NEW MAJOR FACILITATOR SUPERFAMILY (MFS) PROTEIN (BAD) IN HMO PRODUCTION

20230072639 · 2023-03-09

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to the field of recombinant production of biological molecules in genetically modified cells. More particularly, it relates to a method for recombinant production of human milk oligosaccharides (HMO) using a genetically modified cell expressing a protein of the major facilitator superfamily (MFS), the protein expressed being Bad.

    Claims

    1. A genetically modified cell capable of producing one or more Human Milk Oligosaccharides (HMOs), wherein said genetically modified cell comprises a heterologous nucleic acid sequence encoding a major facilitator superfamily (MFS) polypeptide shown in SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80% identical to SEQ ID NO: 1.

    2. The genetically modified cell according to claim 1, wherein the cell further comprises a nucleic acid sequence comprising a regulatory element for the regulation of the expression of the heterologous nucleic acid sequence.

    3. The genetically modified cell according to claim 2, wherein the regulatory element regulates the expression of the MFS polypeptide shown in SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80% identical to SEQ ID NO: 1.

    4. The genetically modified cell according to claim 2, wherein the regulatory element is selected from the group consisting of PglpF and PglpF_SD4.

    5. The genetically modified cell according to claim 1 wherein the genetically modified cell is Escherichia coli.

    6. The genetically modified cell according to claim 1, wherein the one or more HMOs are selected from the group consisting of 2′-fucosyllactose (2′-FL), 3-fucosyllactose (3-FL) and difucosyllactose (DFL); or a mixture thereof.

    7. A nucleic acid construct comprising a nucleic acid sequence encoding an MFS polypeptide according to SEQ ID NO: 1, or a functional homologue thereof, having more than 80% sequence identity to SEQ ID NO: 1, wherein the nucleic acid sequence encoding the MFS polypeptide has at least 70% sequence identity to SEQ ID NO: 2.

    8. The nucleic acid construct according to claim 7, wherein the construct further comprises a nucleic acid sequence comprising a regulatory element.

    9. The nucleic acid construct according to claim 8, wherein the regulatory element regulates the expression of the nucleic acid sequence having at least 70% sequence identity to SEQ ID NO: 2.

    10. The nucleic acid construct according to claim 8, wherein the regulatory element is selected from the group consisting of PglpF and PglpF_SD4.

    11. A method for the biosynthetic production of one or more Human Milk Oligosaccharides (HMOs), the method comprising the steps of: providing a genetically modified cell according to claim 1; (ii) culturing the genetically modified cell according to (i) in a suitable cell culture medium to express said polypeptide capable of efflux sugar transportation and produce one or more Human Milk Oligosaccharides (HMOs) and; (iii) harvesting the one or more HMOs produced in step (ii).

    12.-13. (canceled)

    14. The method according to claim 11, wherein the one or more HMOs are selected from the group consisting of 2′-fucosyllactose (2′-FL), 3-fucosyllactose (3-FL) and difucosyllactose (DFL); or a mixture thereof.

    15. The method according to claim 14, wherein one or more HMOs comprises 2′-FL.

    16. The method according to claim 14, wherein one or more HMOs comprises 3-FL.

    17. The genetically modified cell according to claim 1, wherein the one or more HMOs are selected from the group consisting of LNT-2, LNT, and LNFP I; or a mixture thereof.

    18. The genetically modified cell according to claim 17, wherein the one or more HMOs comprises LNT.

    19. The method according to claim 11, wherein the one or more HMOs are selected from the group consisting of LNT-2, LNT, and LNFP I; or a mixture thereof.

    20. The method according to claim 19, wherein the one or more HMOs comprises LNT.

    21. The nucleic acid construct according to claim 9, wherein the regulatory element is selected from the group consisting of PglpF and PglpF_SD4.

    22. A method for the biosynthetic production of one or more Human Milk Oligosaccharides (HMOs), the method comprising the steps of: (iv) providing a genetically modified cell according to claim 21; (v) culturing the genetically modified cell according to (i) in a suitable cell culture medium to express said polypeptide capable of efflux sugar transportation and produce one or more Human Milk Oligosaccharides (HMOs) and; (vi) harvesting the one or more HMOs produced in step (ii).

    Description

    BRIEF DESCRIPTION OF FIGURES

    [0030] FIG. 1 shows the relative 3-FL production of modified E. coli strain (Strain 1) with and without the expression of the Bad MFS transporter protein with SEQ ID NO: 1, Strain 2 and Strain 1, respectively. Data is obtained from a deep-well feed batch assay.

    [0031] FIG. 2 shows the relative distribution of 3-FL inside and outside the cells in modified E. coli strain (Strain 1) with and without the expression of the Bad MFS transporter protein with SEQ ID NO: 1, Strain 2 and Strain 1, respectively. Data is obtained from a deep-well feed batch assay.

    [0032] FIG. 3 shows the relative 2′-FL production of modified E. coli strain (Strain 3) with and without the expression of the Bad MFS transporter protein with SEQ ID NO: 1, Strain 4 and Strain 3, respectively. Data is obtained from a deep-well feed batch assay.

    [0033] FIG. 4 shows relative distribution of 2′-FL inside and outside the cells in modified E. coli strain (Strain 3) with and without the expression of the Bad MFS transporter protein with SEQ ID NO: 1, Strain 4 and 5, versus Strain 3, respectively. Data is obtained from a deep-well feed batch assay.

    [0034] FIG. 5 shows the percentage (%) relative LNnT concentrations in total samples for seven strains that express GlcNacT and Gal4T genes and a heterologous transporter gene, yberC0001_9420, bad, fred, marc, vag, nec, or yabM, correspondingly. The strain MP3672 expresses the glycosyltransferase genes and no transporter genes;

    [0035] FIG. 6 shows the percentage (%) relative LNnT concentrations in the supernatant of cells expressing vag or yabM.

    DETAILED DESCRIPTION

    [0036] In the following, embodiments of the invention will be described in further detail. Each specific variation of the features can be applied to other embodiments of the invention unless specifically stated otherwise.

    [0037] Generally, all terms used herein are to be interpreted according to their ordinary meaning in the technical field, and applicable to all aspects and embodiments of the invention, unless explicitly defined or stated otherwise.

    [0038] All references to “a/an/the [cell, sequence, gene, transporter, step, etc]” are to be interpreted openly as referring to at least one instance of said cell, sequence, gene, transporter, step, etc., unless explicitly stated otherwise.

    [0039] The steps of any method disclosed herein do not have to be performed in the exact order disclosed, unless explicitly stated.

    [0040] The present invention in general relates to a genetically modified cell for efficient production of oligosaccharides and use of said genetically modified cell in a method of producing the oligosaccharides. In particular, the present invention relates to a genetically modified cell enabled to synthesize an oligosaccharide, preferably a heterologous oligosaccharide, in particular a human milk oligosaccharide (HMO).

    [0041] Accordingly, a genetically modified cell of the invention is modified to express a set of recombinant nucleic acids that are necessary for synthesis of one or more HMOs by the cells (which enable the host cell to synthesize one or more HMOs), such as genes encoding one or more enzymes with glycosyltransferase activity as described below. The oligosaccharide producing recombinant cell of the invention is further modified to comprise a heterologous recombinant nucleic acid sequence, preferably, a DNA sequence, encoding a putative MFS (major facilitator superfamily) transporter protein, originating from the bacterium Rouxiella badensis.

    [0042] Specifically, the invention relates to a genetically modified cell optimized for the production of one or more particular oligosaccharides, in particular one or more particular HMOs, comprising a recombinant nucleic acid encoding a Bad protein.

    [0043] A nucleic acid sequence encoding a Bad protein having the nucleic acid sequence of SEQ ID NO: 2 is herein identified as “Bad coding nucleic acid/DNA” or “bad gene” or “bad”.

    [0044] The MFS transporter protein identified herein as “Bad protein” or “Bad transporter” or “Bad”, interchangeably, has the amino acid sequence of SEQ ID NO: 1; The amino acid sequence identified herein as SEQ ID NO: 1 is an amino acid sequence that has 100% identity with the amino acid sequence having the GenBank accession ID WP_017489914.1.

    [0045] Accordingly, one aspect of the invention relates to a genetically modified cell capable of producing one or more Human Milk Oligosaccharides (HMOs), wherein said genetically modified cell comprises a heterologous nucleic acid sequence encoding a polypeptide capable of sugar transportation, said nucleic acid sequence having at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95% and even more preferably at least 99% sequence identity to SEQ ID NO: 2.

    [0046] Further, the invention relates to a genetically modified cell optimized for the production of one or more particular oligosaccharides, in particular one or more particular HMOs, comprising a recombinant nucleic acid encoding a protein having at least 80%, such as at least 90% sequence identity, preferably at least 95%, more preferably at least 97%, more preferably at least 98%, and even more preferably at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 1.

    [0047] Accordingly, one aspect of the invention relates to a genetically modified cell capable of producing one or more Human Milk Oligosaccharides (HMOs), wherein said genetically modified cell comprises a heterologous nucleic acid sequence encoding a polypeptide capable of sugar transportation, said nucleic acid sequence having at least 70%, more preferably at least 75%, more preferably at least 80% more preferably at least 90% and even more preferably at least 95%, such as 99% sequence identity to SEQ ID NO: 2.

    [0048] Accordingly, another aspect of the invention relates to a genetically modified cell capable of producing one or more HMOs, wherein said cell comprises a recombinant nucleic acid encoding a protein of SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80% identical, preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99% identical to SEQ ID NO: 1.

    [0049] By the term “functional homolog” in the present context is meant a protein that has an amino acid sequence that is at least 80%, such as 90%-99.9% identical to SEQ ID NO: 1 and has a function that is beneficial to achieve at least one advantageous effect of the invention, e.g. an increase of the total HMO production or of a selection of HMO by the genetically modified cell, facilitate recovery of the produced HMO(s), HMO production efficiency and/or viability of an HMO producing cell.

    [0050] By the term “Major Facilitator Superfamily (MFS)” is meant a large and exceptionally diverse family of the secondary active transporter class, which is responsible for transporting a range of different substrates, including sugars, drugs, hydrophobic molecules, peptides, organic ions, etc. The specificity of sugar transporter proteins is highly unpredictable and the identification of novel transporter protein with specificity towards for example oligosaccharides requires unburden laboratory experimentation (for more details see review by Reddy V. S. et al., (2012), FEBS J. 279(11): 2022-2035). The term “MFS transporter” means in the present context a protein that facilitates transport of an oligosaccharide, preferably, an HMO, through the cell membrane, preferably transport of an HMO/oligosaccharide synthesized by the genetically modified cell from the cell cytosol to the cell medium, preferably an HMO/oligosaccharide comprising three or four sugar units, e.g. 2′-FL, 3-FL, LNT-2, LNT, LNnT, 3′-SL or 6′-SL. Additionally, or alternatively, the MFS transporter may also facilitate efflux of molecules that are not considered HMO or oligosaccharides according to the present invention, such as lactose, glucose, cell metabolites or toxins.

    [0051] The term “sequence identity of [a certain] %” in the context of two or more nucleic acid or amino acid sequences means that the two or more sequences have nucleotides or amino acid residues in common in the given percent when compared and aligned for maximum correspondence over a comparison window or designated sequences of nucleic acids or amino acids (i.e. the sequences have at least 90 percent (%) identity). Percent identity of nucleic acid or amino acid sequences can be measured using a BLAST 2.0 sequence comparison algorithm with default parameters, or by manual alignment and visual inspection (see e.g. http://www.ncbi.nlm.nih.gov/BLAST/). This definition also applies to the complement of a test sequence and to sequences that have deletions and/or additions, as well as those that have substitutions. An example of an algorithm that is suitable for determining percent identity, sequence identity and for alignment is the BLAST 2.2.20+ algorithm, which is described in Altschul et al. Nucl. Acids Res. 25, 3389 (1997). BLAST 2.2.20+ is used to determine percent sequence identity for the nucleic acids and proteins of the invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). Examples of sequence alignment algorithms are CLUSTAL Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/), EMBOSS Needle (http://www.ebi.ac.uk/Tools/psa/emboss_needle/), MAFFT (http://mafft.cbrc.jp/alignment/server/) or MUSCLE (http://www.ebi.ac.uk/Tools/msa/muscle/).

    [0052] In the context of the invention, the term “oligosaccharide” means a saccharide polymer containing a number of monosaccharide units. In some embodiments, preferred oligosaccharides are saccharide polymers consisting of three or four monosaccharide units, i.e. trisaccharides or tetrasaccharides. Preferable oligosaccharides of the invention are human milk oligosaccharides (HMOs).

    [0053] HMO

    [0054] The term “human milk oligosaccharide” or “HMO” in the present context means a complex carbohydrate found in human breast milk (for reference, see Urashima et al.: Milk Oligosaccharides. Nova Science Publisher (2011); or Chen, Adv. Carbohydr. Chem. Biochem. 72, 113 (2015)). The HMOs have a core structure comprising a lactose unit at the reducing end that can be elongated by one or more β-N-acetyl-lactosaminyl and/or one or more β-lacto-N-biosyl units, and this core structure can be substituted by an α-L-fucopyranosyl and/or an α-N-acetyl-neuraminyl (sialyl) moiety. In this regard, the non-acidic (or neutral) HMOs are devoid of a sialyl residue, and the acidic HMOs have at least one sialyl residue in their structure. The non-acidic (or neutral) HMOs can be fucosylated or non-fucosylated. Examples of such neutral non-fucosylated HMOs include lacto-N-triose 2 (LNT-2) lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), lacto-N-neohexaose (LNnH), para-lacto-N-neohexaose (pLNnH), para-lacto-N-hexaose (pLNH) and lacto-N-hexaose (LNH). Examples of neutral fucosylated HMOs include 2′-fucosyllactose (2′-FL), lacto-N-fucopentaose I (LNFP-I), lacto-N-difucohexaose I (LNDFH-I), 3-fucosyllactose (3-FL), difucosyllactose (DFL), lacto-N-fucopentaose II (LNFP-II), lacto-N-fucopentaose III (LNFP-III), lacto-N-difucohexaose III (LNDFH-III), fucosyl-lacto-N-hexaose II (FLNH-II), lacto-N-fucopentaose V (LNFP-V), lacto-N-difucohexaose II (LNDFH-II), fucosyl-lacto-N-hexaose I (FLNH-I), fucosyl-para-lacto-N-hexaose I (FpLNH-I), fucosyl-para-lacto-N-neohexaose II (F-pLNnH II) and fucosyl-lacto-N-neohexaose (FLNnH). Examples of acidic HMOs include 3′-sialyllactose (3′-SL), 6′-sialyllactose (6′-SL), 3-fucosyl-3′-sialyllactose (FSL), 3′-O-sialyllacto-N-tetraose a (LST a), fucosyl-LST a (FLST a), 6′-O-sialyllacto-N-tetraose b (LST b), fucosyl-LST b (FLST b), 6′-O-sialyllacto-N-neotetraose (LST c), fucosyl-LST c (FLST c), 3′-O-sialyllacto-N-neotetraose (LST d), fucosyl-LST d (FLST d), sialyl-lacto-N-hexaose (SLNH), sialyl-lacto-N-neohexaose I (SLNH-I), sialyl-lacto-N-neohexaose II (SLNH-II) and disialyl-lacto-N-tetraose (DSLNT). In the context of the present invention lactose is not regarded as an HMO species.

    [0055] In some embodiments of the invention, tri-HMOs and tetra-HMOs may be a preferred, e.g. trisaccharides 2′-FL, 3-FL, LNT-2, 3′-SL, 6′-SL, and tetrasaccharides DFL, LNT, LNnT, FSL.

    [0056] In a presently preferred aspect of the invention, tri-HMOs are preferred, in particular trisaccharides selected from 2′-FL and 3-FL, and tetrasaccharides selected from DFL and LNT.

    [0057] 2′-FL

    [0058] 2′-Fucosyllactose (2′-FL or 2′O-fucosyllactose) is a trisaccharide, more precisely, fucosylated, neutral trisaccharide composed of L-fucose, D-galactose, and D-glucose units (Fucα1-2Galβ1-4Glc). It is the most prevalent human milk oligosaccharide (HMO) naturally present in human breast milk, making up about 30% of all of HMOs. In a genetically modified cell or in an enzymatic reaction, 2′-FL is produced primarily by an α-1,2-fucosyltransferase enzymatic reaction with lactose and a fucosyl doner.

    [0059] 3-FL

    [0060] 3-Fucosyllactose (3-FL) is a trisaccharide, more precisely, fucosylated, neutral trisaccharide composed of D-galactose, L-fucose, and D-glucose (Galβ1-4(Fucα1-3)Glc). It is naturally present in human milk. In a genetically modified cell or in an enzymatic reaction, 3-FL is produced primarily by an α-1,3-fucosyltransferase or α-1,3/4-fucosyltransferase enzymatic reaction with lactose and a fucosyl doner.

    [0061] LNT

    [0062] Lacto-N-tetraose (LNT) is a tetrasaccharide, more precisely, a neutral tetrasaccharide composed of galactose, N-acetylglucosamine, galactose, and glucose (GlcNAcβ1-3Galβ1-4Glc). It is naturally present in human milk.

    [0063] DFL

    [0064] Difucosyllactose (DFL or 2′,3-di-O-fucosyllactose) is an oligosaccharide, more precisely, focusylated neutral tetrasaccharide composed of L-fucose, D-galactose, L-fucose, and D-glucose (Fucα1-2Galβ1-4(Fucα1-3)Glc). It is naturally present in human milk. In a genetically modified cell or in an enzymatic reaction, DFL is produced primarily by an α-1,2-fucosyltransferase, α-1,3-fucosyltransferase and/or α-1,3/4-fucosyltransferase enzymatic reaction with lactose and two fucosyl doners.

    [0065] Functional Enzymes

    [0066] To be able to synthesize one or more HMOs, the recombinant cell of the invention comprises at least one recombinant nucleic acid which encodes a functional enzyme with glycosyltransferase activity. The galactosyltransferase gene may be integrated into the genome (by chromosomal integration) of the genetically modified cell, or alternatively, it may be comprised in a plasmid DNA and expressed as plasmid-borne. If two or more glycosyltransferases are needed for the production of an HMO, e.g. LNT or LNnT, two or more recombinant nucleic acids encoding different enzymes with glycosyltransferase activity may be integrated in the genome and/or expressed from a plasmid, e.g. a β-1,3-N-acetylglucosaminyltransferase (a first recombinant nucleic acid encoding a first glycosyltransferase) in combination with a β-1,3-galactosyltransferase (a second recombinant nucleic acid encoding a second glycosyltransferase) for the production of LNT, where the first and second recombinant nucleic acid can independently from each other be integrated chromosomally or on a plasmid.

    [0067] In one preferred embodiment, both the first and second recombinant nucleic acids are stably integrated into the chromosome of the production cell; in another embodiment at least one of the first and second glycosyltransferase is plasmid-borne. A protein/enzyme with glycosyltransferase activity (glycosyltransferase) may be selected in different embodiments from enzymes having the activity of α-1,2-fucosyltransferase, α-1,3-fucosyltransferase, α-1,3/4-fucosyltransferase, α-1,4-fucosyltransferase α-2,3-sialyltransferase, α-2,6-sialyltransferase, acetylglucosaminyltransferase, β-1,6-N-acetylglucosaminyltransferase, β-1,3-galactosyltransferase and β-1,4-galactosyltransferase. For example, the production of 2′-FL requires that the modified cell expresses an active α-1,2-fucosyltransferase enzyme; for the production of 3-FL the modified cell needs expression of an active α-1,3-fucosyltransferase enzyme; for the production of LNT the modified cell need to express at least two glycosyltransferases, a β-1,3-N-acetylglucosaminyltransferase and a β-1,3-galactosyltransferase; for the production of 6′-SL the modified cell has to express an active α-2,6-sialyltransferase enzyme and a pathway for CMP-sialic acid synthesis; for the production of 3′-SL the modified cell has to express an active α-2,3-sialyltransferase enzyme and a pathway for CMP-sialic acid synthesis. Some non-limiting embodiments of proteins having glycosyltransferase activity, which can be encoded by the recombinant genes comprised by the production cell, can be selected from non-limiting examples of Table 1.

    TABLE-US-00001 TABLE 1 Protein Sequence ID Gene (GenBank) Description HMO example lgtA_Nm WP_002248149.1 33-1,3-N- LNT, LNnT, LNFP-I, LNFP- acetylglucosaminyl- II, LNFP-Ill, LNFP-V, LNFP- transferase VI, LNDFH-I, LNDFH-II, pLNH, F-pLNH I, pLNnH lgtA_Nm_MC58 AAF42258.1 8-1,3-N- LNT, LNnT, LNFP-I, LNFP- acetylglucosaminyl- II, LNFP-Ill, LNFP-V, LNFP- transferase VI, LNDFH-I, LNDFH-II, pLNH, F-pLNH I, pLNnH lgtA_Hd AANO5638.1 8-1,3-N- LNT, LNnT, LNFP-I, LNFP- acetylglucosaminyl- II, LNFP-Ill, LNFP-V, LNFP- transferase VI, LNDFH-I, LNDFH-II, pLNH, F-pLNH I, pLNnH lgtA_Ng_PID2 AAK70338.1 8-1,3-N- LNT, LNnT, LNFP-I, LNFP- acetylglucosaminyl- II, LNFP-Ill, LNFP-V, LNFP- transferase VI, LNDFH-I, LNDFH-II, pLNH, F-pLNH I, pLNnH lgtA_Ng_NCCP11 ACF31229.1 8-1,3-N- LNT, LNnT, LNFP-I, LNFP- 945 acetylglucosaminyl- II, LNFP-Ill, LNFP-V, LNFP- transferase VI, LNDFH-I, LNDFH-II, pLNH, F-pLNH I, pLNnH lgtA_Past AAK02595.1 8-1,3-N- LNT, LNnT, LNFP-I, LNFP- acetylglucosaminyl- II, LNFP-Ill, LNFP-V, LNFP- transferase VI, LNDFH-I, LNDFH-II, pLNH, F-pLNH I, pLNnH lgtA_Nc EEZ72046.1 8-1,3-N- LNT, LNnT, LNFP-I, LNFP- acetylglucosaminyl- II, LNFP-Ill, LNFP-V, LNFP- transferase VI, LNDFH-I, LNDFH-II, pLNH, F-pLNH I, pLNnH lgtA_Nm_87255 ELK60643.1 8-1,3-N- LNT, LNnT, LNFP-I, LNFP- acetylglucosaminyl- II, LNFP-Ill, LNFP-V, LNFP- transferase VI, LNDFH-I, LNDFH-II, pLNH, F-pLNH I, pLNnH galT_Hp/HP0826 NP_207619.1 33-1,4- LNnT, LNFP-Ill, LNFP-VI, galactosyl transferase pLNH I, F-pLNH I, pLNnH galT_Nm/ AAF42257.1 P-1,4- LNnT, LNFP-Ill, LNFP-VI, igtB galactosyl transferase pLNH I, F-pLNH I, pLNnH wbgO WP_000582563.1 P-1,3- LNT, LNFP-I, LNFP-II, galactosyl transferase LNFP-V, LNDFH-I, LNDFH- II, pLNH, F-pLNH I cpsIBJ AB050723.1 38-1,3- LNT, LNFP-I, LNFP-II, galactosyl transferase LNFP-V, LNDFH-I, LNDFH- II, pLNH, F-pLNH I jhp0563 AEZ55696.1 P-1,3- LNT, LNFP-I, LNFP-II, galactosyl transferase LNFP-V, LNDFH-I, LNDFH- II, pLNH, F-pLNH I galTK homologous to P-1,3- LNT, LNFP-I, LNFP-II, BD182026 galactosyl transferase LNFP-V, LNDFH-I, LNDFH- II, pLNH, F-pLNH I futC WP_080473865.1 a-1,2-fucosyl- 2′-FL, DFL, LNFP-I, transferase LNDFH-I FucT2_HpUA802 AAC99764.1 a-1,2-fucosyl- 2′-FL, DFL, LNFP-I, transferase LNDFH-I FucT2_EcO126t ABE98421.1 a-1,2-fucosyl- 2′-FL, DFL, LNFP-I, transferase LNDFH-I FucT2_Hm12198 CBG40460.1 a-1,2-fucosyl- 2′-FL, DFL, LNFP-I, transferase LNDFH-I FucT2_Pm9515 ABM71599.1 a-1,2-fucosyl- 2′-FL, DFL, LNFP-I, transferase LNDFH-I FucT2_HpF57 BAJ59215.1 a-1,2-fucosyl- 2′-FL, DFL, LNFP-I, transferase LNDFH-I FucT6_3_Bf CAH09151.1 a-1,3-fucosyl- 2′-FL, 3-FL, DFL, LNFP-I, transferase LNFP-Ill, LNFP-V, LNFP- VI, LNDFH-II, F-pLNH I FucT7_3_Bf CAH09495.1 a-1,3-fucosyl- 2′-FL, 3-FL, DFL, LNFP-I, transferase LNFP-Ill, LNFP-V, LNFP- VI, LNDFH-II, F-pLNH I FucT_3_Am ACD04596.1 a-1,3-fucosyl- 2′-FL, 3-FL, DFL, LNFP-I, transferase LNFP-Ill, LNFP-V, LNFP- VI, LNDFH-II, F-pLNH I MAMA_R764 AGCO2224.1 a-1,3-fucosyl- 2′-FL, 3-FL, DFL, LNFP-I, transferase LNFP-Ill, LNFP-V, LNFP- VI, LNDFH-II, F-pLNH I Mg791 AEQ33441.1 a-1,3-fucosyl- 2-FL, 3-FL, DFL, LNFP-I, transferase LNFP-Ill, LNFP-V, LNFP- VI, LNDFH-II, F-pLNH I Moumou_00703 YP_007354660 a-1,3-fucosyl- 2′-FL, 3-FL, DFL, LNFP-I, transferase LNFP-Ill, LNFP-V, LNFP- VI, LNDFH-II, F-pLNH I MA NP_207177.1 a-1,3-fucosyl- 2′-FL, 3-FL, DFL, LNFP-I, transferase LNFP-Ill, LNFP-V, LNFP- VI, LNDFH-II, F-pLNH I fucT AAB81031.1 a-1,3-fucosyl- 2′-FL, 3-FL, DFL, LNFP-I, transferase LNFP-Ill, LNFP-V, LNFP- VI, LNDFH-II, F-pLNH I fucTIII AY450598.1 a-1,4-fucosyl- LNDFH-I, LNDFH-II transferase MTa AF194963.1 a-1,3/4-fucosyl- LNFP-II, LNDFH-I, LNDFH- transferase II Pd2,6ST BAA25316.1 a-2,6-sialyltransferase 6′-SL PspSTG BAF92026.1 a-2,6-sialyltransferase 6′-SL PiST6_145 BAF91416.1 a-2,6-sialyltransferase 6′-SL PiST6_119 BAI49484.1 a-2,6-sialyltransferase 6′-SL NST AAC44541.1 a-2,3-sialyltransferase 3′-SL

    [0068] Heterologous Nucleic Acid Sequence

    [0069] An aspect of the present invention is the provision of a nucleic acid construct comprising a heterologous nucleic acid sequence(s) encoding a polypeptide capable of sugar transportation which is a major facilitator superfamily (MFS) polypeptide as shown in SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80% identical to SEQ ID NO: 1, wherein the nucleic acid sequence encoding the sugar transportation polypeptide has at least 70% sequence identity to SEQ ID NO: 2.

    [0070] By the term “heterologous nucleic acid sequence”, “recombinant gene/nucleic acid/DNA encoding” or “coding nucleic acid sequence” is meant an artificial nucleic acid sequence (i.e. produced in vitro using standard laboratory methods for making nucleic acid sequences) that comprises a set of consecutive, non-overlapping triplets (codons) which is transcribed into mRNA and translated into a polypeptide whened under the control of the appropriate control sequences, i.e. promoter. The boundaries of the coding sequence are generally determined by a ribosome binding site located just upstream of the open reading frame at the 5′end of the mRNA, a transcriptional start codon (AUG, GUG or UUG), and a translational stop codon (UAA, UGA or UAG). A coding sequence can include, but is not limited to, genomic DNA, cDNA, synthetic, and recombinant nucleic acid sequences.

    [0071] The term “nucleic acid” includes RNA, DNA and cDNA molecules. It is understood that, as a result of the degeneracy of the genetic code, a multitude of nucleotide sequences encoding a given protein may be produced. The term nucleic acid is used interchangeably with the term “polynucleotide”.

    [0072] An “oligonucleotide” is a short chain nucleic acid molecule.

    [0073] “Primer” is an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as

    [0074] DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is a deoxyribonucleotide sequence. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer and the use of the method.

    [0075] The recombinant nucleic sequence of the invention may be a coding DNA sequence, e.g. a gene, or non-coding DNA sequence, e.g. a regulatory DNA, such as a promoter sequence. One aspect of the invention relates to providing a recombinant cell comprising recombinant DNA sequences encoding enzymes necessary for the production of one or more HMOs and a DNA sequence encoding Bad transporter. Accordingly, in one embodiment the invention relates to a nucleic acid construct comprising a coding nucleic sequence, i.e. recombinant DNA sequence of a gene of interest, e.g. a glycosyltransferase gene or the bad gene, and a non-coding DNA sequence, e.g. a promoter DNA sequence, e.g. a recombinant promoter sequence derived from the promoter of lac operon or an glp operon, or a promoter sequence derived from another genomic promoter DNA sequence, or a synthetic promoter sequence, wherein the coding and promoter sequences are operably linked. The term “operably linked” refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence. For example, a promoter sequence is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system. Generally, promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis-acting.

    [0076] In one embodiment, the nucleic acid construct of the invention may be a part of the vector DNA, in another embodiment the construct it is an expression cassette/cartridge that is integrated in the genome of a host cell. Accordingly, the term “nucleic acid construct” means an artificially constructed segment of nucleic acid, in particular a DNA segment, which is intended to be ‘transplanted’ into a target cell, e.g. a bacterial cell, to modify expression of a gene of the genome or express a gene/coding DNA sequence which may be included in the construct. In the context of the invention, the nucleic acid construct contains a recombinant DNA sequence comprising two or more recombinant DNA sequences: essentially, a non-coding DNA sequence comprising a promoter DNA sequence and a coding DNA sequence encoding a gene of interest, e.g. Bad protein, a glycosyltransferase, of another gene useful for production of an HMO in a host cell. Preferably, the construct comprises further non-coding DNA sequences that either regulate transcription or translation of the coding DNA of the construct, e.g. a DNA sequence facilitating ribosome binding to the transcript, a leading DNA sequence that stabilize the transcript.

    [0077] Integration of the recombinant nucleic acid of interest comprised in the construct (expression cassette) into the bacterial genome can be achieved by conventional methods, e.g. by using linear cartridges that contain flanking sequences homologous to a specific site on the chromosome, as described for the attTn7-site (Waddell C. S. and Craig N. L., Genes Dev. (1988) February; 2(2):137-49.); methods for genomic integration of nucleic acid sequences in which recombination is mediated by the Red recombinase function of the phage λ or the RecE/RecT recombinase function of the Rac prophage (Murphy, J Bacteriol. (1998);180(8):2063-7; Zhang et al., Nature Genetics (1998) 20: 123-128 Muyrers et al., EMBO Rep. (2000) 1(3): 239-243); methods based on Red/ET recombination (Wenzel et al., Chem Biol. (2005), 12(3):349-56.; Vetcher et al., Appl Environ Microbiol. (2005);71(4):1829-35); or positive clones, i.e. clones that carry the expression cassette, can be selected e.g. by means of a marker gene, or loss or gain of gene function.

    [0078] A single copy of the expression cassette comprising a gene of interest may be sufficient to secure production of a desired HMO and achieve the desired effects according to the invention. Accordingly, in some preferred embodiments, the invention relates to a recombinant HMO producing cell that comprises one, two or three copies of a gene of interest integrated in the genomic DNA of the cell. In some embodiments the single copy of the gene is preferred.

    [0079] In one preferred embodiment, recombinant coding nucleic acid sequence of the nucleic acid construct of the invention is heterologous with respect to the promoter, which means that in the equivale native coding sequence in the genome of species of origin is transcribed under control of another promoter sequence (i.e. not the promoter sequence of the construct). Still, with respect to the host cell, the coding DNA may be either heterologous (i.e. derived from another biological species or genus), such as e.g. the DNA sequence encoding Bad protein expressed in Escherichia coli host cells, or homologous (i.e. derived from the host cell), such as e.g. genes of the colonic acid operon, the wca genes.

    [0080] Preferably, the construct of the invention comprising a gene related to biosynthetic production of an HMO, a promoter DNA sequence, and other regulatory sequences, such as a ribosomal binding site sequence (e.g. Shine-Dalgarno sequence), expressed in the genetically modified cell enables production of the HMO at the level of at least 0.03 g/OD (optical density) of 1 liter of the fermentation media comprising a suspension of genetically modified cell s, e.g., at the level of around 0.05 g/l/OD to around 0.5 g/l/OD. For the purposes of the invention, the later level of HMO production is regarded as “sufficient” and the genetically modified cell capable of producing this level of a desired HMO is regarded as “suitable genetically modified cell”, i.e. the cell can be further modified to express the HMO transporter protein, e.g. Bad, to achieve at least one effect described herein that is advantageous for the HMO production.

    [0081] The genetically modified cell or the nucleic acid construct of the present invention comprises a nucleic acid sequence such as a heterologous gene encoding a putative MFS (major facilitator superfamily) transporter protein.

    [0082] A MFS transporter of particular interest in the present invention is Bad protein. A nucleic acid construct of the present invention therefore contains a nucleic acid sequence having at least 70% sequence identity to the gene, bad, SEQ ID NO: 2.

    [0083] The nucleic acid sequence contained in the genetically modified cell or in nucleic acid construct encodes for a protein of SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80%, such as at least 85%, 90%, 95% or 99% identical to SEQ ID NO: 1.

    [0084] A functional homologue of the protein of SEQ ID NO: 1, may be obtained by mutagenesis. The functional homologue should have a remaining functionality of at least 50%, such as 60%, 70%, 80%, 90% or 100% compared to the functionality of amino acid sequence of SEQ ID NO: 1. The functional homologue can have a higher functionality compared to the functionality of amino acid sequence of SEQ ID NO: 1. The functional homologue of SEQ ID NO: 1, should be able to enhance HMO production of the genetically modified cell according to the invention.

    [0085] A Genetically Modified Cell

    [0086] A “genetically modified cell” as used herein is understood as a cell which has been transformed or transfected, by a heterologous polynucleotide sequence. In the present context, the terms a “genetically modified cell” and “a host cell” are used interchangeably.

    [0087] Accordingly, a “genetically modified cell” or “genetically modified cell” is in the present context understood as a host cell which has been transformed or transfected by an exogenous polynucleotide sequence.

    [0088] The genetically modified cell is preferably a prokaryotic cell. Appropriate microbial cells that may function as a host cell include yeast cells, bacterial cells, archaebacterial cells, algae cells, and fungal cells.

    [0089] Host Cell

    [0090] The genetically modified cell (host cell or recombinant cell) may be e.g. a bacterial or yeast cell. In one preferred embodiment, the genetically modified cell is a bacterial cell.

    [0091] Regarding the bacterial host cells, there are, in principle, no limitations; they may be eubacteria (gram-positive or gram-negative) or archaebacteria, as long as they allow genetic manipulation for insertion of a gene of interest and can be cultivated on a manufacturing scale. Preferably, the host cell has the property to allow cultivation to high cell densities. Non-limiting examples of bacterial host cells that are suitable for recombinant industrial production of an HMO(s) according to the invention could be Erwinia herbicola (Pantoea agglomerans), Citrobacter freundii, Pantoea citrea, Pectobacterium carotovorum, or Xanthomonas campestris. Bacteria of the genus Bacillus may also be used, including Bacillus subtilis, Bacillus licheniformis, Bacillus coagulans, Bacillus thermophilus, Bacillus laterosporus, Bacillus megaterium, Bacillus mycoides, Bacillus pumilus, Bacillus lentus, Bacillus cereus, and Bacillus circulans. Similarly, bacteria of the genera Lactobacillus and Lactococcus may be modified using the methods of this invention, including but not limited to Lactobacillus acidophilus, Lactobacillus salivarius, Lactobacillus plantarum, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus rhamnosus, Lactobacillus bulgaricus, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus jensenii, and Lactococcus lactis. Streptococcus thermophiles and Proprionibacterium freudenreichii are also suitable bacterial species for the invention described herein. Also included as part of this invention are strains, modified as described here, from the genera Enterococcus (e.g., Enterococcus faecium and Enterococcus thermophiles), Bifidobacterium (e.g., Bifidobacterium longum, Bifidobacterium infantis, and Bifidobacterium bifidum), Sporolactobacillus spp., Micromomospora spp., Micrococcus spp., Rhodococcus spp., and Pseudomonas (e.g., Pseudomonas fluorescens and Pseudomonas aeruginosa).

    [0092] Bacteria comprising the characteristics described herein are cultured in the presence of lactose, and an oligosaccharide, such as an HMO, produced by the cell is retrieved, either from the bacterium itself or from a culture supernatant of the bacterium. In one preferred embodiment, the genetically modified cell of the invention is an Escherichia coli cell.

    [0093] In another preferred embodiment the host cell is a yeast cell e.g. Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Kluveromyces lactis, Kluveromyces marxianus, etc.

    [0094] Genetically modified cells of the invention can be provided using standard methods of the art e.g. those described in the manuals by Sambrook et al., Wilson & Walker, “Maniatise et al., and Ausubel et al.

    [0095] A host suitable for the HMO production, e.g. E. coli, may comprise an endogenous β-galactosidase gene or an exogenous β-galactosidase gene, e.g. E. coli comprises an endogenous lacZ gene (e.g., GenBank Accession Number V00296 (GI:41901)). For the purposes of the invention, an HMO-producing host cell is genetically manipulated to either comprise any β-galactosidase gene or to comprise the gene that is inactivated. The gene may be inactivated by a complete or partial deletion of the corresponding nucleic acid sequence from the bacterial genome, or the gene sequence is mutated in the way that it is transcribed, or, if transcribed, the transcript is not translated or if translated to a protein (i.e. β-galactosidase), the protein does not have the corresponding enzymatic activity. In this way the HMO-producing bacterium accumulates an increased intracellular lactose pool which is beneficial for the production of HMOs.

    [0096] In some embodiments, the engineered cell, e.g. bacterium, contains a deficient sialic acid catabolic pathway. By “sialic acid catabolic pathway” is meant a sequence of reactions, usually controlled and catalyzed by enzymes, which results in the degradation of sialic acid. An exemplary sialic acid catabolic pathway described herein is the E. coli pathway. In this pathway, sialic acid (Neu5Ac; N-acetylneuraminic acid) is degraded by the enzymes NanA (N-acetylneuraminic acid lyase) and NanK (N-acetylmannosamine kinase) and NanE (N-acetylmannosamine-6-phosphate epimerase), all encoded from the nanATEK-yhcH operon, and repressed by NanR (http://ecocyc.org/ECOLI). A deficient sialic acid catabolic pathway is rendered in the E. coli host by introducing a mutation in the endogenous nanA (N-acetylneuraminate lyase) (e.g., GenBank Accession Number D00067.1(GL216588)) and/or nanK (N-acetylmannosamine kinase) genes (e.g., GenBank Accession Number (amino acid) BAE77265.1 (GL85676015)), and/or nanE (N-acetylmannosamine-6-phosphate epimerase, GI: 947745, incorporated herein by reference). Optionally, the nanT (N-acetylneuraminate transporter) gene is also inactivated or mutated. Other intermediates of sialic acid metabolism include: (ManNAc-6-P) N-acetylmannosamine-6-phosphate; (GlcNAc-6-P) N-acetylglucosamine-6-phosphate; (GlcN-6-P) Glucosamine-6-phosphate, and (Fruc-6-P) Fructose-6-phosphate. In some preferred embodiments, nanA is mutated. In other preferred embodiments, nanA and nanK are mutated, while nanE remains functional. In another preferred embodiment, nanA and nanE are mutated, while nanK has not been mutated, inactivated or deleted. A mutation is one or more changes in the nucleic acid sequence coding the gene product of nanA, nanK, nanE, and/or nanT. For example, the mutation may be 1, 2, up to 5, up to 10, up to 25, up to 50 or up to 100 changes in the nucleic acid sequence. For example, the nanA, nanK, nanE, and/or nanT genes are mutated by a null mutation. Null mutations as described herein encompass amino acid substitutions, additions, deletions, or insertions, which either cause a loss of function of the enzyme (i.e. reduced or no activity) or loss of the enzyme (i.e. no gene product). By “deleted” is meant that the coding region is removed completely or in part such that no (functional) gene product is produced. By inactivated is meant that the coding sequence has been altered such that the resulting gene product is functionally inactive or encodes for a gene product with less than 100%, e.g. 90%, 80%, 70%, 60%, 50%, 40%, 30% or 20% of the activity of the native, naturally occurring, endogenous gene product. A “not mutated” gene or protein does not differ from a native, naturally-occurring, or endogenous coding sequence by 1, 2, up to 5, up to 10, up to 20, up to 50, up to 100, up to 200 or up to 500 or more codons, or to the corresponding encoded amino acid sequence.

    [0097] Furthermore, the bacterium (e.g., E. coli) may also comprise a sialic acid synthetic capability. For example, the bacterium comprises a sialic acid synthetic capability through provision of an exogenous UDP-GlcNAc 2-epimerase (e.g., neuC of Campylobacter jejuni (GenBank AAK91727.1) or equivalent (e.g. (GenBank CAR04561.1), a Neu5Ac synthase (e.g., neuB of C. jejuni (GenBank AAK91726.1) or equivalent, (e.g. Flavobacterium limnosediminis sialic acid synthase, GenBank WP_023580510.1), and/or a CMP-Neu5Ac synthetase (e.g., neuA of C. jejuni (GenBank AAK91728.1) or equivalent, (e.g. Vibrio brasiliensis CMP-sialic acid synthase, GenBank WP_006881452.1).

    [0098] Production of neutral N-acetylglucosamine-containing HMOs in modified bacteria is also known in the art (see e.g. Gebus C et al. (2012) Carbohydrate Research 363 83-90).

    [0099] For the production of N-acetylglucosamine-containing HMOs, such as Lacto-N-triose 2 (LNT-2), Lacto-N-tetraose (LNT), Lacto-N-neotetraose (LNnT), Lacto-N-fucopentaose I (LNFP-I), Lacto-N-fucopentaose II (LNFP-II), Lacto-N-fucopentaose III (LNFP-III), Lacto-N-fucopentaose V (LNFP-V), Lacto-N-difucohexaose I (LDFH-I), Lacto-N-difucohexaose II (LDFH-II), and Lacto-N-neodifucohexaose II (LNDFH-III), as described above, and it is modified to comprise an exogenous UDP-GlcNAc:Galα/β-R β-3-N-acetylglucosaminyltransferase gene, or a functional variant or fragment thereof. This exogenous UDP-GlcNAc:Galα/β-R β-3-N-acetylglucosaminyltransferase gene may be obtained from any one of a number of sources, e.g., the IgtA gene described from N. meningitides (Genbank protein Accession AAF42258.1) or N. gonorrhoeae (Genbank protein Accession ACF31229.1). Optionally, an additional exogenous glycosyltransferase gene may be co-expressed in the bacterium comprising an exogenous UDP-GlcNAc:Galα/β-R β-3-N-acetylglucosaminyltransferase. For example, a β-1,4-galactosyltransferase gene is co-expressed with the UDP-GlcNAc:Galα/β-R β-3-N-acetylglucosaminyltransferase gene. This exogenous β-1,4-galactosyltransferase gene can be obtained from any one of a number of sources, e.g., the one described from N. meningitidis, the lgtB gene (Genbank protein Accession AAF42257.1), or from H. pylori, the HP0826/galT gene (Genbank protein Accession NP_207619.1). Optionally, the additional exogenous glycosyltransferase gene co-expressed in the bacterium comprising an exogenous UDP-GlcNAc:Galα/β-R β-3-N-acetylglucosaminyltransferase gene is a P-I,3-galactosyltransferase gene, e.g., that described from E. coli 055:H7, the wbgO gene (Genbank protein Accession WP_000582563.1), or from H. pylori, the jhp0563 gene (Genbank protein Accession AEZ55696.1), or from Streptococcus agalactiae type Ib OI2 the cpsIBJ gene (Genbank protein Accession AB050723). Functional variants and fragments of any of the enzymes described above are also encompassed by the disclosed invention.

    [0100] A N-acetylglucosaminyltransferase gene and/or a galactosyltransferase gene, can also be operably linked to a Pglp and be expressed from the corresponding genome-integrated cassette. In one embodiment, the gene that is genome integrated is a gene encoding for a galactosyltransferase, e.g. HP0826 gene encoding for the GaIT enzyme from H. pylori (Genbank protein Accession NP_207619.1); in another embodiment, the gene that is genome integrated is a gene encoding a β-1,3-N-acetylglucosaminyltransferase, e.g. IgtA gene from N. meningitidis (Genbank protein Accession AAF42258.1). In these embodiments, the second gene, i.e. a gene encoding a β-1,3-N-acetylglucosaminyltransferase or galactosyltransferase, correspondingly, may either be expressed from a genome-integrated or plasmid borne cassette. The second gene may optionally be expressed either under the control of a glp promoter or under the control of any other promoter suitable for the expression system, e.g. Plac.

    [0101] HMO producing host cells typically comprise a functional lacY and a dysfunctional lacZ gene.

    [0102] The HMOs produced by recombinant cells of the invention may be purified using a suitable procedure available in the art (e.g. such as described in WO2015188834, WO2017182965 or WO2017152918).

    [0103] Encoded Polypeptide Capable of Sugar Transportation

    [0104] Sugar transportation relates to the transport of a sugar, such as, but not limited to, an oligosaccharide, and in relation to the invention, influx and/or efflux transport of one/or more HMOs, from the cytoplasm or periplasm of a genetically modified cell to the production media and/or from the production media to the cytoplasm or periplasm of a genetically modified cell. Thus, a polypeptide expressed in the genetically modified cell, capable of transporting HMOs from the cytoplasm or periplasm to the production medium and/or from the production media to the cytoplasm or periplasm of a genetically modified cell is a polypeptide capable of sugar transportation. Thus, in the present invention, sugar transportation can mean efflux and/or influx transportation of sugar, such as, but not limited to, an oligosaccharide.

    [0105] In that regard, the polypeptide capable of sugar transportation is a polypeptide belonging to the Major Facilitator Superfamily (MFS). In particular, the polypeptide has at least 80%, such as at least 90%, such as at least 95%, such as at least 99%, sequence identity with SEQ ID NO:1 or it is a functional variant thereof as described herein. SEQ ID NO:1 is the amino acid sequence of the Bad protein.

    [0106] The genetically modified cell or the nucleic acid construct of the present invention comprises a nucleic acid sequence such as a heterologous gene encoding a Bad protein. Said nucleic acid sequence has at least 70% sequence identity to the bad gene as shown in SEQ ID No: 2, such as at least 75%, 80%, 85%, 90% or 99% A identity.

    [0107] The nucleic acid sequence construct encodes a protein of SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80%, such as at least 90% identical to SEQ ID NO: 1.

    [0108] A functional homologue of the protein of SEQ ID NO: 1, may be obtained by mutagenesis. The functional homologue should have a remaining functionality of at least 50%, such as 60%, 70%, 80%, 90% or 100% compared to the functionality of amino acid sequence of SEQ ID NO: 1. The functional homologue can have a higher functionality compared to the functionality of amino acid sequence of SEQ ID NO: 1. The functional homologue of SEQ ID NO: 1, should be able to enhance HMO production of the genetically modified cell according to the invention.

    [0109] The genetically modified cell or the nucleic acid construct may contain one or more nucleic acid sequences encoding the polypeptide capable of sugar transportation. More often, the genetically modified cell or the nucleic acid construct of the invention, encodes a single copy of a polypeptide capable of sugar transportation.

    [0110] A single copy of the expression cassette comprising a gene of interest may be sufficient to secure production of a desired HMO and achieve the desired effects according to the invention.

    [0111] Accordingly, in some preferred embodiments, the invention relates to a recombinant HMO producing cell that comprises one, two or three copies of a gene or genes of interest integrated in the genomic DNA of the cell. In some embodiments the single copy of the gene or genes is/are preferred.

    [0112] The genetically modified cell or the nucleic acid construct, may also contain one or more regulatory elements for the regulation of the expression of a nucleic acid sequence encoding the sugar transportation polypeptide and wherein said nucleic acid sequence has at least 70% sequence identity with SEQ ID NO: 2.

    [0113] Regulatory Element

    [0114] As mentioned above, the genetically modified cell or the nucleic acid construct may further comprise a nucleic acid sequence comprising a regulatory element for the regulation of the expression of the nucleic acid sequence having at least 70% sequence identity to SEQ ID NO: 2. The nucleic acid sequence of the regulatory region may be heterologous or homologous.

    [0115] The term, a “regulatory element” or “promoter” or “promoter region” or “promoter element” is a nucleic acid sequence that is recognized and bound by a DNA dependent RNA polymerase during initiation of transcription. The promoter, together with other transcriptional and translational regulatory nucleic acid sequences (also termed “control sequences”) is necessary to express a given gene or group of genes (an operon). In general, the transcriptional and translational regulatory sequences include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences. The “transcription start site” means the first nucleotide to be transcribed and is designated +1. Nucleotides downstream of the start site are numbered +2, +3, +4 etc., and nucleotides in the 5′ opposite (upstream) direction are numbered −1, −2, −3 etc. The promoter of the construct can derive from a promoter region of any gene encoded in the genome of a species. Preferably, a promoter region of the genomic DNA of E. coli. Accordingly, any promoter that is able to bind to an RNA polymerase and initiate transcription is suitable for practicing the invention. In principle, any promoter can be used to control transcription of the recombinant gene, such as the MFS transporter or the glycosyltransferases of the invention. In carrying out the invention, different or identical promoter sequences may be used to drive transcription of different genes of interest integrated in the genome of the host cell or in expression vector DNA. In one example promoter sequence A is promoting the expression of the MFS transporter, and another promoter sequence B or identical promoter sequence A is promoting the expression of the glycosyltransferase.

    [0116] To have an optimal expression of the recombinant genes included in the construct, the construct may comprise further regulatory sequences, e.g. a leading DNA sequence, such as a DNA sequence derived from 5′-untranslated region (5′UTR) of a glp gene of E. coli, a sequence for ribosomal binding. Examples of the later sequences are described in WO2019123324 (incorporated herein by reference) and are illustrated in non-limiting working examples herein.

    [0117] In one aspect of the invention, one or more regulatory elements may be inserted into to the DNA construct encoding the bad gene according to SEQ ID NO: 2 and/or into to the DNA construct encoding one or more glycosyltransferases, according to the invention. In another aspect of the invention, one or more copies of the bad gene according to SEQ ID NO: 2 may be inserted into the DNA construct, according to the invention. In yet another aspect of the invention, the bad gene according to SEQ ID NO: 2 may be inserted into one or more identical or non-identical DNA constructs, according to the invention.

    [0118] In one aspect of the invention, the regulatory element for the regulation of the expression of a recombinant gene included in the construct of the invention is glpFKX operon promoter, PglpF. In another aspect of the invention, the promoter is lac operon promoter, Plac. And in yet another aspect of the invention, the regulatory element is PglpF_SD4, which are modified version of the PglpF sequence comprising a modified ribosomal binding site sequence downstream of the promoter sequence. However, any promoter enabling transcription and/or regulation of the level of transcription, of one or more recombinant nucleic acids that encode one or more polypeptides according to the invention are suitable for practicing the invention.

    [0119] Typically, promoters for the expression of a heterologous gene according to the present invention are selected from table 2.

    TABLE-US-00002 TABLE 2 SEQ ID Promoter name Description Reference NO: PgatY_70UTR E. coli promoter for gatYZABCD; tagatose- NA 3 1,6-bisP aldolase PglpF E. coli promoter for glpFKX operon; glycerol WO2019123324 4 uptake PglpF_SD1 E. coli promoter for glpFKX operon; glycerol WO2019123324 uptake PglpF_SD10 E. coli promoter for glpFKX operon; glycerol WO2019123324 uptake PglpF_SD2 E. coli promoter for glpFKX operon; glycerol WO2019123324 uptake PglpF_SD3 E. coli promoter for glpFKX operon; glycerol WO2019123324 uptake PglpF_SD4 E. coli promoter for glpFKX operon; glycerol WO2019123324 5 uptake PglpF_SD5 E. coli promoter for glpFKX operon; glycerol WO2019123324 uptake PglpF_SD6 E. coli promoter for glpFKX operon; glycerol WO2019123324 uptake PglpF_SD7 E. coli promoter for glpFKX operon; glycerol WO2019123324 uptake PglpF_SD8 E. coli promoter for glpFKX operon; glycerol WO2019123324 uptake PglpF_SD9 E. coli promoter for glpFKX operon; glycerol WO2019123324 uptake Plac_16UTR E. coli promoter for lacZYA: lac operon WO2019123324 Plac E. coli promoter for lacZYA: lac operon WO2019123324 17 PmglB_70UTR E. coli promoter for mgIBAC; NA 6 galactose/methyl-galactosidade transporter PmglB_70UTR_ E. coli promoter for mgIBAC; NA 7 SD4 galactose/methyl-galactosidade transporter

    [0120] The preferred regulatory elements present in a genetically modified cell or in a nucleic acid construct of the present invention, is selected from the group consisting of PgatY_70UTR, PglpF, PglpF_SD1, PglpF_SD10, PglpF_SD2, PglpF_SD3, PglpF_SD4, PglpF_SD5, PglpF_SD6, PglpF_SD7, PglpF_SD8, PglpF_SD9, Plac_16UTR, Plac, PmglB_70UTR and PmglB_70UTR_SD4.

    [0121] Especially preferred regulatory elements present in a genetically modified cell or in a nucleic acid construct of the present invention, is selected from the group consisting of PglpF and PglpF_SD4.

    [0122] Genetically Modified Cells for Biosynthetic Production

    [0123] In the present invention, promoters may be either necessary or beneficial for achieving an optimal level of biosynthetic production of one or more HMOs in the genetically modified cell and allowing to achieve the desired effects according to the invention. Thus, a promoter sequence, of this invention, enables transcription and/or regulates the expression of a polypeptide capable of sugar transportation and/or the glycosyltransferases of the invention, resulting in optimized biosynthesis and transport of HMOs or HMO precursors and/or degradation of by-products of the HMO production.

    [0124] In the genetically modified cell of the invention, a nucleic acid construct is comprised in the genetically modified cell, that encodes at least one gene related to biosynthetic production of one or more HMOs, a promoter DNA sequence, and other regulatory sequences, such as a ribosomal binding site sequence (e.g. Shine-Dalgarno sequence). The expression of the gene or genes related to the biosynthetic production of one or more HMOs in a genetically modified cell, enables production of the HMOs, making the host cell a “suitable host cell” for carrying out the invention as described. In the genetically modified cell, the expression, of the gene or genes related to the biosynthetic production of HMOs, as mentioned above, enables the production of one or more HMOs at level of 0.03 g/l/OD (optical density) from 1 liter of fermentation media comprising a suspension of the genetically modified cell s. Thus, the HMO level could be approx. 0.05 g/l/OD to approx. 0.5 g/l/OD, such as at least 0.25-0.3 g/L/OD. For the purposes of the invention, the level of HMO production is regarded as “sufficient” and the genetically modified cell capable of producing this level of a desired HMO or mixture of HMOs is regarded as the suitable genetically modified cell for carrying out the invention.

    [0125] Thus, in. the light of the invention, the “suitable genetically modified cell ” can be further modified, as described above, to express the sugar polypeptide capable of sugar transportation of the MFS family, e.g. bad, to achieve an, in one way or another, advantageous HMO production, such as but not limited to, a higher HMO level pr biosynthetic production, a higher level of purity in the biosynthetic production, a faster production time and/or a more efficient biosynthetic production of HMOs.

    [0126] Method of Production

    [0127] A second aspect of the invention related to a method for the production of one or more HMOs, the method comprising the steps of: [0128] (i) providing a genetically modified cell capable of producing an HMO, wherein said cell comprises a recombinant nucleic acid encoding a protein of SEQ ID NO: 1, or a functional homologue thereof which amino acid sequence is at least 80%, such as at least 90% identical, preferably at least 95% identical, more preferably at least 99% identical to SEQ ID NO: 1; [0129] (ii) culturing the cell of (i) in a suitable cell culture medium to allow the HMO production and expression of the DNA sequence to produce the protein having the amino acid sequence of SEQ ID NO: 1, or a functional thereof which amino acid sequence is at least 80%, such as at least 90% identical, preferably at least 95% identical, more preferably at least 99% identical to SEQ ID NO: 1; [0130] (iii) harvesting the HMOs produced in step (ii).

    [0131] According to the invention, the term “culturing” (or “cultivating” or “cultivation”, also termed “fermentation”) relates to the propagation of bacterial expression cells in a controlled bioreactor according to methods known in the industry.

    [0132] To produce one or more HMOs, the HMO-producing bacteria as described herein are cultivated according to the procedures known in the art in the presence of a suitable carbon source, e.g. glucose, glycerol, lactose, etc., and the produced HMO is harvested from the cultivation media and the microbial biomass formed during the cultivation process. Thereafter, the HMOs are purified according to the procedures known in the art, e.g. such as described in WO2015188834, WO2017182965 or WO2017152918, and the purified HMOs are used as nutraceuticals, pharmaceuticals, or for any other purpose, e.g. for research.

    [0133] Manufacturing of HMOs is typically accomplished by performing cultivation in larger volumes. The term “manufacturing” and “manufacturing scale” in the meaning of the invention defines a fermentation with a minimum volume of 5 L culture broth. Usually, a “manufacturing scale” process is defined by being capable of processing large volumes of a preparation containing the product of interest and yielding amounts of the protein of interest that meet, e.g. in the case of a therapeutic compound or composition, the demands for clinical trials as well as for market supply. In addition to the large volume, a manufacturing scale method, as opposed to simple lab scale methods like shake flask cultivation, is characterized by the use of the technical system of a bioreactor (fermenter) which is equipped with devices for agitation, aeration, nutrient feeding, monitoring and control of process parameters (pH, temperature, dissolved oxygen tension, back pressure, etc.). To a large extent, the behavior of an expression system in a lab scale method, such as shake flasks, benchtop bioreactors or the deep well format described in the examples of the disclosure, does allow to predict the behavior of that system in the complex environment of a bioreactor.

    [0134] With regard to the suitable cell medium used in the fermentation process, there are no limitations. The culture medium may be semi-defined, i.e. containing complex media compounds (e.g. yeast extract, soy peptone, casamino acids, etc.), or it may be chemically defined, without any complex compounds.

    [0135] By the term “one or more HMOs” is meant that an HMO production cell may be able to produce a single HMO structure (a first HMO) or multiple HMO structures (a second, a third, etc. HMO). In some embodiments, it may be preferred a genetically modified cell that produces a single HMO, in other preferred embodiments, a genetically modified cell producing multiple HMO structures may be preferred. Non-limiting examples for genetically modified cell s producing single HMO structures are 2′-FL, 3-FL, 3′-SL, 6′-SL or LNT-2 producing cells. Non-limiting examples of genetically modified cells capable of producing multiple HMO structures can be DFL, FSL, LNT LNnT, LNFP I, LNFP II, LNFP III, LNFP IV, LNFP V, pLNnH, pLNH2 producing cells.

    [0136] In particular, the present invention relates to genetically modified cells producing one or more of the single HMO structures which are selected from the group consisting of 2′-FL, 3-FL and DFL producing cells.

    [0137] The term “harvesting” in the context in the invention relates to collecting the produced HMO(s) following the termination of fermentation. In different embodiments it may include collecting the HMO(s) included in both the biomass (i.e. the genetically modified cell s) and cultivation media, i.e. before/without separation of the fermentation broth from the biomass. In other embodiments the produced HMOs may be collected separately from the biomass and fermentation broth, i.e. after/following the separation of biomass from cultivation media (i.e. fermentation broth). The separation of cells from the medium can be carried out with any of the methods well known to the skilled person in the art, such as any suitable type of centrifugation or filtration. The separation of cells from the medium can follow immediately after harvesting the fermentation broth or be carried out at a later stage after storing the fermentation broth at appropriate conditions. Recovery of the produced HMO(s) from the remaining biomass (or total fermentation) include extraction thereof from the biomass (the production cells). It can be done by any suitable methods of the art, e.g. by sonication, boiling, homogenization, enzymatic lysis using lysozyme, or freezing and grinding.

    [0138] After recovery from fermentation, HMO(s) are available for further processing and purification. Purification of HMOs produced by fermentation can be done using a suitable procedure described in WO2016095924, WO2015188834, WO2017152918, WO2017182965, US20190119314 (all incorporated by reference).

    [0139] In some embodiments of the invention, a genetically modified cell may produce several HMOs, wherein one HMO is the “product” HMO and some/all the other HMOs are “by-product” HMOs. Typically, by-product HMOs are either the major HMO precursors or products of further modification of the major HMO. In some embodiments, it may be desired to produce the product HMO in abundant amounts and by-product HMOs in minor amounts. Cells and methods for HMO production described herein allow for controlled production of an HMO product with a defined HMO profile, e.g. in one embodiment, the produced HMO mixture wherein the product HMO is a dominating HMO compared to the other HMOs (i.e. by-product HMOs) of the mixture, i.e. the product HMO is produced in higher amounts than other by-product HMOs; in other embodiments, the cell producing the same HMO mixture may be tuned to produce one or more by-product HMOs in higher amount than product HMO. For example, during the production of 2′-FL, the product HMO, often a significant amount of DFL, the by-product HMO, is produced. With the genetically modified cells of the present invention the level of DFL in the 2′-FL product can be significantly reduced.

    [0140] Advantageously, the invention provides both a decreased ratio of by-product to product and an increased overall yield of the product (and/or HMOs in total). This, less by-product formation in relation to product formation facilitates an elevated product production and increases efficiency of both the production and product recovery process, providing superior manufacturing procedure of HMOs.

    [0141] In different preferred embodiments, different genetically modified cells producing 2′-FL, 3-FL, DFL and/or LNT, as the product or by-product HMO, may be selected. In one preferred embodiment, the product is 3-FL. In another preferred embodiment, the product is 2′-FL and by-product is DFL. In another preferred embodiment, the product is LNT-2, and by-products are LNT and LNFP I.

    [0142] Preferred HMO products of the invention as described are 2′-FL and 3-FL.

    [0143] Use

    [0144] The present invention also related to the use of a host cell as described herein for use in the production of one or more Human Milk Oligosaccharides (HMOs). In particular, the invention relates to the use of a host cell as described herein for the production of a specific HMO, wherein the host cell is selected with the aim of generating a majority of one specific HMO, preferably selected from 2′-FL and 3-FL.

    [0145] General

    [0146] It should be understood that any feature and/or aspect discussed above in connections with the described invention apply by analogy to the methods described herein.

    [0147] The following figures and examples are provided below to illustrate the present invention. They are intended to be illustrative and are not to be construed as limiting in any way.

    EXAMPLES

    [0148] Materials and Methods

    [0149] Unless otherwise noted, standard techniques, vectors, control sequence elements, and other expression system elements known in the field of molecular biology are used for nucleic acid manipulation, transformation, and expression. Such standard techniques, vectors, and elements can be found, for example, in: Ausubel et al. (eds.), Current Protocols in Molecular Biology (1995) (John Wiley & Sons); Sambrook, Fritsch, & Maniatis (eds.), Molecular Cloning (1989) (Cold Spring Harbor Laboratory Press, NY); Berger & Kimmel, Methods in Enzymology 152: Guide to Molecular Cloning Techniques (1987) (Academic Press); Bukhari et al. (eds.), DNA Insertion Elements, Plasmids and Episomes (1977) (Cold Spring Harbor Laboratory Press, NY); Miller, J. H. Experiments in molecular genetics (1972.) (Cold spring Harbor Laboratory Press, NY)

    [0150] The embodiments described below are selected to illustrate the invention and are not limiting the invention in any way.

    [0151] Strains utilized in the present Examples are described in the following table 3.

    TABLE-US-00003 TABLE 3 Strain IDs Product Relevant Genotype DH1 — F.sup.− λ.sup.− endA1 recA1 relA1 gyrA96 thi-1 glnV44 hsdR17(r.sub.K.sup. m.sub.K.sup.) MDO — E coli DH1 ΔlacZ, ΔlacA, ΔnanKETA, ΔmelA, ΔwcaJ, ΔmdoH wcaF::Plac Strain 1 3-FL MDO PglpF-CA PglpF-futA Δlacl Strain 2 MDO PglpF-CA PglpF-futA Δlacl PglpF-bad Strain 3 2-FL MDO PglpF-CA PglpF-futC Δlacl Strain 4 MDO PglpF-CA PglpF-futC Δlacl PglpF_SD4-bad MP3672 LNnT MDO PglpF-GIcNAcT PglpF-Gal4T (version 1)* MP3708 MDO PglpF-GIcNAcT PglpF-Gal4T Plac-yberC0001_9420 MP3972 MDO PglpF-GIcNAcT PglpF-Gal4T Plac-bad MP3979 MDO PglpF-GIcNAcT PglpF-Gal4T Plac-fred MP4011 MDO PglpF-GIcNAcT PglpF-Gal4T Plac-marc MP3994 MDO PglpF-GIcNAcT PglpF-Gal4T Plac-vag (version 1)** MP3984 MDO PglpF-GIcNAcT PglpF-Gal4T Plac-nec MP4362 MDO PglpF-GIcNAcT PglpF-Gal4T Plac-yabM MP3020 MDO PglpF-GIcNAcT PglpF-Gal4T(version 2)* MP4064 MDO PglpF-GIcNAcT PglpF-Gal4T PglpF-vag MP4065 MDO PglpF-GIcNAcT PglpF-Gal4T Plac-vag (version 2)** MP4473 LNT MDO PglpF-GIcNAcT PglpF-Gal3T MP4546 MDO PglpF-GIcNAcT PglpF-Gal3T PglpF-vag CA = gmd-wcaG-wcaH-wcal-manC-manB *Strains MP3672 and MP3020 bear the same heterologous GIcNAcT and Gal4T, but differ in the copy number of the corresponding GIcNAcT-encoding gene **Strains MP3994 and MP4065 bear the same heterologous GIcNAcT and Gal4T, but differ in the copy number of the corresponding GIcNAcT-encoding gene

    [0152] Cultivation

    [0153] Unless otherwise noted, E. coli strains were propagated in Basal Minimal medium containing 0.2% glucose (in Luria-Bertani (LB) medium containing 0.2% glucose in experiment 3) at 37° C. with agitation. Agar plates were incubated at 37° C. overnight.

    [0154] Basal Minimal medium had the following composition: NaOH (1 g/L), KOH (2.5 g/L), KH.sub.2PO.sub.4 (7 g/L), NH.sub.4H.sub.2PO.sub.4 (7 g/L), Citric acid (0.5 g/l), Trace mineral solution (5 mL/L). The trace mineral stock solution contained: ZnSO.sub.4*7H.sub.20 0.82 g/L, Citric acid 20 g/L, MnSO.sub.4*H.sub.2O 0.98 g/L, FeSO.sub.4*7H.sub.2O 3.925 g/L, CuSO.sub.4*5H.sub.2O 0.2 g/L. The pH of the Basal Minimal Medium was adjusted to 7.0 with 5 N NaOH and autoclaved. Before inoculation, the Basal Minimal medium was supplied with 1 mM MgSO.sub.4, 4 pg/mL thiamine, 0.5% of a given carbon source (glycerol (Carbosynth)).

    [0155] Thiamine, and antibiotics, were sterilized by filtration. All percentage concentrations for glycerol are expressed as v/v and for glucose as w/v.

    [0156] Chemical Competent Cells and Transformations

    [0157] E. coli was inoculated from LB plates in 5 mL LB containing 0.2% glucose at 37° C. with shaking until OD600 ˜0.4. 2 mL culture was harvested by centrifugation for 25 seconds at 13.000 g. The supernatant was removed, and the cell pellet resuspended in 600 μL cold TB solutions (10 mM PIPES, 15 mM CaCl2, 250 mM KCl). The cells were incubated on ice for 20 minutes followed by pelleting for 15 seconds at 13.000 g. The supernatant was removed, and the cell pellet resuspended in 100 μL cold TB solution. Transformation of plasmids were done using 100 μL competent cells and 1 to 10 ng plasmid DNA. Cells and DNA were incubated on ice for 20 minutes before heat shocking at 42° C. for 45 seconds. After 2 min incubation on ice 400 μL SOC (20 g/L tryptone, 5 g/L Yeast extract, 0.5 g/L NaCl, 0.186 g/L KCl, 10 mM MgCl2, 10 mM MgSO4 and 20 mM glucose) was added and the cell culture was incubated at 37° C. with shaking for 1 hour before plating on selective plates.

    [0158] Plasmid were transformed into TOP10 chemical competent cells at conditions recommended by the supplier (ThermoFisher Scientific).

    [0159] DNA Techniques

    [0160] Plasmid DNA from E. coli was isolated using the QIAprep Spin Miniprep kit (Qiagen). Chromosomal DNA from E. coli was isolated using the QIAmp DNA Mini Kit (Qiagen). PCR products were purified using the QIAquick PCR Purification Kit (Qiagen). DreamTaq PCR Master Mix (Thermofisher), Phusion U hot start PCR master mix (Thermofisher), USER Enzym (New England Biolab) were used as recommended by the supplier. Primers were supplied by Eurofins Genomics, Germany. PCR fragments and plasmids were sequenced by Eurofins Genomics. Colony PCR was done using DreamTaq PCR Master Mix in a T100™ Thermal Cycler (Bio-Rad).

    [0161] The heterologous proteins expressed in the genetically modified HMO producing cells of this invention is described in table 4, the promoter elements which was used in the below exemplifications of the invention is described in table 5, and the oligos used for amplification of plasmid backbones, promoter, elements, and bad is described in table 6.

    TABLE-US-00004 TABLE 4 The heterologous proteins expressed in the genetically modified HMO producing cells Protein Accession Gene Origin of Genes Number Protein Function futC Helicobacter pylori WP_080473865.1 a-1,2-fucosyl-transferase 26695 futA Helicobacter pylori WP_000487428.1 a-1,3-fucosyl-transferase 26695 bad Rouxiella badensis WP_087817556.1 MFS transporter yberC0001_9420 Yersinia bercovieri EEQ08298.1 Major facilitator superfamily MFS_1 fred* Yersinia frederiksenii WP_087817556.1 MFS transporter nec* Rosenbergiella nectarea WP_092672081.1 MFS transporter marc* Serratia marcescens WP_060448169.1 MFS transporter vag* Pantoea vagans WP_048785139.1 MFS transporter yabM Erwinia pyrifoliae CAY73138.1 Putative MFS sugar efflux transporter *the gene name is given to identify the nucleic acid encoding the protein having amino acid sequence of the corresponding GenBank Accession Number for the purposes of the present invention.

    TABLE-US-00005 TABLE 5 The synthetic DNA elements utilized for expression of bad. Sequence SEQ name ID NO Sequence (5′-3′) Description PglpF 4 GCGGCACGCCTTGCAGATTACGGTTTGC 300-nucleotide CACACTTTTCATCCTTCTCCTGGTGACAT DNA expression AATCCACATCAATCGAAAATGTTAATAAAT element TTGTTGCGCGAATGATCTAACAAACATGC ATCATGTACAATCAGATGGAATAAATGGC GCGATAACGCTCATTTTATGACGAGGCAC ACACATTTTAAGTTCGATATTTCTCGTTTT TGCTCGTTAACGATAAGTTTACAGCATGC CTACAAGCATCGTGGAGGTCCGTGACTTT CACGCATACAACAAACATTAACCAAGGAG GAAACAGCT PglpF_SD4 5 GCGGCACGCCTTGCAGATTACGGTTTGC 300-nucleotide CACACTTTTCATCCTTCTCCTGGTGACAT DNA expression AATCCACATCAATCGAAAATGTTAATAAAT element TTGTTGCGCGAATGATCTAACAAACATGC ATCATGTACAATCAGATGGAATAAATGGC GCGATAACGCTCATTTTATGACGAGGCAC ACACATTTTAAGTTCGATATTTCTCGTTTT TGCTCGTTAACGATAAGTTTACAGCATGC CTACAAGCATCGTGGAGGTCCGTGACTTT CACGCATACAACAAACATTAACCAACTAG GAAACAGCT bad 2 ATGAGCAGCCGTCGTCTGAGCATCATTTT DNA encoding CGCGACCTTTCTGCTGGTTAGCTTCCTGA MFS transporter CCGGTATTGCGGGTGCGCTGCAGGCGC CGACCCTGAGCCTGTTTCTGACCAACGA GGTTAAAGTGCGTCCGCTGTGGGTTGGT CTGTTCTACACCGTGAACGCGCTGGGTG GCATCGTTATTAGCTTTCTGCTGGCGAAC TATAGCGACAAGAAAGGTGATCGTCGTAA ACTGCTGTTCTTTTGCACCCTGATGGCGA TCGGCAACAGCCTGATTTTCGCGTACAG CCGTGACTATCTGGTGCTGATCAGCGTT GGTGTGCTGCTGGCGGCGATTGGCAACG CGAGCATGCCGCAGCTGTTTGCGCTGGC GCGTGAGTACGCGGATCGTAGCGCGCAC GAAGTGGTTATGTTTAGCAGCATGATGCG TGCGACCCTGAGCCTGGCGTGGGTTCTG GGTCCGCCGATCAGCTTCACCCTGGCGC TGAACTACGGTTTTACCCTGATGTATCTG TGCGCGGCGGGCGTGTTCATCTTTAGCG CGCTGATGGTTTGGTTCTTTCTGCCGAGC GTGGGCCGTATTGAACAACCGGTTGACA AGGTGGTTGTGCACGTGAGCGCGTGGAA AAACCGTGATGTTCGTCTGCTGTTCTTTG CGAGCCTGCTGATGTGGACCTGCAACAT CATGTACATCATTGACATGCCGCTGTATA TTACCAGCGATCTGGGTCTGCCGGAGGG TCTGGCGGGCCTGCTGATGGGTGCTGCG GCGGGCCTGGAAATCCCGGTTATGCTGA TTGCGGGTTACCTGGTGAAGCGTACCGG CAAACGTCGTCTGATGCTGTGCGCGGCG GTTTTCGGTATCCTGTTTTATCTGGGCCT GGTGCTGTTCCAGTTTAAGGCGGCGCTG ATGATCCTGCAACTGTTCAACGCGATCTT TATTGGTATCATTGCGGGTATTGGCATGC TGTATTTCCAGGACCTGATGCCGGGTCG TGCGGGCAGCGCGACCACCCTGTTTACC AACAGCATCAGCACCGGCGCGATTCTGG CGGGTGTTATCCAGGGCACCATTGTGCA AAACTTCGGTCACTACCAAGTGTATTGGA TGGCGCTGGCGCTGGCGGTTGGTGCGC TGGTGCTGATGACCCGTGTTAAAAACGTG TAA Plac 17 ATGCGCAAATTGTGAGTTAGCTCACTCATTAG 195-nucleotide GCACCCCAGGCTTTACACTTTATGCTTCCGGC DNA expression TCGTATGTTGTGTGGAATTGTGAGCGGATAAC element AATTTCACACAGGAAACAGCTATGACCATGAT TACGCCAAGCGCGCAATTAACCCTCACTAAAG GGAACAAAAGCTGGGTACCTAAGGAGGAAAC AGCT

    TABLE-US-00006 TABLE 6 Oligos used for amplification of plasmid backbones, promoter, elements, and bad. SEQ Name ID NO Oligonucleotide Sequence 5′-3′ Description O40 8 ATTAACCCUCCAGGCATCAAATAAAACGAAA Backbone.for GGC O79 9 ATTTGCGCAUCACCAATCAAATTCACGCGGC Backbone.rev C O261 10 ATGCGCAAAUGCGGCACGCCTTGCAGATTA PglpF.for CG O262 11 AGCTGTTUCCTCCTTGGTTAATGTTTGTTGT PglpF.rev ATGCG O459 12 AGCTGTTUCCTAGTTGGTTAATGTTTGTTGT PglpF_SD4 ATGCG KABY729 13 AAACAGCUATGAGCAGCCGTCGTCTGAGC bad.for KABY730 14 AGGGTTAAUTTACACGTTTTTAACACGGGTC bad.rev ATCAG O48 15 CCCAGCGAGACCTGACCGCAGAAC galK.for O49 16 CCCCAGTCCATCAGCGTGACTACC galK.rev O68 18 ATGCGCAAAUTGTGAGTTAGCTCACTCATTA Plac.for G O113 19 AGCTGTTUCCTCCTTAGGTACCCAGCTTTTG Plac.rev TTCCC KABY745 20 AAACAGCUATGAAGAGCCTGCTGACCCGTA vag.for AAC KABY746 21 AGGGTTAAUTTAAACGTTTTTCACACGCGCG vag.rev KABY721 22 AAACAGCUATGAAGAGCGCGCTGACCTTTA yberC0001_9420.for GC KABY722 23 AGGGTTAAUTTACGCCTCACGCACACGCG yberC0001_9420.rev KABY733 24 AAACAGCUATGAAGAGCGCGCTGACCTTCA fred.for G KABY734 25 AGGGTTAAUTTACGCTTCACGCACACGCG fred. rev KABY741 26 AAACAGCUATGCAGAGCTTCACCCCGCC nec.for KABY742 27 AGGGTTAAUTTACGCCTGCTCTTTAACACGC nec.rev AGC KABY737 28 AAACAGCUATGCAGCGTCTGAGCCGTCTGA marc.for G KABY738 29 AGGGTTAAUTTAAACTTCACGCACTTTCGCG marc.rev C MP1217 30 AAACAGCUATGAAGGCGCTGTGGAGCCGTC yabM.for G MP1218 31 AGGGTTAAUCGCCAGCGGAACGCTCTTCAC yabM.rev G

    [0162] Construction of Plasmids

    [0163] Plasmid backbones containing two I-SceI endonuclease sites, separated by two DNA fragments appropriated for homologous recombination into the E. coli genome and a T1 transcriptional terminator sequence were synthesized. For example, in one plasmid backbone (pUC57::gal) the gal operon (required for homologous recombination in galK), and a T1 transcriptional terminator sequence was synthesized (GeneScript). The DNA sequences used for homologous recombination in the gal operon covered base pairs 3.628.621-3.628.720 and 3.627.572-3.627.671 in sequence Escherichia coli K-12 MG155 complete genome GenBank: ID: CP014225.1. Insertion by homologous recombination would result in a deletion of 949 base pairs of galK and a galK-phenotype. In similar ways backbones based on pUC57 (GeneScript) or an any other appropriated vector containing two I-SceI endonuclease sites, separated by two DNA fragments appropriated for homologous recombination into the E. coli genome and a T1 transcriptional terminator sequence could be synthesized. Standard techniques well-known in the field of molecular biology were used for designing of primers and amplification of specific DNA sequences of the Escherichia coli K-12 DH1 chromosomal DNA. Such standard techniques, vectors, and elements can be found, for example, in: Ausubel et al. (eds.), Current Protocols in Molecular Biology (1995) (John Wiley & Sons); Sambrook, Fritsch, & Maniatis (eds.), Molecular Cloning (1989) (Cold Spring Harbor Laboratory Press, NY); Berger & Kimmel, Methods in Enzymology 152: Guide to Molecular Cloning Techniques (1987) (Academic Press); Bukhari et al. (eds.).

    [0164] Chromosomal DNA obtained from E. coli DH1 was used to amplify a 300 bp DNA fragment containing the promoter PglpF using oligos O261 and O262, or PglpF_SD4 using oligos O261 and O459,

    [0165] A 1.182 bp DNA fragment containing a codon optimized version of the bad gene, SEQ ID NO: 2, originating from Rouxiella badensis was synthesized by Genescript (Table 5). The bad gene was amplified using oligos KABY729, SEQ ID NO: 13 and KABY730, SEQ ID NO: 14.

    [0166] All PCR fragments (plasmid backbones, promoter containing elements and the bad gene) were purified, and plasmid backbones, promoter elements (PglpF and PglpF_SD4), and a bad containing DNA fragment were assembled. The plasmids were cloned by standard USER cloning. Cloning in any appropriated plasmid could be done using any standard DNA cloning techniques. The plasmids were transformed into TOP10 cells and selected on LB plates containing 100 μg/mL ampicillin (or any appropriated antibiotic) and 0.2% glucose. The constructed plasmids were purified and the promoter sequence and the 5′end of the bad gene was verified by DNA sequencing (MWG Eurofins Genomics). In this way, a genetic cassette containing any promoter of interest linked to the bad gene was constructed.

    [0167] Construction of Strains

    [0168] The bacterial strain used, MDO, was constructed from Escherichia coli K-12 DH1. The E. coli K-12 DH1 genotype is: F.sup.−, λ−, gyrA96, recA1, relA1, endA1, thi-1, hsdR17, supE44. In addition to the E. coli K-12 DH1 genotype MDO has the following modifications: lacZ: deletion of 1.5 kbp, lacA: deletion of 0.5 kbp, nanKETA: deletion of 3.3 kbp, melA: deletion of 0.9 kbp, wcaJ: deletion of 0.5 kbp, mdoH: deletion of 0.5 kbp, and insertion of Plac promoter upstream of the gmd gene.

    [0169] Insertion of an expression cassette containing a promoter linked to the bad gene and to a T1 transcriptional terminator sequence in the chromosomal DNA of E. coli K-12 DH1 MDO was performed by Gene Gorging essentially as described by Herring et al. (Herring, C. D., Glasner, J. D. and Blattner, F. R. (2003). Gene (311). 153-163). Briefly, the donor plasmid and the helper plasmid were co-transformed into MDO and selected on LB plates containing 0.2% glucose, ampicillin (100 μg/mL) or kanamycin (50 mg/mL) and chloramphenicol (20 μg/mL). A single colony was inoculated in 1 mL LB containing chloramphenicol (20 μg/mL) and 10 μL of 20% L-arabinose and incubated at 37° C. with shaking for 7 to 8 hours. For integration in the galK loci of E. coli cells were then plated on M9-DOG plates and incubated at 37° C. for 48 hours. Single colonies formed on MM-DOG plates were re-streaked on LB plates containing 0.2% glucose and incubated for 24 hours at 37° C. Colonies that appeared white on MacConkey-galactose agar plates and were sensitive for both ampicillin and chloramphenicol were expected to have lost the donor and the helper plasmid and contain an insertion in the galK loci. Insertions in the galK site was identified by colony PCR using primers O48 (SEQ ID NO: 15) and O49 (SEQ ID NO: 16) and the inserted DNA was verified by sequencing (Eurofins Genomics, Germany).

    [0170] Insertion of genetic cassettes at other loci in the E. coli chromosomal DNA was done in a similar way using different selection marker genes and different screening methods.

    [0171] Deep Well Assay

    [0172] The deep well assay was performed as originally described to Lv et al (Bioprocess Biosyst Eng (2016) 39:1737-1747) and optimized for the purposes of the current invention.

    [0173] More specifically, the strains disclosed in the examples were screened in 24 deep well plates using a 4-day protocol. During the first 24 hours, shaker culture cells were grown at 34° C. with 700 rpm shaking, to high densities while in the next 48 hours cells were transferred to a medium that allowed induction of gene expression and product formation. Specifically, during day 1 fresh inoculums were prepared using a basal minimal medium supplemented with magnesium sulphate, thiamine and glucose. After 24 hours of incubation, cells were transferred to a new basal minimal medium (2 ml) supplemented with magnesium sulphate and thiamine with addition of an initial bolus consisting of 20% glucose solution (1 μl) and 10% lactose solution (0.1 ml) were added, then 50% sucrose solution (0.04 ml) as carbon source was provided to the cells accompanied by the addition of sucrose hydrolase (invertase, 5 μl of a 0.1 g/L solution) so that glucose was provided at a slow rate for growth by cleavage of sucrose by the invertase. After inoculation of the new medium, cells were shaken at 700 rpm at 28° C. for 48 hours. After denaturation and subsequent centrifugation, the supernatants were analysed by HPLC. For the analysis of total samples, the cell lysate prepared by boiling was pelleted by centrifugation for 10 minutes at 4.700 rpm. The HMO concentration in the supernatant was determined by HPLC or HPAC methods.

    Example 1—Production of 3-FL

    [0174] Engineering of Escherichia coli for 3-FL Production Expressing the Bad Gene

    [0175] The Escherichia coli K-12 (DH1) MDO) strain can be manipulated to express heterologous genes of interest. For instance, Strain 1 is a 3-FL producing strain overexpressing the α1,3-fucosyltransferase gene, futA, and the colonic acid genes (gmd-wcaG-wcaH-wcaI-manC-manB). Insertion of an expression cassette containing a promoter element (PglpF) linked to bad in a single copy into the Strain 1 background resulted in Strain 2. Results from deep-well assays showed that expression of the bad gene using PglpF increase the 3-FL production by 1.4-fold (40% increase in the total 3-FL production (fig.1). Expression of the bad gene does not affect the supernatant-to-pellet distribution of 3-FL (fig.2).

    Example 2—Production of 2′-FL

    [0176] Engineering of Escherichia coli for 2′-FL Production Expressing the Bad Gene

    [0177] The Escherichia coli K-12 (DH1) MDO) strain can be manipulated to express heterologous genes of interest. For instance, Strain 3 is a 2′-FL producing strain overexpressing the α1,2-fucosyltransferase gene, futC, and the colonic acid genes (gmd-wcaG-wcaH-wcaI-manC-manB). Insertion of an expression cassette containing a promoter element (PglpF_SD4) linked to bad in a single copy into the Strain 3 background resulted in Strain 4. Results from deep-well assays showed that expression of the bad gene using PglpF_SD4 increase the 2′-FL production by 1.7-fold (70% increase in the total 2′-FL production (fig.3)). Expression of the bad gene improves the product distribution by decreasing the intracellular 2′-FL concentration and increasing the product outside the cells (fig.4).

    [0178] Summary of Examples 1-2

    [0179] Chromosomal insertion of a single-copy promoter-bad construct in a 2′-FL or 3-FL production strain increased the total production of HMO significantly. Chromosomal expression of bad in a 2′-FL production strain decreased the amount of HMO inside the cells (pellet fraction).

    [0180] Hence, export of HMOs by the Major facilitator superfamily protein bad increase the HMO production capacity of the production strains

    TABLE-US-00007 TABLE 7 ID of new strain Background expressing HMO Reduction of Strain* bad HMO production HMO in pellet Strain 1 Strain 2 3-FL 140% no Strain 3 Strain 4 2′-FL 170% yes *Strain background for HMO production

    Example 3—The Vag Transporter is a Novel LNT-2-Core Transporter with High Selectivity for LNnT

    [0181]

    TABLE-US-00008 TABLE 8 Examples of helper and donor plasmids used for strain construction Plasmid Relevant genotype Marker gene pACBSR Para-I-Scel-A Red, p15A ori, cam* cam pUC57 pMB1, bla bla pUC57:gal pUC57::galTK′/ T1-galKM′ bla

    [0182] DNA sequences of heterologous genes coding for transporters or glycosyltransferases of interest were codon optimized and synthesized by GenScript. The genes of interest encoding for the transporter proteins as shown in Table 4 were amplified by PCR using appropriated primers covering the start codon, ATG, and the stop codon, TAA, of the gene (Table 3). To construct donor plasmids with any heterologous gene of interest, standard USER cloning was employed to combine the purified PCR fragments of the relevant plasmid backbone, promoter element and gene of interest. Cloning in an appropriated plasmid could be done using any standard DNA cloning technique. Following cloning the DNA was transformed into TOP10 cells and selected on LB plates containing 100 μg/mL ampicillin (or 50 mg/mL kanamycin depending on the backbone applied) and 0.2% glucose. The constructed plasmids were purified, and the promoter sequence and the 5′end of the gene of interest were verified by DNA sequencing (MWG Eurofins Genomics).

    [0183] Construction of Strains

    [0184] The bacterial strain used, MDO, was constructed from Escherichia coli K-12 DH1. The E. coli K-12 DH1 genotype is: F.sup.−, λ.sup.−, gyrA96, recA1, relA1, endA1, thi-1, hsdR17, supE44. In addition to the E. coli K-12 DH1 genotype MDO has the following modifications: lacZ: deletion of 1.5 kbp, lacA: deletion of 0.5 kbp, nanKETA: deletion of 3.3 kbp, melA: deletion of 0.9 kbp, wcaJ: deletion of 0.5 kbp, mdoH: deletion of 0.5 kbp, and insertion of Plac promoter upstream of the gmd gene.

    [0185] Insertion of an expression cassette containing a promoter linked to the vag gene and to a T1 transcriptional terminator sequence was performed by Gene Gorging essentially as described by Herring et al (Herring, C. D., Glasner, J. D. and Blattner, F. R. (2003). Gene (311). 153-163), and example of helper and donor plasmids used to construct strains presented in the present application are provided in Table 6. Briefly, the donor plasmid and the helper plasmid were co-transformed into MDO and selected on LB plates containing 0.2% glucose, ampicillin (100 μg/mL) or kanamycin (50 mg/mL) and chloramphenicol (20 μg/mL). A single colony was inoculated in 1 mL LB containing chloramphenicol (20 μg/mL) and 10 μL of 20% L-arabinose and incubated at 37° C. with shaking for 7 to 8 hours. For integration in the galK loci of E. coli cells were then plated on M9-DOG plates and incubated at 37° C. for 48 hours. Single colonies formed on MM-DOG plates were re-streaked on LB plates containing 0.2% glucose and incubated for 24 hours at 37° C. Colonies that appeared white on MacConkey-galactose agar plates and were sensitive for both ampicillin and chloramphenicol were expected to have lost the donor and the helper plasmid and contain an insertion in the galK loci. Insertions in the galK site was identified by colony PCR using primers O48 (SEQ ID NO: 15) and O49 (SEQ ID NO: 16) and the inserted DNA was verified by sequencing (Eurofins Genomics, Germany).

    [0186] Insertion of genetic cassettes at other loci in the E. coli chromosomal DNA was done in a similar way using different selection marker genes.

    [0187] Sequence Alignments

    [0188] Heuristic pairwise sequence alignments as implemented in BLAST 2.1.2 (Basic Local Alignment Search Tool) (Altschul et al. 1990) on the NCBI database (http://www.ncbi.nlm.nih.gov) were performed to test the homology among the transporter protein sequences mentioned in the present invention. All parameters were kept at their default values for every BLAST alignment.

    [0189] In the present invention, we tested the ability of selected heterologous MFS transporters to export LNnT out of the host cell using a reference strain, namely MP3672. The strain has one PglpF-driven copy of each heterologous glycosyltransferase that is required for product formation.

    [0190] One copy of each of the selected heterologous transporter genes, i.e. vag, yberC0001_9420, marc, bad, nec, yabM and fred (Table 4), was individually integrated in the genome of the strain MP3672 under the control of the Plac promoter, which is known to provide moderate transcript levels. The ribosomal binding site of the Plac promoter (i.e., the 16 bp upstream of the translational start site) has been modified (see Table 5) to strengthen ribosomal binding to the synthesized transcripts and in this manner positively regulate Plac-driven expression at the translational level.

    [0191] Following the above strain engineering approach and testing strain performance in DWA, we report here that only Vag-expressing LNnT producing cells show a relative increase both in the efflux of the produced LNnT and LNnT total production, compared to the reference strain.

    [0192] As shown in FIG. 5, Plac-driven expression of most transporter genes (marc, fred, bad, nec, yabM, yberC0001_9420) either has no significant effect or diminish LNnT production (down to 45%). On the contrary introduction of the vag gene in the genetic background of the strain MP3672 results in a marked increase in LNnT titer (FIG. 5).

    [0193] The alignment of amino acid sequences of the seven tested putative MSF transporters revealed that the Vag transporter has a very high sequence coverage (99 to 100%) to the rest six transporters tested in the present invention, with sequence identity ranging from 65% to 75%. The highest sequence identity (75%) was scored for the sequence of Vag and sequence of the MFS transporter encoded by the yabM gene (Table 8). Interestingly, the MFS transporter YabM, described in WO2017042382 as a putative effective exporter of LNT, did not show any significant impact on neither the final total LNnT titer nor LNnT efflux (FIG. 5, 6). Thus, contrary to its relatively high protein sequence similarity to Vag, the YabM transporter seems to be ineffective in relation to LNnT transport, which is clearly reflected by the product concentrations detected in the extracellular fraction of the corresponding host cell cultures (FIG. 6). Specifically, as revealed by the analysis of the supernatant fractions of bacterial cultures, extracellular LNnT concentrations were much higher for the strain MP3994 (vag-expressing cells) than for the strains MP4362 (yabM-expressing cells) and MP3672 (reference cells expressing no heterologous transporter) (FIG. 6).

    [0194] Taken together, this data suggest that the Vag transporter is an efficient transporter for LNnT. This conclusion derives from both the results of a screening procedure of the seven transporter genes genomically expressed in the same reference strain, under the same culture conditions and control of the same promoter, Plac, and analysis of the transporter protein sequences, that revealed that transporter proteins with relatively high homology to Vag, such as YabM and Marc (75% and 71%), do not export LNnT at all, or , if export, the efficiency is very low.

    TABLE-US-00009 TABLE 9 Homology between different heterologous transporters of the present invention Identical to Vag WP_048785139.1 Protein name Identification From organism (coverage) YberC0001_9420 EEQ08298.1 Major Yersinia bercovieri 68% (99%) facilitator superfamily MFS_1 Fred WP_087817556.1 MFS Yersinia 69% (99%) transporter frederiksenii Bad WP_017489914.1 MFS Rouxiella badensis 65% (99%) transporter Nec WP_092672081.1 MFS Rosenbergiella 66% (99%) transporter nectarea Marc WP_060448169.1 MFS Serratia 71% (99%) transporter marcescens YabM CAY73138.1 Putative Erwinia pyrifoliae 75% (99%) MFS sugar efflux transporter