at least about 80%, at least about 80%, at least about 90%, or at least 100%, at least about 200%, at least about 300%, at least about 400% or greater than a reference agricultural plant grown under similar conditions in the soil.
[0357] The trait to be improved may be assessed under conditions including the application of one or more biotic or abiotic stressors. Examples of stressors include abiotic stresses (such as heat stress, salt stress, drought stress, cold stress, and low nutrient stress) and biotic stresses (such as nematode stress, insect herbivory stress, fungal pathogen stress, bacterial pathogen stress, and viral pathogen stress).
[0358] The trait improved by methods and compositions of the present disclosure may be nitrogen fixation, including in a plant not previously capable of nitrogen fixation. In some cases, bacteria isolated according to a method described herein produce 1% or more (e.g. 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or more) of a plant's nitrogen, which may represent an increase in nitrogen fixation capability of at least 2-fold (e.g. 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold, or more) as compared to bacteria isolated from the first plant before introducing any genetic variation. In some cases, the bacteria produce 5% or more of a plant's nitrogen. The desired level of nitrogen fixation may be achieved after repeating the steps of introducing genetic variation, exposure to a plurality of plants, and isolating bacteria from plants with an improved trait one or more times (e.g. 1, 2, 3, 4, 5, 10, 15, 25, or more times). In some cases, enhanced levels of nitrogen fixation are achieved in the presence of fertilizer supplemented with glutamine, ammonia, or other chemical source of nitrogen. Methods for assessing degree of nitrogen fixation are known, examples of which are described herein.
[0359] Microbe breeding is a method to systematically identify and improve the role of species within the crop microbiome. The method comprises three steps: 1) selection of candidate species by mapping plant-microbe interactions and predicting regulatory networks linked to a particular phenotype, 2) pragmatic and predictable improvement of microbial phenotypes through intraspecies crossing of regulatory networks and gene clusters, and 3) screening and selection of new microbial genotypes that produce desired crop phenotypes. To systematically assess the improvement of strains, a model is created that links colonization dynamics of the microbial community to genetic activity by key species. The model is used to predict genetic targets for breeding and improve the frequency of selecting improvements in microbiome-encoded traits of agronomic relevance.
Bacterial Species
[0360] Microbes useful in the methods and compositions disclosed herein may be obtained from any source. In some cases, microbes may be bacteria, archaea, protozoa or fungi. The microbes of this disclosure may be nitrogen fixing microbes, for example a nitrogen fixing bacteria, nitrogen fixing archaea, nitrogen fixing fungi, nitrogen fixing yeast, or nitrogen fixing protozoa. Microbes useful in the methods and compositions disclosed herein may be spore forming microbes, for example spore forming bacteria. In some cases, bacteria useful in the methods and compositions disclosed herein may be Gram positive bacteria or Gram negative bacteria. In some cases, the bacteria may be an endospore forming bacteria of the Firmicute phylum. In some cases, the bacteria may be a diazotroph. In some cases, the bacteria may not be a diazotroph.
[0361] The methods and compositions of this disclosure may be used with an archaea, such as, for example, Methanothermobacter thermoautotrophicus.
[0362] In some cases, bacteria which may be useful include, but are not limited to, Agrobacterium radiobacter, Bacillus acidocaldarius, Bacillus acidoterrestris, Bacillus agri, Bacillus aizawai, Bacillus albolactis, Bacillus alcalophilus, Bacillus alvei, Bacillus aminoglucosidicus, Bacillus aminovorans, Bacillus amylolyticus (also known as Paenibacillus amylolyticus) Bacillus amyloliquefaciens, Bacillus aneurinolyticus, Bacillus atrophaeus, Bacillus azotoformans, Bacillus badius, Bacillus cereus (synonyms: Bacillus endorhythmos, Bacillus medusa), Bacillus chitinosporus, Bacillus circulans, Bacillus coagulans, Bacillus endoparasiticus Bacillus fastidiosus, Bacillus firmus, Bacillus kurstaki, Bacillus lacticola, Bacillus lactimorbus, Bacillus lactis, Bacillus laterosporus (also known as Brevibacillus laterosporus), Bacillus lautus, Bacillus lentimorbus, Bacillus lentus, Bacillus licheniformis, Bacillus maroccanus, Bacillus megaterium, Bacillus metiens, Bacillus mycoides, Bacillus natto, Bacillus nematocida, Bacillus nigrificans, Bacillus nigrum, Bacillus pantothenticus, Bacillus popillae, Bacillus psychrosaccharolyticus, Bacillus pumilus, Bacillus siamensis, Bacillus smithii, Bacillus sphaericus, Bacillus subtilis, Bacillus thuringiensis, Bacillus uniflagellatus, Bradyrhizobium japonicum, Brevibacillus brevis Brevibacillus laterosporus (formerly Bacillus laterosporus), Chromobacterium subtsugae, Delftia acidovorans, Lactobacillus acidophilus, Lysobacter antibioticus, Lysobacter enzymogenes, Paenibacillus alvei, Paenibacillus polymyxa, Paenibacillus popilliae (formerly Bacillus popilliae), Pantoea agglomerans, Pasteuria penetrans (formerly Bacillus penetrans), Pasteuria usgae, Pectobacterium carotovorum (formerly Erwinia carotovora), Pseudomonas aeruginosa, Pseudomonas aureofaciens, Pseudomonas cepacia (formerly known as Burkholderia cepacia), Pseudomonas chlororaphis, Pseudomonas fluorescens, Pseudomonas proradix, Pseudomonas putida, Pseudomonas syringae, Serratia entomophila, Serratia marcescens, Streptomyces colombiensis, Streptomyces galbus, Streptomyces goshikiensis, Streptomyces griseoviridis, Streptomyces lavendulae, Streptomyces prasinus, Streptomyces saraceticus, Streptomyces venezuelae, Xanthomonas campestris, Xenorhabdus luminescens, Xenorhabdus nematophila, Rhodococcus globerulus AQ719 (NRRL Accession No. B-21663), Bacillus sp. AQ175 (ATCC Accession No. 55608), Bacillus sp. AQ 177 (ATCC Accession No. 55609), Bacillus sp. AQ178 (ATCC Accession No. 53522), and Streptomyces sp. strain NRRL Accession No. B-30145. In some cases the bacterium may be Azotobacter chroococcum, Methanosarcina barkeri, Klebsiella pneumoniae, Azotobacter vinelandii, Rhodobacter sphaeroides, Rhodobacter capsulatus, Rhodobacter palustris, Rhodospirillum rubrum, Rhizobium leguminosarum or Rhizobium etli.
[0363] In some cases the bacterium may be a species of Clostridium, for example Clostridium pasteurianum, Clostridium beijerinckii, Clostridium perfringens, Clostridium tetani, Clostridium acetobutylicum.
[0364] In some cases, bacteria used with the methods and compositions of the present disclosure may be cyanobacteria. Examples of cyanobacterial genuses include Anabaena (for example Anagaena sp. PCC7120), Nostoc (for example Nostoc punctiforme), or Synechocystis (for example Synechocystis sp. PCC6803).
[0365] In some cases, bacteria used with the methods and compositions of the present disclosure may belong to the phylum Chlorobi, for example Chlorobium tepidum.
[0366] In some cases, microbes used with the methods and compositions of the present disclosure may comprise a gene homologous to a known NifH gene. Sequences of known NifH genes may be found in, for example, the Zehr lab NifH database, (wwwzehr.pmc.ucsc.edu/nifH_Database_Public/, Apr. 4, 2014), or the Buckley lab NifH database (www.css.cornell.edu/faculty/buckley/nifh.htm, and Gaby, John Christian, and Daniel H. Buckley. A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen-fixing bacteria. Database 2014 (2014): bau001.). In some cases, microbes used with the methods and compositions of the present disclosure may comprise a sequence which encodes a polypeptide with at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99% or more than 99% sequence identity to a sequence from the Zehr lab NifH database, (wwwzehr.pmc.ucsc.edu/nifH_Database_Public/, Apr. 4, 2014). In some cases, microbes used with the methods and compositions of the present disclosure may comprise a sequence which encodes a polypeptide with at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99% or more than 99% sequence identity to a sequence from the Buckley lab NifH database, (Gaby, John Christian, and Daniel H. Buckley. A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen-fixing bacteria. Database 2014 (2014): bau001.).
[0367] Microbes useful in the methods and compositions disclosed herein can be obtained by extracting microbes from surfaces or tissues of native plants; grinding seeds to isolate microbes; planting seeds in diverse soil samples and recovering microbes from tissues; or inoculating plants with exogenous microbes and determining which microbes appear in plant tissues. Non-limiting examples of plant tissues include a seed, seedling, leaf, cutting, plant, bulb, tuber, root, and rhizomes. In some cases, bacteria are isolated from a seed. The parameters for processing samples may be varied to isolate different types of associative microbes, such as rhizospheric, epiphytes, or endophytes. Bacteria may also be sourced from a repository, such as environmental strain collections, instead of initially isolating from a first plant. The microbes can be genotyped and phenotyped, via sequencing the genomes of isolated microbes; profiling the composition of communities in planta; characterizing the transcriptomic functionality of communities or isolated microbes; or screening microbial features using selective or phenotypic media (e.g., nitrogen fixation or phosphate solubilization phenotypes). Selected candidate strains or populations can be obtained via sequence data; phenotype data; plant data (e.g., genome, phenotype, and/or yield data); soil data (e.g., pH, N/P/K content, and/or bulk soil biotic communities); or any combination of these.
[0368] The bacteria and methods of producing bacteria described herein may apply to bacteria able to self-propagate efficiently on the leaf surface, root surface, or inside plant tissues without inducing a damaging plant defense reaction, or bacteria that are resistant to plant defense responses. The bacteria described herein may be isolated by culturing a plant tissue extract or leaf surface wash in a medium with no added nitrogen. However, the bacteria may be unculturable, that is, not known to be culturable or difficult to culture using standard methods known in the art. The bacteria described herein may be an endophyte or an epiphyte or a bacterium inhabiting the plant rhizosphere (rhizospheric bacteria). The bacteria obtained after repeating the steps of introducing genetic variation, exposure to a plurality of plants, and isolating bacteria from plants with an improved trait one or more times (e.g. 1, 2, 3, 4, 5, 10, 15, 25, or more times) may be endophytic, epiphytic, or rhizospheric. Endophytes are organisms that enter the interior of plants without causing disease symptoms or eliciting the formation of symbiotic structures, and are of agronomic interest because they can enhance plant growth and improve the nutrition of plants (e.g., through nitrogen fixation). The bacteria can be a seed-borne endophyte. Seed-borne endophytes include bacteria associated with or derived from the seed of a grass or plant, such as a seed-borne bacterial endophyte found in mature, dry, undamaged (e.g., no cracks, visible fungal infection, or prematurely germinated) seeds. The seed-borne bacterial endophyte can be associated with or derived from the surface of the seed; alternatively, or in addition, it can be associated with or derived from the interior seed compartment (e.g., of a surface-sterilized seed). In some cases, a seed-borne bacterial endophyte is capable of replicating within the plant tissue, for example, the interior of the seed. Also, in some cases, the seed-borne bacterial endophyte is capable of surviving desiccation.
[0369] The bacterial isolated according to methods of the disclosure, or used in methods or compositions of the disclosure, can comprise a plurality of different bacterial taxa in combination. By way of example, the bacteria may include Proteobacteria (such as Pseudomonas, Enterobacter, Stenotrophomonas, Burkholderia, Rhizobium, Herbaspirillum, Pantoea, Serratia, Rahnella, Azospirillum, Azorhizobium, Azotobacter, Duganella, Delftia, Bradyrhizobium, Sinorhizobium and Halomonas), Firmicutes (such as Bacillus, Paenibacillus, Lactobacillus, Mycoplasma, and Acetobacterium), and Actinobacteria (such as Streptomyces, Rhodococcus, Microbacterium, and Curtobacterium). The bacteria used in methods and compositions of this disclosure may include nitrogen fixing bacterial consortia of two or more species. In some cases, one or more bacterial species of the bacterial consortia may be capable of fixing nitrogen. In some cases, one or more species of the bacterial consortia may facilitate or enhance the ability of other bacteria to fix nitrogen. The bacteria which fix nitrogen and the bacteria which enhance the ability of other bacteria to fix nitrogen may be the same or different. In some examples, a bacterial strain may be able to fix nitrogen when in combination with a different bacterial strain, or in a certain bacterial consortia, but may be unable to fix nitrogen in a monoculture. Examples of bacterial genuses which may be found in a nitrogen fixing bacterial consortia include, but are not limited to, Herbaspirillum, Azospirillum, Enterobacter, and Bacillus.
[0370] Bacteria that can be produced by the methods disclosed herein include Azotobacter sp., Bradyrhizobium sp., Klebsiella sp., and Sinorhizobium sp. In some cases, the bacteria may be selected from the group consisting of: Azotobacter vinelandii, Bradyrhizobium japonicum, Klebsiella pneumoniae, and Sinorhizobium meliloti. In some cases, the bacteria may be of the genus Enterobacter or Rahnella. In some cases, the bacteria may be of the genus Frankia, or Clostridium. Examples of bacteria of the genus Clostridium include, but are not limited to, Clostridium acetobutylicum, Clostridium pasteurianum, Clostridium beijerinckii, Clostridium perfringens, and Clostridium tetani. In some cases, the bacteria may be of the genus Paenibacillus, for example Paenibacillus azotofixans, Paenibacillus borealis, Paenibacillus durus, Paenibacillus macerans, Paenibacillus polymyxa, Paenibacillus alvei, Paenibacillus amylolyticus, Paenibacillus campinasensis, Paenibacillus chibensis, Paenibacillus glucanolyticus, Paenibacillus illinoisensis, Paenibacillus larvae subsp. Larvae, Paenibacillus larvae subsp. Pulvifaciens, Paenibacillus lautus, Paenibacillus macerans, Paenibacillus macquariensis, Paenibacillus macquariensis, Paenibacillus pabuli, Paenibacillus peoriae, or Paenibacillus polymyxa.
[0371] In some examples, bacteria isolated according to methods of the disclosure can be a member of one or more of the following taxa: Achromobacter, Acidithiobacillus, Acidovorax, Acidovoraz, Acinetobacter, Actinoplanes, Adlercreutzia, Aerococcus, Aeromonas, Afipia, Agromyces, Ancylobacter, Arthrobacter, Atopostipes, Azospirillum, Bacillus, Bdellovibrio, Beijerinckia, Bosea, Bradyrhizobium, Brevibacillus, Brevundimonas, Burkholderia, Candidatus Haloredivivus, Caulobacter, Cellulomonas, Cellvibrio, Chryseobacterium, Citrobacter, Clostridium, Coraliomargarita, Corynebacterium, Cupriavidus, Curtobacterium, Curvibacter, Deinococcus, Delftia, Desemzia, Devosia, Dokdonella, Dyella, Enhydrobacter, Enterobacter, Enterococcus, Erwinia, Escherichia, Escherichia/Shigella, Exiguobacterium, Ferroglobus, Filimonas, Finegoldia, Flavisolibacter, Flavobacterium, Frigoribacterium, Gluconacetobacter, Hafnia, Halobaculum, Halomonas, Halosimplex, Herbaspirillum, Hymenobacter, Klebsiella, Kocuria, Kosakonia, Lactobacillus, Leclercia, Lentzea, Luteibacter, Luteimonas, Massilia, Mesorhizobium, Methylobacterium, Microbacterium, Micrococcus, Microvirga, Mycobacterium, Neisseria, Nocardia, Oceanibaculum, Ochrobactrum, Okibacterium, Oligotropha, Oryzihumus, Oxalophagus, Paenibacillus, Panteoa, Pantoea, Pelomonas, Perlucidibaca, Plantibacter, Polynucleobacter, Propionibacterium, Propioniciclava, Pseudoclavibacter, Pseudomonas, Pseudonocardia, Pseudoxanthomonas, Psychrobacter, Rahnella, Ralstonia, Rheinheimera, Rhizobium, Rhodococcus, Rhodopseudomonas, Roseateles, Ruminococcus, Sebaldella, Sediminibacillus, Sediminibacterium, Serratia, Shigella, Shinella, Sinorhizobium, Sinosporangium, Sphingobacterium, Sphingomonas, Sphingopyxis, Sphingosinicella, Staphylococcus, 25 Stenotrophomonas, Strenotrophomonas, Streptococcus, Streptomyces, Stygiolobus, Sulfurisphaera, Tatumella, Tepidimonas, Thermomonas, Thiobacillus, Variovorax, WPS-2 genera Incertae sedis, Xanthomonas, and Zimmermannella.
[0372] In some cases, a bacterial species selected from at least one of the following genera are utilized: Enterobacter, Klebsiella, Kosakonia, and Rahnella. In some cases, a combination of bacterial species from the following genera are utilized: Enterobacter, Klebsiella, Kosakonia, and Rahnella. In some cases, the species utilized can be one or more of: Enterobacter sacchari, Klebsiella variicola, Kosakonia sacchari, and Rahnella aquatilis.
[0373] In some cases, a Gram positive microbe may have a Molybdenum-Iron nitrogenase system comprising: nifH, nifD, nifK, nifB, nifE, nifN, nifX, hesA, nifV, nmfW, nifU, nifS, nifI1, and nifI2. In some cases, a Gram positive microbe may have a vanadium nitrogenase system comprising: vnfDG, vnfK, vnfE, vnfN, vupC, vupB, vupA, vnfV, vnfR1, vnfH, vnfR2, vnfA (transcriptional regulator). In some cases, a Gram positive microbe may have an iron-only nitrogenase system comprising: anfK, anfG, anfD, anfH, anfA (transcriptional regulator). In some cases, a Gram positive microbe may have a nitrogenase system comprising glnB, and glnK (nitrogen signaling proteins). Some examples of enzymes involved in nitrogen metabolism in Gram positive microbes include glnA (glutamine synthetase), gdh (glutamate dehydrogenase), bdh (3-hydroxybutyrate dehydrogenase), glutaminase, gltAB/gltB/gltS (glutamate synthase), asnA/asnB (aspartate-ammonia ligase/asparagine synthetase), and ansA/ansZ (asparaginase).
[0374] Some examples of proteins involved in nitrogen transport in Gram positive microbes include amtB (ammonium transporter), glnK (regulator of ammonium transport), glnPHQ/ginQHMP (ATPdependent glutamine/glutamate transporters), glnT/alsT/yrbD/yflA (glutamine-like proton symport transporters), and gltP/gltT/yhcl/ngt (glutamate-like proton symport transporters).
[0375] Examples of Gram positive microbes which may be of particular interest include Paenibacillus polymixa, Paenibacillus riograndensis, Paenibacillus sp., Frankia sp., Heliobacterium sp., Heliobacterium chlorum, Heliobacillus sp., Heliophilum sp., Heliorestis sp., Clostridium acetobutylicum, Clostridium sp., Mycobacterium flaum, Mycobacterium sp., Arthrobacter sp., Agromyces sp., Corynebacterium autitrophicum, Corynebacterium sp., Micromonspora sp., Propionibacteria sp., Streptomyces sp., and Microbacterium sp.
[0376] Some examples of genetic alterations which may be made in Gram positive microbes include: deleting glnR to remove negative regulation of BNF in the presence of environmental nitrogen, inserting different promoters directly upstream of the nif cluster to eliminate regulation by GlnR in response to environmental nitrogen, mutating glnA to reduce the rate of ammonium assimilation by the GS-GOGAT pathway, deleting amtB to reduce uptake of ammonium from the media, mutating glnA so it is constitutively in the feedback-inhibited (FBI-GS) state, to reduce ammonium assimilation by the GS-GOGAT pathway.
[0377] In some cases, glnR is the main regulator of N metabolism and fixation in Paenibacillus species. In some cases, the genome of a Paenibacillus species may not contain a gene to produce glnR. In some cases, the genome of a Paenibacillus species may not contain a gene to produce glnE or glnD. In some cases, the genome of a Paenibacillus species may contain a gene to produce glnB or glnK. For example, Paenibacillus sp. WLY78 doesn't contain a gene for glnB, or its homologs found in the archaeon Methanococcus maripaludis, nifI1 and nifI2. In some cases, the genomes of Paenibacillus species may be variable. For example, Paenibacillus polymixa E681 lacks glnK and gdh, has several nitrogen compound transporters, but only amtB appears to be controlled by GlnR. In another example, Paenibacillus sp. JDR2 has glnK, gdh and most other central nitrogen metabolism genes, has many fewer nitrogen compound transporters, but does have glnPHQ controlled by GlnR. Paenibacillus riograndensis SBR5 contains a standard glnRA operon, an fdx gene, a main nif operon, a secondary nif operon, and an anf operon (encoding irononly nitrogenase). Putative glnR/tnrA sites were found upstream of each of these operons. GlnR may regulate all of the above operons, except the anf operon. GlnR may bind to each of these regulatory sequences as a dimer.
[0378] Paenibacillus N-fixing strains may fall into two subgroups: Subgroup I, which contains only a minimal nif gene cluster and subgroup II, which contains a minimal cluster, plus an uncharacterized gene between nifX and hesA, and often other clusters duplicating some of the nif genes, such as nifH, nifHDK, nifBEN, or clusters encoding vanadaium nitrogenase (vnf) or irononly nitrogenase (anf) genes.
[0379] In some cases, the genome of a Paenibacillus species may not contain a gene to produce glnB or glnK. In some cases, the genome of a Paenibacillus species may contain a minimal nif cluster with 9 genes transcribed from a sigma-70 promoter. In some cases, a Paenibacillus nif cluster may be negatively regulated by nitrogen or oxygen. In some cases, the genome of a Paenibacillus species may not contain a gene to produce sigma-54. For example, Paenibacillus sp. WLY78 does not contain a gene for sigma-54. In some cases, a nif cluster may be regulated by glnR, and/or TnrA. In some cases, activity of a nif cluster may be altered by altering activity of glnR, and/or TnrA.
[0380] In Bacilli, glutamine synthetase (GS) is feedback-inhibited by high concentrations of intracellular glutamine, causing a shift in confirmation (referred to as FBI-GS). Nif clusters contain distinct binding sites for the regulators GlnR and TnrA in several Bacilli species. GlnR binds and represses gene expression in the presence of excess intracellular glutamine and AMP. A role of GlnR may be to prevent the influx and intracellular production of glutamine and ammonium under conditions of high nitrogen availability. TnrA may bind and/or activate (or repress) gene expression in the presence of limiting intracellular glutamine, and/or in the presence of FBI-GS. In some cases, the activity of a Bacilli nif cluster may be altered by altering the activity of GlnR.
[0381] Feedback-inhibited glutamine synthetase (FBI-GS) may bind GlnR and stabilize binding of GlnR to recognition sequences. Several bacterial species have a GlnR/TnrA binding site upstream of the nif cluster. Altering the binding of FBI-GS and GlnR may alter the activity of the nif pathway.
Sources of Microbes
[0382] The bacteria (or any microbe according to the disclosure) may be obtained from any general terrestrial environment, including its soils, plants, fungi, animals (including invertebrates) and other biota, including the sediments, water and biota of lakes and rivers; from the marine environment, its biota and sediments (for example, sea water, marine muds, marine plants, marine invertebrates (for example, sponges), marine vertebrates (for example, fish)); the terrestrial and marine geosphere (regolith and rock, for example, crushed subterranean rocks, sand and clays); the cryosphere and its meltwater; the atmosphere (for example, filtered aerial dusts, cloud and rain droplets); urban, industrial and other man-made environments (for example, accumulated organic and mineral matter on concrete, roadside gutters, roof surfaces, and road surfaces).
[0383] The plants from which the bacteria (or any microbe according to the disclosure) are obtained may be a plant having one or more desirable traits, for example a plant which naturally grows in a particular environment or under certain conditions of interest. By way of example, a certain plant may naturally grow in sandy soil or sand of high salinity, or under extreme temperatures, or with little water, or it may be resistant to certain pests or disease present in the environment, and it may be desirable for a commercial crop to be grown in such conditions, particularly if they are, for example, the only conditions available in a particular geographic location. By way of further example, the bacteria may be collected from commercial crops grown in such environments, or more specifically from individual crop plants best displaying a trait of interest amongst a crop grown in any specific environment: for example the fastest-growing plants amongst a crop grown in saline-limiting soils, or the least damaged plants in crops exposed to severe insect damage or disease epidemic, or plants having desired quantities of certain metabolites and other compounds, including fiber content, oil content, and the like, or plants displaying desirable colors, taste or smell. The bacteria may be collected from a plant of interest or any material occurring in the environment of interest, including fungi and other animal and plant biota, soil, water, sediments, and other elements of the environment as referred to previously.
[0384] The bacteria (or any microbe according to the disclosure) may be isolated from plant tissue. This isolation can occur from any appropriate tissue in the plant, including for example root, stem and leaves, and plant reproductive tissues. By way of example, conventional methods for isolation from plants typically include the sterile excision of the plant material of interest (e.g., root or stem lengths, leaves), surface sterilization with an appropriate solution (e.g. 2% sodium hypochlorite), after which the plant material is placed on nutrient medium for microbial growth.
[0385] Alternatively, the surface-sterilized plant material can be crushed in a sterile liquid (usually water) and the liquid suspension, including small pieces of the crushed plant material spread over the surface of a suitable solid agar medium, or media, which may or may not be selective (e.g. contain only phytic acid as a source of phosphorus). This approach is especially useful for bacteria which form isolated colonies and can be picked off individually to separate plates of nutrient medium, and further purified to a single species by well-known methods. Alternatively, the plant root or foliage samples may not be surface sterilized but only washed gently thus including surface dwelling epiphytic microorganisms in the isolation process, or the epiphytic microbes can be isolated separately, by imprinting and lifting off pieces of plant roots, stem or leaves onto the surface of an agar medium and then isolating individual colonies as above. This approach is especially useful for bacteria, for example. Alternatively, the roots may be processed without washing off small quantities of soil attached to the roots, thus including microbes that colonize the plant rhizosphere. Otherwise, soil adhering to the roots can be removed, diluted and spread out onto agar of suitable selective and non-selective media to isolate individual colonies of rhizospheric bacteria.
Agricultural Compositions
[0386] Compositions comprising bacteria or bacterial populations produced according to methods described herein and/or having characteristics as described herein can be in the form of a liquid, a foam, or a dry product. Compositions comprising bacteria or bacterial populations produced according to methods described herein and/or having characteristics as described herein may also be used to improve plant traits. In some examples, a composition comprising bacterial populations may be in the form of a dry powder, a slurry of powder and water, or a flowable seed treatment. The compositions comprising bacterial populations may be coated on a surface of a seed, and may be in liquid form.
[0387] The composition can be fabricated in bioreactors such as continuous stirred tank reactors, batch reactors, and on the farm. In some examples, compositions can be stored in a container, such as a jug or in mini bulk. In some examples, compositions may be stored within an object selected from the group consisting of a bottle, jar, ampule, package, vessel, bag, box, bin, envelope, carton, container, silo, shipping container, truck bed, and case.
[0388] Compositions may also be used to improve plant traits. In some examples, one or more compositions may be coated onto a seed. In some examples, one or more compositions may be coated onto a seedling. In some examples, one or more compositions may be coated onto a surface of a seed. In some examples, one or more compositions may be coated as a layer above a surface of a seed. In some examples, a composition that is coated onto a seed may be in liquid form, in dry product form, in foam form, in a form of a slurry of powder and water, or in a flowable seed treatment. In some examples, one or more compositions may be applied to a seed and/or seedling by spraying, immersing, coating, encapsulating, and/or dusting the seed and/or seedling with the one or more compositions. In some examples, multiple bacteria or bacterial populations can be coated onto a seed and/or a seedling of the plant. In some examples, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more than ten bacteria of a bacterial combination can be selected from one of the following genera: Acidovorax, Agrobacterium, Bacillus, Burkholderia, Chryseobacterium, Curtobacterium, Enterobacter, Escherichia, Methylobacterium, Paenibacillus, Pantoea, Pseudomonas, Ralstonia, Saccharibacillus, Sphingomonas, and Stenotrophomonas.
[0389] Examples of compositions may include seed coatings for commercially important agricultural crops, for example, Sorghum, canola, tomato, strawberry, barley, rice, maize, and wheat. Examples of compositions can also include seed coatings for corn, soybean, canola, Sorghum, potato, rice, vegetables, cereals, and oilseeds. Seeds as provided herein can be genetically modified organisms (GMO), non-GMO, organic, or conventional. In some examples, compositions may be sprayed on the plant aerial parts, or applied to the roots by inserting into furrows in which the plant seeds are planted, watering to the soil, or dipping the roots in a suspension of the composition. In some examples, compositions may be dehydrated in a suitable manner that maintains cell viability and the ability to artificially inoculate and colonize host plants. The bacterial species may be present in compositions at a concentration of between 108 to 1010 CFU/ml. In some examples, compositions may be supplemented with trace metal ions, such as molybdenum ions, iron ions, manganese ions, or combinations of these ions. The concentration of ions in examples of compositions as described herein may between about 0.1 mM and about 50 mM. Some examples of compositions may also be formulated with a carrier, such as beta-glucan, carboxylmethyl cellulose (CMC), bacterial extracellular polymeric substance (EPS), sugar, animal milk, or other suitable carriers. In some examples, peat or planting materials can be used as a carrier, or biopolymers in which a composition is entrapped in the biopolymer can be used as a carrier. The compositions comprising the bacterial populations described herein can improve plant traits, such as promoting plant growth, maintaining high chlorophyll content in leaves, increasing fruit or seed numbers, and increasing fruit or seed unit weight.
[0390] The compositions comprising the bacterial populations described herein may be coated onto the surface of a seed. As such, compositions comprising a seed coated with one or more bacteria described herein are also contemplated. The seed coating can be formed by mixing the bacterial population with a porous, chemically inert granular carrier. Alternatively, the compositions may be inserted directly into the furrows into which the seed is planted or sprayed onto the plant leaves or applied by dipping the roots into a suspension of the composition. An effective amount of the composition can be used to populate the sub-soil region adjacent to the roots of the plant with viable bacterial growth, or populate the leaves of the plant with viable bacterial growth. In general, an effective amount is an amount sufficient to result in plants with improved traits (e.g. a desired level of nitrogen fixation).
[0391] Bacterial compositions described herein can be formulated using an agriculturally acceptable carrier. The formulation useful for these embodiments may include at least one member selected from the group consisting of a tackifier, a microbial stabilizer, a fungicide, an antibacterial agent, a preservative, a stabilizer, a surfactant, an anti-complex agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a fertilizer, a rodenticide, a dessicant, a bactericide, a nutrient, and any combination thereof. In some examples, compositions may be shelf-stable. For example, any of the compositions described herein can include an agriculturally acceptable carrier (e.g., one or more of a fertilizer such as a non-naturally occurring fertilizer, an adhesion agent such as a non-naturally occurring adhesion agent, and a pesticide such as a non-naturally occurring pesticide). A non-naturally occurring adhesion agent can be, for example, a polymer, copolymer, or synthetic wax. For example, any of the coated seeds, seedlings, or plants described herein can contain such an agriculturally acceptable carrier in the seed coating. In any of the compositions or methods described herein, an agriculturally acceptable carrier can be or can include a non-naturally occurring compound (e.g., a non-naturally occurring fertilizer, a non-naturally occurring adhesion agent such as a polymer, copolymer, or synthetic wax, or a non-naturally occurring pesticide). Non-limiting examples of agriculturally acceptable carriers are described below. Additional examples of agriculturally acceptable carriers are known in the art.
[0392] In some cases, bacteria are mixed with an agriculturally acceptable carrier. The carrier can be a solid carrier or liquid carrier, and in various forms including microspheres, powders, emulsions and the like. The carrier may be any one or more of a number of carriers that confer a variety of properties, such as increased stability, wettability, or dispersability. Wetting agents such as natural or synthetic surfactants, which can be nonionic or ionic surfactants, or a combination thereof can be included in the composition. Water-in-oil emulsions can also be used to formulate a composition that includes the isolated bacteria (see, for example, U.S. Pat. No. 7,485,451).
[0393] Suitable formulations that may be prepared include wettable powders, granules, gels, agar strips or pellets, thickeners, and the like, microencapsulated particles, and the like, liquids such as aqueous flowables, aqueous suspensions, water-in-oil emulsions, etc. The formulation may include grain or legume products, for example, ground grain or beans, broth or flour derived from grain or beans, starch, sugar, or oil.
[0394] In some embodiments, the agricultural carrier may be soil or a plant growth medium. Other agricultural carriers that may be used include water, fertilizers, plant-based oils, humectants, or combinations thereof. Alternatively, the agricultural carrier may be a solid, such as diatomaceous earth, loam, silica, alginate, clay, bentonite, vermiculite, seed cases, other plant and animal products, or combinations, including granules, pellets, or suspensions. Mixtures of any of the aforementioned ingredients are also contemplated as carriers, such as but not limited to, pesta (flour and kaolin clay), agar or flour-based pellets in loam, sand, or clay, etc. Formulations may include food sources for the bacteria, such as barley, rice, or other biological materials such as seed, plant parts, sugar cane bagasse, hulls or stalks from grain processing, ground plant material or wood from building site refuse, sawdust or small fibers from recycling of paper, fabric, or wood.
[0395] For example, a fertilizer can be used to help promote the growth or provide nutrients to a seed, seedling, or plant. Non-limiting examples of fertilizers include nitrogen, phosphorous, potassium, calcium, sulfur, magnesium, boron, chloride, manganese, iron, zinc, copper, molybdenum, and selenium (or a salt thereof). Additional examples of fertilizers include one or more amino acids, salts, carbohydrates, vitamins, glucose, NaCl, yeast extract, NH.sub.4H.sub.2PO.sub.4, (NH.sub.4).sub.2SO.sub.4, glycerol, valine, L-leucine, lactic acid, propionic acid, succinic acid, malic acid, citric acid, KH tartrate, xylose, lyxose, and lecithin. In one embodiment, the formulation can include a tackifier or adherent (referred to as an adhesive agent) to help bind other active agents to a substance (e.g., a surface of a seed). Such agents are useful for combining bacteria with carriers that can contain other compounds (e.g., control agents that are not biologic), to yield a coating composition. Such compositions help create coatings around the plant or seed to maintain contact between the microbe and other agents with the plant or plant part. In one embodiment, adhesives are selected from the group consisting of: alginate, gums, starches, lecithins, formononetin, polyvinyl alcohol, alkali formononetinate, hesperetin, polyvinyl acetate, cephalins, Gum Arabic, Xanthan Gum, Mineral Oil, Polyethylene Glycol (PEG), Polyvinyl pyrrolidone (PVP), Arabinogalactan, Methyl Cellulose, PEG 400, Chitosan, Polyacrylamide, Polyacrylate, Polyacrylonitrile, Glycerol, Triethylene glycol, Vinyl Acetate, Gellan Gum, Polystyrene, Polyvinyl, Carboxymethyl cellulose, Gum Ghatti, and polyoxyethylene-polyoxybutylene block copolymers.
[0396] In some embodiments, the adhesives can be, e.g. a wax such as carnauba wax, beeswax, Chinese wax, shellac wax, spermaceti wax, candelilla wax, castor wax, ouricury wax, and rice bran wax, a polysaccharide (e.g., starch, dextrins, maltodextrins, alginate, and chitosans), a fat, oil, a protein (e.g., gelatin and zeins), gum arables, and shellacs. Adhesive agents can be non-naturally occurring compounds, e.g., polymers, copolymers, and waxes. For example, non-limiting examples of polymers that can be used as an adhesive agent include: polyvinyl acetates, polyvinyl acetate copolymers, ethylene vinyl acetate (EVA) copolymers, polyvinyl alcohols, polyvinyl alcohol copolymers, celluloses (e.g., ethylcelluloses, methylcelluloses, hydroxymethylcelluloses, hydroxypropylcelluloses, and carboxymethylcelluloses), polyvinylpyrolidones, vinyl chloride, vinylidene chloride copolymers, calcium lignosulfonates, acrylic copolymers, polyvinylacrylates, polyethylene oxide, acylamide polymers and copolymers, polyhydroxyethyl acrylate, methylacrylamide monomers, and polychloroprene.
[0397] In some examples, one or more of the adhesion agents, anti-fungal agents, growth regulation agents, and pesticides (e.g., insecticide) are non-naturally occurring compounds (e.g., in any combination). Additional examples of agriculturally acceptable carriers include dispersants (e.g., polyvinylpyrrolidone/vinyl acetate PVPIVA 5-630), surfactants, binders, and filler agents.
[0398] The formulation can also contain a surfactant. Non-limiting examples of surfactants include nitrogen-surfactant blends such as Prefer 28 (Cenex), Surf-N(US), Inhance (Brandt), P-28 (Wilfarm) and Patrol (Helena); esterified seed oils include Sun-It II (AmCy), MSO (UAP), Scoil (Agsco), Hasten (Wilfarm) and Mes-100 (Drexel); and organo-silicone surfactants include Silwet L77 (UAP), Silikin (Terra), Dyne-Amic (Helena), Kinetic (Helena), Sylgard 309 (Wilbur-Ellis) and Century (Precision). In one embodiment, the surfactant is present at a concentration of between 0.01% v/v to 10% v/v. In another embodiment, the surfactant is present at a concentration of between 0.1% v/v to 1% v/v.
[0399] In certain cases, the formulation includes a microbial stabilizer. Such an agent can include a desiccant, which can include any compound or mixture of compounds that can be classified as a desiccant regardless of whether the compound or compounds are used in such concentrations that they in fact have a desiccating effect on a liquid inoculant. Such desiccants are ideally compatible with the bacterial population used, and should promote the ability of the microbial population to survive application on the seeds and to survive desiccation. Examples of suitable desiccants include one or more of trehalose, sucrose, glycerol, and methylene glycol. Other suitable desiccants include, but are not limited to, non-reducing sugars and sugar alcohols (e.g., mannitol or sorbitol). The amount of desiccant introduced into the formulation can range from about 5% to about 50% by weight/volume, for example, between about 10% to about 40%, between about 15% to about 35%, or between about 20% to about 30%. In some cases, it is advantageous for the formulation to contain agents such as a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, bactericide, or a nutrient. In some examples, agents may include protectants that provide protection against seed surface-borne pathogens. In some examples, protectants may provide some level of control of soil-borne pathogens. In some examples, protectants may be effective predominantly on a seed surface.
[0400] In some examples, a fungicide may include a compound or agent, whether chemical or biological, that can inhibit the growth of a fungus or kill a fungus. In some examples, a fungicide may include compounds that may be fungistatic or fungicidal. In some examples, fungicide can be a protectant, or agents that are effective predominantly on the seed surface, providing protection against seed surface-borne pathogens and providing some level of control of soil-borne pathogens. Non-limiting examples of protectant fungicides include captan, maneb, thiram, or fludioxonil.
[0401] In some examples, fungicide can be a systemic fungicide, which can be absorbed into the emerging seedling and inhibit or kill the fungus inside host plant tissues. Systemic fungicides used for seed treatment include, but are not limited to the following: azoxystrobin, carboxin, mefenoxam, metalaxyl, thiabendazole, trifloxystrobin, and various triazole fungicides, including difenoconazole, ipconazole, tebuconazole, and triticonazole. Mefenoxam and metalaxyl are primarily used to target the water mold fungi Pythium and Phytophthora. Some fungicides are preferred over others, depending on the plant species, either because of subtle differences in sensitivity of the pathogenic fungal species, or because of the differences in the fungicide distribution or sensitivity of the plants. In some examples, fungicide can be a biological control agent, such as a bacterium or fungus. Such organisms may be parasitic to the pathogenic fungi, or secrete toxins or other substances which can kill or otherwise prevent the growth of fungi. Any type of fungicide, particularly ones that are commonly used on plants, can be used as a control agent in a seed composition.
[0402] In some examples, the seed coating composition comprises a control agent which has antibacterial properties. In one embodiment, the control agent with antibacterial properties is selected from the compounds described herein elsewhere. In another embodiment, the compound is Streptomycin, oxytetracycline, oxolinic acid, or gentamicin. Other examples of antibacterial compounds which can be used as part of a seed coating composition include those based on dichlorophene and benzylalcohol hemi formal (ProxelR from ICI or ActicideR RS from Thor Chemie and KathonR MK 25 from Rohm & Haas) and isothiazolinone derivatives such as alkylisothiazolinones and benzisothiazolinones (ActicideR MBS from Thor Chemie).
[0403] In some examples, growth regulator is selected from the group consisting of: Abscisic acid, amidochlor, ancymidol, 6-benzylaminopurine, brassinolide, butralin, chlormequat (chlormequat chloride), choline chloride, cyclanilide, daminozide, dikegulac, dimethipin, 2,6-dimethylpuridine, ethephon, flumetralin, flurprimidol, fluthiacet, forchlorfenuron, gibberellic acid, inabenfide, indole-3-acetic acid, maleic hydrazide, mefluidide, mepiquat (mepiquat chloride), naphthaleneacetic acid, N-6-benzyladenine, paclobutrazol, prohexadione phosphorotrithioate, 2,3,5-tri-iodobenzoic acid, trinexapac-ethyl and uniconazole. Additional non-limiting examples of growth regulators include brassinosteroids, cytokinines (e.g., kinetin and zeatin), auxins (e.g., indolylacetic acid and indolylacetyl aspartate), flavonoids and isoflavanoids (e.g., formononetin and diosmetin), phytoaixins (e.g., glyceolline), and phytoalexin-inducing oligosaccharides (e.g., pectin, chitin, chitosan, polygalacuronic acid, and oligogalacturonic acid), and gibellerins. Such agents are ideally compatible with the agricultural seed or seedling onto which the formulation is applied (e.g., it should not be deleterious to the growth or health of the plant). Furthermore, the agent is ideally one which does not cause safety concerns for human, animal or industrial use (e.g., no safety issues, or the compound is sufficiently labile that the commodity plant product derived from the plant contains negligible amounts of the compound).
[0404] Some examples of nematode-antagonistic biocontrol agents include ARF18; 30 Arthrobotrys spp.; Chaetomium spp.; Cylindrocarpon spp.; Exophilia spp.; Fusarium spp.; Gliocladium spp.; Hirsutella spp.; Lecanicillium spp.; Monacrosporium spp.; Myrothecium spp.; Neocosmospora spp.; Paecilomyces spp.; Pochonia spp.; Stagonospora spp.; vesiculararbuscular mycorrhizal fungi, Burkholderia spp.; Pasteuria spp., Brevibacillus spp.; Pseudomonas spp.; and Rhizobacteria. Particularly preferred nematode-antagonistic biocontrol agents include ARF18, Arthrobotrys oligospora, Arthrobotrys dactyloides, Chaetomium globosum, Cylindrocarpon heteronema, Exophilia jeanselmei, Exophilia pisciphila, Fusarium aspergilus, Fusarium solani, Gliocladium catenulatum, Gliocladium roseum, Gliocladium vixens, Hirsutella rhossiliensis, Hirsutella minnesotensis, Lecanicillium lecanii, Monacrosporium drechsleri, Monacrosporium gephyropagum, Myrotehcium verrucaria, Neocosmospora vasinfecta, Paecilomyces lilacinus, Pochonia chlamydosporia, Stagonospora heteroderae, Stagonospora phaseoli, vesiculararbuscular mycorrhizal fungi, Burkholderia cepacia, Pasteuria penetrans, Pasteuria thornei, Pasteuria nishizawae, Pasteuria ramosa, Pastrueia usage, Brevibacillus laterosporus strain G4, Pseudomonas fluorescens and Rhizobacteria.
[0405] Some examples of nutrients can be selected from the group consisting of a nitrogen fertilizer including, but not limited to Urea, Ammonium nitrate, Ammonium sulfate, Non-pressure nitrogen solutions, Aqua ammonia, Anhydrous ammonia, Ammonium thiosulfate, Sulfur-coated urea, Urea-formaldehydes, IBDU, Polymer-coated urea, Calcium nitrate, Ureaform, and Methylene urea, phosphorous fertilizers such as Diammonium phosphate, Monoammonium phosphate, Ammonium polyphosphate, Concentrated superphosphate and Triple superphosphate, and potassium fertilizers such as Potassium chloride, Potassium sulfate, Potassium-magnesium sulfate, Potassium nitrate. Such compositions can exist as free salts or ions within the seed coat composition. Alternatively, nutrients/fertilizers can be complexed or chelated to provide sustained release over time, Some examples of rodenticides may include selected from the group of substances consisting of 2-isovalerylindan-1,3-dione, 4-(quinoxalin-2-ylamino) benzenesulfonamide, alphachlorohydrin, aluminum phosphide, antu, arsenous oxide, barium carbonate, bisthiosemi, brodifacoum, bromadiolone, bromethalin, calcium cyanide, chloralose, chlorophacinone, cholecalciferol, coumachlor, coumafuryl, coumatetralyl, crimidine, difenacoum, difethialone, diphacinone, ergocalciferol, flocoumafen, fluoroacetamide, flupropadine, flupropadine hydrochloride, hydrogen cyanide, iodomethane, lindane, magnesium phosphide, methyl bromide, norbormide, phosacetim, phosphine, phosphorus, pindone, potassium arsenite, pyrinuron, scilliroside, sodium arsenite, sodium cyanide, sodium fluoroacetate, strychnine, thallium sulfate, warfarin and zinc phosphide.
[0406] In the liquid form, for example, solutions or suspensions, bacterial populations can be mixed or suspended in water or in aqueous solutions. Suitable liquid diluents or carriers include water, aqueous solutions, petroleum distillates, or other liquid carriers.
[0407] Solid compositions can be prepared by dispersing the bacterial populations in and on an appropriately divided solid carrier, such as peat, wheat, bran, vermiculite, clay, talc, bentonite, diatomaceous earth, fuller's earth, pasteurized soil, and the like. When such formulations are used as wettable powders, biologically compatible dispersing agents such as non-ionic, anionic, amphoteric, or cationic dispersing and emulsifying agents can be used.
[0408] The solid carriers used upon formulation include, for example, mineral carriers such as kaolin clay, pyrophyllite, bentonite, montmorillonite, diatomaceous earth, acid white soil, vermiculite, and pearlite, and inorganic salts such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, ammonium chloride, and calcium carbonate. Also, organic fine powders such as wheat flour, wheat bran, and rice bran may be used. The liquid carriers include vegetable oils such as soybean oil and cottonseed oil, glycerol, ethylene glycol, polyethylene glycol, propylene glycol, polypropylene glycol, etc.
Plant Species
[0409] The methods and bacteria described herein are suitable for any of a variety of plants, such as plants in the genera Hordeum, Oryza, Zea, and Triticeae. Other non-limiting examples of suitable plants include mosses, lichens, and algae. In some cases, the plants have economic, social and/or environmental value, such as food crops, fiber crops, oil crops, plants in the forestry or pulp and paper industries, feedstock for biofuel production and/or ornamental plants. In some examples, plants may be used to produce economically valuable products such as a grain, a flour, a starch, a syrup, a meal, an oil, a film, a packaging, a nutraceutical product, a pulp, an animal feed, a fish fodder, a bulk material for industrial chemicals, a cereal product, a processed human food product, a sugar, an alcohol, and/or a protein. Non-limiting examples of crop plants include maize, rice, wheat, barley, Sorghum, millet, oats, rye triticale, buckwheat, sweet corn, sugar cane, onions, tomatoes, strawberries, and asparagus. In some embodiments, the methods and bacteria described herein are suitable for any of a variety of transgenic plants, non-transgenic plants, and hybrid plants thereof.
[0410] In some examples, plants that may be obtained or improved using the methods and compositions disclosed herein may include plants that are important or interesting for agriculture, horticulture, biomass for the production of biofuel molecules and other chemicals, and/or forestry. Some examples of these plants may include pineapple, banana, coconut, lily, grass peas and grass; and dicotyledonous plants, such as, for example, peas, alfalfa, tomatillo, melon, chickpea, chicory, clover, kale, lentil, soybean, tobacco, potato, sweet potato, radish, cabbage, rape, apple trees, grape, cotton, sunflower, thale cress, canola, citrus (including orange, mandarin, kumquat, lemon, lime, grapefruit, tangerine, tangelo, citron, and pomelo), pepper, bean, lettuce, Panicum virgatum (switch), Sorghum bicolor (Sorghum, sudan), Miscanthus giganteus (Miscanthus), Saccharum sp. (energycane), Populus balsamifera (poplar), Zea mays (corn), Glycine max (soybean), Brassica napus (canola), Triticum aestivum (wheat), Gossypium hirsutum (cotton), Oryza sativa (rice), Helianthus annuus (sunflower), Medicago sativa (alfalfa), Beta vulgaris (sugarbeet), Pennisetum glaucum (pearl millet), Panicum spp. Sorghum spp., Miscanthus spp., Saccharum spp., Erianthus spp., Populus spp., Secale cereale (rye), Salix spp. (willow), Eucalyptus spp. (eucalyptus), Triticosecale spp. (Triticum25 wheat X rye), Bamboo, Carthamus tinctorius (safflower), Jatropha curcas (Jatropha), Ricinus communis (castor), Elaeis guineensis (oil palm), Phoenix dactylifera (date palm), Archontophoenix cunninghamiana (king palm), Syagrus romanzoffiana (queen palm), Linum usitatissimum (flax), Brassica juncea, Manihot esculenta (cassaya), Lycopersicon esculentum (tomato), Lactuca saliva (lettuce), Musa paradisiaca (banana), Solanum tuberosum (potato), Brassica oleracea (broccoli, cauliflower, brussel sprouts), Camellia sinensis (tea), Fragaria ananassa (strawberry), Theobroma cacao (cocoa), Coffea arabica (coffee), Vitis vinifera (grape), Ananas comosus (pineapple), Capsicum annum (hot & sweet pepper), Allium cepa (onion), Cucumis melo (melon), Cucumis sativus (cucumber), Cucurbita maxima (squash), Cucurbita moschata (squash), Spinacea oleracea (spinach), Citrullus lanatus (watermelon), Abelmoschus esculentus (okra), Solanum melongena (eggplant), Papaver somniferum (opium poppy), Papaver orientale, Taxus baccata, Taxus brevifolia, Artemisia annua, Cannabis saliva, Camptotheca acuminate, Catharanthus roseus, Vinca rosea, Cinchona officinalis, Coichicum autumnale, Veratrum californica, Digitalis lanata, Digitalis purpurea, Dioscorea 5 spp., Andrographis paniculata, Atropa belladonna, Datura stomonium, Berberis spp., Cephalotaxus spp., Ephedra sinica, Ephedra spp., Erythroxylum coca, Galanthus wornorii, Scopolia spp., Lycopodium serratum (Huperzia serrata), Lycopodium spp., Rauwolfia serpentina, Rauwolfia spp., Sanguinaria canadensis, Hyoscyamus spp., Calendula officinalis, Chrysanthemum parthenium, Coleus forskohlii, Tanacetum parthenium, Parthenium argentatum (guayule), Hevea spp. (rubber), Mentha spicata (mint), Mentha piperita (mint), Bixa orellana, Alstroemeria spp., Rosa spp. (rose), Dianthus caryophyllus (carnation), Petunia spp. (Petunia), Poinsettia pulcherrima (Poinsettia), Nicotiana tabacum (tobacco), Lupinus albus (lupin), Uniola paniculata (oats), Hordeum vulgare (barley), and Lolium spp. (rye).
[0411] In some examples, a monocotyledonous plant may be used. Monocotyledonous plants belong to the orders of the Alismatales, Arales, Arecales, Bromeliales, Commelinales, Cyclanthales, Cyperales, Eriocaulales, Hydrocharitales, Juncales, Lilliales, Najadales, Orchidales, Pandanales, Poales, Restionales, Triuridales, Typhales, and Zingiberales. Plants belonging to the class of the Gymnospermae are Cycadales, Ginkgoales, Gnetales, and Pinales. In some examples, the monocotyledonous plant can be selected from the group consisting of a maize, rice, wheat, barley, and sugarcane.
[0412] In some examples, a dicotyledonous plant may be used, including those belonging to the orders of the Aristochiales, Asterales, Batales, Campanulales, Capparales, Caryophyllales, Casuarinales, Celastrales, Cornales, Diapensales, Dilleniales, Dipsacales, Ebenales, Ericales, Eucomiales, Euphorbiales, Fabales, Fagales, Gentianales, Geraniales, Haloragales, Hamamelidales, Middles, Juglandales, Lamiales, Laurales, Lecythidales, Leitneriales, Magniolales, Malvales, Myricales, Myrtales, Nymphaeales, Papeverales, Piperales, Plantaginales, Plumb aginales, Podostemales, Polemoniales, Polygalales, Polygonales, Primulales, Proteales, Rafflesiales, Ranunculales, Rhamnales, Rosales, Rubiales, Salicales, Santales, Sapindales, Sarraceniaceae, Scrophulariales, Theales, Trochodendrales, Umbellales, Urticales, and Violates.
[0413] In some examples, the dicotyledonous plant can be selected from the group consisting of cotton, soybean, pepper, and tomato.
[0414] In some cases, the plant to be improved is not readily amenable to experimental conditions. For example, a crop plant may take too long to grow enough to practically assess an improved trait serially over multiple iterations. Accordingly, a first plant from which bacteria are initially isolated, and/or the plurality of plants to which genetically manipulated bacteria are applied may be a model plant, such as a plant more amenable to evaluation under desired conditions. Non-limiting examples of model plants include Setaria, Brachypodium, and Arabidopsis. Ability of bacteria isolated according to a method of the disclosure using a model plant may then be applied to a plant of another type (e.g. a crop plant) to confirm conferral of the improved trait.
[0415] Traits that may be improved by the methods disclosed herein include any observable characteristic of the plant, including, for example, growth rate, height, weight, color, taste, smell, changes in the production of one or more compounds by the plant (including for example, metabolites, proteins, drugs, carbohydrates, oils, and any other compounds). Selecting plants based on genotypic information is also envisaged (for example, including the pattern of plant gene expression in response to the bacteria, or identifying the presence of genetic markers, such as those associated with increased nitrogen fixation). Plants may also be selected based on the absence, suppression or inhibition of a certain feature or trait (such as an undesirable feature or trait) as opposed to the presence of a certain feature or trait (such as a desirable feature or trait).
Non-Genetically Modified Maize
[0416] The methods and bacteria described herein are suitable for any of a variety of nongenetically modified maize plants or part thereof. And in some aspects, the corn is organic. Furthermore, the methods and bacteria described herein are suitable for any of the following nongenetically modified hybrids, varieties, lineages, etc. In some embodiments, corn varieties generally fall under six categories: sweet corn, flint corn, popcorn, dent corn, pod corn, and flour corn.
Sweet Corn
[0417] Yellow su varieties include Earlivee, Early Sunglow, Sundance, Early Golden Bantam, Iochief, Merit, Jubilee, and Golden Cross Bantam. White su varieties include True Platinum, Country Gentleman, Silver Queen, and Stowell's Evergreen. Bicolor su varieties include Sugar & Gold, Quickie, Double Standard, Butter & Sugar, Sugar Dots, Honey & Cream. Multicolor su varieties include Hookers, Triple Play, Painted Hill, Black Mexican/Aztec.
[0418] Yellow se varieties include Buttergold, Precocious, Spring Treat, Sugar Buns, Colorow, Kandy King, Bodacious R/M, Tuxedo, Incredible, Merlin, Miracle, and Kandy Korn EH. White se varieties include Spring Snow, Sugar Pearl, Whiteout, Cloud Nine, Alpine, Silver King, and Argent. Bicolor se varieties include Sugar Baby, Fleet, Bon Jour, Trinity, Bi-Licious, Temptation, Luscious, Ambrosia, Accord, Brocade, Lancelot, Precious Gem, Peaches and Cream Mid EH, and Delectable R/M. Multicolor se varieties include Ruby Queen.
[0419] Yellow sh2 varieties include Extra Early Super Sweet, Takeoff, Early Xtra Sweet, Raveline, Summer Sweet Yellow, Krispy King, Garrison, Illini Gold, Challenger, Passion, Excel, Jubilee SuperSweet, Illini Xtra Sweet, and Crisp 'N Sweet. White sh2 varieties include Summer Sweet White, Tahoe, Aspen, Treasure, How Sweet It Is, and Camelot. Bicolor sh2 varieties include Summer Sweet Bicolor, Radiance, Honey 'N Pearl, Aloha, Dazzle, Hudson, and Phenomenal.
[0420] Yellow sy varieties include Applause, Inferno, Honeytreat, and Honey Select. White sy varieties include Silver Duchess, Cinderella, Mattapoisett, Avalon, and Captivate. Bicolor sy varieties include Pay Dirt, Revelation, Renaissance, Charisma, Synergy, Montauk, Kristine, Serendipity/Providence, and Cameo.
[0421] Yellow augmented supersweet varieties include Xtra-Tender lddA, Xtra-Tender 11dd, Mirai 131Y, Mirai 130Y, Vision, and Mirai 002. White augmented supersweet varieties include Xtra-Tender 3dda, Xtra-Tender 31dd, Mirai 421 W, XTH 3673, and Devotion. Bicolor augmented supersweet varieties include Xtra-Tender 2dda, Xtra-Tender 21dd, Kickoff XR, Mirai 308BC, Anthem XR, Mirai 336BC, Fantastic XR, Triumph, Mirai 301BC, Stellar, American Dream, Mirai 350BC, and Obsession.
Flint Corn
[0422] Flint corn varieties include Bronze-Orange, Candy Red Flint, Floriani Red Flint, Glass Gem, Indian Ornamental (Rainbow), Mandan Red Flour, Painted Mountain, Petmecky, Cherokee White Flour,
Pop Corn
[0423] Pop corn varieties include Monarch Butterfly, Yellow Butterfly, Midnight Blue, Ruby Red, Mixed Baby Rice, Queen Mauve, Mushroom Flake, Japanese Hull-less, Strawberry, Blue Shaman, Miniature Colored, Miniature Pink, Pennsylvania Dutch Butter Flavor, and Red Strawberry.
Dent Corn
[0424] Dent corn varieties include Bloody Butcher, Blue Clarage, Ohio Blue Clarage, Cherokee White Eagle, Hickory Cane, Hickory King, Jellicorse Twin, Kentucky Rainbow, Daymon Morgan's Knt. Butcher, Learning, Learning's Yellow, McCormack's Blue Giant, Neal Paymaster, Pungo Creek Butcher, Reid's Yellow Dent, Rotten Clarage, and Tennessee Red Cob.
[0425] In some embodiments, corn varieties include P1618 W, P1306 W, P1345, P1151, P1197, P0574, P0589, and P0157. W=white corn.
[0426] In some embodiments, the methods and bacteria described herein are suitable for any hybrid of the maize varieties set forth herein.
Genetically Modified Maize
[0427] The methods and bacteria described herein are suitable for any of a hybrid, variety, lineage, etc. of genetically modified maize plants or part thereof.
EXAMPLES
[0428] The maize hybrid DKC 66-40 was grown under standard greenhouse growth conditions with a 15-hour day length and temperature set points of 25 C. during daylight hours and 22 C. during night hours. Seeds were planted in standard potting mix combined 1:1 with calcined clay by pressing (2) 2-inch holes near the center of each pot with a planting tool. One seed was then dropped into each prepared hole and inoculated with sterile PBS (UTC controls) or a bacterial suspension of the strain 137-3890, a microbe with an increased potential to fix nitrogen in planta, using cells diluted to a prescribed optical density. Seedlings were given water only for the first week, then thinned to a single plant per pot by selecting the most vigorous seedling and removing the remaining plant at approximately 7 days after planting. At one-week post planting, fertigation began on all plants using a modified Hoagland's solution containing 2 mM of total nitrogen. Fertigation typically occurred twice per week, and additional water was given to all plants as needed.
[0429] At 3 weeks post-planting, plants were moved to chamber 102. After closing and sealing the chamber, 20 L of gas were removed from the chamber and replaced with the same volume of 98% atom .sup.15N gas (obtained from Sigma-Aldrich, St. Louis, MO), such that the internal atmosphere of chamber 102 was raised to approximately 0.5 atom % .sup.15N. Growth conditions in the chamber were controlled such that plants experienced a constant humidity of approximately 60%, supplemental light from metal halide lamps for 15 hours per day, and day and night temperatures as described above. Oxygen and carbon dioxide levels were monitored and adjusted as necessary to pre-determined set values. Irrigation with the same 2 mM modified Hoagland's solution was performed two times per week without opening chamber 102 to the external environment.
[0430] Plants were harvested after two weeks in the chamber and approximately five weeks after planting (e.g., at the V8 growth stage). Plants were sectioned into four distinct portions: root tissue, newly emerged whorl tissue, top-collared leaf tissue, and all remaining vegetative tissue (other vegetative tissue). Dry weight (weight in grams of whole plant after complete drying to a stable weight) was measured approximately 14 days after plant harvest for each tissue portion. Samples were then ground to a fine powder and isotopic analysis was performed at the UC Davis Stable Isotope Facility (Davis, CA, USA). For each sample, percent nitrogen and percent .sup.15N were determined.
[0431]
[0432] A biologically pure culture of Klebsiella variicola was deposited on Apr. 2, 2020, with the American Type Culture Collection (ATCC; an International Depositary Authority), Manassas, VA, USA, and assigned ATTC Patent Deposit Designation number PTA-126749.
[0433] This deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations (Budapest Treaty).
OTHER EMBODIMENTS
[0434] Other features and aspects of the systems, methods, and compositions described herein are described, for example, in PCT Application Publication Nos. WO 2019/084059, WO 2019/084342, and WO 2020/014498, the entire contents of each of which are incorporated herein by reference.
[0435] While this disclosure describes specific implementations, these should not be construed as limitations on the scope of the disclosure, but rather as descriptions of features in certain embodiments. Features that are described in the context of separate embodiments can also generally be implemented in combination in a single embodiment. Conversely, various features that are described in the context of a single embodiment can also be implemented in multiple embodiments separately or in any suitable sub-combination. Moreover, although features may be described above as present in certain combinations and even initially claimed as such, one or more features from a claimed combination can generally be excised from the combination, and the claimed combination may be directed to a sub-combination or variation of a sub-combination.
[0436] In addition to the embodiments expressly disclosed herein, it will be understood that various modifications to the embodiments described may be made without departing from the spirit and scope of the disclosure. Accordingly, other embodiments are within the scope of the following claims.