Methods and compositions for inhibiting glyoxalase 1 (GLO1)
12521426 ยท 2026-01-13
Inventors
- Abraham Palmer (La Jolla, CA, US)
- Margaret Distler (Los Angeles, CA, US)
- Katherine M. J. McMurray (Oxford, OH, US)
Cpc classification
A61B5/4848
HUMAN NECESSITIES
A61K33/00
HUMAN NECESSITIES
A61B5/165
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
International classification
A61B5/00
HUMAN NECESSITIES
A61B5/16
HUMAN NECESSITIES
A61K33/00
HUMAN NECESSITIES
Abstract
Methods and compositions are provided for treating or preventing a neurological disease or disorder using an inhibitor of Glyoxalase 1 (GLO1). In some embodiments, the inhibitor is a small molecule. In certain embodiments, the disease or disorder is a sleep disorder, a mood disorder such as depression, epilepsy, an anxiety disorder, substance abuse, substance dependence or substance such as an alcohol withdrawal syndrome.
Claims
1. A method of treating a condition in a subject comprising administering to the subject a therapeutically effective amount of a composition comprising a Glo1 inhibitor, wherein the condition is an alcohol abuse disorder or alcohol withdrawal syndrome, and wherein the Glo1 inhibitor is an antibody, an inhibitory nucleic acid, a molecule having a glutathione structure, a 1-hydroxy-6,7-diphenylpyridin-2-one derivative (3d), a flavonoid, a curcumin, a benzothiazole derivative, a 4-(7-azaindole)-substituted 6-phenyl-N-hydroxypyridones, or 4,6-diphenyl-N-hydroxypyridone.
2. The method of claim 1, wherein the Glo1 inhibitor is an antibody.
3. The method of claim 1, wherein the Glo1 inhibitor is an inhibitory nucleic acid.
4. The method of claim 1, wherein the Glo1 inhibitor is a molecule having a glutathione structure, a 1-hydroxy-6,7-diphenylpyridin-2-one derivative (3d), a flavonoid, a curcumin, a benzothiazole derivative, a 4-(7-azaindole)-substituted 6-phenyl-N-hydroxypyridones, or 4,6-diphenyl-N-hydroxypyridone.
5. The method of claim 1, wherein the condition is an alcohol abuse disorder.
6. The method of claim 1, wherein the condition is alcohol withdrawal syndrome.
7. The method of claim 1, further comprising administering a second treatment.
8. The method of claim 1, wherein the second treatment comprises benzodiazepines, barbiturates, clonidine, topiramate carbamazepine, or clomethiazole (heminevrin).
9. The method of claim 1, wherein the subject is a human.
10. The method of claim 1, wherein the subject has been determined to have an alcohol abuse disorder.
11. The method of claim 10, further comprising monitoring the subject for the alcohol abuse disorder within a week of first administering the composition.
12. The method of claim 11, wherein the subject is administered the composition within 1 week of being determined to have the alcohol abuse disorder.
13. The method of claim 1, wherein the subject is at risk of an alcohol abuse disorder.
14. The method of claim 1, wherein the subject has been determined to have alcohol withdrawal syndrome.
15. The method of claim 14, further comprising monitoring the subject for the alcohol withdrawal syndrome within a week of first administering the composition.
16. The method of claim 14, wherein the subject is administered the composition within 1 week of being determined to have alcohol withdrawal syndrome.
17. The method of claim 1, wherein the subject is at risk of alcohol withdrawal syndrome.
18. The method of claim 1, wherein the composition is administered orally, topically, nasally, intravascularly, intraperitoneally, intrathecally, intratracheally, by inhalation or instillation.
19. The method of claim 1, wherein the composition is administered orally, topically, or intravenously.
Description
DESCRIPTION OF THE DRAWINGS
(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. Certain aspects may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
DETAILED DESCRIPTION OF THE INVENTION
(60) Certain embodiments are directed to compositions and methods relating to use of GLO1 inhibitors or MG or its prodrug or precursor for therapeutic applications, particularly those methods and compositions related to preventing or treating neurological conditions or diseases.
I. GLO1 (Glyoxalase 1)
(61) In enzymology, a lactoylglutathione lyase (EC 4.4.1.5) (also known as glyoxalase I) is an enzyme that catalyzes the isomerization of hemithioacetal adducts, which are formed in a spontaneous reaction between a glutathionyl group and aldehydes such as methylglyoxal.
glutathione+methylglyoxalhemithioacetal adduct(R)S-lactoylglutathione
(62) Glyoxalase I derives its name from its catalysis of the first step in the glyoxalase system, a critical two-step detoxification system for methylglyoxal. Methylglyoxal is produced naturally as a byproduct of normal biochemistry, but may be toxic, due to its chemical reactions with proteins, nucleic acids, and other cellular components. The second detoxification step, in which (R)S-lactoylglutathione is split into glutathione and D-lactate, is carried out by glyoxalase II, a hydrolase. Unusually, these reactions carried out by the glyoxalase system does not oxidize glutathione, which usually acts as a redox coenzyme. Although aldose reductase can also detoxify methylgloxal, the glyoxalase system is more efficient and seems to be the most important of these pathways. Glyoxalase I is an attractive target for the development of drugs to treat infections by some parasitic protozoa, and cancer. Several inhibitors of glyoxalase I have been identified, such as S(N-hydroxy-N-methylcarbamoyl)glutathione.
(63) Glyoxalase I is classified as a carbon-sulfur lyase although, strictly speaking, the enzyme does not form or break a carbon-sulfur bond. Rather, the enzyme shifts two hydrogen atoms from one carbon atom of the methylglyoxal to the adjacent carbon atom. In effect, the reaction is an intramolecular redox reaction; one carbon is oxidized whereas the other is reduced. The mechanism proceeds by subtracting and then adding protons, forming an enediolate intermediate, rather than by transferring hydrides. Unusually for a metalloprotein, this enzyme shows activity with several different metals.
(64) Glyoxalase I is also unusual in that it is stereospecific in the second half of its mechanism, but not in the first half. Structurally, the enzyme is a domain-swapped dimer in many species, although the two subunits have merged into a monomer in yeast, through gene duplication.
(65) Due to their roles in AGE formation and cytotoxicity, GLO1 and MG have been shown to influence diseases where these effects are relevant to pathogenesis, such as diabetic complications, aging, and cancer (Brownlee 2001; Ahmed 2007; Fleming 2010; Morcos 2008; Thornalley 2003; Thornalley 2011).
(66) GLO1 has also been implicated in degenerative changes associated with aging. During the aging process, GLO1 activity declines, while MG and AGEs accumulate (Xue 2011). AGE accumulation has been associated with age-related diseases, such as Alzheimer's disease, diabetic complications, and atherosclerosis (Brownlee 2001; Krautwald 2010). Further, in C. elegans, overexpression of the Glo1 homolog increased lifespan, while its knockdown reduced lifespan (Morcos 2008).
(67) GLO1's cytoprotective effects paradoxically promote disease in patients with cancer, where malignant cells utilize GLO1 to increase survival and resist chemotherapy. For example, in patients with malignant melanoma, cancer cells were found to significantly overexpress GLO1 compared to cells from healthy controls (Bair 2010). Knockdown of GLO1 in cancer cells increased their susceptibility to MG-induced cyototoxicity (Bair 2010). Similarly, GLO1 inhibitors have been shown to prevented tumor growth in vitro and in vivo (Creighton 2003).
(68) In contrast to GLO1's well-characterized roles in the pathogenesis of these diseases, its mechanistic role in neurological disorders such as anxiety disorders is not established. In fact, none of GLO1's established cellular effects has been mechanistically linked to anxiety.
II. Treatment Methods and Compositions
(69) Method and compositions include treatments for a disease or condition responsive to GLO1 inhibition or GABA-A agonists. A GLO1 inhibitor can be given to prevent or treat a subject having a neurological disease or disorder or suspected of having a neurological disease or disorder or at risk of having a neurological disease or disorder. Methods may be employed with respect to individuals who have been tested for having a neurological disease or disorder or who are deemed to be at risk for having a neurological disease or disorder.
(70) In particular, there are methods of treatment for a neurological disease or disorder, particularly sleep disorders, mood disorders such as depression or bipolar disorders, epilepsy, anxiety disorders, or alcohol withdrawal syndrome. Moreover, methods concern treating any condition or disease that is caused by, perpetuated by, or promoted by reduced GABA-A signaling activity.
III. Disease or Disorder to be Treated
(71) Method and compositions involving Glo1 inhibitors may be provided to treat diseases or disorders such as any neurological diseases or disorders, including, but not limited to, anxiety disorders, depressive disorders, epilepsy, sleep disorders, mood disorders, substance abuse or dependence, substance withdrawal symptoms.
(72) A. Anxiety Disorders
(73) GABAA receptors are critical in regulating neuronal inhibitory tone throughout the CNS (Kalueff 2007); as such, they contribute to the pathogenesis of several neurological disorders. Through their effect on GABAA receptors, GLO1 and MG are likely to contribute to a broad range of CNS conditions in addition to anxiety.
(74) Anxiety disorders are the most common psychiatric conditions in the United States, affecting 40 million adults each year (NIMH 2009). However, current anxiolytic therapies are not effective in all patients and can have undesirable side effects (Pollack 2009). Therefore, investigating novel molecular pathways that contribute to anxiety may identify new therapeutic targets.
(75) Although Glo1 has been associated with anxiety, the underlying mechanism was unknown. In fact, Glo1 is an unlikely candidate for regulating anxiety. Despite its high expression in the brain, Glo1 is not brain-specific, but rather is ubiquitously expressed (Thornalley 1993). Further, GLO1's cellular function is not typical of a mediator of anxiety. GLO1 is an enzyme in the glyoxalase system, a metabolic pathway that detoxifies methylglyoxal (MG) by converting it into d-lactate (Thornalley 2003). MG is formed from the non-enzymatic fragmentation of the glycolytic intermediates dihydroxyacetone phosphate and glyceraldehyde-3-phosphate (Thornalley 1993). GLO1 is the major cellular enzyme regulating MG; as such, changes in GLO1 activity and Glo1 expression directly affect MG levels. In vitro, inhibition of GLO1 increased MG accumulation (Kuhla 2006), and overexpression of Glo1 prevented MG accumulation (Shinohara 1998). When MG accumulates to high levels, it induces cytotoxic effects, including protein modification (Brownlee 2001), reactive oxygen species (ROS) generation (Schleicher 2007), and apoptosis (Kuhla 2006; Loh 2006; Di Loreto 2008). MG forms adducts on proteins and nucleotides, termed advanced glycation end-products (AGEs). The effects of AGEs are twofold: first, AGE formation causes dysfunction of affected proteins (Brownlee 2001). Second, AGEs ligate the receptor for AGEs (RAGE), which triggers the production of ROS (Schleicher 2007) and leads to apoptosis (Loh 2006). Glo1 expression and GLO1 activity mediate MG-induced cytotoxicity; for instance, GLO1 inhibition results in reduced cellular viability (Kuhla 2006).
(76) GLO1 had no obvious mechanistic relationship to anxiety. Rather, GLO1 was best characterized for detoxifying MG, a cytotoxic byproduct of glycolysis (Thornalley 1993; Thornalley 2003). In the present work, the inventors demonstrated that GLO1 increases anxiety by reducing MG concentration. Glo1 overexpression reduced MG concentration in the brain (
(77) GABAA receptors are comprised of various combinations of subunits, and different receptor compositions mediate different GABAergic effects, such as anxiety and sedation (Rudolph 2011). Therefore, MG's activity at different receptor subtypes may contribute to its endogenous role in the CNS. While the inventors did not identify the specific GABAA receptor subtypes activated by MG, potent activation of currents in CGN suggests that MG operates receptors containing 6 subunits, which are prevalent in CGN (Nusser 1999). Further, MG-evoked currents were enhanced by co-application of diazepam, midazolam, and zolpidem (
(78) MG is generated intracellularly by both neurons and glia and then crosses the plasma membrane (
(79) Based on the results, a mechanism has been contemplated in certain aspects of the invention whereby GLO1 reduces endogenous MG concentration, thus reducing neuronal inhibitory tone and increasing anxiety-like behavior. MG is generated intracellularly from triose phosphates during glycolysis (Thornalley 1993; Thornalley 2003) and is then metabolized by GLO1 and GLO2 (Thornalley 1993; Thornalley 2003). MG that is not catabolized crosses the plasma membrane to activate GABAA receptors and regulate downstream behaviors, including anxiety. This mechanism is summarized in
(80) B. Depression
(81) Interestingly, while antidepressant drugs are also effective for some anxiety symptoms, anxiolytic drugs that act via GABAergic mechanisms do not have antidepressant effects (Birkenhager 1995; Johnson 1985; Barbui 2011). While there are many effective pharmacotherapies for both disorders, there is an urgent need for better drugs. Major limitations of existing anxiolytic drugs include sedating side effects and abuse liability. For antidepressant drugs limitations include side effects and a slow onset of therapeutic effects. In addition, a significant fraction of patients fail to respond to existing drugs. Thus, the available treatments leave significant room for improvement.
(82) The inventors demonstrated that Glo1 overexpression increased depression-like behavior in mice (
(83) C. Epilepsy
(84) It was demonstrated that exogenous administration of MG reduced the duration and severity of both picrotoxin- and pilocarpine-induced seizures (
(85) An important caveat is that these studies utilized a crude MG preparation to investigate seizure phenotypes. As such, it remains possible that contaminants in the preparation could have affected the results. This is unlikely, because pure and crude MG were found to have similar effects in vivo (e.g., anxiolysis, locomotor depression, ataxia, and hypothermia) and in vitro (
(86) GLO1 inhibition with BrBzGCp2 decreased seizure duration (
(87) Finally, the inventors examined the effect of differential Glo1 expression on seizures. The inventors found that differential expression of Glo1 in BXD RI lines was associated with seizure susceptibility
(88) These studies emphasize the importance of GLO1 and MG in neuronal physiology through regulating neuronal inhibitory tone as well as associated pathophysiological conditions, including anxiety, depression, and epilepsy. Moreover, these results may provide insight into the high comorbidity between epilepsy and anxiety disorders (Titlic 2009; Schmidt 2009; LaFrance 2008; Beyenburg 2005). There is a 25-50% prevalence of anxiety disorders among patients with epilepsy, which is twice the prevalence among the general population (LaFrance 2008). The prevalence of comorbid anxiety disorders is especially high in epileptic patients who do not respond to AEDs (Schmidt 2009; LaFrance 2008). This could suggest a convergent pathologic mechanism that is not targeted by current AEDs. Polymorphisms in Glo1 and related changes in MG concentration may contribute to both anxiety and epilepsy, providing a common underlying pathway.
(89) In addition to the behavioral manifestations of seizures, there remain additional features of epilepsy that the present study did not investigate, particularly neuronal cell death resulting from status epilepticus (Naegele 2007; Henshall 2008; Rakhade 2009; Willmore 2005; Pitkanen 2003). Mechanisms underlying this type of neuronal cell death are largely excitotoxic, whereby increased activation of NMDA receptors causes excessive cellular Ca2+ influx, organelle swelling, initiation of the caspase cascade, activation of degradative enzymes (proteases, lipases, etc.), ROS generation, and apoptosis (Naegele 2007; Henshall 2008). The long-term sequelae of seizure-related neuronal cell death include reduced brain volume (Henshall 2008) and eplieptogenesis, an increased predilection toward future seizures (Henshall 2008; Rakhade 2009). Therefore, protection against neuronal cell death is an important goal in the treatment of epilepsy. Unfortunately, experimental studies of anti-apoptotic agents have not demonstrated their anti-seizure or anti-epileptogenic effects (Naegele 2007; Henshall 2008). More promisingly, several AEDs, such as lamotrigine, levetiracetam, and topiramate, have been shown to be neuroprotective after status epilepticus (Willmore 2005; Pitkanen 2002). Therefore, it is possible that MG could have neuroprotective effects in addition to its anti-seizure effects. This possibility would add a layer of complexity to MG's physiological role, as it has previously been characterized as cytotoxic. Importantly, the inventors found no evidence of cytotoxicity at the doses of MG used in this study. If MG were neuroprotective, this would indicate that MG has a dichotomous cellular action, with cytoprotective effects at physiological concentrations and cytotoxic effects at supra-physiological concentrations.
(90) D. Alcohol Withdrawal Syndrome
(91) Methods and compositions can be also provided for preventing or treating an alcohol withdrawal syndrome. Alcohol withdrawal syndrome is the set of symptoms seen when an individual reduces or stops alcohol consumption after prolonged periods of excessive alcohol intake. Excessive use of alcohol leads to tolerance, physical dependence, and an alcohol withdrawal syndrome. The withdrawal syndrome is largely due to the central nervous system being in a hyper-excitable state. The withdrawal syndrome can include seizures and delirium tremens and may lead to excito-neurotoxicity.
(92) Sedative-hypnotics, such as alcohol, are well known for their propensity to induce physiological dependence. Alcohol withdrawal occurs as a result of neuro-adaptation resulting from chronic exposure to alcohol. A withdrawal syndrome occurs upon declining blood levels of alcohol which can be alleviated by reintroduction of alcohol or a cross-tolerant agent. Alcohol withdrawal is characterized by neuropsychiatric excitability and autonomic disturbances similar to other sedative-hypnotic drugs. Dependence on other sedative-hypnotics increases the severity of the withdrawal syndrome.
(93) E. Addictive Agents and Substance Abuse/Dependence Disorders
(94) The term addiction is used to describe a recurring compulsion by an individual to engage in some specific activity, despite harmful consequences to the individual's health, mental state or social life. The term is often reserved for drug addictions, but it is applied to other compulsions, such as problem gambling, and binge eating. Factors that have been suggested as causes of addiction include genetic, biological/pharmacological and social factors.
(95) The medical community now makes a careful theoretical distinction between physical or physiological dependence (characterized by symptoms of withdrawal) and psychological dependence (sometimes referred to simply as addiction). Addiction is now narrowly defined as uncontrolled, compulsive use. If there is no harm being suffered by, or damage done to, the patient or another party, then clinically it may be considered compulsive, but to the definition of some it is not categorized as addiction. In practice, the two kinds of addiction (physiological dependence and psychological dependence) are not always easy to distinguish. Addictions often have both physical and psychological components.
(96) Physical dependence (or drug dependence) refers to a state resulting from habitual use of a drug, where negative physical withdrawal symptoms result from abrupt discontinuation. Examples of addictive agents for which a user may develop a physical dependence include nicotine, opioids, barbiturates, benzodiazepines, alcohol, i.e., ethyl alcohol, GHB, and methaqualone.
(97) Commonly abused stimulants such as cocaine or amphetamine class drugs are not believed to cause significant physical dependence. However, their potential for extreme psychological addiction can compel the user to consume amounts which become physically damaging, but life-threatening withdrawal effects have not been observed.
(98) As used herein, addictive agent(s) includes any and all agents to which a subject can become addicted, either physically or psychologically, or both. As noted above, addiction includes addiction to chemical entities, such as drugs, as well as addiction to behaviors, as in impulse control disorders.
(99) Addictive agents include addictive recreational drugs, as well as addictive medications. Examples of addictive agents include, but are not limited to, alcohol, e.g., ethyl alcohol, gamma hydroxybutyrate (GHB), caffeine, nicotine, cannabis (marijuana) and cannabis derivatives, opiates and other morphine-like opioid agonists such as heroin, phencyclidine and phencyclidine-like compounds, sedative hypnotics such as benzodiazepines, methaqualone, mecloqualone, etaqualone and barbiturates and psychostimulants such as cocaine, amphetamines and amphetamine-related drugs such as dextroamphetamine and methylamphetamine. Other examples include LSD, psilocybin, ecstasy and other hallucinogens. Examples of addictive medications include, e.g., benzodiazepines, barbiturates, and pain medications including alfentanil, allylprodine, alphaprodine, anileridine benzylmorphine, bezitramide, buprenorphine, butorphanol, clonitazene, codeine, cyclazocine, desomorphine, dextromoramide, dezocine, diampromide, dihydrocodeine, dihydromorphine, dimenoxadol, dimepheptanol, dimethylthiambutene, dioxaphetyl butyrate, dipipanone, eptazocine, ethoheptazine, ethylmethylthiambutene, ethylmorphine, etonitazene fentanyl, heroin, hydrocodone, hydromorphone, hydroxypethidine, isomethadone, ketobemidone, levallorphan, levorphanol, levophenacylmorphan, lofenitanil, meperidine, meptazinol, metazocine, methadone, metopon, morphine, myrophine, nalbuphine, narceine, nicomorphine, norlevorphanol, normethadone, nalorphine, normorphine, norpipanone, opium, oxycodone, OXYCONTIN, oxymorphone, papaveretum, pentazocine, phenadoxone, phenomorphan, phenazocine, phenoperidine, piminodine, piritramide, propheptazine, promedol, properidine, propiram, propoxyphene sufentanil, tramadol, tilidine, salts thereof, mixtures of any of the foregoing, mixed -agonists/antagonists, and the like.
(100) In certain embodiments, a subject may be addicted to an opioid agonist. The terms opioid agonist, opioid and opiate are used interchangably herein and are used to designate a group of drugs that are, to varying degrees, opium- or morphine-like in their properties. Their main use is for pain relief. These agents work by binding to opioid receptors, which are found principally in the central nervous system and the gastrointestinal tract. Opiates are also addictive agents. Opiates include alfentanil, allylprodine, alphaprodine, anileridine, apomorphine, benzylmorphine, beta-hydroxy 3-methylfentanyl, bezitramide, carfentanil, clonitazene, codeine, desomorphine, dextromoramide, diacetylmorphine (heroin), diampromide, dihydro codeine, dihydroetorphine, dihydromorphine, dimenoxadol, dimepheptanol, dimethylthiambutene, dioxaphetylbutyrate, dipipanone, eptazocine, ethoheptazine, ethylmethylthiambutene, ethylmorphine, etonitazene, etorphine, fentanyl, hydrocodone, hydromorphone, hydroxypethidine, isomethadone, ketobemidone, LMM, levorphanol, levophenacylmorphan, lofentanil, meperidine, metapon, metazocine, methadone, methadyl acetate, metopon, morphine, myrophine, narceine, nicomorphine, norlevorphanol, normethadone, normorphine, norpipanone, opium, oxycodone, oxymorphone, papaverine, phenadoxone, phenomorphan, phenoperidine, piminodine, piritramide, propheptazine, promedol, properidine, propoxyphene, remifentanil, sufentanil, thebaine, tildine, and tramadol.
(101) Naturally occurring opiates include codeine, morphine, noscapine, papaverine, and thebaine. Semi-synthetic opioids include diacetylmorphine, hydrocodone, hydromorphone, levorphanol, metapon, nalorphine, naloxone, naltrexone, oxycodone, oxymorphone, and tramadol. Synthetic opioids include ethoheptazine, fentanyl, levorphanol, meperidine, methadone, phenazocine, propoxyphene and sufentanil.
(102) Three broad classifications of opiates are phenanthrenes, phenylheptylamines, and phenylpiperidines. Examples of phenanthrenes include codeine, etorpine, hydrocodone, hydromorphone, morphine, oxycodone, and oxymorphone. Examples of phenylheptylamines include dimeheptanol, dimenoxadol, dipipanone, isomethadone, methadone, methadyl acetate, and propoxyphene. Examples of phenylpiperidines include alfentanyl, alphaprodine, beta-promedol, carfentanyl, fentanyl, lofentanil, meperidine, properidine, and sufentanil.
(103) Specific psychostimulants include, by way of example, amphetamine, cocaine, dextroamphetamine, methamphetamine, pemoline, Ritalin, Adderall and methylenedioxymethamphetamine.
(104) As noted above, addiction includes addiction to behaviors, e.g., food addiction, binge eating disorder, pathological gambling, pathological use of electronic devices, e.g., BlackBerry, pathological use of electronic video games, pathological use of electronic communication devices, pathological use of cellular telephones, addiction to pornography, sex addiction, obsessive-compulsive disorder, compulsive spending, intermittent explosive disorder, kleptomania, pyromania, trichotillomania, compulsive over-exercising, and compulsive overworking.
(105) In one aspect, a subject suffers from food addiction or binge eating disorder, often with secondary health problems such as obesity due to excessive consumption of food and/or malnutrition due to excessive consumption of foods that are high in fat and/or sugar and low in vitamins and minerals.
(106) As used herein binge eating disorder or binge eating includes at least one of the following episodic symptoms: eating large amounts of food, eating even when full, rapid eating, feeling that eating behavior is out of control, eating substantial amounts of food when not hungry, frequent dieting possibly without weight loss, eating alone, feeling depressed or disgusted about eating habits, eating in response to stress. Binge eating disorder is distinguished from other types of eating disorders, including food addiction, bulimia and binge-purge syndromes. Unlike bulimia and binge-purge syndromes, a subject suffering from binge eating disorder and food addiction-like behavior is that subjects suffering from binge eating disorder and food addiction-like behavior do not undertake compensatory behavior to attenuate excessive calorie consumption.
(107) A body of scientific literature is building to support the characterization of certain types of problematic eating behaviors as addictions, given that binge eating and chronic excess eating share many characteristics with addictive behaviors (e.g., diminished control, continued use despite negative consequences). Despite similarities, binge eating disorder and food addiction may represent unique yet overlapping conditions. Gearhardt, A. N., et al., Binge Eating Disorder and Food Addiction, Curr. Drug Abuse Rev, 4:201-207 (2011).
(108) As used herein, the term food addiction refers to a regular, persistent and habitual pattern of overeating characterized by craving and seeking high caloric foods, overeating in response to stimuli other than hunger, diminished control over food consumption, continued consumption despite negative consequences and diminished ability to cut down and abstain from consumption of an excess of food. Food addiction is a chronic relapsing disorder that typically follows a course of over-eating, tolerance, withdrawal, high caloric food seeking behavior and relapse (initiation of overeating after a period of abstinence).
(109) A natural preference for highly palatable foods rich in fat and carbohydrate has developed for evolutionary reasons due to the high caloric support associated with such foods. Although it is indisputable that feeding behavior is regulated by homeostatic mechanisms, eating and overeating are also regulated by emotional, affective and learning processes. Polivy, et al., Food restriction and binge eating: a study of a former prisoner of war, J Abnorm Psychol 103:409-411 (1994). In this respect several commonalities exist between excessive eating and drug abuse (reward, reinforcement, effects on mood, external cue-control of appetite, stress-induced motivation). Evidence is accumulating that excessive intake of certain foods under specific conditions produces behaviors and changes in the brain that resemble an addiction-like state. Gold, et al., Overeating, binge eating, and eating disorders as addictions, Psychiatr Ann 33:112-116 (2003); Kenny, et al., Common cellular and molecular mechanisms in obesity and drug addiction, Nat Rev Neurosci 12:638-651 (2011); Pelchat, et al., Images of desire: food-craving activation during fMRI, Neuroimage 23:1486-1493 (2004); Avena, et al., Evidence for sugar addiction: behavioral and neurochemical effects of intermittent, excessive sugar intake, Neurosci Biobehav Rev 32:20-39 (2008); Ifland, et al., Refined food addiction: a classic substance use disorder, Med Hypotheses 72:518-526 (2009); Gearhardt, et al., Food addiction: an examination of the diagnostic criteria for dependence, J Addict Med 3:1-7 (2011).
(110) Drug addiction can be characterized by progressive escalation in drug use, tolerance development, abstinence following abrupt cessation of their use and recurrent relapse, and similar phenomena have been described for high sucrose high fat food. For example, rats fed with highly palatable sucrose solution experience opiate-like withdrawal symptoms following sucrose removal. Cross sensitization between sucrose and drugs of abuse has also been described. Avena, et al., Evidence for sugar addiction: behavioral and neurochemical effects of intermittent, excessive sugar intake, Neurosci Biobehav Rev 32:20-39 (2008); Avena, et al., Dysregulation of brain reward systems in eating disorders: Neurochemical information from animal models of binge eating, bulimia nervosa, and anorexia nervosa, Neuropharmacology (Epub ahead of print) (Nov. 27, 2011). Moreover, it has been well documented that psychological stress and dysphoric mood states play a major role in facilitating overeating as well as excessive drug use, and contribute to the high rate of recidivism typical of both disorders. Corwin, et al., Feeling and reward: perspective from three rat models of binge eating, Physiol Behav 104:87-97 (2011); Ghitza, et al., The anxiogenic drug yohimbine reinstates palatable food seeking in a rat relapse model: a role of CRF1 receptors, Neuropsychopharmacology 31(10):2188-2196 (2006); Mizes, et al., Bulimia: A review of its symptomatology and treatment, Adv. Behav. Res. Ther. 7:91-142 (1985); Crowther, et al., The role of daily hassles in binge eating, Int J Eat Disord 29:449-454 (2001); Herman, et al., Anxiety, restraint, and eating behaviour, J Abnorm Psychol 84:66-72 (1975).
(111) Exposure to environmental conditioning stimuli has also been shown to play a critical role in eliciting drug craving in addicted individuals as well as food craving in obese patients meeting the criteria for food addiction. Gearhardt, et al., Food addiction: an examination of the diagnostic criteria for dependence, J Addict Med 3:1-7 (2011). Consistent with studies in humans, in laboratory animals it has been shown that exposure to environmental conditioning factors and exposure to stress (i.e., yohimbine) are similarly effective in eliciting reinstatement behaviors for drugs of abuse and for highly palatable food. Cifani, et al., Preclinical model of binge-eating elicited by yo-yo dieting and stressful exposure to food: effect of sibutramine, fluoxetine, topiramate and midazolam, Psychopharmacology 204:113-25 (2009); Cifani, et al., Pre-exposure to environmental cues predictive of food availability elicits hypothalamic-pituitary-adrenal axis activation and increases operant responding for food in female rats, Addict Biol. 14(4):397-407 (September 2009); Pickens, et al., Effect of fenfluramine on reinstatement of food seeking in female and male rats: implications for the predictive validity of the reinstatement model, Psychopharmacology (Berl) 221(2):341-353 (May 2012). Neural systems that motivate and reinforce drug abuse have also been proposed to underlie behaviors associated with compulsive food seeking and excessive food intake. Johnson, et al., Dopamine D2 receptors in addiction-like reward dysfunction and compulsive eating in obese rats, Nat Neurosci 13:635-641 (2010); Hoebel, et al., Brain neurotransmitters in food and drug reward, Am J Clin Nutr 42(5 Suppl):1133-1150 (1985); Volkow, et al., How can drug addiction help us understand obesity? Nat Neurosci 8:555-560 (2005); Corwin, et al., Feeling and reward: perspective from three rat models of binge eating, Physiol Behav 104:87-97 (2011); Gearhardt, et al., Neural correlates of food addiction, Arch Gen Psychiatry 68:808-816 (2011); Wang, et al., Enhanced striatal dopamine release during food stimulation during binge eating disorder, Obesity 19(8):1601-1608 (August 2011). For example, studies suggest that like in drug addicts, an altered regulation of striatal dopamine (DA) may exist in patients with bulimia nervosa.
(112) Interest in the concept of food addiction has recently received greater attention, in large part due to the similarities between the behavioral indicators of addiction and binge eating disorder (BED). Episodes of binge eating in humans are characterized by compulsive, non-homeostatic consumption of an unusually large quantity of highly palatable food in a short period of time. Even though they are not hungry, subjects eat more rapidly than normal until feeling uncomfortably full. As described by the DMS-IV-TR (American Psychiatric Association, Diagnostic and statistic manual of mental disorders, Washington, D.C. (2000)), these episodes are accompanied by a subjective sense of loss of control over eating, and are associated with feeling of distress, disgust, depression, being guilty about overeating, and eating alone because of embarrassment.
(113) BED, described for the first time by Stunkard, Eating patterns and obesity, Psychiatry Q 33:284-295 (1959), is probably the most prevalent eating disorder. Hudson, et al., The prevalence and correlates of eating disorders in the National Comorbidity Survey Replication, Biol Psychiatry 61:348-58 (2007). It is characterized by repeated episodes of binge eating in the absence of compensatory behaviors to avoid weight gain. The diagnostic criteria for BED in the DSM-IV-TR include that binge eating episodes should occur at least 2 days per week for six months. BED is associated with significant medical and psychiatric comorbidity. Javaras, et al., Co-occurrence of binge eating disorder with psychiatric and medical disorders, J Clin Psychiatry 269:266-273 (2008); Grucza, et al., Prevalence and correlates of binge eating disorder in a community sample, Compr Psychiatry 48:124-131 (2007). It is estimated that binge eating afflicts approximately 5% of the US adult population at some time during their lives (Foulds, et al., The biology of binge eating, Appetite 52:545-553 (2009)) and that it contributes to aggravate obesity and associated pathologies. Hudson, et al., The prevalence and correlates of eating disorders in the National Comorbidity Survey Replication, Biol Psychiatry 61:348-58 (2007); Yanovski, Binge eating disorder and obesity in 2003: could treating an eating disorder have a positive effect on the obesity epidemic? Int J Eat Disord 34 Suppl: S117-S1120 (2003).
(114) A large body of evidence suggests that dieting, stress and negative affective states represent important triggers of binge eating in patients suffering from BED or bulimia nervosa. Wardle, et al., Stress, dietary restraint and food intake, J Psychosom Res 48:195-202 (2000); Freeman, et al., Daily stress, coping, and dietary restraint in binge eating, Int J Eat Disord 36: 204-212 (2004). Indeed, dieting periods are common in the histories of binge eaters, although hunger itself does not appear to be enough to induce bing eating in the absence of stress and negative affective state. Polivy, et al., Food restriction and binge eating: a study of former prisoner of war, J Abnorm Psychol 103:409-411 (1994); Waters, et al., Internal and external antecedents of binge eating episodes in a group of women with bulimia nervosa, Int J Eat Disord 29:17-22 (2001). Considerable evidence suggests that binge eating may be caused by a unique interaction between dieting and stress; thus, environmental stress and a history of cyclic food restrictions may be responsible for its precipitation and maintenance. Stice, et al. Subtyping binge eating-disordered women along dieting and negative affect dimensions, Int J Eat Disord 30:11-27 (2001); Crowther, et al., The role of daily hassles in binge eating, Int J Eat Disord 29:449-454 (2001). Accordingly, recurring food restrictions are consistently the strongest predictor of overeating in response to stress. Wardle, et al., Stress, dietary restraint and food intake, J Psychosom Res 48:195-202 (2000).
(115) While a subject may be addicted to a single addictive agent or behavior, frequently subject is addicted to two or more addictive agents or behaviors. Addiction to two or more addictive agents or addictive behaviors is referred to as polyaddiction.
(116) F. GLO1 in Other Neurological Diseases
(117) Methods and compositions can be also provided for preventing or treating other neurological diseases, such as autism and Alzheimer's disease. Previous studies have also suggested associations between GLO1 and other diseases of the CNS, including autism and Alzheimer's disease (Junaid 2004; Sacco 2007; Chen 2004). The present study may provide mechanistic insight into GLO1's role in these diseases.
(118) 1. Autism
(119) Autism is a disorder characterized by abnormal development in social interaction and communication as well as restricted interests (Habig 1974). As described above, Junaid et al. reported that the 419A GLO1 allele was more 1.5 times more common among autistic patients than controls (Junaid 2004). However, this study was limited by its small sample size (71 autistic subjects and 49 controls) and its use of a candidate gene approach. Candidate gene studies can suffer from biases and confounding variables (e.g., population stratification) (Tabor 2002). Indeed, subsequent studies have not replicated the association between the GLO1 419 SNP and autism (Wu 2008; Rehnstrom 2008; Sacco 2007). Although this could have resulted from differences in design or population between the studies (Tabor 2002), several human GWAS have also failed to identify associations between GLO1 polymorphisms and autism. This suggests that the findings of Junaid et al. were spurious or that they overestimated the effect size of GLO1's contribution to autism.
(120) Nevertheless, Junaid et al. suggested that the 419A GLO1 allele was associated with a functional change in GLO1 enzymatic activity. Specifically, they reported that post-mortem brain tissue from autistic patients had reduced GLO1 enzymatic activity and increased AGE content compared to that from control patients (Junaid 2004). In a later study, they reported a correlation between the 111E GLO1 isoform and reduced enzymatic activity (Barua 2011).
(121) However, the inventors' data do not indicate reduced enzymatic activity of the 111E GLO1 isoform. Instead, the 111E GLO1 isoform had 20-30% greater enzymatic activity than the 111A isoform. In addition, the inventors' behavioral data suggest that the 111A/E isoforms are not likely to significantly affect MG concentration or behavior. Glo1 KD mice, which had a similar 25% reduction in enzymatic activity, displayed no change in MG concentration or anxiety-like behavior (
(122) Nevertheless, the association between autism and high levels of MG and AGEs may indicate a functional role for GLO1 in the pathogenesis of autism (Junaid 2004). Few studies have examined whether AGEs contribute to autism (Boso 2006); therefore, the mechanism underlying this association is unclear. Alternatively, it is possible that GLO1's role in GABAergic signaling could contribute to autism, since disruptions in GABAergic signaling are thought to underlie autism (Rubenstein 2011; DiCristo 2007). However, the GABAergic dysfunction observed in autism likely arises from aberrant development of GABAergic circuits and aberrant cortical plasticity of GABAergic neurons (Rubenstein 2011; Di Cristo 2007).
(123) 2. Alzheimer's Disease
(124) Alzheimer's disease is a neurodegenerative disease prevalent among the elderly that results in cognitive impairment. The hallmark neuropathological features of Alzheimer's disease are aggregated protein depositions, specifically amyloid-0 plaques and tau-containing neurofibrillary tangles (Ittner 2011). Previous reports have suggested an association between GLO1 and Alzheimer's disease. In mice with a transgenic mutant tau protein, which increases neurofibrillary tangles and thus models some aspects of Alzheimer's disease (Gotz 2001), there was a 1.8-fold increase in GLO1 protein in the brain compared to WT mice (Chen 2004). This finding was supported by studies in humans: post-mortem brains of patients with Alzheimer's disease displayed increased GLO1 protein compared to those of healthy controls (Chen 2004; Kuhla 2005). In contrast, there was an increased level of MG in the cerebrospinal fluid (Kuhla 2005) and increased AGEs in the brains of patients with Alzheimer's disease (Grillo 2008). As such, it was suggested that increased Glo1 expression is a compensatory mechanism to combat the toxic effects of AGEs.
(125) Despite this correlation between Glo1 expression and Alzheimer's disease, Chen et al. did not identify a genetic association between the 419A/C SNP and Alzheimer's disease (Chen 2004). An earlier study also failed to identify associations between GLO1 alleles and Alzheimer's disease (Nerk 1984), and GAWS for Alzheimer's disease have not identified polymorphisms in GLO1. The strength of the mouse data is also questionable. Specifically, differential Glo1 expression could have been an artifact of differential fixation of the Glo1 CNV. The mutant tau transgenic mice were generated on a B6/D2 F1 background and were then intercrossed with B6 mice (Gotz 2001). The D2 background contains the Glo1 duplication, while the B6 background does not (Vince 1971). Since the mice were not backcrossed, it is possible that the transgene was linked to the Glo1 locus. This could result in differential Glo1 expression due to the CNV rather than a functional role of GLO1 in Alzheimer's disease. In order to rule out this possibility, these mice should be genotyped for the presence of the Glo1 duplication (Vince 1971).
(126) Although AGEs have been identified in the amyloid- and neurofibrillary tangles characteristic of Alzheimer's disease (Grillo 2008), it is unclear whether slight differences in Glo1 expression are sufficient to regulate this. Instead, it is possible that the aggregated proteins become glycated spontaneously, since AGEs form non-specifically. AGEs are not unique to Alzheimer's disease and are thought to accumulate with age (Xue 2011; Semba 2010). In summary, it is unclear whether GLO1 contributes to the pathogenesis of Alzheimer's disease. Future studies must experimentally manipulate Glo1 expression to assess its effect on disease progression, including development of senile plaque and neurofibrillary tangles, neurotoxicity, and cognitive deficits. If GLO1 modulates disease pathogenesis, a potential mechanism can then be pursued. Due to the prevalence of AGEs in the brains of patients with Alzheimer's disease, as well as the known role of cytotoxicity in disease progression, GLO1 is more likely to influence Alzheimer's disease through its role in AGE formation than its role in GABAergic signaling, which is not a well-established mechanism in Alzheimer's disease.
(127) G. Other CNS Diseases Such as Sleep Disorders
(128) Compositions and methods in certain aspects can be used to treat other CNS diseases, such as schizophrenia, or other diseases responsive to modulation of GABA.sub.A receptor signaling, such as sleep disorders.
(129) GLO1 may contribute to other CNS disorders as well. For instance, recent studies have suggested a role for GLO1 in schizophrenia (Arai 2010; Toyosima 2011). In particular, a frameshift mutation in GLO1 was identified in a schizophrenic patient and was correlated with reduced GLO1 enzymatic activity (Toyosima 2011). Further, schizophrenic patients were found to have increased AGE accumulation compared to control subjects (Arai 2010). Nevertheless, small sample sizes and confounding variables make this association preliminary.
(130) Human GWAS have also identified an association between restless legs syndrome (RLS) and a haplotype containing GLO1 (Kemlink 2009; Stefansson 2007). Because GABAA receptor agonists are used to treat RLS (Trenkwalder 2010), GLO1's role in GABAergic signaling could underlie its association with RLS.
(131) Finally, it is possible that GLO1 and MG affect other diseases where GABAA receptor signaling is important to pathogenesis, including sleep disorders (Winsky-Sommerer 2009).
IV. GLO1 as a Target for Therapeutic Agents
(132) Certain aspects demonstrated that GLO1 inhibition increased MG concentration in vivo (
(133) Similarly, there may be provided methods and compositions for increasing MG concentration as a novel therapeutic approach for treating epilepsy. MG levels increase under conditions of high metabolic load, such as diabetes (Shinohara 1998; Brownlee 2001; Masterjohn 2011), positioning MG as an intermediate between metabolic state and neuronal inhibitory tone. Therefore, metabolic interventions that raise endogenous MG levels could be a promising intervention for epilepsy without the adverse side effects of AEDs (Brodie 2011; Perucca 2011; Rossetti 2011).
(134) For instance, the ketogenic diet is a high-fat, low-carbohydrate diet that is administered to patients with epilepsy who do not respond to AEDs (Rosetti 2011; Payne 2011). The mechanism by which the ketogenic diet controls seizures is unknown, but it has been hypothesized that the ketogenic diet increases MG levels (Beisswenger 2005; Hartman 2007; Kalapos 2007; Gasior 2007). When the inventors administered the ketogenic diet ad libitum to mice for one month, however, there was no increase in MG concentration in the brain (data not shown). The inventors did not investigate whether the ketogenic diet reduced seizures in the inventors' mice, so it was unclear that it was effectively administered. Therefore, it remains possible that the ketogenic diet acts by increasing MG levels. Furthermore, other interventions that increase MG should be investigated as novel methods for controlling seizures.
(135) GLO1 inhibition would represent a novel mechanism of action among anxiolytic drugs and AEDs. Most current anxiolytic therapies target neurotransmitter systems, including the serotonin and GABA systems (Pollack 2009). Similarly, most AEDs target ion channels, including GABAA receptors (Brodie 2011; Perucca 2011; Rossetti 2011). GLO1 inhibitors would increase the production of an endogenous GABAergic agent. This could have a milder side effect profile than agents that directly activate GABAA receptors or other ion channels. For instance, endogenously generated MG might have brain-region specificity, thus preventing off-target effects. Similarly, GLO1 inhibition may not increase MG levels sufficiently to cause sedation or have abuse potential, which are common concerns of current GABAA receptor agonists. Indeed, in the inventors' experience, mice treated with BrBzGCp2 did not display sedation or gross deficits. However, the inventors have not thoroughly characterized its side effect profile, and this remains an important direction for future studies.
(136) Studies of the adverse effects of GLO1 inhibition in vivo must also pay particular attention to cytotoxicity. In vitro studies have demonstrated that GLO1 inhibition can cause cell death (Kuhla 2006). This is unlikely to occur in vivo over a short period of time, since GLO1 inhibition increased MG levels by only 20% (
(137) Certain examples involve the investigation of GLO1's effect on anxiety and elucidated the underlying molecular mechanism. In doing so, uncovered novel physiological roles were unconvered for GLO1 and its substrate, MG, as modulators of GABAA receptors. This finding was extended to identify a role for GLO1 and MG in other CNS disorders, including depression and epilepsy. Finally, it was established the therapeutic potential of GLO1 inhibition in the treatment of anxiety and epilepsy.
V. Combination Treatments
(138) In some embodiments, the treatment is administered in conjunction with a second treatment for such a neurological disease or disorder. Furthermore, in some examples, treatment comprises administration of other agents commonly used against such a neurological disease or disorder. The compositions and related methods, particularly administration of a GLO1 inhibitor or a compound that inhibits GLO1, may also be used in combination with the administration of traditional therapies for sleep disorders, mood disorders, epilepsy, alcohol withdrawal syndrome or anxiety disorders.
(139) A. Combination Treatment for Mood and/or Anxiety Disorders
(140) In order to increase the effectiveness of the treatment method provided in certain aspects, it may be desirable to combine the treatment methods with secondary treatments to treat the mood disorders such as bipolar disorders or depressive disorders and/or anxiety diseases, disorders or conditions, such as chemical stimulation or the use of stimulating drugs (e.g., antidepressants), psychotherapy, and the use of devices including electroconvulsive therapy, vagus nerve stimulation, repetitive transcranial magnetic stimulation, and cranial electrotherapy stimulation.
(141) Herein, stimulating drugs may comprise medications, anesthetic agents, synthetic or natural peptides or hormones, neurotransmitters, cytokines and other intracellular and intercellular chemical signals and messengers, and the like. In addition, certain neurotransmitters, hormones, and other drugs are excitatory for some tissues, yet are inhibitory to other tissues. Therefore, where, herein, a drug is referred to as an excitatory drug, this means that the drug is acting in an excitatory manner, although it may act in an inhibitory manner in other circumstances and/or locations. Similarly, where an inhibitory drug is mentioned, this drug is acting in an inhibitory manner, although in other circumstances and/or locations, it may be an excitatory drug. In addition, stimulation of an area herein includes stimulation of cell bodies and axons in the area.
(142) Similarly, excitatory neurotransmitter agonists (e.g., norepinephrine, epinephrine, glutamate, acetylcholine, serotonin, dopamine), agonists thereof, and agents that act to increase levels of an excitatory neurotransmitter(s) (e.g., edrophonium; Mestinon; trazodone; SSRIs (e.g., flouxetine, paroxetine, sertraline, citalopram and fluvoxamine); tricyclic antidepressants (e.g., imipramine, amitriptyline, doxepin, desipramine, trimipramine and nortriptyline), monoamine oxidase inhibitors (e.g., phenelzine, tranylcypromine, isocarboxasid)), generally have an excitatory effect on neural tissue, while inhibitory neurotransmitters (e.g., dopamine, glycine, and gamma-aminobutyric acid (GABA)), agonists thereof, and agents that act to increase levels of an inhibitory neurotransmitter(s) generally have an inhibitory effect. (Dopamine acts as an excitatory neurotransmitter in some locations and circumstances, and as an inhibitory neurotransmitter in other locations and circumstances.) However, antagonists of inhibitory neurotransmitters (e.g., bicuculline) and agents that act to decrease levels of an inhibitory neurotransmitter(s) have been demonstrated to excite neural tissue, leading to increased neural activity. Similarly, excitatory neurotransmitter antagonists (e.g., prazosin, and metoprolol) and agents that decrease levels of excitatory neurotransmitters may inhibit neural activity.
(143) Exemplary second treatments of anxiety disorders include, but are not limited to therapy such as cognitive-behavioral therapy (CBT), exposure therapy, acceptance and commitment therapy (ACT), dialectical behavioral therapy (DBT), interpersonal therapy (IPT) or eye movement desensitization and reprocessing (EMDR) or medications such as SSRIs, SNRIs, Benzodiazepines or tricyclic antidepressants.
(144) Selective Serotonin Reuptake Inhibitors (SSRIs). SSRIs relieve symptoms by blocking the reabsorption, or reuptake, of serotonin by certain nerve cells in the brain. This leaves more serotonin available, which improves mood. SSRIs (citalopram, escitalopram, fluoxetine, paroxetine, and sertraline) generally produced fewer side effects when compared with tricyclic antidepressants. However, common side effects include insomnia or sleepiness, sexual dysfunction, and weight gain. They are considered an effective treatment for all anxiety disorders, although the treatment of obsessive-compulsive disorder, or OCD, typically requires higher doses.
(145) Serotonin-Norepinephrine Reuptake Inhibitors (SNRIs). The serotonin-norepinephrine reuptake inhibitor, or SNRI, class (venlafaxine and duloxetine) is notable for a dual mechanism of action: increasing the levels of the neurotransmitters serotonin and norepinephrine by inhibiting their reabsorption into cells in the brain. As with other medications, side effects may occur, including stomach upset, insomnia, headache, sexual dysfunction, and minor increase in blood pressure. These medications are considered as effective as SSRIs, so they are also considered a first-line treatment, particularly for the treatment of generalized anxiety disorder.
(146) Benzodiazepines. This class of drugs is frequently used for short-term management of anxiety. Benzodiazepines (alprazolam, clonazepam, diazepam, and lorazepam) are highly effective in promoting relaxation and reducing muscular tension and other physical symptoms of anxiety. Long-term use may require increased doses to achieve the same effect, which may lead to problems related to tolerance and dependence.
(147) Tricyclic Antidepressants. Concerns about long-term use of the benzodiazepines led many doctors to favor tricyclic antidepressants (amitriptyline, imipramine, and nortriptyline). Although effective in the treatment of anxiety, they can cause significant side effects, including orthostatic hypotension (drop in blood pressure on standing), constipation, urinary retention, dry mouth, and blurry vision.
(148) There may be different types of treatments available for mood disorders, such as therapy and medications. Major depressive disorder medications usually include antidepressants, while bipolar disorder medications can consist of antipsychotics, mood stabilizers and/or lithium. Exemplary second treatments of depressive disorders include, but are not limited to medications including stimulating drugs (e.g., antidepressants), psychotherapy, and the use of devices including electroconvulsive therapy, vagus nerve stimulation, repetitive transcranial magnetic stimulation, and cranial electrotherapy stimulation. Non-limiting anti-depressants include SSRIs, SNRIs, Norepinephrine reuptake inhibitors (NRIs), Norepinephrine-dopamine reuptake inhibitors (NDRIs), Norepinephrine-dopamine releasing agents (NDRAs), Tricyclic antidepressants (TCAs), Tetracyclic antidepressants (TeCAs), Monoamine oxidase inhibitors (MAOIs), 5-HT1A Receptor Partial Agonists, 5-HT2 Receptor Partial Agonists, 5-HT7 Receptor Antagonists, D2 Receptor Partial Agonists, D2 Receptor Antagonists, D3 Receptor Antagonists, D4 Receptor Antagonists, -adrenergic Receptor Antagonists, mACh Receptor Antagonists, Serotonin Reuptake Inhibitors (SRIs), Norepinephrine Reuptake Inhibitors (NRIs), Selective Serotonin Reuptake Enhancers (SSREs), Sigma Receptor Agonists and Mood Stabilizers.
(149) B. Combination Treatment for Epilepsy
(150) The treatment methods provided in certain aspects can be combined with other treatment of epilepsy such as anticonvulsant medications. For example, drugs for treatment of epileptic seizures include, but are not limited to, carbamazepine (common US brand name Tegretol), clorazepate (Tranxene), clonazepam (Klonopin), ethosuximide (Zarontin), felbamate (Felbatol), fosphenytoin (Cerebyx), gabapentin (Neurontin), lacosamide (Vimpat), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (Trileptal), phenobarbital (Luminal), phenytoin (Dilantin), pregabalin (Lyrica), primidone (Mysoline), tiagabine (Gabitril), topiramate (Topamax), valproate semisodium (Depakote), valproic acid (Depakene), zonisamide (Zonegran), clobazam (Frisium), vigabatrin (Sabril), retigabine, brivaracetam, and seletracetam.
(151) Other drugs are commonly used to abort an active seizure or interrupt a seizure flurry; these include diazepam (Valium, Diastat) and lorazepam (Ativan). Drugs used only in the treatment of refractory status epilepticus include paraldehyde (Paral), midazolam (Versed), and pentobarbital (Nembutal).
(152) Some anticonvulsant medications do not have primary FDA-approved uses in epilepsy but are used in limited trials, remain in rare use in difficult cases, have limited grandfather status, are bound to particular severe epilepsies, or are under current investigation. These include acetazolamide (Diamox), progesterone, adrenocorticotropic hormone (ACTH, Acthar), various corticotropic steroid hormones (prednisone), or bromide.
(153) The goal for individual patients is no seizures and minimal side-effects, and the job of the physician is to aid the patient to find the best balance between the two during the prescribing of anticonvulsants. Some patients can achieve this balance best with monotherapy, the use of a single anticonvulsant medication. Some patients, however, require polypharmacy, the use of two or more anticonvulsants.
(154) If a person's epilepsy cannot be brought under control after adequate trials of two or three (experts vary here) different drugs, that person's epilepsy is generally said to be medically refractory. A study of patients with previously untreated epilepsy demonstrated that 47% achieved control of seizures with the use of their first single drug. 14% became seizure free during treatment with a second or third drug. An additional 3% became seizure-free with the use of two drugs simultaneously.
(155) Other treatments such as the treatment comprising GLO1 inhibitors, in addition to or instead of, anticonvulsant medications may be considered by those people with continuing seizures.
(156) Epilepsy surgery is also an option for people with focal seizures that remain resistant to treatment. The goal for these procedures is total control of epileptic seizures, although anticonvulsant medications may still be required. The evaluation for epilepsy surgery is designed to locate the epileptic focus (the location of the epileptic abnormality) and to determine if resective surgery will affect normal brain function. Physicians will also confirm the diagnosis of epilepsy to make sure that spells arise from epilepsy (as opposed to non-epileptic seizures). The evaluation typically includes neurological examination, routine EEG, Long-term video-EEG monitoring, neuropsychological evaluation, and neuroimaging such as MM, Single photon emission computed tomography (SPECT), positron emission tomography (PET). Some epilepsy centers use intracarotid sodium amobarbital test (Wada test), functional MRI or Magnetoencephalography (MEG) as supplementary tests.
(157) Certain lesions require Long-term video-EEG monitoring with the use of intracranial electrodes if noninvasive testing was inadequate to identify the epileptic focus or distinguish the surgical target from normal brain tissue and function. Brain mapping by the technique of cortical electrical stimulation or Electrocorticography are other procedures used in the process of invasive testing in some patients.
(158) The most common surgeries are the resection of lesions like tumors or arteriovenous malformations, which, in the process of treating the underlying lesion, often result in control of epileptic seizures caused by these lesions.
(159) Other lesions are more subtle and feature epilepsy as the main or sole symptom. The most common form of intractable epilepsy in these disorders in adults is temporal lobe epilepsy with hippocampal sclerosis, and the most common type of epilepsy surgery is the anterior temporal lobectomy, or the removal of the front portion of the temporal lobe including the amygdala and hippocampus. Some neurosurgeons recommend selective amygdalahippocampectomy because of possible benefits in postoperative memory or language function. Surgery for temporal lobe epilepsy is effective, durable, and results in decreased health care costs. Despite the efficacy of epilepsy surgery, some patients decide not to undergo surgery owing to fear or the uncertainty of having a brain operation.
(160) Palliative surgery for epilepsy is intended to reduce the frequency or severity of seizures. Examples are callosotomy or commissurotomy to prevent seizures from generalizing (spreading to involve the entire brain), which results in a loss of consciousness. This procedure can therefore prevent injury due to the person falling to the ground after losing consciousness. It is performed only when the seizures cannot be controlled by other means. Multiple subpial transection can also be used to decrease the spread of seizures across the cortex especially when the epileptic focus is located near important functional areas of the cortex. Resective surgery can be considered palliative if it is undertaken with the expectation that it will reduce but not eliminate seizures.
(161) Hemispherectomy involves removal or a functional disconnection of most or all of one half of the cerebrum. It is reserved for people suffering from the most catastrophic epilepsies, such as those due to Rasmussen syndrome. If the surgery is performed on very young patients (2-5 years old), the remaining hemisphere may acquire some rudimentary motor control of the ipsilateral body; in older patients, paralysis results on the side of the body opposite to the part of the brain that was removed. Because of these and other side-effects, it is usually reserved for patients having exhausted other treatment options.
(162) Other Treatments May Include:
(163) A ketogenic diet (high-fat, low-carbohydrate) was first tested in the 1920s, but became less used with the advent of effective anticonvulsants. In the 1990s specialized diets again gained traction within the medical community. The mechanism of action is unknown. It is used mainly in the treatment of children with severe, medically intractable epilepsies, and the New York Times reported that use is supported by peer-reviewed research that found that the diet reduced seizures among drug-resistant epileptics by >50% in 38% of patients and by >90% in 7% of patients.
(164) While far from a cure, operant-based biofeedback based on conditioning of EEG waves has some experimental support (see Professional practice of behavior analysis). Overall, the support is based on a handful of studies reviewed by Barry Sterman. These studies report a 30% reduction in weekly seizures.
(165) Electrical stimulation methods of anticonvulsant treatment are both currently approved for treatment and investigational uses. A currently approved device is vagus nerve stimulation (VNS). Investigational devices include the responsive neurostimulation system (RNS) and deep brain stimulation (DBS).
(166) Vagus nerve stimulation (US manufacturer Cyberonics) consists of a computerized electrical device similar in size, shape and implant location to a heart pacemaker that connects to the vagus nerve in the neck. The device stimulates the vagus nerve at preset intervals and intensities of current. Efficacy has been tested in patients with localization-related epilepsies, demonstrating 50% of patients experience a 50% improvement in seizure rate. Case series have demonstrated similar efficacies in certain generalized epilepsies, such as Lennox-Gastaut syndrome. Although success rates are not usually equal to that of epilepsy surgery, it is a reasonable alternative when the patient is reluctant to proceed with any required invasive monitoring, when appropriate presurgical evaluation fails to uncover the location of epileptic foci, or when there are multiple epileptic foci.
(167) Responsive neurostimulator system (US manufacturer Neuropace) consists of a computerized electrical device implanted in the skull, with electrodes implanted in presumed epileptic foci within the brain. The brain electrodes send EEG signals to the device, which contains seizure-detection software. When certain EEG seizure criteria are met, the device delivers a small electrical charge to other electrodes near the epileptic focus, which disrupt the seizure. The efficacy of the RNS is under current investigation with the goal of FDA approval.
(168) Deep brain stimulation (U.S. manufacturer Medtronic) consists of a computerized electrical device implanted in the chest in a manner similar to the VNS, but electrical stimulation is delivered to deep brain structures through depth electrodes implanted through the skull. In epilepsy, the electrode target is the anterior nucleus of the thalamus. The efficacy of the DBS in localization-related epilepsies is currently under investigation.
(169) Noninvasive surgery using the gamma knife or other devices used in radiosurgery is currently being investigated as an alternative to traditional open surgery in patients who would otherwise qualify for anterior temporal lobectomy.
(170) Avoidance therapy consists of minimizing or eliminating triggers in patients whose seizures are particularly susceptible to seizure precipitants (see above). For example, sunglasses that counter exposure to particular light wavelengths can improve seizure control in certain photosensitive epilepsies.
(171) Canine warning system is where a seizure response dog, a form of service dog, is trained to summon help or ensure personal safety when a seizure occurs. These are not suitable for everybody, and not all dogs can be so trained. Rarely, a dog may develop the ability to sense a seizure before it occurs. Development of electronic forms of seizure detection systems are currently under investigation.
(172) Seizure prediction-based devices using long-term EEG recordings is presently being evaluated as a new way to stop epileptic seizures before they appear clinically.
(173) Alternative or complementary medicine, including acupuncture, psychological interventions, vitamins and yoga, was evaluated in a number of systematic reviews by the Cochrane Collaboration into treatments for epilepsy, and found there is no reliable evidence to support the use of these as treatments for epilepsy. Exercise or other physical activity have also been proposed as efficacious strategies for preventing or treating epilepsy.
(174) C. Combination Treatments for Sleep Disorders
(175) Sleep disorders can generally be divided into 3 large groups: (1) those producing insomnia (complaints of difficulty falling asleep, staying asleep, or nonrestorative sleep), (2) those with a primary complaint of daytime sleepiness, and (3) those associated with disruptive behaviors during sleepthe disorders of arousal.
(176) Additional sleep disorder treatments that may be used in combination treatments may include, but are not limited to, amitriptyline (Elavil and others), amoxapine (Asendin and others), bupropion (Wellbutrin), buspirone (BuSpar), carbidopa-levodopa (Sinemet and others), citalopram (Celexa), clonazepam (Klonopin and others), clorazepate (Tranxene and others), desipramine (Norpramin and others), desmopressin (DDAVP and others), dextroamphetamine (Dexedrine and others), diazepam (Valium and others), doxepin (Sinequan and others), estazolam (ProSom and others), fluoxetine (Prozac), flurazepam (Dalmane and others), fluvoxamine (Luvox), medroxyprogesterone (Provera and others), methylphenidate (Ritalin and others), mirtazapine (Remeron), modafinil (Provigil), nefazodone (Serzone), nortriptyline (Pamelor and others), paroxetine (Paxil), pemoline (Cylert), pergolide (Permax), phenelzine (Nardil), phenobarbital (Donnatal and others), pramipexole (Mirapex), protriptyline (Vivactil), ropinirole (Requip), selegiline (Eldepryl), sertraline (Zoloft), temazepam (Restoril and others), tranylcypromine (Parnate), trazodone (Desyrel and others), triazolam (Halcion and others), trimipramine (Surmontil), venlafaxine (Effexor), zaleplon (Sonata), zolpidem (Ambien). Particular examples are described in Pagel et al., 2001.
(177) D. Combination Treatments for Alcohol Withdrawal Syndrome
(178) Second treatment of alcohol withdrawal syndrome can be managed with various pharmaceutical medications including barbiturates and clonidine. Certain vitamins are also an important part of the management of alcohol withdrawal syndrome.
(179) Benzodiazepines, such as diazepam or lorazepam, are the most commonly used drug for the treatment of alcohol withdrawal and are generally safe and effective in suppressing alcohol withdrawal signs. Chlordiazepoxide and diazepam are the benzodiazepines most commonly used in alcohol detoxification.
(180) Antipsychotic agents, such as haloperidol, are sometimes used for alcohol withdrawal as an add-on to first-line measures such as benzodiazepines to control agitation or psychosis. Antipsychotics may potentially worsen alcohol withdrawal effects (or other CNS depressant withdrawal states) as they lower the seizure threshold and can worsen withdrawal effects. Clozapine, olanzapine or low potency phenothiazines (e.g. chlorpromazine) are particularly risky; if used, extreme caution is required. There is also concern for this class of drugs prolonging the QT interval, sometimes leading to fatal heart dysrhthmias.
(181) Some evidence indicates that topiramate carbamazepine and other anticonvulsants are effective in the treatment of alcohol withdrawal.
(182) Baclofen has been shown to be as effective as diazepam in uncomplicated alcohol withdrawal syndrome.
(183) Barbiturates are superior to diazepam in the treatment of severe alcohol withdrawal syndromes such as delirium tremens but equally effective in milder cases of alcohol withdrawal.
(184) Clomethiazole (Heminevrin) is a non-benzodiazepine sedative-hypnotic with anticonvulsant effects which is active on the barbiturate site of the GABA-A receptor. Clomethiazole also inhibits the enzyme alcohol dehydrogenase, which is responsible for breaking down alcohol in the body. This slows the rate of elimination of alcohol from the body, which helps to relieve the sudden effects of alcohol withdrawal in alcoholics.
(185) Clonidine has demonstrated superior clinical effects in the suppression of alcohol withdrawal symptoms in a head to head comparison study with the benzodiazepine drug chlordiazepoxide.
(186) Alcohol (ethanol) itself at low doses, but only when given intravenously by medical personnel, has been found to be superior to chlordiazepoxide in the detoxification of alcohol dependent patients.
(187) Flumazenil, which has shown some promise in the management of the benzodiazepine withdrawal syndrome has also demonstrated benefit in a research study in reducing anxiety withdrawal related symptomatology during alcohol withdrawal.
(188) Trazodone has demonstrated efficacy in the treatment of the alcohol withdrawal syndrome. It may have particular use in withdrawal symptoms, especially insomnia, persisting beyond the acute withdrawal phase.
(189) Magnesium appears to be effective in the treatment of alcohol withdrawal related cardiac arrhythmias. It is ineffective in controlling other symptoms of alcohol withdrawal.
(190) Nitrous oxide has been shown to be an effective and safe treatment for alcohol withdrawal.
(191) E. Combination Treatments for Substance Abuse/Dedence/Withdrawal
(192) The additional therapeutic agent provided in combination with a Glo1 inhibitor may be any therapeutic agent that contributes to an aspect of the effective treatment or prevention of the addiction. For example, the additional therapeutic agent may be a drug used to treat an addiction or a drug used to alleviate side-effects associated with physiological withdrawal from an addictive agent. In addition, the additional therapeutic agent may be any drug that affects brain serotonin neurotransmission, such as selective serotonin reuptake inhibitors (SSRIs), and tricyclic and tetracyclic serotonin and norepinephrine reuptake inhibitors (SNRIs) as described below, and serotonin agonists such as sumatriptan, ergonovine, dihydroergotamine and buspirone. In certain embodiments, the additional therapeutic agent is an opioid antagonist, including mixed opioid partial agonist/antagonists, an antidepressant, an antiepileptic, an antiemetic, a dopaminergic agent such as a dopamine D1 receptor agonist, a corticotrophin-releasing factor-1 (CRF-1) receptor antagonist, a selective serotonin-3 (5-HT3) antagonist, a 5-HT2A/2C antagonist such as mianserin, mirtazapine and ketanserin, or a cannabinoid-1 (CB1) receptor antagonist, including but not limited to those therapeutic agents specifically described herein.
(193) 1. Opioid Antagonists
(194) An opioid antagonist acts on one or more opioid receptors. At least three types of opioid receptors, mu, kappa, and delta opioid receptors, have been reported, and opioid antagonists are generally classified by their effects on the opioid receptors. Opioid antagonists may antagonize central receptors, peripheral receptors or both. Naloxone and naltrexone are commonly used opioid antagonist drugs that are competitive in that they bind to the opioid receptors with higher affinity than agonists, but do not activate the receptors. This effectively blocks the receptor, preventing the body from responding to opiates and endorphins.
(195) Many opioid antagonists are not pure antagonists but also produce some weak opioid partial agonist effects, and can produce analgesic effects when administered in high doses to opioid-naive individuals. Examples of such compounds include nalorphine, and levallorphan. However, the analgesic effects from these drugs are limited and tend to be accompanied by dysphoria, most likely due to action at the kappa opioid receptor. Since they induce opioid withdrawal effects in people who are taking, or have previously used, opioid full agonists, these drugs are considered to be antagonists.
(196) Naloxone is one example of an opioid antagonist that has no partial agonist effects. Instead, it is a weak inverse agonist at mu opioid receptors, and is used for treating opioid overdose.
(197) Specific examples of opioid antagonists that may be used include alvimopan, binaltorphimine, buprenorphine, cyclazocine, cyclorphan, cypridime, dinicotinate, beta-funaltrexamine, levallorphan, methylnaltrexone, nalbuphine, nalide, nalmefene, nalmexone, nalorphine, nalorphine dinicotinate, naloxone, naloxonazine, naltrendol, naltrexone, naltrindole, oxilorphan, and pentazocine.
(198) 2. Antidepressents
(199) Antidepressents are drugs used to treat depression. The three neurotransmitters believed to be involved in depression are serotonin, dopamine, and norepinephrine. Certain types of antidepressants increase the levels of one or more of these neurotransmitters in the brain by blocking their reabsorption.
(200) Several different classes of antidepressants have been identified, including selective serotonin reuptake inhibitors (SSRIs), tricyclic and tetracyclic serotonin and norepinephrine reuptake inhibitors (SNRIs), norepinephrine reuptake inhibitors (NRIs), norepinephrine and dopamine reuptake inhibitors (NDRIs), azaspirones, monoamine oxidase inhibitors (MAOIs), and atypical antidepressants.
(201) SSRIs include, e.g., cericlamine, citalopram, clomipramine, cyanodothiepin, dapoxetine, duloxetine, escitalopram, femoxetine, fluoxetine, fluvoxamine, ifoxetine, imipramine, indalpine, indeloxazine, litoxetine, lofepramine, mianserine, milnacipran, mirtazapine, nefazadone, nortriptyline, paroxetine, sertraline, sibutramine, tomoxetine, trazodone, venlafaxine, and zimeldine.
(202) Amitriptyline, amoxapine, butriptyline, clomipramine, demexiptiline, desipramine, dibenzepin, dimetacrine, dothiepin, doxepin, imipramine, iprindole, lofepramine, maprotiline, melitracen, metapramine, mianserin, mirtazpine, nortriptyline, propizepine, protriptyline, quinupramine, setiptiline, tianeptine, and trimipramine are all tricyclic and tetracyclic antidepressants.
(203) SNRIs include, e.g., amoxapine, atomoxetine, bicifadine, desipramine, desvenlafaxine, duloxetine, maprotiline, milnacipran, nefazodone, reboxetine, sibutramine, and venlafaxine.
(204) Nisoxetine, nortriptyline, reboxetine, talsupram, and tomoxetine are all examples of NRIs.
(205) NDRIs include, e.g., bupropion, hydroxybupropion, and tesofensine.
(206) Azaspirones include, e.g., buspirone, gepirone, ipsapirone, tandospirone, and tiaspirone. Buspirone is an anxiolytic (partial agonist at 5-HT1 autoreceptors) that may be provided with an anti-depressant such as an SSRI.
(207) Specific MAOIs include, e.g., amiflamine, brofaromine, clorgyline, alpha-ethyltryptamine, iproclozide, iproniazid, isocarboxazid, mebanazine, moclobemide, nialamide, pargyline, phenelzine, pheniprazine, pirlindole, safrazine, selegiline, toloxatone, and tranlcypromine.
(208) Atypical antidepressants include, e.g., amesergide, amineptine, benactyzine, bupropion, clozapine, fezolamine, levoprotiline, lithium, medifoxamine, mianserin, minaprine, olanzapine, oxaflozane, oxitriptan, rolipram, teniloxazine, tofenacin, trazodone, tryptophan, and viloxazine.
(209) 3. Antiepileptics
(210) The anticonvulsants, also called anti-epileptic drugs (AEDs) are a diverse group of drugs used in prevention of the occurrence of epileptic seizures and bipolar disorders AEDs suppress the rapid and excessive firing of neurons that begins a seizure and/or prevents the spread of the seizure within the brain and offer protection against possible excitotoxic effects that may result in brain damage. Many anticonvulsants block sodium channels, calcium channels, AMPA receptors, or NMDA receptors.
(211) Anti-epileptic agents include, but are not limited to, benzodiazepines, barbituates, valproates, GABA agents, iminostilibenes, hydantoins, NMDA antagonists, sodium channel blockers and succinamides.
(212) Benzodiazepines include, e.g., alprazolam, chlordiazepoxide, cholrazepate, clobazam, clonazepam, diazepam, halazapam, lorazepam, oxazepam, and prazepam.
(213) Barbiturates used as anti-epileptics include, e.g., amobarbital, mepobarbital, methylphenobarbital, pentobarbital, phenobarbital, and primidone.
(214) Valproates used as anti-epileptics include, e.g., sodium valporate, valproic acid, valproate semisodium, and valpromide.
(215) Anti-epileptic GABA agents include, e.g., gabapentin, losigamone, pregabalin, retigabine, rufinamide, and vigabatrin.
(216) Carbamazepine and oxcarbazepine are examples of iminostilbenes.
(217) Hydantoins include, e.g., fosphenyloin sodium, mephenyloin, and phenyloin sodium.
(218) NMDA antagonists such as harkoseramide are used as anti-epileptics.
(219) Sodium channel blockers such as lamotrigine are also anti-epileptic agents.
(220) Succinimides include, e.g., ethosuximide, methsuximide, and phensuximide.
(221) Other anti-epileptic drugs include acetazolamide, briveracetam, CBD cannabis derivative, clomthiazole edisilate, divalproex sodium, felbamate, isovaleramide, lacosamide, lamotrigine, levetiracetam, methanesulphonamide, talampanel, tiagabine, topiramate, safinamide, seletracetam, soretolide, stiripentol, sultiam, valrocemide, and zonisamide.
(222) 4. Antiemetics
(223) Antiemetics are drugs effective against vomiting and nausea. Antiemetics are typically used to treat motion sickness and the side effects of opioid analgesics, general anaesthetics, and chemotherapy.
(224) Classifications of antiemetics include, e.g., 5-hydroxytryptamine 3 (5-HT3) receptor antagonists, histamine receptor antagonists, dopamine receptor antagonists, muscarinic receptor antagonists, acetyl choline receptor antagonists, cannabinoid receptor antagonists, limbic system inhibitors, NK-1 receptor antagonists, corticosteroids, tachykinin antagonists, GABA agonists, cannabinoids, benzodiazepines, anticholinergics, and substance P inhibitors.
(225) 5-HT3 receptor antagonists include, e.g., alosetron, azasetron, bemesetron, cilansetron, dolasetron, granisetron, indisetron, itasetron, ondansetron, palonosetron, propisetron, ramosetron, renzapride, tropisetron, and zatosetron.
(226) Coritcosteroid antiemetics include dexamethasone and methylprednisolone.
(227) Lymbic system inhibitors include alprazolam, lorazepam, and midazolam.
(228) Dopamine receptor antagonists include diphenhydramine, dronabinol, haloperidol, metoclopramide, and prochlorperazine.
(229) NK-1 receptor antagonists used as an antiemetic include aprepitant and morpholine, and an example of a GABA agonist is propofol.
(230) Thiethylperazine is a type of histamine receptor antagonist.
(231) Cannabinoid receptor antagonists or agonists used as antiemetics include dronabinol, nabilone, rimonabant, tanarabout, and tetrahydrocannabinol.
(232) Examples of other antiemetics include acetylleucine, monoethanolamine, alizapride, benzquinamide, bietanautine, bromopride, buclizine, chlorpromazine, clebopride, cyclizine, dimenhydrinate, dipheniodol, domperidone, dranisetron, meclizine, methalltal, metopimazine, oxypendyl, pipamazine, piprinhydrinate, scopolamine, thioproperzaine, and trimethobenzamide.
(233) 5. Cannabinoid Receptor Antagonists
(234) The cannabinoid receptors are a class of the G-protein coupled receptor superfamily. Their ligands are known as cannabinoids. There are currently two known subtypes, CB1 which is expressed mainly in the brain, but also in the lungs, liver, and kidney, and CB2, which is mainly expressed in the immune system and in hematopoietic cells. It is also believed that there are novel cannabinoid receptors that is, non-CB1 and non-CB2, which are expressed in endothelial cells and in the CNS. Cannabinoid receptor antagonists may be selective for either the CB1 or CB2 receptor. For example, either or both CB1 and CB2 receptor antagonists can be used.
(235) Addictive agents (e.g., alcohol, opiates, Delta(9)-tetrahydrocannabinol (Delta(9)-THC) and psychostimulants, including nicotine) elicit a variety of chronically relapsing disorders by interacting with endogenous neural pathways in the brain. In particular, they share the common property of activating mesolimbic dopamine brain reward systems, and virtually all abused drugs elevate dopamine levels in the nucleus accumbens. Cannabinoid-1 (CB1) receptors are expressed in this brain reward circuit and modulate the dopamine-releasing effects of Delta(9)-THC and nicotine.
(236) Rimonabant (SR141716), a CB1 receptor antagonist, blocks both the dopamine-releasing and the discriminative and rewarding effects of Delta(9)-THC in animals. Although CB1 receptor blockade is generally ineffective in reducing the self-administration of cocaine in rodents and primates, it reduces the reinstatement of extinguished cocaine-seeking behavior produced by cocaine-associated conditioned stimuli and cocaine priming injections. Similarly, CB1 receptor blockade is effective in reducing nicotine-seeking behavior induced by re-exposure to nicotine-associated stimuli. In human clinical trials, rimonabant was shown to block the subjective effects of Delta(9)-THC in humans and prevents relapse to smoking in ex-smokers.
(237) Other examples of cannabinoid receptor CB1 antagonists include SR141716A (rimonabant), rosanabant, taranabant and CP-945598.
(238) 6. Dopaminergic Agents
(239) Drug addiction is a chronic, relapsing disease characterized by a loss of control over drug use, compulsive drug seeking and craving for a substance, use that persists despite negative consequences, and physical and/or psychological dependence on the substance. A fundamental role in the pathogenesis of addiction has been attributed to dopamine. Dopamine, in fact, has permeated the natural history of drug addiction at all levels, from its involvement in shaping individual response to vulnerability factors (i.e., genetics, environmental and stress) to its role in the mechanism of action of the drugs of abuse.
(240) The mesocorticolimbic dopamine system originates in the ventral tegmental area (VTA), which prominently projects to the nucleus accumbens (NAc) and the prefrontal cortex (PPC). It is a defining commonality of all addictive drugs that at least initially they stimulate dopamine transmission in the terminal areas of the mesolimbic system and in particular in the nucleus NAc shell. Nestler, E. J., is there a common molecular pathway for addiction? Nat Neurosci 8:1445-1449 (2005); Pierce, R. C., et al., The mesolimbic dopamine system: The final common pathway for the reinforcing effect of drugs of abuse? Neurosci Biobehav Rev 30:215-238 (2006). Brain imaging studies have extended these observations to humans. Drevets, W. C., et al., Amphetamine-induced dopamine release in human ventral striatum correlates with euphoria, Biol Psychiatry 49:81-96 (2001); Brody A. L., et al., Smoking-induced ventral striatum dopamine release, Am J Psychiatry 161:1211-1218 (2004). The release of dopamine from these projections is thought to play an important role in mediating drug reward, reinforcement and in the induction of compulsive addictive behaviour. Although dopamine is involved in the predisposition and in the initial stages of the development of drug addiction, this condition, once established, is associated with long-lasting changes related to the chronic exposure to the drugs themselves.
(241) These changes are collectively indicated as neuroadaptive and are thought to be the substrate of behavioural sensitization, a long-lasting increase in the sensitivity to the behavioural stimulant properties of drugs and of changes in the baseline of hedonic state (hedonic allostasis). Berridge K. C., et at, What is the role of dopamine in reward: Hedonic impact, reward learning, or incentive salience? Brain Res Rev 28:309-369 (1998); Koob, G. F., et al., Neurobiological mechanisms for opponent motivational processes in addiction, Philos Trans R Soc. Lond B Biol Sci. 363:3113-3123 (2008). Neuroadaptations occurs also at the level of the dopamine system, where a relative reduction in the basal level of activity of dopamine transmission in ventral striatal areas and a reduction in dopamine D2-receptor levels has been documented. Volkow, N. D., et al., Dopamine in drug abuse and addiction: results from imaging studies and treatment implications, Mol Psychiatry 9:557-569 (2004); Volkow, N. D., et al., Dopamine in drug abuse and addiction: results from imaging studies and treatment implications, Arch Neurol 64:1575-1579 (2007); Fehr, C. et al., Association of low striatal dopamine d2 receptor availability with nicotine dependence similar to that seen with other drugs of abuse, Am Psychiatry 165:507-514 (2008).
(242) The most common mechanism through which drugs of abuse result in dopamine neurotransmission is through modulation of VTA presynaptic -aminobutyric acid (GABA) activity. Lscher, C., et al., The mechanistic classification of addictive drugs, PLoS Med 3:e437 (2006). In the VTA, GABA neurons act as local inhibitory interneurons playing a tonic control on corticomesolimbic dopamine cells. Reduction in GABA neurotransmission leads to a net disinhibition of dopamine neurons and increased dopamine release in terminal areas such as the NAc and in the PFC.
(243) A prototypical example of this mechanism is offered by opiates that following activation of opioid receptors located onto presynaptic GABA cells lead to a marked inhibition of GABAergic neurotransmission resulting in disinhibition of VTA dopaminergic cells. Johnson, S. W., et al., Opioids excite dopamine neurons by hyperpolarization of local interneurons, J Neurosci 12:483-488 (1992). Cannabis derivatives appear to increase VIA dopamine firing rate with a similar mechanism but through selective activation of cannabinoid receptor 1 (CB1R) located on presynaptic GABA neurons. Also nicotine, increases dopamine neurotransmission but through a complex interplay of actions of nicotinic receptors on GABA and on glutamatergic inputs to dopamine neurons. Lscher C, et al., The mechanistic classification of addictive drugs, PLoS Med. 3(11):e437 (2006). In fact, nicotine through 2-containing nAChRs decreases presynaptic GABA release leading to a prolonged disinhibition of dopamine, at the same time acting on homomeric 7-containing nAChRs, which are mainly expressed on synaptic terminals of excitatory glutamatergic afferents on dopamine neurons in the VTA, facilitating glutamate release. This effect may also contribute to nicotine-evoked dopamine release. Furthermore, recent evidence suggests that nicotine directly modulates dopamine release in the NAc. Ethanol and benzodiazepines also appear to stimulate VTA dopamine neurotransmission through inhibition of presynaptic GABA activity via modulation of specific GABA-A receptors subunits.
(244) Psychostimulants like amphetamine derivatives and cocaine, comprise a class of addictive drugs that act directly on dopaminergic terminals by inhibiting dopamine reuptake mechanisms or by facilitating dopamine release from synapses. Through these mechanisms they increase extracellular dopamine levels in terminal areas (i.e., NAc and MPF) of the brain dopamine system. Most notably, however, dopamine terminals are also present in the VTA where D1- and D2-like receptors are expressed on dopaminergic cell bodies (autoreceptors) as well as on glutamatergic and GABAergic presynaptic neurons. Direct application of cocaine in the VIA results in a reduction or to an increase (depending on the dose) of dopamine firing rate, an effect that could be potentially mediated by D1 receptors located onto presynaptic GABA and glutamate cells, respectively. Hence presynaptic modulation of VTA DA activity may play a role also in the regulation of the addictive properties of psychostimulants. Brodie, M. S., et al., Cocaine effects in the ventral tegmental area. Evidence for an indirect dopaminergic mechanism of action Naunym Schmiedebergs Arch Pharmacol 342:660-665 (1990); Bonci, A., et al., Increased probability of GABA release during withdrawal from morphine, J Neurosci 17:796-803 (1997).
(245) Accordingly, in one embodiment the additional therapeutic agent administered in combination, concurrently or sequentially with a Glo1 inhibitor is a dopaminergic agent to treat a patient suffering from an addiction or compulsive disorder. In another embodiment, the Glo1 inhibitor is administered in combination, concurrently or sequentially with a dopamine receptor agonist to treat a patient suffering from an addiction or impulse control disorder. In another embodiment, the Glo1 inhibitor is administered in combination, concurrently or sequentially with a dopamine D1 receptor agonist (i.e., a dopamine subtype D1 receptor agonist) to treat a patient suffering from an addiction or impulse control disorder.
(246) Exemplary dopaminergic agents suitable for administration in conjunction with Glo1 inhibitors include, for example, levodopa (also referred to as L-dopa), carbidopa, and dopamine receptor agonists and precursors such as bromocriptine, pergolide, pramipexole, ropinirole, cabergoline, apomorphine, lisuride, rotigotine and quinagolide, as well as fenoldopam, which is selective for dopamine receptor D1.
(247) Suitable dosages of D1 receptor agonists for administration in conjunction with a Glo1 inhibitor may be determined by medical practitioners but may be, for example, in the range of 0.1 mg to 1,000 mg per day or biweekly, or 0.25 mg to 100 mg per day or biweekly.
VI. Regimes of Combination Treatments
(248) In one aspect, it is contemplated that a GLO1 inhibitor therapy is used in conjunction with other treatment. Alternatively, the therapy may precede or follow the other agent treatment by intervals ranging from minutes to weeks. In embodiments where the other agents and/or a proteins or polynucleotides are administered separately, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agent and antigenic composition would still be able to exert an advantageously combined effect on the subject. In such instances, it is contemplated that one may administer both modalities within about 12-24 h of each other or within about 6-12 h of each other. In some situations, it may be desirable to extend the time period for administration significantly, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations.
(249) Various combinations may be employed, for example antibiotic therapy is A and the Glo1 inhibitor is B:
(250) TABLE-US-00001 A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A
(251) Administration of the compositions of certain aspects to a patient/subject will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the composition, or other compositions described herein. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, such as hydration, may be applied in combination with the described therapy.
VII. GLO1 Inhibitors
(252) Certain aspects provide compounds useful as GLO1 inhibitors for preventing or treating neurological diseases or disorders. The GLO1 inhibitors may be inhibitory nucleic acids, antibodies or small molecules.
(253) In particular aspects, the GLO1 inhibitor may be a small molecule. For example, the GLO1 inhibitor may have a glutathione group, such as an S-substituted glutathione or an S-substituted glutathione prodrug, particularly S-bromobenzylglutathione cyclopentyl diester (BrBzGCp2). In certain aspects, the GLO1 inhibitor may not have a glutathione group.
(254) Other known GLO1 inhibitor may be a 1-hydroxy-6,7-diphenylpyridin-2-one derivative, a flavonoid, a curcumin, a benzothiazole derivative, or a 4-(7-azaindole)-substituted 6-phenyl-N-hydroxypyridones, or 4,6-diphenyl-N-hydroxypyridon (Chiba 2012, which is hereby incorporated by reference). For example, the GLO1 inhibitor may be called 3d and has an IC.sub.50 value of 11 nM.
(255) For example, the GLO1 inhibitors may be S-substituted glutathiones or corresponding prodrugs. The inventors have shown that the GLO1 inhibitor pBBG (i.e., S-bromobenzylglutathione cyclopentyl diester (BrBzGCp2)) (Vince 1971, which is hereby incorporated by reference) has anti-anxiety effects in behavioral mouse models, is non-sedating, and increases the concentration of MG in the brain (Distler 2012, which is hereby incorporated by reference). pBBG, like other GLO1 inhibitors (Vince 1971; Al-Timari 1986; Lo 1992; Hamilton 1992; Murthy 1994; More 2009; each of which is hereby incorporated by reference), is based on the GSH scaffold and has been patented for a variety of disorders (Creighton 2000; U.S. Pat. Nos. 3,984,569; 5,616,563; 5,969,174; WO/1998/009986; WO/1999/035128; each of which is hereby incorporated by reference). Numerous 5-substituted glutathione GLO1 inhibitors are known, such as, for example, the reversible competitive inhibitors including: S(N-p-chlorophenyl-N-hydroxycarbamoyl)glutathione, S(N-p-bromophenyl-N-hydroxycarbamoyl)glutathione, S(N-p-iodophenyl-N-hydroxycarbamoyl)glutathione, S(N-phenyl-N-hydroxycarbamoyl)glutathione, S-p-bromobenzyl-glutathione, and S(N-alkyl-N-hydroxycarbamoyl)glutathione (where alkyl is methyl, ethyl, n-propyl, n-butyl, n-pentyl and n-hexyl. Particularly examples are S(N-aryl/alkyl-N-hydroxycarbamoyl)glutathiones.
(256) Other S-substituted glutathiones or S-substituted glutathione prodrug(s) include irreversible inactivators. Irreversible inactivators of certain aspects may be compounds of the formula S(CH.sub.2C(O)ORO C(O)CH.sub.2X) glutathione, wherein R is selected from the group consisting of alkylene (C.sub.1-C.sub.20), (poly)ethylene glycol (CH.sub.2CH.sub.2O).sub.1-20, (poly)ethylene amine (CH.sub.2CH.sub.2N).sub.1-20, and arylene (C.sub.6-C.sub.20), and wherein X is a halogen. According to certain aspects, irreversible inactivators may be employed as monovalent GLO1 inactivators, or alternatively, employed as bivalent inhibitors in combination with other inhibitors such as irreversible inactivators or reversible competitive inhibitors.
(257) Particular examples of irreversible inactivators are compounds of the formula CH.sub.2C(O)O(CH.sub.2).sub.nOC(O)CH.sub.2X) glutathione, wherein n is 2 through 6 and wherein X is a halogen. Particularly examples of irreversible inactivators are S-(bromoacetoxy butyl acetoxy)glutathione and S-(bromoacetoxy propyl acetoxy)glutathione. Computational docking of these compounds into the X-ray crystal structure of GLO1 indicates that the 5-substituents are ideally positioned to alkylate the sulfhydryl group of Cys60 in the active site, which is located about 12 to 13 Angstroms from the sulfur atom of the bound inactivators. Other irreversible inactivators are accommodated by the GLO1 active site, especially where the S-substituent is able to assume a bowed conformation in the active site, allowing the haloacetyl function to be positioned near Cys60.
(258) Exemplary irreversible inactivators may have bromoacetoxy, chloroacetoxy, acryloyl and crotonyl groups. Particular examples are irreversible inactivators having a bromoacetoxy group. For example, U.S. Pat. No. 5,616,563, which is hereby incorporated by reference, describes methods of synthesis for S(N-hydroxycarbamoyl)glutathione derivatives including: S(N-p-chlorophenyl-N-hydroxycarbamoyl)glutathione, S(N-p-bromophenyl-N-hydroxycarbamoyl)glutathione, S(N-p-iodophenyl-N-hydroxycarbamoyl)glutathione, S(N-phenyl-N-hydroxy-carbamoyl)glutathione. Moreover, the synthesis of the S(N-aryl/alkyl-N-hydroxycarbamoyl)glutathiones is described by Kalsi, et al, J. Med. Chem. 2000, 43, 3981-3986, which is hereby incorporated by reference.
(259) As used herein, the term S-substituted glutathione prodrug refers to any [glycyl, glutamyl] dialkyl, diaryl or diarylalkyl ester or [glycyl] or [glutamyl] mono-alkyl, mono-aryl or mono-arylalkyl esters of an S-substituted glutathione. Exemplary embodiments include mono- or diethyl esters, mono- or di-n-propyl or mono- or diisopropyl esters, and mono- or di-cyclopentyl esters. The rates of cellular accumulation of the prodrugs described above are believed to increase with increasing hydrophobicity of the ester functions, as accumulation involves simple passive diffusion across the cell membrane (Kavarana 1999).
(260) According to certain aspects, any GLO1 inhibitors (for example as described in U.S. Pat. No. 7,700,560, which is hereby incorporated by reference) may be linked together to increase binding affinity for the enzyme over the monovalent form of the inhibitor. Particularly example may be the linking of a relatively high affinity reversible competitive inhibitor, such as CHG, to a lower affinity irreversible inactivator, such as S-(bromoacetoxy butyl acetoxy)glutathione and S-(bromoacetoxy propyl acetoxy)glutathione.
(261) While any S-substituted glutathione may be employed according to certain aspects, one skilled in the art understands that the hydrophobicity of the S-substituent correlates with a higher affinity for the human GLO1 active site. Moreover, the S(N-aryl-N-hydroxycarbamoyl)-glutathione derivatives bind especially tightly to the active site of GLO1, as these compounds mimic the stereoelectronic features of the tightly bound transition state formed along the reaction coordinate of the enzyme during normal catalysis. In certain embodiments, one or more of the GLO1 inhibitors discussed herein may not be used, or may be excluded, in methods or compositions.
(262) In other aspects, GLO1 inhibitors may be inhibitory nucleic acids. Examples of an inhibitory nucleic acid include but are not limited to siRNA (small interfering RNA), short hairpin RNA (shRNA), double-stranded RNA, an antisense oligonucleotide, a ribozyme and a nucleic acid encoding thereof. An inhibitory nucleic acid may inhibit the transcription of a gene or prevent the translation of a gene transcript in a cell. An inhibitory nucleic acid may be from 16 to 1000 nucleotides long, and in certain embodiments from 18 to 100 nucleotides long. In certain embodiments, the inhibitory nucleic acid is an isolated nucleic acid that binds or hybridizes to a GLO1 nucleotide sequence and inhibits the expression of a gene that encodes GLO1.
(263) In some embodiments, GLO1 inhibitors may be antibodies, such as a monoclonal antibody or a polyclonal antibody. In further embodiments, the antibody is selected from the group consisting of a chimeric antibody, an affinity matured antibody, a humanized antibody, and a human antibody. In some embodiments, the antibody is an antibody fragment. In some embodiments, the antibody is a Fab, Fab, Fab-SH, F(ab).sub.2, or scFv.
(264) In one embodiment, the antibody is a chimeric antibody, for example, an antibody comprising antigen binding sequences from a non-human donor grafted to a heterologous non-human, human or humanized sequence (e.g., framework and/or constant domain sequences). In one embodiment, the non-human donor is a mouse. In one embodiment, an antigen binding sequence is synthetic, e.g., obtained by mutagenesis (e.g., phage display screening, etc.). In one embodiment, a chimeric antibody may have murine V regions and human C region. In one embodiment, the murine light chain V region is fused to a human kappa light chain or a human IgG1 C region.
(265) Examples of binding include, without limitation: (i) the Fab fragment, consisting of VL, VH, CL and CH1 domains; (ii) the Fd fragment consisting of the VH and CH1 domains; (iii) the Fv fragment consisting of the VL and VH domains of a single antibody; (iv) the dAb fragment, which consists of a VH domain; (v) isolated CDR regions; (vi) F(ab)2 fragments, a bivalent fragment comprising two linked Fab fragments; (vii) single chain Fv molecules (scFv), wherein a VH domain and a VL domain are linked by a peptide linker which allows the two domains to associate to form a binding domain; (viii) bi-specific single chain Fv dimers (see U.S. Pat. No. 5,091,513, which is hereby incorporated by reference) and (ix) diabodies, multivalent or multispecific fragments constructed by gene fusion (US Patent Pub. 2005/0214860, which is hereby incorporated by reference). Fv, scFv or diabody molecules may be stabilized by the incorporation of disulphide bridges linking the VH and VL domains. Minibodies comprising a scFv joined to a CH3 domain may also be made (Hu et al, 1996, which is hereby incorporated by reference).
VIII. Pharmaceutical Formulations and Modes of Administration
(266) Pharmaceutical compositions in accordance with certain embodiments comprise an effective amount of one or more GLO1 inhibitors or additional active ingredient dissolved or dispersed in a pharmaceutically acceptable carrier.
(267) As used herein, the term pharmaceutically acceptable refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem complications commensurate with a reasonable benefit/risk ratio. The term pharmaceutically acceptable carrier, means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a chemical agent.
(268) The pharmaceutical composition can be introduced to a subject by any method known to those of ordinary skill in the art. Examples may include, but not be limited to administration intravenously, intradermally, intrathecally, intraarterially, intraperitoneally, intramuscularly, subcutaneously; orally, intrarectally, mucosally (intranasal, intravaginal, etc.), topically (e.g. transdermally), locally, via inhalation (e.g., aerosol inhalation), via injection, via infusion, via continuous infusion, via localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference).
(269) The pharmaceutical composition may be formulated into a composition in a free base, neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
(270) In embodiments where the composition is in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods. It may include isotonic agents, such as, for example, sugars, sodium chloride or combinations thereof.
(271) The GLO1 inhibitors described herein can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, or even intraperitoneal routes. The preparation of an aqueous composition that contains GLO1 inhibitors will be known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for use to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and, the preparations can also be emulsified. In addition to the compounds formulated for parenteral administration, other pharmaceutically acceptable forms include, e.g., aerosolizable, inhalable, or instillable formulations; tablets or other solids for oral administration; time release capsules; creams; lotions; mouthwashes; and the like. The preparation of such formulations will be known to those of skill in the art in light of the present disclosure.
(272) The pharmaceutical forms suitable for injectable use may include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that it may be easily injected. It also should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. In certain embodiments the active ingredient is combined with a liquid for intravenous administration.
(273) The carrier also can be a solvent or dispersion medium containing, e.g., water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it may include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
(274) Sterile injectable solutions may be prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Dispersions may be prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation are, e.g., vacuum-drying and freeze-drying techniques, which yield a powder of the active ingredient, plus any additional desired ingredient from a previously sterile-filtered solution thereof.
(275) The actual dosage amount of a composition in accordance with certain embodiments administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a particular dosage and/or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
(276) Some variation in dosage will necessarily occur depending on the condition of the subject. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. An effective amount of therapeutic or prophylactic composition is determined based on the intended goal. The term unit dose or dosage refers to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of the composition calculated to produce the desired responses discussed above in association with its administration, i.e., the appropriate route and regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the effects desired. Precise amounts of the composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the subject, route of administration, intended goal of treatment (alleviation of symptoms versus cure), and potency, stability, and toxicity of the particular composition.
(277) Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically or prophylactically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above.
(278) Typically, for a human adult (weighing approximately 70 kilograms), from about 0.1 mg to about 3000 mg (including all values and ranges there between), or from about 5 mg to about 1000 mg (including all values and ranges there between), or from about 10 mg to about 100 mg (including all values and ranges there between), of a compound are administered. It is understood that these dosage ranges are by way of example only, and that administration can be adjusted depending on the factors known to the skilled artisan.
IX. Definitions
(279) The use of the word a or an, when used in conjunction with the term comprising in the claims and/or the specification may mean one, but it is also consistent with the meaning of one or more, at least one, and one or more than one.
(280) Throughout this application, the term about is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
(281) The terms comprise, have and include are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as comprises, comprising, has, having, includes and including, are also open-ended. For example, any method that comprises, has or includes one or more steps is not limited to possessing only those one or more steps and also covers other unlisted steps.
(282) The term effective, as that term is used in the specification and/or claims, means adequate to accomplish a desired, expected, or intended result.
(283) As used herein, the term IC.sub.50 refers to an inhibitory dose which is 50% of the maximum response obtained.
(284) As used herein, the term patient or subject refers to a living mammalian organism, such as a human, monkey, cow, sheep, goat, dog, cat, mouse, rat, guinea pig, or transgenic species thereof. In certain embodiments, the patient or subject is a primate. Non-limiting examples of human subjects are adults, juveniles, infants and fetuses.
(285) Pharmaceutically acceptable means that which is useful in preparing a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable and includes that which is acceptable for veterinary use as well as human pharmaceutical use.
(286) Pharmaceutically acceptable salts means salts of compounds which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity. Such salts include acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or with organic acids such as 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, 2-naphthalenesulfonic acid, 3-phenylpropionic acid, 4,4-methylenebis(3-hydroxy-2-ene-1-carboxylic acid), 4-methylbicyclo[2.2.2]oct-2-ene-1-carboxylic acid, acetic acid, aliphatic mono- and dicarboxylic acids, aliphatic sulfuric acids, aromatic sulfuric acids, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, carbonic acid, cinnamic acid, citric acid, cyclopentanepropionic acid, ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, heptanoic acid, hexanoic acid, hydroxynaphthoic acid, lactic acid, laurylsulfuric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, muconic acid, o-(4-hydroxybenzoyl)benzoic acid, oxalic acid, p-chlorobenzenesulfonic acid, phenyl-substituted alkanoic acids, propionic acid, p-toluenesulfonic acid, pyruvic acid, salicylic acid, stearic acid, succinic acid, tartaric acid, tertiarybutylacetic acid, trimethylacetic acid, and the like. Pharmaceutically acceptable salts also include base addition salts which may be formed when acidic protons present are capable of reacting with inorganic or organic bases. Acceptable inorganic bases include sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide and calcium hydroxide. Acceptable organic bases include ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine and the like. It should be recognized that the particular anion or cation forming a part of any salt is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002).
(287) Prevention or preventing includes: (1) inhibiting the onset of a neurological disease, disorder, or condition in a subject or patient which may be at risk and/or predisposed to the disease, disorder or condition but does not yet experience or display any or all of the pathology or symptomatology of such, and/or (2) slowing the onset of the pathology or symptomatology of a neurological disease, disorder, condition in a subject or patient which may be at risk and/or predisposed to the neurological disease, disorder, condition but does not yet experience or display any or all it the pathology or symptomatology.
(288) Prodrug means a compound that is convertible in vivo metabolically into an inhibitor according to embodiments discussed herein. The prodrug itself may or may not also have activity with respect to a given target protein. For example, a compound comprising a hydroxy group may be administered as an ester that is converted by hydrolysis in vivo to the hydroxy compound. Suitable esters that may be converted in vivo into hydroxy compounds include acetates, citrates, lactates, phosphates, tartrates, malonates, oxalates, salicylates, propionates, succinates, fumarates, maleates, methylene-bis--hydroxynaphthoate, gentisates, isethionates, di-p-toluoyltartrates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, cyclohexylsulfamates, quinates, esters of amino acids, and the like. Similarly, a compound comprising an amine group may be administered as an amide that is converted by hydrolysis in vivo to the amine compound.
(289) Therapeutically effective amount or pharmaceutically effective amount means that amount which, when administered to a subject or patient for treating the neurological disease or disorder, is sufficient to effect such treatment.
(290) Treatment and treating refer to administration or application of a therapeutic agent to a subject or performance of a procedure or modality on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition. For example, a treatment may include administration of a pharmaceutically effective amount of a nucleic acid that inhibits GLO1 for the purposes of minimizing the symptoms of a neurological disease or disorder. Treatment or treating includes (1) inhibiting neurological disease or disorder in a subject or patient experiencing or displaying the pathology or symptomatology of the neurological disease, disorder, or condition (e.g., arresting further development of the pathology and/or symptomatology), (2) ameliorating the neurological disease, disorder or condition in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease (e.g., reversing the pathology and/or symptomatology), and/or (3) effecting any measurable decrease in the disease, disorder or condition in a subject or patient that is experiencing or displaying the relevant pathology or symptomatology.
(291) As used herein, the term water soluble means that the compound dissolves in water at least to the extent of 0.010 mole/liter or is classified as soluble according to literature precedence.
(292) As used herein, the term mood disorder refers to a group of diagnoses in the Diagnostic and Statistical Manual of Mental Disorders (DSM IV TR) classification system where a disturbance in the person's mood is hypothesized to be the main underlying feature. The classification is known as mood (affective) disorders in ICD 10. Examples of mood disorders include depression or bipolar disorders.
(293) As used herein, the term depression refers to a mental disorder typically characterized by a lasting sad mood and/or lost of interest or pleasure in most activities. Examples of depression disorders which may be treated using an effective amount of a named compound or pharmaceutically acceptable salt thereof include, but are not limited to: major depressive disorder also known as major depression, unipolar disorder, or clinical depression; major depressive episode; atypical depression; depression (mood); melancholic depression; psychotic depression; and postpartum depression.
(294) As used herein, the term anxiety refers to an anxiety disorder. Examples of anxiety disorders which may be treated using an effective amount of a named compound or pharmaceutically acceptable salt thereof include, but are not limited to: panic attack; agoraphobia; acute stress disorder; specific phobia; panic disorder; psychoactive substance anxiety disorder; organic anxiety disorder; obsessive-compulsive anxiety disorder; posttraumatic stress disorder; generalized anxiety disorder; and anxiety disorder NOS.
(295) As used herein, the term sleep disorder refers to a disruptive pattern of sleep arising from many causes. Examples of sleep disorders which may be treated using an effective amount of a named compound or pharmaceutically acceptable salt thereof include, but are not limited to: insomnia (e.g., transient, short-term, and chronic), delayed sleep phase syndrome, hypnotic-dependent sleep disorder, and stimulant-dependent sleep disorder; disorders associated with difficulties in staying awake such as sleep apnea, narcolepsy, restless leg syndrome, obstructive sleep apnea, central sleep apnea, idiopathic hypersomnia, respiratory muscle weakness-associated sleep disorder; disorders associated with difficulties in adhering to a regular sleep schedule such as sleep state misperception, shift work sleep disorder, chronic time zone change syndrome, and irregular sleep-wake syndrome; disorders associated with abnormal behaviors such as sleep terror disorder (e.g., parasomnia) and sleepwalking (e.g., somnambulism); and other disorders such as sleep bruxism, fibromyalgia, and nightmares.
(296) As used herein, the term epilepsy refers to a disorder of brain function characterized by recurrent unprovoked seizures.
(297) The above definitions supersede any conflicting definition in any of the reference that is incorporated by reference herein. The fact that certain terms are defined, however, should not be considered as indicative that any term that is undefined is indefinite. Rather, all terms used are believed to describe the invention in terms such that one of ordinary skill can appreciate the scope and practice the present invention.
X. Examples
(298) The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. One skilled in the art will appreciate readily that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those objects, ends and advantages inherent herein. The present examples, along with the methods described herein are presently representative of certain embodiments, are provided as an example, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.
Example 1Glo1 Copy Number Regulates Glo1 Expression and Anxiety-Like Behavior
(299) A/J Mice Segregate a CNV Including Glo1
(300) Previous work identified a CNV in mice that caused a duplication of four genes including Glo1 and was positively correlated with Glo1 expression and anxiety-like behavior (Williams 2009). A previous survey of CNVs across the mouse genome suggested different Glo1 copy numbers among A/J mice (Egan 2007). Therefore, the inventors investigated whether A/J mice segregated the Glo1 CNV and whether this affected Glo1 expression and anxiety-like behavior. In contrast to previous studies of the Glo1 CNV, the present experiment investigated the effect of the CNV on a near-isogenic background.
(301) The inventors obtained 50 A/J mice from Jackson Laboratories (JAX) and used quantitative real-time PCR (qPCR) to measure Glo1 copy number relative to C57B1/6J (B6) mice, which do not carry the duplication. qPCR results revealed Glo1 copy numbers ranging from 2.17 to 4.46 (Table 1). In a pilot study of the Glo1 copy number assay, DBA/2J (D2) mice, which carry the Glo1 duplication, showed an average qPCR value of 2.03 (average minimum, 1.8; average maximum, 2.3). The inventors concluded that the qPCR values were accurate to approximately 0.25 copies. The inventors used this criterion to assign whole and half Glo1 copy numbers to each animal. For instance, mice with qPCR values between 1.75 and 2.25 were classified as having 2 copies, while those with values between 2.25 and 2.75 were classified as having 2.5 copies. Using these criteria, A/J mice from JAX were classified as having 2-4.5 copies of Glo1 (Table 1).
(302) TABLE-US-00002 TABLE 1 Glol copy number in A/J mice obtained from JAX (Glol copy number was measured by qPCR, and copy numbers were assigned based on the following criteria: 2 copies, 2.25; 2.5 copies, 2.26-2.75; 3 copies, 2.76.) Initial copy number Revised copy number Animal ID qPCR Results assignment assignment 24426 3.08 3 3 24427 3.14 3 3 24428 2.88 3 3 24429 3.04 3 3 24430 3.05 3 3 24431 3.03 3 3 24432 3.40 3.5 3 24433 3.50 3.5 3 24434 3.65 3.5 3 24435 3.01 3 3 24436 2.70 2.5 2.5 24437 3.07 3 3 24438 3.17 3 3 24439 3.33 3.5 3 24440 2.86 3 3 24441 3.66 3.5 3 24442 3.59 3.5 3 24443 3.47 3.5 3 24444 3.14 3 3 24445 3.02 3 3 24446 2.63 2.5 2.5 24447 3.32 3.5 3 24448 2.81 3 3 24449 3.83 4 3 24450 4.46 4.5 3 24451 3.51 3.5 3 24452 3.74 3.5 3 24453 2.89 3 3 24454 2.77 3 3 24455 2.69 2.5 2.5 24456 2.43 2.5 2.5 24457 3.11 3 3 24458 3.31 3.5 3 24459 3.01 3 3 24460 2.62 2.5 2.5 24461 3.32 3.5 3 24462 3.22 3 3 24463 2.17 2 2 24464 2.88 3 3 24465 3.02 3 3 24466 2.95 3 3 24467 3.36 3.5 3 24468 2.90 3 3 24469 3.15 3 3 24470 2.80 3 3 24471 2.68 2.5 2.5 24472 2.89 3 3 24473 2.70 2.5 2.5 24474 3.42 3.5 3 24475 2.71 2.5 2.5
(303) Next, the inventors investigated whether the different copy numbers bred true by forming breeder pairs homozygous for whole Glo1 copy numbers (2, 3, and 4). Because only one A/J mouse obtained from JAX had 2 copies of Glo1, the inventors used an intermediate breeding step. The mouse with 2 copies of Glo1 was bred with a mouse with 2.5 copies, and the resulting 2-copy offspring formed a homozygous breeder pair. Breeders homozygous for 2 copies produced offspring with 2 copies of Glo1, and those homozygous for 3 copies produced offspring with 3 copies of Glo1 (
(304) The inventors then used qPCR to measure Glo1 mRNA expression in the brains of mice homozygous for 2 and 3 copies of Glo1. Similar to the inventors' previous findings (Williams 2009), increased Glo1 copy number was positively correlated with increased Glo1 expression (
(305) Next, the inventors used the OF test to assess anxiety-like behavior in A/J mice obtained from JAX. Mice with high Glo1 copy numbers spent less time in the center of the OF compared to mice with low Glo1 copy numbers (
(306) Based on these data, the inventors conclude that a Glo1 CNV segregates among A/J mice and regulates Glo1 expression. Although there was some evidence suggesting that increased copies of Glo1 increased anxiety-like behavior in A/J mice, the data were inconclusive. This highlights the need for additional studies of Glo1's effect on anxiety using different genetic backgrounds.
(307) Generation of BAC Transgenic Mice
(308) In order to investigate GLO1's role in anxiety and overcome limitations of previous experiments, the inventors generated mice with a transgenic bacterial artificial chromosome (BAC) containing the Glo1 gene and its cis-regulatory elements. BAC transgenic (Tg) mice are widely used in neuroscience research (Heintz 2001). Traditional transgenes are susceptible to positional effects: their expression can be affected by insertion site, resulting in variegated, ectopic, uncontrolled, or silenced expression (Giraldo 2003). BACs, on the other hand, are large enough to contain the cis-regulatory elements necessary for accurate transgene expression (Yang 2005). This partially protects BACs from positional effects, allowing for copy number-dependent transgene expression (Heintz 2001; Yang 2005; Chandler 2007). Nevertheless, multiple lines of Tg mice should be tested in order to establish the transgene's true effect and to control for remaining positional effects.
(309) The use of BAC Tg mice for investigating Glo1's effect on anxiety had several advantages over previous studies. First, Glo1 was expressed under its endogenous promoter elements, which accurately reflected its physiological effects. This was superior to studies using viral vectors, which overexpressed Glo1 in only one brain region during adulthood (Hovatta 2005). Second, the inventors ablated the transcriptional start sites of the genes in the BAC flanking Glo1 by inserting ampicillin and kanamycin cassettes into the first exons of each gene, respectively (
(310) The inventors generated three lines of BAC Tg mice on a B6 background. The inventors measured BAC copy number in each line using qPCR: Tg lines had 2, 8, and 10 copies of the BAC (
(311) TABLE-US-00003 TABLE 2 General health and behaviors of wild-type and transgenic mice Tg Proportion BAC Proportion higher or Toe Ear Whisker Whisker Eye Visual Copy of Tg lower vs. Body Righting pinch twitch placing orienting blink placing Balance Line Number Offspring expected Position reflex reflex reflex response reflex reflex response.sup. beam B6 WT 0 6 6/6 6/6 6/6 6/6 6/6 6/6 6/6 0.333 Line 1 2 0.398* Lower 6 3/3 3/3 3/3 3/3 3/3 3/3 3/3 0.333 Line 2 8 0.458 6 3/3 2/3 3/3 3/3 3/3 3/3 3/3 0.333 Line 3 10 0.363* Lower 6 4/4 4/4 4/4 4/4 4/4 4/4 4/4 0.25 FVB WT 0 6 6/6 6/6 6/6 6/6 6/6 6/6 0.333 Line 1 2 0.418* Lower Line 2 7 0.500 6 4/4 4/4 4/4 4/4 4/4 4/4 0.5 Line 3 28 0.636* Higher 6 1/1 1/1 1/1 1/1 1/1 1/1 0 Line 4 35 0.356* Lower 6 2/2 2/2 2/2 2/2 2/2 2/2 0 Line 5 50 0.478 6 2/2 2/2 2/2 2/2 2/2 2/2 0 The proportion of Tg mice produced from each line was measured. The expected proportion was 0.5; deviation from the expected rate was assessed by a Chi-square test. Tg proportions that significantly differed from expected are indicated by an asterisk (*). All together, 4 lines had lower, 1 line had higher, and 3 lines had the expected Tg proportion. WT and Tg mice from B6 and FVB lines were tested for body position, neurological reflexes, vision, and motor coordination. Body position was scored on a scale of 1-8 (223) and is reported as mean. Presence (1) or absence (0) of reflexes was measured; data are reported as fraction of mice with the reflex present. The balance beam test was used to assess motor coordination; data are reported as mean footslips. .sup.The visual placing reflex was not measured in FVB mice, because they are homozygous for the Pde6b.sup.rd1 allele, which results in early onset retinal degeneration (http://jaxmice.jax.org/strain/001800.html).
(312) In order to investigate the relationship between Glo1 copy number and expression, the inventors measured Glo1 mRNA using qPCR. Tg mice showed a copy number-dependent increase in Glo1 mRNA in the brain (
(313) Next, the inventors used a microarray to investigate differential gene expression in the brains of WT and Tg mice from B6 line 3. Importantly, the inventors confirmed that Tg mice did not overexpress the ablated genes in the BAC, Dnahc8 and Btbd9 (Table 3). This indicates that Tg mice should suitably model Glo1's effect on anxiety without the confounding effect of other genes in the CNV.
(314) TABLE-US-00004 TABLE 3 Microarray data of brain mRNA expression in wild-type and transgenic mice Probe set Gene mRNA Fold change Validated by qPCR Validated by qPCR ID symbol accession Genomic location (Tg v. WT) q-value in Tg line 3? in all Tg lines? 10536444 Foxp2 NM_053242 chr6:15135506-15391977 0.64 0.0029* Yes No 10449644 Glo1 NM_025374 chr17:30729807-30749604 2.81 0.0029* Yes Yes 10543145 Thsd7a NM_001164805 chr6:12261608-12699253 0.63 0.0029* Yes No 10471675 Glo1 NM_025374 chr17:30729807-30749604 2.85 0.0099* Yes Yes 10536407 Phf14 NM_029404 chr6:11875881-12031198 0.53 0.022* Yes No 10543134 Ndufa4 NM_010886 chr6:11850373-11857446 0.58 0.027* Yes No 10449631 Btbd9 NM_027060 chr17:30352469-30713232 1.19 0.99 10443598 Dnahc8 NM_013811 chr17:30940008-30950175 1.11 0.99 10449652 Dnahc8 NM_013811 chr17:30940008-30950175 0.99 Whole-brain mRNA was purified from WT and Tg littermates from B6 line 3. P-values were converted to q-values, and q-values < 0.05 were considered statistically significant (indicated by an asterisk). Only genes that were significantly differentially expressed between WT and Tg were measured by qPCR. qPCR data for Glo1 are presented in FIG. 4. qPCR data for Foxp2, Thsd7a, Phf14, and Ndufa4 are not shown. n = 5 WT, 5 Tg from B6 Line 3.
Anxiety-Like Behavior in Tg Mice
(315) The inventors used male Tg mice to investigate the effect of Glo1 overexpression on anxiety-like behavior in the OF test, which was sensitive to differential Glo1 expression in previous studies (Hovatta 2005; Williams 2005).
(316) Tg mice displayed a significant, copy number-dependent decrease in center time compared to WT mice (
(317) Generation and Characterization of FVB BAC Tg Mice
(318) Because previous studies of GLO1's role in anxiety-like behavior have yielded conflicting results (Hovatta 2005; Kromer 2005; Williams 2009), it was suggested that GLO1's effect could be mouse strain-specific (Thornalley 2006). Therefore, the inventors generated five additional lines of Tg mice on a FVB/NJ (FVB) background to assess the generalizability of GLO1's anxiogenic effect. FVB Tg mice showed increased Glo1 copy number by qPCR with 2, 7, 28, 36, and 49 copies (
(319) Effect of Glo1 Overexpression on Anxiety-Like Behavior in Additional Tests
(320) In order to more thoroughly assess GLO1's role in anxiety, the inventors tested WT and Tg mice in two additional tests, the LD box test and the EPM. In the LD box test, Tg mice spent significantly less time in the light compartment compared to WT mice (Table 4). WT and Tg mice did not significantly differ in the number of transitions between the compartments, which indicates normal locomotor activity (Bourin 2003; Bouwknecht 2008). In the EPM, Tg mice made fewer entries into the open arms compared to WT mice (Table 5). WT and Tg mice did not differ in the number of total arm entries, again indicating normal locomotor activity. Together, these behavioral data corroborate findings from the OF test and demonstrate that Glo1 overexpression increases anxiety-like behavior.
(321) TABLE-US-00005 TABLE 4 Glol overexpression increases anxiety-like behavior in the light-dark box test Genotype n % Time in Light P-value B6 WT 10 40.5 3.3 0.028 B6 Tg 12 31.6 2.1 FVB WT 11 37.5 4.3 0.041 FVB Tg 10 26 2.8
(322) TABLE-US-00006 TABLE 5 Glol overexpression increases anxiety-like behavior in the elevated plus maze (WT and Tg littermates from FVB line 4 were tested in the EPM. Tg mice made significantly fewer entries into the open arms compared to WT mice, indicating increased anxiety-like behavior. WT and Tg mice did not differ in total number of arm entries. Data are mean SEM. P-values were determined by two-tailed t-tests.) Genotype n % Open Arm Entries P-value Total Entries P-value FVB WT 8 35.2 3.7 0.044 19.6 1.5 0.20 FVB Tg 10 22.8 4.1 15.9 2.2
(323) The inventors also measured fear learning in WT and Tg mice using a FC paradigm. WT and Tg mice did not significantly differ in fear learning (data not shown). This contrasts with the results from the OF, LD box, and EPM tests. While fear learning and innate anxiety share similar neural substrates (Ponder 2007; Lissek 2005), they are distinct phenotypes. Previous work in the inventors' lab also demonstrated that the Glo1 duplication did not affect fear learning in outbred CD-1 mice, which segregate the Glo1 CNV (unpublished data).
Conclusions
(324) In BAC Tg mice, Glo1 copy number regulated Glo1 expression and anxiety-like behavior. This corroborates previous findings suggesting that a CNV underlies differential Glo1 expression and anxiety-like behavior among inbred mouse strains. Furthermore, this finding helps resolve the previous discrepancy in the literature and demonstrates that Glo1 overexpression increases anxiety-like behavior.
Example 2Glo1 Increases Anxiety by Reducing Methylglyoxal Concentration in the Brain
(325) MG Clearance and Concentration in Tg Mice
(326) The inventors explored the molecular mechanism underlying GLO1's anxiogenic effect using the B6 line with the highest copy number (B6 Tg line 3). Given GLO1's known role in clearing MG (Thornalley 2003), the inventors hypothesized that GLO1 increases anxiety by regulating MG concentration. First, the inventors measured MG metabolism in WT and Tg mice using a GLO1 enzymatic activity assay. Brain tissue from Tg mice metabolized a hemithioacetal substrate, formed from MG and glutathione, more rapidly than brain tissue from WT mice (
(327) The concentration of MG measured in the brain (5 M, Table 6) was within the previously reported range: 1.5 to 175 M (Hambsch 2010; Kurz 2011). Using the same detection method, the inventors found that the MG concentration in the plasma was 720 nM (150 nM, n=3). Again, this was within the range previously reported for blood, plasma, and serum: 50 nM to 4.5 M (Jia 2007; Wang 2008; Dhar 2009; Randella 2005; Lu 2011). Interestingly, the concentration of MG in the brain was higher than that in blood, suggesting that MG concentration in the brain could regulate anxiety-like behavior.
(328) MG is Anxiolytic
(329) Glo1 overexpression reduced MG concentration in the brain and increased anxiety-like behavior. Therefore, the inventors hypothesized that MG is anxiolytic and that GLO1 increases anxiety by reducing endogenous MG concentration. To test this hypothesis, the inventors administered MG intra-peritoneally (i.p.) to male WT mice. First, the inventors confirmed that MG treatment dose-dependently increased MG concentrations in the brain (
(330) TABLE-US-00007 TABLE 6 Methylglyoxal concentration in the brain with and without exogenous methylglyoxal administration Relative MG Estimated MG MG concentration concentration concentration Treatment (nmol/g tissue) (%) (M).sup. Vehicle 4.89 0.43 100.00 5.13 MG (50 mg/kg) 5.66 0.36 115.75 5.94 MG (100 mg/kg) 6.23 0.26 127.40 6.54 MG (300 mg/kg) 7.87 0.56 160.94 8.26
(331) The inventors then used a three-pronged approach to establish the validity and robustness of MG's anxiolytic effect. First, the inventors performed six replication studies to independently confirm MG's anxiolytic effect in the OF test. A meta-analysis of the replication studies demonstrated that MG treatment had a large effect on anxiety-like behavior (Cohen's d=0.78; meta-analysis z-score=5.0) that was highly significant (P<10.sup.5) (
(332) TABLE-US-00008 TABLE 7 Meta-analysis of methylglyoxal's anxiolytic effect in the open field test (A meta-analysis was performed on a total of seven individual experiments (the first demonstration plus six replication studies) using a fixed-effect model. Total n = 181. The meta-analysis revealed that MG had a large effect on anxiety-like behavior (Cohen's d = 0.78). The result was statistically significant (P < 0.0001). There was no significant heterogeneity among the studies.) Meta-analysis Cohen's d 0.7798 95% CI lower limit 0.4747 95% CI upper limit 1.0848 Meta-analysis z-score 5.0096 P-value <0.0001 Heterogeneity Q 4.0687 P-value 0.6674 H 1 95% CI lower limit 95% CI upper limit 1.8509 I.sup.2 0% 95% CI lower limit 0% 95% CI upper limit 70.81% t.sup.2 0 Q-index 0%
Increasing MG Levels Reverses GLO1's Anxiogenic Effect
(333) The inventors then investigated whether increasing MG concentration could reverse GLO1's anxiogenic effect. In CD-1 mice, which segregate a Glo1 CNV, the Glo1 duplication increased anxiety-like behavior (Williams 2009) (
(334) MG is Anxiolytic when Acutely and Chronically Administered
(335) The inventors performed time course experiments to further characterize MG's effects. First, the inventors administered an anxiolytic dose of MG (50 mg/kg) to separate cohorts of mice and tested them at different intervals after injection. The inventors found that MG's anxiolytic effect persisted until 20 minutes after injection and diminished thereafter (
(336) Next, the inventors investigated MG's chronic anxiolytic effect. The inventors administered a low dose of MG (4 mg/kg) twice daily for five days and tested mice in the OF on the sixth day. Mice chronically treated with MG displayed a significant reduction in anxiety-like behavior compared to vehicle-treated mice (
Conclusions
(337) Tg mice had an increased capacity for clearing MG and a corresponding reduction in MG concentration. Further, administration of exogenous MG was anxiolytic. MG's acute and short-acting effects suggest that changes in MG concentration are linked to rapid behavioral effects. MG's anxiolytic effect upon chronic administration suggests that long-term differences in MG concentration between WT and Tg mice could account for their differential anxiety-like behavior.
Example 3Glo1 Inhibition Increases Methylglyoxal Concentration and Reduces Anxiety-Like Behavior
(338) The inventors hypothesized that a reduction in GLO1 activity would have an opposite effect from Glo1 overexpression on anxiety-like behavior. To test this hypothesis, the inventors obtained S-bromobenzylglutathione cyclopentyl diester (BrBzGCp2), a previously described GLO1 inhibitor (Vince 1971; Thornalley 1996), and confirmed its ability to inhibit GLO1 enzymatic activity in vitro (
(339) Genetic Reduction in Glo1 Expression
(340) Glo1 Knockout Mice are not Viable
(341) These results indicate that Glo1 overexpression increases anxiety-like behavior and that pharmacological inhibition of GLO1 reduces anxiety-like behavior. Therefore, the inventors hypothesized that a genetic reduction in Glo1 expression would reduce anxiety-like behavior in mice.
(342) To test this, the inventors first attempted to generate Glo1 knockout mice. The inventors obtained embryonic stem (ES) cells with gene-trapped Glo1 alleles from Texas A&M Institute for Genomic Medicine (TIGM). Gene trapping is a technique that allows a gene-trap vector, which contains a splice acceptor followed by a stop codon and polyadenylation sequence, to prematurely terminate the transcribed portion of a gene (Hansen 2008). The inventors obtained four ES cell lines from TIGM with gene-trap vectors inserted between the first and second exons of Glo1. The ES cells were injected into mouse blastocysts and implanted into pseudo-pregnant females by the Transgenic Core Facility at the University of Chicago. Unfortunately, Glo1 gene-trapped mice were not successfully generated. There were few gene-trap positive founders: only three positive males were produced from four rounds of injection with each of the four ES cell lines. The founders were poor breeders and produced no gene-trap positive offspring. Therefore, the inventors concluded that generation of Glo1 knockout mice was difficult, if not impossible, due to reduced viability even in heterozygous mice.
(343) Characterization of Glo1 Knockdown Mice
(344) Because the inventors were unable to generate Glo1 knockout mice, the inventors utilized mice with a transgenic siRNA targeting Glo1, termed Glo1 knockdown (KD) mice. These mice were previously reported to have reduced GLO1 enzymatic activity (Queisser 2010). The inventors used qPCR to measure Glo1 mRNA expression in the brain and peripheral tissues of KD mice. KD mice had reduced Glo1 mRNA expression in all tissues assayed, although the level of knockdown varied by tissue type. In the eye, KD mice exhibited a 70% knockdown of Glo1 expression compared to WT mice (
(345) Next, the inventors investigated whether KD mice had altered MG handling. In the brain, KD mice had a 25% reduction in GLO1 enzymatic activity compared to WT mice (
(346) The inventors then measured anxiety-like behavior in Glo1 KD mice using the OF test. Glo1 KD mice did not significantly differ from WT mice in time spent exploring the center of the OF (
Conclusions
(347) Glo1 overexpression increased anxiety-like behavior, and GLO1 inhibition reduced anxiety-like behavior. However, in Glo1 KD mice, which exhibited a 25% reduction in GLO1 enzymatic activity, there was no change in MG concentration or anxiety-like behavior. This suggests that an increase in MG concentration requires a dramatic reduction in GLO1 activity.
Example 4Methylglyoxal is an Endogenous Partial Agonist at GABA.SUB.A .Receptors
(348) MG does not Exert its Anxiolytic Effect Through Inducing Cytotoxicity
(349) The inventors next explored the molecular mechanism underlying MG's anxiolytic effect. MG is best characterized as a cytotoxic agent that induces AGEs and apoptosis, although neither process has a known mechanistic role in anxiety. Nevertheless, a previous study reported that intracerebroventricular administration of MG reduced anxiety-like behavior coincident with AGE formation (Hambsch 2010). This group utilized a high dose of MG that exceeded the anxiolytic concentration of approximately 6 M (Table 6). Specifically, they administered 7 mol of MG into the cerebrospinal fluid (CSF) via the third ventricle. This corresponds to a concentration of 17.5 mM throughout the CSF, assuming a CSF volume of 0.04 mL (Johanson 2008), and an average concentration of 1.6 mM throughout the brain, assuming a brain volume of 0.45 mL (www.mbl.org). Administration of this excessive dose over a prolonged time course could have induced AGEs independent of MG's anxiolytic effect. In contrast, the inventors found that a low dose of MG was anxiolytic within minutes of administration; this time course is inconsistent with AGE formation, which requires hours to days (Lo 1994). As such, the inventors considered AGE formation to be an unlikely candidate in mediating MG's effect on anxiety.
(350) Similarly, MG's apoptotic effect is not relevant to its effect on anxiety. In vitro, MG concentrations of 100-1,000 M induce neuronal cell death (Di Loreto 2008; Di Loreto 2004; Li 2010). On the other hand, an anxiolytic dose of MG increased the concentration of MG in the brain to approximately 6 M (Table 6), a concentration well below that leading to neuronal apoptosis. In addition, MG requires hours to days to induce apoptosis (Di Loreto 2008), which is inconsistent with MG's acute behavioral effects. The inventors further ruled out apoptosis as the mechanism underlying MG's anxiolytic effect by using in situ TUNEL staining to quantify apoptosis in the brains of mice twenty-four hours after treatment with MG (
(351) MG has GABAergic Properties In Vivo
(352) To gain insight into MG's mechanism of action in the brain, the inventors examined its pharmacological properties at higher doses in WT B6 mice. At 100 mg/kg, MG caused decreased locomotion in the OF (
(353) MG Activates GABA.sub.A Receptors
(354) To test the hypothesis that MG activates GABA.sub.A receptors, the inventors studied MG's electrophysiological effects on primary cerebellar granule neurons (CGN) using current-clamp recording to assess neuronal membrane potential (V.sub.m) and voltage-clamp recording to measure ionic currents. In whole-cell current-clamp mode, extracellular application of MG rapidly depolarized CGN in a concentration-dependent manner (
(355) The inventors next established that MG's electrophysiological effects were specific to GABA.sub.A receptor activation. MG did not affect the major sodium currents (
(356) The inventors also compared the baseline electrophysiological properties of CGN cultured from WT and Tg mice. Neurons from Tg mice were more excitable, displaying a diminished potassium leak current (IKso), a depolarized V.sub.m, and increased cellular input resistance (
(357) MG is a Competitive Partial Agonist at GABA.sub.A Receptors
(358) After establishing that MG activates GABA.sub.A receptors, the inventors investigated whether MG acts competitively or non-competitively with GABA. To do this, the inventors co-applied MG and GABA to CGN at 100 concentrations that saturate the GABA.sub.A receptor response, indicating that binding sites are maximally occupied. Consistent with
(359) MG Diffuses Across the Plasma Membrane to Activate GABA.sub.A Receptors
(360) Endogenous MG is generated intracellularly; therefore, the inventors investigated MG's intracellular effects on GABA.sub.A receptors using macropatches of plasma membrane. When applied to the intracellular face, MG elicited an inward current following a latency of approximately 40 seconds; this current was inhibited when SR was applied to the extracellular face, suggesting that MG crosses the plasma membrane by diffusion to activate GABA.sub.A receptors (
(361) MG Activates Multiple GABA.sub.A Receptor Subtypes Across Different Neuronal Types
(362) The inventors next investigated MG's GABAergic effects in different neuronal types and at different GABA.sub.A receptor subtypes. First, the inventors demonstrated that MG's electrophysiological effects in CGN were similar in primary cultures of hippocampal neurons (HN) (
(363) The inventors next investigated MG's specificity for GABA.sub.A receptor subtypes. GABA.sub.A receptors are pentamers comprised of various combinations of at least 16 possible subunits: 1-6, 1-3, 1-3, , , , and (Bollan 2003). Different subunits and subunit compositions are thought to mediate different GABAergic effects. For instance 2 subunits are thought to mediate the anxiolytic effects of benzodiazepines, while 5 subunits largely mediate their sedative effects (Rudolph 2011). Investigating MG's receptor subunit selectivity may elucidate its endogenous role in the CNS. Therefore, the inventors co-applied 10 M MG to HN with different subtype-selective positive modulators of GABA currents. Similar to GABA-evoked currents, MG-evoked currents were increased by co-application of diazepam, midazolam, and zolpidem (
Conclusions
(364) In vivo, MG has a pharmacodynamic profile characteristic of GABA.sub.A receptor agonists, including anxiolysis, locomotor depression, hypothermia, and sedation. MG activates GABA.sub.A receptors in vitro and is a partial competitive agonist across a range of GABA.sub.A receptor subtypes and neuronal cell types. Together, these data demonstrate an important physiological role for MG as a GABA.sub.A receptor agonist.
(365) Behavioral and Electrophysiological Effects of Pure Methylglyoxal
(366) The behavioral experiments described above utilized a crude MG preparation obtained from Sigma-Aldrich. Crude preparations of MG have been reported to contain contaminants, such as formaldehyde and methanol (Pourmotabbed 1986; McLellen 1992). Although the exact concentrations of these contaminants in the inventors' MG preparation are unknown, they could have had biological effects in vivo and in vitro. Therefore, the inventors obtained MG free of impurities, as verified by nuclear magnetic resonance spectroscopy. The inventors investigated the effects of pure MG in vivo, including behavior in the OF test, locomotor depression, ataxia, and hypothermia. Pure MG had similar pharmacological effects as crude MG. At a low dose, pure MG was anxiolytic in the OF test (
(367) MG's electrophysiological effects described above were studied using pure MG. However, the inventors also confirmed that pure MG and crude MG had identical electrophysiological effects in CGN (
Example 5Glo1's Role in Depression
Background
(368) The inventors have established that GLO1 mediates anxiety-like behavior by regulating endogenous levels of MG, a GABA.sub.A receptor agonist. The inventors predicted that this pathway is applicable to neurological phenotypes in addition to anxiety. Therefore, the inventors investigated the roles of MG and GLO1 in other disorders with a known GABAergic component, including depression and epilepsy. The inventors also recognized the utility of the inventors' Tg mouse model for assessing non-behavioral phenotypes associated with Glo1 overexpression. In particular, the inventors investigated metabolic phenotypes in Tg mice given the well-established association between GLO1 and diabetes.
(369) Affective disorders are common psychiatric conditions that are divided into depressive and bipolar disorders. Depressive disorders are characterized by depressive episodes and depressed mood; bipolar disorders are characterized by manic episodes, often with depressive episodes as well (American Psychiatric Association 2000). There is strong evidence for a shared genetic vulnerability to anxiety and depression (Cerda 2010). Benton et al. found a positive correlation between GLO1 protein levels and baseline depression-like behavior as well as anxiety-like behavior across a panel of inbred mice (Benton 2011). This suggests that Glo1 contributes to the common genetic etiology of anxiety and depression.
(370) Deficits in the GABA system are thought to contribute to depression (Luscher 2011; Hasler 2011). Depressed patients have reduced GABA levels in the plasma and cerebrospinal fluid (Petty 1981; Petty 1984; Gerner 1981) and altered expression of GABA.sub.A receptor-encoding genes (Luscher 2011). Furthermore, mice heterozygous for the null allele of the 2 GABA.sub.A receptor subunit show increased anxiety-like and depression-like behavior (Crestani 1999; Shen 2010; Earnheart 2007). Therefore, the inventors hypothesized that GLO1 regulates both anxiety and depression through modulating GABAergic tone. Accordingly, the inventors investigated the effects of Glo1 overexpression and MG administration in the tail-suspension test (TST), a mouse model of depression (O'Leary 2009). In this model, mice are suspended by their tails for several minutes, representing an inescapable stressor (O'Leary 2009). Initially, mice display escape behaviors, including running, jerking, and writhing. Eventually, mice exhibit behavioral despair and display immobility, the duration of which reflects depression-like behavior (O'Leary 2009). The inventors utilized the TST, because it has excellent predictive validity, and several studies have suggested that it is sensitive to genetic factors underlying depression (O'Leary 2009). Further, Benton et al. used the TST to establish a positive correlation between GLO1 and depression-like behavior (Benton 2011).
(371) Glo1 Overexpression Increases Depression-Like Behavior
(372) First, the inventors tested WT and Tg mice from FVB Tg line 3 in the TST. Tg mice had a longer duration of immobility than WT mice (
(373) Glo1 overexpression increases both anxiety-like behavior and depression-like behavior. Given the role of GABAergic signaling in depression, it is possible that GLO1 increases depression by reducing MG concentration. Although acute administration of MG did not affect depression-like behavior in mice, further experiments are required to investigate this possibility.
Example 6Methylglyoxal Levels Modulate Seizure Susceptibility and Severity
Background
(374) Epileptic seizures are transient interruptions of brain function due to abnormal (e.g., excessive or synchronous) neuronal activity (Fischer 2005). Epilepsy is a neurological disorder characterized by a predisposition toward epileptic seizures (Fischer 2005). It is not a single disease, but rather a group of disorders that share seizures as a common manifestation (Noe 2011). Epilepsy is a complex trait with multiple genetic, non-genetic, and interacting causes (Mulley 2005). In the majority of patients with epilepsy, there is no known genetic cause (Rees 2010). Unfortunately, current anti-epileptic drugs (AEDs) have adverse side effects and are not effective in all patients (Brodie 2011; Perucca 2011; Rossetti 2011). Therefore, identifying novel genes and biological pathways underlying epilepsy will provide valuable insight into its pathogenesis as well as therapeutic targets.
(375) Abundant clinical and experimental evidence has demonstrated that mutations in GABA.sub.A receptor-encoding genes perturb GABA.sub.A receptor signaling and cause epileptic seizures (Briggs 2011; Galanopoulou 2010). Furthermore, several well-established AEDs activate or potentiate GABA.sub.A receptors, including carbamazepine, phenobarbital, and valproate (Perucca 2011). Given the prominent role of GABA.sub.A receptors in epilepsy and MG's action at GABA.sub.A receptors, the inventors hypothesized that MG would protect against epileptic seizures. This would represent an endogenous pathway whereby a metabolic byproduct could influence inhibitory tone via GABA.sub.A receptors and affect downstream seizure phenotypes.
(376) MG Treatment Reduces Seizure Severity and Duration
(377) The inventors investigated whether MG could prevent or attenuate seizures by administering exogenous MG (50 and 200 mg/kg) to mice before seizure induction. After pre-treatment with MG, the inventors induced seizures using picrotoxin. Picrotoxin is a GABAA receptor antagonist that induces generalized convulsions in mice (Fisher 1989). Pre-treatment with MG dose-dependently attenuated generalized convulsions. Specifically, MG treatment delayed seizure onset (
(378) Next, the inventors induced seizures using a second pharmacological agent, pilocarpine, which is a muscarinic cholinergic agonist that induces severe, continuous limbic seizures (Curia 2008). The inventors scored pilocarpine-induced seizures on a five-stage scale that reflects seizure severity (Winawer 2011). The inventors pre-treated mice with MG (50 and 200 mg/kg) and then induced seizures with 250 mg/kg pilocarpine. This dose of pilocarpine induced partial status epilepticus (stage 3 seizures) but not generalized status epilepticus. MG pre-treatment dose-dependently delayed seizure onset (
(379) GLO1 Inhibition Reduces Seizure Severity
(380) To explore the therapeutic potential of increasing endogenous levels of MG, the inventors treated mice with BrBzGCp2, which increased MG concentration in the brain by approximately 20% when administered at 30 mg/kg (
(381) Differential Glo1 Overexpression Affects Seizure Susceptibility and Severity
(382) Finally, the inventors explored whether genetic changes that affect MG concentration affect epileptic seizures. This may provide a link between the complex genetic architecture underlying epilepsy and MG, a novel mediator of seizures in mice. Specifically, the inventors focused on Glo1. The inventors hypothesized that mice with increased Glo1 expression would display increased seizure susceptibility and severity.
(383) The inventors first utilized data from BXD recombinant inbred (RI) lines (Shifman 2006; Peirce 2004; Williams 2001), which are derived from intercrosses between B6 and D2 inbred strains. The D2 strain carries a genomic duplication of Glo1, while the B6 strain does not (Williams 2009). The inventors assessed the correlation between the Glo1 duplication and published seizure phenotypes in these lines, specifically their susceptibility to high pressure-induced seizures. In this seizure model, mice exposed to increasing pressure in a helium-oxygen atmosphere suffer from progressive convulsive seizures (McCall 1981; Mansfield 1980; Lever 1971). This model is clinically relevant, because patients with epilepsy have an increased susceptibility to seizures at high atmospheric pressure (Doherty 2007). Previous studies identified a locus on chromosome 17 associated with seizure susceptibility at high atmospheric pressure among BXD RI lines (McCall 1981; Plomin 1991). The inventors used tools at Gene Network (www.genenetwork.org) to demonstrate that the locus for seizure susceptibility co-localized with that of Glo1 expression, which the inventors previously attributed to the Glo1 duplication (
(384) BXD RI lines are a convenient population for investigating the effects of differential Glo1 expression on seizure susceptibility. However, there are numerous genetic differences between the lines, making it impossible to establish a causal relationship with a particular variant. Furthermore, genes in linkage disequilibrium with a particular variant could contribute to the phenotype of interest, leading to spurious associations. In order to more directly test Glo1's effect on seizures, the inventors employed FVB Tg mice overexpressing Glo1. FVB Tg mice had approximately 20% less MG in the brain than WT mice (
Conclusions
(385) The present results demonstrate an important physiological role for MG in reducing seizure susceptibility and severity. Increasing endogenous MG by GLO1 inhibition had a similar effect and may be a useful therapeutic strategy. Finally, polymorphisms in Glo1 that regulate MG concentration may contribute to the genetic underpinnings of epilepsy.
Example 7Tre Use of Glo1 Inhibitors as a Treatment for Depression
(386) This Example focuses on GLO1's potential as an anti-depressant. An independent group found that Glo1 overexpression increased immobility on the tail-suspension test (TST; Benton et al 2011) and another group found that administration of MG decreased immobility on the TST (Hambsch et al 2010), which is a behavioral assay for anti-depressant drugs. This was surprising because the inventors' data showed that MG acts at GABA-A receptors and all other known GABA-A agonists (e.g. benzodiazepines and barbiturates) do not decrease immobility on the TST (Cryan et al 2005). Indeed, because GABA-A agonists cause locomotor-depression at higher doses, they tend to increase rather than decrease immobility in the TST.
(387) In order to determine if the reported correlation with Glo1 was causal the inventors examined TST behavior in the inventors' Glo1 Tg mice, which are on an isogenic background, and thus provide more definitive results than the panel of inbred strains used by Benton et al (2011). As shown in the upper panel of
(388) The inventors present preliminary data showing that GLO1 inhibitors have both anxiolytic and antidepressant effects and provide an example of the qualitatively different effects obtained via GLO1 inhibition compared to conventional GABA.sub.A agonists. Whereas there is extremely strong genetic evidence of comorbidity between anxiety and depression, GABAergic anxiolytic drugs have consistently failed to show activity in preclinical models of antidepressant drug action (Cryan 2005), a conclusion supported by clinical experience (Birkenhager 1995; Johnson 1985; Barbui 2011). In contrast, the inventors present preliminary data suggesting that inhibition of Glo1 expression or GLO1 activity produces antidepressant-like effects in a preclinical model. The inventors contemplate that this is due to the novel mechanism by which chances in GLO1 activity alter GABAergic signaling.
(389) Whereas the inventors had focused on Glo1's role in anxiety-like behavior, an independent group found that Glo1 expression was correlated with immobility on the tail-suspension test (TST) (Benton 2012), which is among the most reliable and heavily used screens for antidepressant drug activity. All major classes of antidepressant drugs decrease immobility of the TST (Cryan 2005). Consistent with this observation, another group reported that chronic administration of MG decreased immobility on the TST (Hambsch 2010). This was surprising because these data showed that MG acts at GABA.sub.AR and all other known GABA.sub.AR agonists (e.g. benzodiazepines and barbiturates) do not decrease immobility on the TST (Cryan 2005).
(390) To determine if the reported correlation with Glo1 expression and effects of MG administration were causal, the inventors examined TST behavior in Glo1 knockdown (Glo1KD) mice, which express less Glo1 than wild type mice and can thus be thought of as a genetic model of GLO1 inhibition. As predicted, the Glo1KD mice showed decreased immobility on the TST (
(391) Because GLO1 inhibition alters an endogenous negative feedback system that links glycolysis to GABAergic inhibitory tone, GLO1 inhibition may offer advantages over existing anti-depressants, such as fewer side-effects, faster efficacy, efficacy for comorbid anxiety disorders or efficacy in treatment refractory individuals. The short-term goal of this application is to obtain better pre-clinical evidence of the efficacy of GLO1 inhibitors and to further elucidate the mechanisms of GLO1 inhibition.
(392) Experimental Plan
(393) The inventors will examine the following behavioral assays of anti-depressant activity: chronic forced swim test (cFST; Hollick et al 2008), Novelty induced hypophagia (NIH; Dulawa et al 2005) and the chronic mild stress paradigm (CMS; Jiao et al 2012). The inventors will use three manipulations of Glo1: constitutive Glo1 over-expressing mice, conditional Glo1 over-expressing mice, and chronic pharmacological inhibition of GLO1.
(394) The inventors will explore the effects of Glo1 over-expression on cFST, NIH and CMS using constitutive BAC Tg mice (Distler et al 2012). Since the inventors' prior studies have shown consistent effects across multiple founder lines, the inventors will use only one founder line for these studies. Groups of 12 mice per genotype per sex (48 per test) will be used for initial studies, however the inventors may add additional subjects if needed to obtain significant results. The inventors anticipate there may be interactions with sex since prior results have shown the anxiolytic effects more clearly in Tg males than females. For behavioral tests that yield significant results the inventors will run follow-up studies with conditional Tg mice (the inventors have already obtained these mice from a collaborator). These Tg mice have a floxed stop codon inserted prior to the first coding exon of Glo1 (Tg-floxed-stop-Glo1). When Tg-floxed-stop-Glo1 mice are crossed to a CRE driver line, Glo1 will be overexpressed only in tissues where CRE is expressed. The inventors will use these mice in conjunction with the B6.Cg-Tg(Camk2-cre)T29-1Stl/J driver line in an effort to narrow down the minimally sufficient brain region for Glo1 overexpression to alter behavioral assays for antidepressant-like behavior. While the inventors assume that Glo1 expression in the limbic system is critical, Glo1 is expressed at high levels in all cells in the body, so the inventors have yet to define its neuroanatomy. Using this conditional system will allow us to begin to define the anatomical specificity of Glo1's behavioral effects.
(395) In a parallel set of studies, the inventors will examine the effects of the GLO1 inhibitor BrBzGCp2 on cFST, NIH and CMS. These studies will require chronic administration of BrBzGCp2, which will be accomplished using Alzet osmotic pumps. The inventors will determine appropriate doses by measuring GLO1 activity in brain homogenates using an in vitro assay, as previously described (Distler et al 2012). While the inventors anticipate the osmotic pumps will be effective, the inventors could revert to chronic injections if needed. Once the inventors identify a doses that produce robust inhibition of GLO1, the inventors will perform studies using 2-3 doses for each behavioral paradigm and a positive control dose of fluoxetine (18 mg/kg/day). Since the inventors are actively working to develop more drug-like (more selective, orally available, etc) compounds, the inventors may be able to substitute such compounds rather than using BrBzGCp2 (e.g. Chiba et al 2012). As with the TG studies, the inventors anticipate using 12 mice per dose and sex for each test but will increase the number of animals or doses as needed based on preliminary results. The goal of these studies would be to determine whether inhibition of GLO1 acts like an antidepressant drug in these chronic behavioral paradigms.
(396) The preliminary data suggests that manipulation of the Glo1/MG system can alter antidepressant behavior. Manipulation of the Glo1/MG system is fundamentally different from benzodiazepines and barbiturates and will therefore have distinct and useful pharmacologic effects. The approach will be to examine the acute forced swim test (aFST), the chronic forced swim test (cFST) (Holick 2008), novelty induced hypophagia (NIH) (Dulawa 2005) and the chronic mild stress paradigm (CMS) (Jiao 2012), all of which are validated behavioral measures that are sensitive to the effects of antidepressant drugs. The inventors will examine transgenic (Tg) Glo1 overexpressing and Glo1 knockdown (Glo1KD) mice and pBBG in these assays. The rationale for these studies is that Tg, Glo1KD and pBBG treatment have all shown antidepressant-like activity on the TST, but the inventors have not yet examined other tests that are sensitive to antidepressants. The inventors also plan to test a subset of the novel GLO1 inhibitors using these same tests.
(397) In clinical practice it is common to treat depressed patients with a combination of serotonin specific reuptake inhibitors (SSRI) and GABAergic drugs because patients commonly present with both depression and anxiety. While SSRIs can treat symptoms of both depression and anxiety, benzodiazepines are not considered to be a useful treatment for depression (Birkenhager 1994; Johnson 1985; Barbui 2011). Similarly, GABA.sub.AR acting drugs have consistently been found not to influence rodent screens for antidepressant drug activity (Cryan 2005). Indeed there are few indications that co-administration of SSRIs and GABAergic drugs act synergistically on behavioral assays of antidepressant activity (Christensen 2012), and in many cases apparently synergistic effects of GABAergic drugs are inconsistent (Da-Rocha 1997). The introduction of a novel drug that acted via a GABAergic mechanism and treated both depression and anxiety-like disorders could provide an extremely valuable option either as a primary treatment for both disorders or as an adjunctive therapy. Before GLO1 inhibitors can be examined for antidepressant effects in humans additional preclinical testing is required to better establish the likelihood of success. In addition, a critical limitation of current antidepressant drugs is their slow onset. Therefore the inventors will also examine whether GLO1 inhibition produces antidepressant effects faster than a conventional antidepressants.
(398) All studies using Tg or Glo1KD mice will use littermate wild-type controls; both lines are maintained on pure B6 backgrounds. Since the inventors's prior studies have shown consistent effects across multiple founder lines, they will use only one founder line for these studies. Pharmacological studies will use B6 mice obtained from JAX. Group sizes will be 12 per group per sex. The inventors will use male and female mice for all studies because of known sex differences the Glo1/MG system (Distler 2012) and because of well documented sexual dimorphism in depression and anxiety disorders in humans (Kendler 2007). Mice will be young adults (60-90 days old) when tested.
(399) The inventors will test a single cohort of Tg and Glo1KD mice and the corresponding wild-type controls in the NIH (Dulawa 2005), aFST (Holick 2008), and CMS (Jiao 2012) paradigms. Because these mice have been genetically manipulated the inventors do not need to consider dose or time course, so a single cohort is sufficient.
(400) In addition, the inventors will perform similar studies using pBBG. The inventors will deliver pBBG using Alzet osmotic minipumps, which are capable continuously delivering drug over up to 28 days; this avoids the confounding stressful effects of daily injections. The inventors will consider several doses with the goal of obtaining steady state plasma concentrations across the relevant range of inhibitory doses. For the aFST and cFST the inventors will test mice at 5 and 14 days after minipumps implantation; the 5 day time point is considered acute. The inventors will also examine the response to an acute injection of pBBG. SSRIs (e.g. citalopram) and tricyclic (e.g. desipramine) antidepressants do not increase swimming until the 14 day time point under these conditions. For the NIH the inventors will use a between groups design, with separate cohorts of mice being tested at 5 and 21 days. SSRIs and tricyclic antidepressants do not ameliorate hypophagia until the 21 day time point under these conditions. CMS involves a challenge day once per week during which anhedonia is assessed by monitoring sucrose drinking. SSRIs and tricyclic antidepressants do not reduce stress-induced anhedonia until 14 or 21 days of chronic treatment. The inventors will also evaluate novel GLO1 inhibitor small molecule compounds in this same manner.
(401) The above study addresses two critical questions. First, it uses a battery of well-validated and mechanistically distinct behavioral paradigms to examine the antidepressant-like effects of GLO1 inhibitors. This is a key question because further development of GLO1 inhibitors as antidepressants is only justified if they are effective in multiple different behavioral tests. The second key question is whether or not GLO1 inhibitors may have faster onset than conventional SSRIs. If GLO1 inhibitors are active at these time points it will suggest that GLO1 inhibitors may be fast acting antidepressants, which would be a major clinical advantage over existing drugs.
Example 8Glyoxalase 1 and its Substrate Methylglyoxal are Novel Regulators of Seizure Susceptibility
(402) MG treatment reduces the severity and duration of picrotoxin-induced seizures: First, the inventors investigated whether MG could prevent or attenuate seizures by administering exogenous MG (50 and 200 mg/kg) or vehicle to mice before seizure induction. The inventors previously demonstrated that this treatment dose-dependently increases MG concentration in the brain (Distler et al., 2012). Treatment with 50 mg/kg and 200 mg/kg MG is expected to increase the concentration of MG in the brain by approximately 16% and 43%, respectively, and does not cause cytotoxicty (Distler et al., 2012). After pre-treatment with MG, the inventors induced seizures using picrotoxin. Picrotoxin is a GABA.sub.A receptor antagonist, which the inventors selected based on its ability to induce seizures in mice (Fisher, 1989) and MG's role as a GABA.sub.A receptor agonist (Distler et al., 2012). Pre-treatment with MG dose-dependently attenuated generalized convulsions induced by 5 mg/kg picrotoxin. Specifically, MG treatment delayed seizure onset (
(403) In order to validate these behavioral data, the inventors assessed seizure activity by EEG analysis of mice treated with 7 mg/kg picrotoxin. Again, pre-treatment with 200 mg/kg MG delayed seizure onset (
(404) MG treatment reduces the severity and duration of pilocarpine-induced seizures: The inventors next investigated MG's anti-seizure effects in a mechanistically distinct seizure model. The inventors induced seizures using pilocarpine, a muscarinic cholinergic agonist that induces severe, continuous limbic seizures after acute administration (Curia et al., 2008). The inventors pre-treated mice with MG (50 mg/kg and 200 mg/kg) or vehicle and then induced seizures with 250 mg/kg pilocarpine. This dose of pilocarpine induced partial status epilepticus (stage 3 seizures), but not generalized status epilepticus, in vehicle- and MG-treated mice. Pre-treatment with MG (50 and 200 mg/kg) dose-dependently delayed acute seizure onset (
(405) The inventors then investigated whether MG could stop or reduce the severity of ongoing seizures. The inventors induced seizures with pilocarpine and then administered MG (200 mg/kg) 10 minutes after seizure induction. The inventors selected this time point, because vehicle-treated mice first reach stage 3 seizures approximately 10 minutes after pilocarpine administration (
Example 9Methods
(406) Animals:
(407) A/J mice: A/J mice were obtained from JAX. Mice homozygous for 2 and 3 copies of Glo1 were maintained as breeders.
(408) B6 mice: WT B6 mice were obtained from JAX and were used for pharmacological studies and as breeders for Tg mice.
(409) FVB mice: WT FVB mice were obtained from JAX and were used as breeders for Tg mice.
(410) BAC Tg mice: The mouse BAC RP23-247F19 was obtained from CHORI and modified by RED/ET recombination (Copeland 2001). To prevent expression of alternatively spliced variants of Btbd9 and Dnahc8, their first exons were replaced with ampicillin and kanamycin cassettes, respectively. Primers for recombineering and screening the modified BAC are reported in Table 8. The modified BAC was purified and injected into B6 or FVB pronuclei by the University of Chicago's Transgenic Core Facility. Positive founders that transmitted the BAC to their offspring were maintained as founder lines and were bred to WT mice.
(411) CD-1 mice: CD-1 mice were obtained from Charles River and were used for pharmacological studies.
(412) Glo1 knockout mice: Gene trap ES cell lines were obtained from TIGM. ES cells were injected into blastocysts, which were implanted into pseudopregnant B6 female mice. Offspring were genotyped for the presence of the gene-trap vector, and positive mice were bred with WT mice. None of the founders generated offspring positive for the gene-trapped allele.
(413) Glo1 KD mice: Glo1 KD mice were obtained from Dr. Michael Brownlee at Albert Einstein College of Medicine, Bronx, NY (Queisser 2010).
(414) For all studies, mutant mice were tested in parallel with their WT littermates. WT mice from each Tg line did not significantly differ and were pooled. All animal procedures were approved by the University of Chicago's IACUC.
(415) TABLE-US-00009 TABLE8 PrimersusedforrecombineeringandscreeningthemodifiedBAC AMP F:GGTGGCTGATAGAATGTGTGGTTTTGTGCGCATGCTCCTCTTGCTCACTA- cassettewith GTGGCACTTTTCGGGGAAATGTGC(SEQIDNO.1) 50bp R:CTGCTTCCCACATGACTTAAATATAAGTAATAATAAGAATAACCATTATT- overhangs CTCGAGGCTAGCTCTAGAAGTCCAGC(SEQIDNo.2) homologous toBtbd9 KAN F:GATAAGGCATCACTGGGAGAAATAAAAACACCCAATGGTCAAGTTATTTG- cassettewith GGCCTGGTGATGATGGCGGGATCG(SEQIDNO.3) 50bp R:ACACTCGTACACACCCCAAAACAAAGGGGAAAACAAATACGGGCACGACT- overhangs TCAGAAGAACTCGTCAAGAAGGCG(SEQIDNO.4) homologous toDnahc8 Screeningfor F:GTCTGTCCCAGACAGCCTTC(SEQIDNO.5) Btbd9 R:AGCCCTCCCGTATCGTAGTT(SEQIDNO.6) modification Screeningfor F:TCCTCAGTTGAGATCCCCTCTA(SEQIDNO.7) Dnahc8 R:GCCGAAAAGGTGTCAAGAAA(SEQIDNO.8) modification
(416) These primers were used for generating the AMP cassette with 50-bp ends homologous to the region of Btbd9 to be excised and the KAN cassette with 50-bp ends homologous to the region of Dnahc8 to be excised. The 50 bp homology ends are underlined. Primer sequences used for screening correctly modified BACs are also included. All sequences are reported from 5 to 3.
(417) Glo1 copy number: Genomic DNA was used as a template in qPCR with SYBR reagents (Applied biosystems). Primers targeted Glo1 and a region of Btbd9 outside the BAC (Glo1 Forward: 5-CTG CTG AGG ATA CCA GGT TTG TT-3 [SEQ ID NO. 9]; Glo1 Reverse: 5-AGC ATC CTG ACG GCA GAT TTA-3 [SEQ ID NO. 10]; Btbd9 Forward: 5-TGC CAG TGT GAT TGA AGG AG-3 [SEQ ID NO. 11]; Btbd9 Reverse: 5-GTG CCA GCT GAA CCA CAA T-3 [SEQ ID NO. 12]). Glo1 copy number was determined using the AACT method (Schmittgen 2008). For A/J mice, copy number was compared to WT B6 mice. For Tg mice, BAC copy number was calculated as (Fold change v. WT2)2, because WT B6 and FVB mice have 2 genomic copies of Glo1 (Williams 2009).
(418) General health and reflexes: Body position and righting, toe pinch, ear twitch, whisker orienting, and eye blink reflexes were scored as previously described (Crawley 2007). The whisker placing and visual placing responses were scored as previously described (Fox 1965). The balance beam test was performed as previously described (Crabbe 2003). The balance beam was 97 cm9.5 mm and elevated to 46 cm. Mice were tested on the balance beam, and missteps were counted.
(419) mRNA Expression:
(420) qPCR: Tissue was dissected, flash frozen on dry ice, and then stored at 80 C. until use. RNA was extracted using the RNeasy kit with DNase digestion (Qiagen). cDNA was generated by reverse transcription (MultiScribe, Applied Biosystems) using oligo dT primers (Invitrogen). cDNA was used as a template in qPCR using SYBR reagents (Applied Biosystems). Primers targeted genes of interest and a housekeeping gene, -actin. Gene expression was normalized to -actin and reported as fold change versus WT using the 2.sup.CT method (Schmittgen 2008). Primer sequences are listed in Table 9.
(421) Microarray: Microarrays were Mouse Gene 1.0 ST Arrays (Affymetrix). Whole brains were dissected, snap frozen, and stored at 80 C. until use. RNA was extracted using TRIzol (Invitrogen) and was cleaned using the RNeasy kit (Qiagen). RNA samples were transferred on dry ice to Precision Biomarker Resources, who processed the samples and performed all procedures, including data analysis. Statistical analyses were performed by converting P-values into q-values using Q-value software (Storey 2003).
(422) TABLE-US-00010 TABLE9 qPCRprimersformeasuringmRNAexpression mRNATarget Sequences SEQIDNO -actin F:CCACAGCTGAGAGGGAAATC 13 R:TCTCCAGGGAGGAAGAGGAT 14 Glo1 F:ACTGGCGTTCATTCAAGACC 15 R:CCCATACCTCAAAGGCACAT 16 Thsd7a F:GCCAGCTTTCTGACTGGTCT 17 R:CTTGAAAGGGCTGGGTTACA 18 Pfh14 F:ATGCCGAGAAAGACGAAAAA 19 R:GCCATCTCTGCTTCCATGTC 20 Ndufa4 F:ACTGTATGTGATGCGCTTGG 21 R:CCAGTTTGTTCCATGGCTCT 22 Foxp2 F:AGCAGCAAGCTGTGATGTTG 23 R:TGCAAAAGCTGAAGATGTAACTG 24
(423) The primers used for gene amplification by qPCR are listed. All sequences are reported from 5 to 3.
(424) Immunoblot: Tissue was homogenized in RIPA buffer. Twenty g of protein was separated by SDS-PAGE and transferred to a PVDF membrane. Membranes were probed with primary antibodies against GLO1 (1:15,000, gift from Dr. Iiris Hovatta at University of Helsinki, Helsinki, Finland) and GAPDH (1:5,000, Cell Signaling Technology). Peroxidase-conjugated secondary antibodies were used (1:100,000, Jackson ImmunoResearch). Blots were developed with ECL plus (Thermo Scientific), digitized, and band intensity was measured by densitometry using NIH ImageJ software. GLO1 band intensity was normalized to GAPDH.
(425) Tests of Anxiety-Like Behavior:
(426) OF test: Mice were placed into the center of the OF, and activity was monitored for five to ten minutes. The apparatus was illuminated to approximately 40 lux. Data were collected and processed using the manufacturer's software (AccuScan Instruments).
(427) LD box test: Mice were placed in the light compartment, and activity was monitored for 4 minutes. The light compartment was illuminated to approximately 1,000 lux, and the dark compartment was illuminated to approximately 5 lux. Behavior was recorded and automatically scored by the Noldus Ethovision System.
(428) EPM: The elevated plus maze (Stoelting) consisted of four arms measuring 5 cm35 cm; the two closed arms had 15-cm-high walls. The apparatus was raised 40 cm above the ground and was illuminated to approximately 15 lux. Mice were placed into the center of the apparatus, and behavior was scored for 5 minutes.
(429) Enzymatic activity: GLO1 activity was assayed by measuring the rate of formation of S-d-lactoylglutathione (Allen 1993).
(430) Brain: Brain tissue was homogenized in 0.1 M sodium phosphate buffer (pH 7.5), 1 mM EDTA, and proteinase inhibitors. Brain homogenate (10-50 g protein) was added to a hemithioacetal substrate (2 mM MG and 2 mM GSH, Sigma-Aldrich), and the absorbance at 240 nm was measured every 30 seconds for 4 minutes.
(431) Purified protein: 100 ng of purified protein was added to a hemithioacetal substrate, and enzymatic activity was measure as described above.
(432) MG quantification by HPLC: MG concentration was measured by HPLC as previously described with modifications (Dhar 2009). Tissue was homogenized in 50 mM sodium phosphate buffer (pH 6.6) and 0.8N perchloric acid. It was then incubated on ice for 10 minutes and centrifuged. The supernatant was filtered, and MG was derivatized with 10 mM o-phenylenediamine to form 2-methylquinoxaline (2-MQ). 5-methylquinoxaline (5-MQ, 15 M) was spiked into each sample as an internal standard. 2-MQ was quantified using an HP 1100 HPLC system (Agilent) with a Nova-Pak C18 column (Waters Corporation). Column effluent was monitored at 315 nm. 2-MQ concentration was determined by comparison to 2-MQ standards of known mass. Quantification of 2-MQ was corrected for losses by comparison with 5-MQ. MG concentration was calculated as 2-MQ/tissue weight.
(433) Methylglyoxal Pharmacology In Vivo:
(434) Treatment: Unless otherwise noted, crude MG was used for all behavioral experiments. MG was obtained from Sigma-Aldrich, filter-sterilized (0.22 m filter, Millipore), diluted in vehicle (0.9% NaCl), and adjusted to pH 7.4. Mice were injected i.p. with 10 ml/kg MG or vehicle.
(435) HPLC: Ten minutes post-injection, mice were sacrificed, and brains were rapidly dissected and flash-frozen on dry ice. MG concentration was measured as described above.
(436) OF test: Ten minutes post-injection, mice were placed into the center of the OF. The apparatus was illuminated to approximately 40 lux. Behavior was measured as described above.
(437) OF test replication studies: Ten to twenty minutes post-injection, mice were tested in the OF for five to ten minutes. In some experiments, behavior was scored as described above. In other experiments, mice were tested in the OF, and behavior was automatically scored by the Noldus Ethovision System. For mice tested in the Noldus system, the apparatus was illuminated to approximately 1,000 lux.
(438) LD box test: Ten minutes post-injection, mice were placed in the light compartment, and activity was monitored for three minutes. The light compartment was illuminated to approximately 1,000 lux, and the dark compartment was illuminated to approximately 5 lux. Behavior was recorded and automatically scored by the Noldus Ethovision System.
(439) Hypothermia: Thirty minutes post-injection, rectal temperature was measured with a digital thermometer.
(440) Balance beam: The balance beam test was performed as described above. Ten minutes post-injection, mice were tested on the balance beam, and missteps were recorded. Data were analyzed using non-parametric statistics, because vehicle-treated mice generally did not make errors.
(441) Rotarod: CD-1 mice were tested on the rotarod with the following settings: acceleration from 4 revolutions per minute (rpm) to 60 rpm at 0.125 rpm/sec. On day 1, mice were trained on the rotarod for five consecutive trials. On day 2, mice were treated with vehicle or MG and were tested once on the rotarod ten minutes after treatment. The latency to fall and the rotarod speed at the time of the fall were recorded.
(442) Chronic MG administration: For five days, mice were injected twice daily with vehicle or MG (4 mg/kg). Twelve hours after the final injection, mice were tested in the OF as described above.
(443) Pure MG: Pure MG was obtained from Dr. John Termini at the City of Hope, Duarte, CA It was administered at the indicated doses by i.p. injection. Mice were tested as described above.
(444) TUNEL staining: WT B6 male mice were treated i.p. with vehicle or MG (50 or 300 mg/kg). Twenty-four hours post-injection, mice were anesthetized with ketamine (100 mg/kg) and xylazine (10 mg/kg) and were then transcardially perfused with PBS (pH 7.4). Brains were dissected and post-fixed for 48 hours in 4% paraformaldehyde (pH 7.4). Fixed brains were washed in PBS and placed in 70% ethanol until processing. Brains were submitted to the University of Chicago's Human Tissue Resource Center for processing. Brains were embedded in paraffin, sectioned to 5 m, TUNEL stained using the ApopTag Plus Peroxidase In Situ Apoptosis Detection Kit (Millipore) according to the manufacturer's instructions, and counterstained with hematoxylin. Slides were digitally scanned with ScanScope XT (Aperio Technologies). Images were analyzed using Spectrum Plus software (Aperio Technologies) to count TUNEL-positive cells and total cells in each section. % TUNEL positive values were calculated as: (TUNEL positive cells/total cells)100%. A positive control (female rodent mammary gland 3-5 days post-weaning, provided in the kit) was stained and analyzed in parallel with the experimental samples.
(445) BrBzGCp2 (GLO1 Inhibitor):
(446) Synthesis: BrBzGCp2 was a gift from Dr. John Termini at the City of Hope, Duarte, CA and was prepared on a multi-gram scale in two steps from reduced glutathione as previously described with modifications (Vince 1971; Thornalley 1996). Reduced glutathione was reacted with 4-bromobenzylbromide and sodium hydroxide in ethanol for ten days followed by acidification with HI to pH 3.5 and filtration to give bromobenzylglutathione (Thornalley 1996) as a bright white solid (Vince 1971). This was then esterified with excess acidified cyclopentanol to give crude BrBzGCp (Thornalley 1996) as a mixture of mono- and diesters. The desired diester was moderately soluble in diethyl ether, whereas the monoester was virtually insoluble. Repeated suspension of the crude product in diethyl ether, followed by filtration and evaporation of the filtrate, gave the desired BrBzGCp2 in >95% purity as assessed by NMR.
(447) Enzymatic activity: Vehicle (DMSO) or 100 M BrBzGCp2 was added to 10 ng of purified human GLO1. Enzymatic activity was measured as described above.
(448) Treatment: BrBzGCp2 was dissolved in vehicle (8% DMSO and 18% Tween-80). Mice were treated i.p. with 10 ml/kg BrBzGCp2 or vehicle.
(449) HPLC: 2 hours post-injection, mice were sacrificed, and brains were rapidly dissected and flash-frozen on dry ice. MG concentration was measured as described above.
(450) OF test: Two hours post-injection, mice were tested in the OF test as described above. The center size was 1010 cm. The apparatus was illuminated to approximately 40 lux.
(451) Glo1 duplication genotyping: CD-1 mice were genotyped for the presence or absence of the Glo1 duplication using PCR as previously reported (Williams 2009).
(452) Electrophysiology:
(453) Reagents: All reagents were obtained from Sigma-Aldrich. Pure MG was provided by Dr. John Termini at the City of Hope, Duarte, CA; electrophysiological results were identical between pure MG and MG obtained from Sigma-Aldrich. MG, GABA, glycine, 1-glutamate, SR, strychnine, CNQX, AP-5, diazepam, midazolam, and zolpidem were applied with a computer controlled MPS-2 multichannel perfusion system (WPI).
(454) Culture of rat CGN: CGN were cultured from mixed-sex Sprague-Dawley rats. Tissue was dissected from 6- to 8-day-old rats. Cells were suspended in minimal essential medium supplemented with 10% fetal calf serum, 26 mM glucose, 19 mM KCl, 2 mM 1-glutamine, and penicillin/streptomycin (50 IU/ml and 50 g/ml). Cells were seeded on poly-1-lysine-coated coverslips and incubated in a humidified atmosphere containing 5% CO.sub.2 at 37 C. After 48 hours, the culture medium was replaced with minimal essential medium supplemented with 10% horse serum, 26 mM glucose, 19 mM KCl, 2 mM 1-glutamine, penicillin/streptomycin (50 IU/ml and 50 g/ml), and 80 M 1-fluorodeoxyuridine. Culture medium was exchanged every three days. All recordings were made from cells between days 6 to 9 in culture.
(455) Culture of rat HN: HN were prepared from E17 Sprague-Dawley rats as previously described (Plant 2011) and seeded on poly-1-lysine coated glass coverslips. Neurons were maintained in neurobasal medium with B27 supplement and glutamax in a humidified atmosphere with 5% CO.sub.2 at 37 C.
(456) Whole-cell patch clamp: Whole-cell patch-clamp was performed as previously described (Plant 2006) using an Axopatch 200B amplifier and pCLAMP software (Molecular Devices). Filter and sampling frequencies were 5 and 25 kHz, respectively, for voltage-clamp experiments and 1 and 10 kHz, respectively, for current-clamp recording. Experiments were performed at 32 C. using a feedback-controlled heated perfusion system (Warner Instruments). V.sub.m, ligand-gated currents, and potassium channel currents were studied in a bath solution containing 1 mM CaCl.sub.2, 1 mM MgCl.sub.2, 4 mM KCl, 140 mM NaCl, 5 mM glucose, and 10 mM HEPES (pH 7.4). Electrodes were fabricated from borosilicate glass (Clark) and had a resistance of 4-5 M when filled with a solution containing 136 mM KCl, 1 mM MgCl.sub.2, 2 mM K.sub.2ATP, 5 mM EGTA, and 10 mM HEPES (pH 7.2). Electrodes were coated with Sigmacote (Sigma) prior to use.
(457) Macropatch recording: Macropatch recording was performed with 1.5-2 M electrodes filled with bath solution. The inside of excised patches was perfused with electrode solution containing the indicated reagents. SR was added to the electrode where indicated.
(458) Potassium currents: Voltage-gated potassium channel currents were evoked using a previously reported protocol with modifications (Plant 2006). The whole voltage-gated potassium current, I.sub.K+, and the delayed rectifier current, I.sub.DR were isolated with two voltage protocols. First, I.sub.K+ was evoked by 250 ms test pulses to between 80 and 90 mV from 80 mV following a 250 ms pre-pulse to 140 mV. Then, the protocol was repeated using a 50 mV pre-pulse to inactivate I.sub.K+ and isolate I.sub.DR. The inactivating component of the current, I.sub.KA, was isolated by subtracting I.sub.DR from I.sub.K+ recorded in the same cells. The standing outward potassium leak current, IKso, and the inwardly rectifying potassium current, I.sub.KIR, were studied as previously reported with modifications (Plant 2002). Cells were held at 20 mV, and the membrane potential was ramped to 120 mV over a period of 100 ms before returning to 20 mV. Ramp hyperpolarizations were repeated every 20 seconds.
(459) Sodium currents: Sodium currents were studied as previously described (Plant 2006) using a bath solution containing 130 mM NaCl, 5 mM CsCl, 2 mM CaCl.sub.2, 1.2 mM MgCl.sub.2, 5 mM glucose, and 10 mM HEPES adjusted to pH 7.4 with NaOH. 500 nM tetrodotoxin (Sigma) was included in the bath to block voltage-gated sodium currents. The electrode solution contained 60 mM CsCl, 80 mM CsF, 10 mM EGTA, 1 mM CaCl.sub.2), 1 mM MgCl.sub.2, 5 mM Na.sub.2ATP, and 10 mM HEPES adjusted to pH 7.4 with CsOH. All voltage-gated currents were studied following a P/5 leak subtraction protocol, and voltage-clamp errors were minimized with 80% series resistance compensation.
(460) Ligand-gated currents: Ligand-gated currents were studied in voltage-clamp mode by application of reagents to cells held at 50 mV. GABAergic and glycinergic currents were activated by application of GABA and glycine and antagonized by application of SR and strychnine, respectively (Kaneda 1995). Glutamatergic currents were activated by 1-glutamate and antagonized by CNQX and AP-5 (Wyllie 1994).
(461) TST: Mice were suspended by their tails using adhesive tape attached to a bar elevated approximately 46 cm above a table. The apparatus was illuminated to approximately 1,000 lux. Mice were tested individually, and time spent immobile was scored manually for six minutes. For MG studies, mice were treated with vehicle (0.9% saline) or crude MG (Sigma-Aldrich, 50 mg/kg) by i.p. injection ten minutes before the test. Behavior was scored for five minutes.
(462) Seizure Testing:
(463) Drug administration: All experiments with MG utilized crude MG obtained from Sigma-Aldrich. For pre-treatment, MG (50 or 200 mg/kg) or vehicle (0.9% saline) was administered by i.p. injection 10 minutes before the seizure-inducing agent. For treatment after seizure onset, MG (200 mg/kg) or vehicle (0.9% saline) was administered by i.p. injection ten minutes after seizure onset. For GLO1 inhibition, BrBzGCp2 (50 mg/kg) or vehicle (8% DMSO and 18% Tween-80) was administered by i.p. injection two hours before seizure induction.
(464) Seizure induction: For picrotoxin-induced seizures, 5 mg/kg of picrotoxin in 0.9% saline was administered by i.p. injection. Seizures were scored for one hour after picrotoxin administration. For pilocarpine-induced seizures, mice were pre-treated with atropine (5 mg/kg in 0.9% saline) by i.p. injection in order to reduce the peripheral effects of pilocarpine. Thirty minutes after atropine administration, pilocarpine was administered by i.p. injection. B6 mice were treated with 250 mg/kg pilocarpine in 0.9% saline, and FVB mice (WT and Tg) were treated with 300 mg/kg pilocarpine in 0.9% saline. Seizures were scored for 90 minutes after pilocarpine administration.
(465) Seizure scoring: Picrotoxin-induced seizures were scored as the presence of generalized convulsions as well as the latency to and duration of generalized convulsions.
(466) Pilocarpine-Induced Seizures were Scored as Previously Reported (Winawer 2011): Stage 1: Immobility/lying low Stage 2: Partial (limbic) seizures. Non-continuous twitching/tremor/shaking of tail/head/body/limbs, forelimb and/or tail extension, rigid posture, repetitive movements, head bobbing Stage 3: Partial status epilepticus. Continuous tremor/clonic seizures of body and tail while retaining posture Stage 4: Generalized seizures. Rearing/hyperexcitability/running/falling, tonic extension/clonic seizures with loss of posture Stage 5: Generalized status epilepticus (continuous stage 4 seizures) resulting in death
(467) Gene network: Data on seizure susceptibility and Glo1 expression in BXD RI lines were obtained from and analyzed using WebQTL at world wide web via www.genenetwork.org (Wang 2003). The record ID for hippocampal Glo1 expression was 1424109_a_at from the Hippocampus Consortium M430v2 (June06) PDNN database. The record ID for seizure susceptibility was 10388, representing data reported by McCall and Frierson (McCall 1981). Data were retrieved on Jan. 28, 2012.
(468) Metabolic cages: WT and Tg littermates from FVB line 3 were individually housed in metabolic cages (TSE Systems) for one week. Mice were allowed to acclimate for five days, and measurements from the sixth and seventh days were used for analysis.
(469) Glucose homeostasis: WT and Tg mice from FVB Tg lines 3, 4, and 5 were fasted overnight. Baseline blood glucose concentration was made using a Contour glucometer (Bayer). Then, mice were given an i.p. injection of 10% glucose (10 ml/kg body weight), and subsequent blood glucose measurements were made 30, 60, and 120 minutes later.
(470) Human GLO1: Human GLO1 cDNA (419A) was obtained from Open Biosystems (clone ID 4182593) in a pCMV-SPORT6 vector. The 419C variant was generated by site-directed mutagenesis using a Quik-Change kit (Stratagene) according to the manufacturer's protocol. Sequences for the mutagenic primers were: 5-GGC ACT GAA GAT GAT GCG ACC CAG AGT TAC CAC-3 (sense) [SEQ ID NO. 25] and 5-GTG GTA ACT CTG GGT CGC ATC ATC TTC AGT GCC-3 (anti-sense) [SEQ ID NO. 26]. After mutagenesis, the sequence was verified using PCR-based sequencing by the University of Chicago DNA Sequencing Facility. The 419A and 419C cDNA sequences were subcloned into pTrcHis expression vectors (Invitrogen) to add a 6-Histidine tag to the N-terminus of the translated protein. To do so, the cDNA sequence was amplified by PCR using the following primers: 5-ATA CTG CAG CCA TGC AGA ACC-3 (forward) [SEQ ID NO. 27] and 5-TGA ATC GGG ACA GTG ATC CA-3 (reverse) [SEQ ID NO. 28]. The amplicon was gel-extracted and digested with PstI and EcoRI and inserted into the pTrcHis vector. The construct's sequence was verified using PCR-based sequencing at the University of Chicago's DNA Sequencing Facility. JM109 competent E. coli were transformed with the plasmids. The recombinant His-tagged 111A and 111E GLO1 proteins were purified under native conditions using a Ni-NTA protein purification kit (Qiagen) according to the manufacturer's protocol. Enzymatic activity of the purified proteins was performed as described above.
(471) Statistical analyses: All statistical analyses were carried out using StatView for Windows (SAS Institute, Inc.) unless otherwise noted. Normally distributed data were analyzed by t-tests or analyses of variance (ANOVA) as appropriate. Post-hoc tests were used to determine significant differences between groups when the ANOVA yielded a significant result. For data that were not normally distributed, Mann-Whitney U tests were used for two-group comparisons; Kruskal-Wallis tests were used for three-group comparisons, and post-hoc comparisons were made using Mann-Whitney U tests. For statistical analysis of the microarray data, P-values were converted to q-values using Q-value software (Storey 2003). For the meta-analysis of MG's anxiolytic effect, results from individual experiments were compiled and analyzed with MIX 1.7 software using a fixed-effect model (Bax 2006). The relationship between Glo1 expression and seizure phenotypes in BXD RI lines was assessed using Pearson correlations. P<0.05 was considered statistically significant. The figure legends indicate the specific tests used and their respective P-values.
Example 10the Use of Glo1 Inhibitors/Mg as Treatment for an Anxiety Disorder
(472) Many studies indicate amygdala-prefrontal cortex circuitry in both normal and disease states of anxiety as well as, in depression (Earnheart et al. 2007; Luscher, Shen & Sahir 2011). As Glo1 and MG are expressed throughout the brain and MG activates GABA.sub.A receptors that are highly expressed within amygdala-prefrontal cortex circuitry, we predicted that the Glo1/MG pathway exerts control over anxiety-like behavior through this circuitry. The studies performed here aimed to determine whether the effects of Glo1/MG on anxiety-like behavior are peripherally or centrally mediated and if central, to elucidate the neuroanatomical systems responsible for regulating the effects of MG on anxiety-like behavior. To test this, mice that have a human copy of Glo1 with a foxed stop codon on a B6 background (FloxGlo1) that results in overexpression of Glo1 only in tissue expressing CRE were used. These FloxGlo1 mice were bred to mice expressing CRE recombinase under the direction of the synapsin promoter to limit overexpression of Glo1 to all neurons. Indeed, limiting overexpression of Glo1 to neurons was sufficient to induce anxiety-like behavior in the OFT (
(473) While many nuclei of the amygdala contribute to anxiety-like behavior, direct injection of a benzodiazepine (in this case midazolam) to the basolateral amygdala (BLA) has been shown to elicit greater anxiolytic effects than other nuclei in the amygdala and is required for the consolidation of anxiety in behavioral models of anxiety-like behavior (Vyas & Chattarji 2004; Heldt & Ressler 2006). As MG is a GABA.sub.A receptor agonist, it was contemplated that direct injection of MG into the BLA would reduce anxiety-like behavior in the OFT to a similar extent as a positive modulator of GABA.sub.A receptors, midazolam. Indeed, a dose dependent increase was observed in center duration after direct injection of MG into the BLA that was comparable to that of midazolam. These data suggest the GLO1/MG pathway modulates anxiety-like behavior through typical circuitry. MG is cell permeable, and as such, it is possible that MG preferentially acts at extrasynaptic GABA.sub.A receptors where concentrations of GABA are low. Extrasynaptic receptors are believed to mediate inhibitory tone, reducing the probability of a neuron firing an action potential. Insufficient inhibition in amygdala-prefrontal cortex circuitry could explain Glo1/MG control over anxiety-like behavior and may suggest a role for Glo1/MG in normal mediation of behaviors associated with anxiety. The extraysnatic effects of MG may be a key benefit of targeting the MG/Glo1, for example by using a GLO1 inhibitor.
(474) While many GABA.sub.A receptor-acting anxiolytic drugs are already is use, they are predominately positive allosteric modulators. GLO1 inhibition/MG accumulation is fundamentally different because MG is an endogenously produced competitive partial agonist and accumulation of MG is dictated by local MG production. Therefore, the neuroanatomical distribution of MG production will influence the effects of GLO1 inhibition. This might account for the better anxiolytic effects observed in
Example 11the Use of Glo1 Inhibitors/Mg as Treatment for Depression
(475) The forced swim test (FST) is a highly reliable screen used to predict antidepressant efficacy after acute antidepressant treatments (Petit-Demouliere, Chenu & Bourin 2005). The FST relies on the phenomenon that relative to no treatment, mice receiving treatment with antidepressants will spend more time performing escape-oriented behaviors than immobile postures. Though similar, intra-strain and interstrain comparisons suggest different biological substrates underlie the observed behavior in this test and convergent data on potential antidepressants can bolster claims of antidepressant activity (Petit-Demouliere, Chenu & Bourin 2005). Mice on three genetic backgrounds (C57BL/6J, FVB/nJ and BALB/cJ) were treated with 50 mg/kg pBBG (i.p.) and assessed depression-like behavior in the FST two hours later. Treatment with pBBG reduced immobility in all strains, suggesting a therapeutic potential of GLO1 inhibition for the treatment of depression (
(476) To fully assess the therapeutic potential of GLO1 inhibitors, it is necessary to utilize behavioral models sensitive to chronic administration. These models are highly informative as the therapeutic onset of antidepressant action mimics clinical onset in humans. pBBG was administered by osmotic minipumps (Alzet) for 14 days at various doses (0, 5, 10, 15, 30 and 60 mg/kg/day) to establish a dose response curve. Osmotic minipumps are ideal for chronic treatment as they release a constant volume at a very slow rate minimizing the stress of multiple injections. These studies indicate low doses (5 or 10 mg/kg/day) of the GLO1 inhibitor pBBG reduce immobility in the FST after chronic treatment for 14 days. These data suggest that inhibition of GLO1 acts as both an antidepressant and anxiolytic drug, without inducing locomotor depression reflecting the different and potentially useful impact of alteration of GABAergic signaling by GLO1 inhibition compared to positive allosteric modulators of GAB AA receptors.
Example 12the Use of Glo1 Inhibitors/Mg in Treatment of Alcohol and Other Substance Abuse/Dependence
(477) According to the National Institute on Alcohol Abuse and Alcoholism, about 18 million people have alcohol use disorders. Binge drinking is drinking enough alcohol within about 2 hours for blood alcohol concentration (BAC) levels to reach 0.08 g/dL. Binge drinking and drinking to intoxication are associated with higher risk for developing AUDs (Courtney & Polich, 2009). The drinking in the dark (DID) paradigm in mice emulates binge drinking in humans as it limits mouse exposure to ethanol to a portion of their dark cycle when their natural consummatory behaviors are greatest. B6 mice are known to consume pharmacologically significant amounts of ethanol in this paradigm. Water bottles are replaced with 20% ethanol 3 hours into the dark phase of the light cycle. The ethanol bottle is removed after 2 hours on the first day of access and after 4 hours on the second day. This results in mice achieving BACs high enough to induce behavioral intoxication on the second day (Barkley-Levenson & Crabbe, 2013). Expression of Glo1 was found to alter ethanol consumption in the DID paradigm (
REFERENCES
(478) The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
(479) 2000. The Amygdala: A Functional Analysis. New York: Oxford Press. Ahmed & Thornalley, Diabetes Obes Metabl. 9:233-45, 2007. Aldinger, et al., PLoS One. 4:e4729, 2009. Allen, et al., J Protein Chem. 12:111-9, 1993. Al-Timari & Douglas, Biochim Biophys Acta. 870:219-25, 1986. AmericanPsychiatricAssociation. Diagnostic and Statistical Manual of Mental Disorders. Washington, DC: American Psychiatric Association. 2000. Anderson, et al., Int J Psychiatry Med. 32:235-47, 2002. Arai, et al., Arch Gen Psychiatry. 67:589-97, 2010. Aronsson, et al., Biochem J 197:67-75, 1981. Association, A. P. 2000. Diagnostic and Statistical Manual of Mental Disorders. Washington, DC: American Psychiatric Association. Baguley & Walton, Angewandte Chemie International Edition. 37:3073-3082, 1998. Bair, et al., Melanoma Res. 20:85-96, 2010. Barbui, et al., Br J Psychiatry. 198:11-6, sup 1, 2011. Barnard, E. A. The Molecular Architecture of GABA-A Receptors in In Mohler (Ed): Handbook of experimental pharmacology: Pharmacology of GABA and Glycine Neurotransmission. 150:79-100, 2001. Barnard, et al., Pharmacol Rev. 50:291-313, 1998. Barros & Deitmer, Brain Res Rev. 63:149-59, 2010. Barton, et al., J Chem Soc Chem Commun. 939-941, 1983. Barua, et al., Autism Res. 4:262-70, 2011. Bax, et al., BMC Med Res Method. 6, 2006. Beg & Jorgensen, Nat NeuroSci. 6:1145-51, 2003. Beisswenger, et al., Ann NY Acad Sci. 1043:201-10, 2005. Beisswenger, et al., Ann N Y Acad Sci. 1043:201-210, 2005. Belzung & Griebel, Behav Brain Res. 125:141-49, 2001. Benton, et al., Psychopharmacology (Berl). 221(2):297-315, 2012. Berner, et al., Diabetologia. 55:845-854, 2012. Beyenburg, et al., Epilepsy Behav. 7:161-171, 2005. Birkenhager, et al., Int Clin Psychopharmacol. 10:181-95, 1995. Bollan, et al., Biochem Soc Trans. 31:875-879, 2003. Boso, et al., Neurosci Lett. 410:169-173, 2006. Bouche & Fromm, Trends Plant Sci 9:110-115, 2004. Bouffard, et al., Org Lett. 10:37-40, 2008. Bourin, M., and Hascoet, M. 2003. The mouse light/dark box test. Eur J Pharmacol 463:55-65 Bourin, et al., Fundam Clin Pharmacol. 21:567-574, 2007. Bouwknecht, et al., Behav Pharmacol. 19:385-402, 2008. Briggs & Galanopoulou, Neural Plast. 2011:527605, 2011. Brodie, et al., Epilepsy Behav. 21:331-341, 2011. Brouwers, et al., J Biol Chem. 286:1374-1380, 2010. Brownlee, Nature 414:813-820, 2001. Bryant, et al., J Neurogenet. 22:315-31, 2008. Bunck, et al., PLoS One. 4:e5129, 2009. Cameron, et al., Biochemistry. 38:13480-13490, 1999. Cameron, et al., EMBO Journal. 16:3386-3395, 1997. Canteras, et al., Curr Top Behav Neurosci. 2:77-96, 2010. Carter, et al., Pharmacol Ther. 121:100-114, 2009. Caspi & Moffitt, Nat Rev Neurosci. 7:583-590, 2006. Castagne, et al., Behavioral Assessment of Antidepressant Activity in Rodents. in Methods of Behavior Analysis in Neuroscience, 2009. Castagne, et al., Curr Protoc Neurosci. Chapter 8, Unit 8 10A (2011). Cerda, et al., J Affect Disord. 126:14-38, 2010. Chandler, Drug Discov Today. 18:202-6, 2013). Chandler, et al., Mamm Genome 18:693-708, 2007. Chang, et al., Heterocycles. 12:903-907, 1979. Chang, et al., J Org Chem. 46:4188-4193, 1981. Chatterjee, et al., Biosens Bioelectron. 42:349-54, 2013. Chen, et al., Assay Drug Dev Technol. 10:325-35, 2012. Chen, et al., Chem Soc Rev. 39:2120-35, 2010. Chen, et al., Proc Natl Acad Sci USA 101:7687-7692, 2004. Chiba, et al., Bioorg Med Chem Lett. 22(24):7486-9, 2012. Christensen, et al., Eur Neuropsychopharmacol. 22:751-60, 2012. Churchill, et al., Nat Genet. 36:1133-7, 2004. Clayton, et al., Curr Med Chem. 14:2755-2775, 2007. Conn & Roth, Neuropsychopharmacology. 33:2048-60, 2008. Cooper, et al., Annu Rev Microbiol 38:49-68, 1984. Copeland, et al., Nat Rev Genet 2:769-779, 2001. Crabbe, et al., J Appl Physiol 95:1338-1351, 2003. Crawley, Brain Res 835:18-26, 1999. Crawley, Wiley-Liss, 2007. Crawley, Neuron 57:809-818, 2008. Creighton, Biochem Soc Trans 31:1378-1382, 2003. Crestani, et al., Proc Natl Acad Sci USA. 99:8980-5, 2002. Crestani, et al., Nat Neurosci 2:833-839, 1999. Cryan, et al., Neurosci Biobehav Rev. 29(4-5):571-625, 2005. Csonga, et al., FEBS Lett. 380:209-14, 1996. Curia, et al., J Neurosci Methods. 172:143-157, 2008. Czibere, et al., PLoS One 6:e23604, 2011. Da-Rocha, et al., J Psychopharmacol. 11:211-8, 1997. Davies, et al., Arch Toxicol Suppl 9:46-50, 1986. Davis, Annu Rev Neurosci 15:353-375, 1992. Dawson, et al., Trends Pharmacol Sci 16:33-36, 1995. Dhar, et al., J Chromatogr B Analyt Technol Biomed Life Sci 877:1093-1100, 2009. Di Cristo, Clin Genet 72:1-8, 2007. Di Lio, et al., Neuropharmacology. 60:626-32, 2011. Di Loreto, et al., Brain Res 1006:157-167, 2004. Di Loreto, et al., Int J Biochem Cell Biol 40:245-257, 2008. Dias, et al., J Neurosci. 25:10682-8, 2005. Dina, et al., Nat Genet 39:724-726, 2007. Distler & Palmer. Front Genet. 3:250. doi: 10.3389/fgene.2012.00250, 2012 Distler, et al., Epilepsia (2013). PMC JournalIn Process Distler, et al., J Clin Invest. 122:2306-2315, 2012. Distler, et al., PLoS One 7:e51235, 2012. U.S. Pat. No. 4,711,775 U.S. Pat. No. 4,185,106 Ditzen, et al., Mol Cell Proteomics 5:1914-1920, 2006. Ditzen, et al., Mol Psychiatry 15:702-711, 2010. Doherty, et al., Epilepsia. 48:1764-1767, 2007. WO1998009986 Dulawa & Hen, Neurosci Biobehav Rev. 29(4-5):771-83, 2005. Dutton, et al., Neurobiol Dis. 25:49C:211-220, 2012. Earnheart, et al., J Neurosci 27:3845-3854, 2007. Edwankar, et al., Org Lett. 13:5216-5219, 2011. Egan, et al., Nat Genet 39:1384-1389, 2007. EP0510440 A1 EP0510443 A1 EP1049444 B1 European Patent 1051396 (A1) Farrant, et al., Nat Rev Neurosci 6:215-229, 2005. Filiou, et al., Biol Psychiatry. 70(11):1074-82, 2011. Finn, et al., Neurogenetics. 4:109-35, 2003. Fischer, et al., Neuropharmacology. 59:612-618, 2010. Fisher, Brain Res Brain Res Rev. 14:245-278, 1989. Fisher, et al., Epilepsia. 46:470-472, 2005. Fleming, et al., Gerontology. 57(5):435-43, 2011. Flint, Methods 53:163-174, 2010. Foldvary-Schaefer, et al., Cleve Clin J Med. 71 Suppl 2:S11-18, 2004. Fox, Anim Behav 13:234-241, 1965. Frayling, et al., Science 316:889-894, 2007. Fujimoto, et al., Neurosci Lett 438:196-199, 2008. Galanopoulou, Pflugers Arch. 460:505-523, 2010. Garakani, et al., Mt Sinai J Med 73:941-949, 2006. Gasior, et al., Epilepsia. 48:793-800, 2007. Gerner & Hare Am J Psychiatry 138:1098-1101, 1981. Gill, et al., Neuropsychopharmacology. 36:1903-1911, 2011. Giraldo, et al., Transgenic Res 12:751-755, 2003. Gisselmann, et al., Br J Pharmacol 142:409-413, 2004. Golden, et al., Assay Drug Dev Technol. 9:608-19, 2011. Gotz, et al., Science 293:1491-1495, 2001. Grant, et al., Nat Genet 38:320-323, 2006. Green & Marsden, ACS Chem Neurosci. 4:9-12, 2013. Gregory, et al., Eur Arch Psychiatry Clin Neurosci 258:69-75, 2008. Grillo & Colomobatto Amino Acids 35:29-36, 2008. Guardiola-Lemaitre, et al., Pharmacol Biochem Behav 41:405-408, 1992. Guthrie, et al., Proc Natl Acad Sci USA 86:7378-7381, 1989. Habig, et al., Proc Natl Acad Sci USA. 71:3879-82, 1974 Hablitz, et al., Neuroscientist 15:218-224, 2009. Hamann, Neuroscientist 11:288-293, 2005. Hambsch, et al., J Neurochem. 113(5):1240-51, 2010. Hamilton, et al., J Biol Chem. 267:24933-6, 1992. Hansen, et al., Genome Res 18:1670-1679, 2008. Hart, et al., Methods Mol Biol 602:299-321, 2010. Hartman, et al., Pediatr Neurol. 36:281-292, 2007. Hasler & Northoff. Mol Psychiatry 16:604-619, 2011. Haza, L. Acta Chimica Hungarica 117, 99-116 (1984). He, et al., Drug Des Discov. 17:131-71, 2000. Heintz, Nat Rev Neurosci 2:861-870, 2001. Henshall & Murphy Curr Opin Pharmacol 8:75-81, 2008. Hohoff, J Neural Transm 116:679-687, 2009. Holick, et al., Neuropsychopharmacology. 33(2):406-17, 2008. Hovatta, et al., Nature. 438(7068):662-6, 2005. Hovatta & Barlow, Ann Med 40:92-109, 2008. Huang, et al., J Med Chem. 43: 71-95, 2000. Inglese, et al., Proc Natl Acad Sci USA. 103:11473-8, 2006. Inoue, et al., Semin Cell Dev Biol 22:278-284, 2011. Irwin, Psychopharmacologia. 13:222-57, 1968. Ittner & Gottz, Nat Rev Neurosci 12:65-72, 2011. Jacquier, et al., Nutr Rev 70:118-131, 2012. Jia & Wu, Mol Cell Biochem 306:133-139, 2007. Jiao, et al., Mot Psychiatry. doi: 10.1038/mp.2012.136. [Epub ahead of print], 2012 Johansen, et al., Cell 147:509-524, 2011. Johanson, et al., Cerebrospinal Fluid Res 5:10, 2008. Johnson, Br J Clin Pharmacol. 19 Suppl 1:31S-35S, 1985 Junaid, et al., Am J Med Genet A 131:11-17, 2004. Kabir, et al., J Org Chem. 75:3626-3643, 2010. Kalapos, Med Hypotheses 68:1382-1388, 2007. Kalueff & Nutt, Depress Anxiety 24:495-517, 2007. Kaneda, et al., J Physiol 485 (Pt 2):419-435, 1995. Kavarana et al J Med. Chem. 42:221-228, 1999. Kemlink, et al., J Med Genet. 46:315-8, 2009. Kendler, et al., Psychol Med. 37:453-62, 2007. Kent, et al., Biol Psychiatry 52:1008-1030, 2002. Khattab, S. Ind. J CHem. 15B: 432-5, 1977. Kim, et al., J Biochem 117:359-361, 1995. Kirik & Bjorklund, Trends Neurosci 26:386-392, 2003. Kitamura, et al., J Am Chem Soc. 124:6649-6667, 2002. Kompf, et al., Humangenetik 27:141-143, 1975. Krautwald, et al., Exp Gerontol 45:744-751, 2010. Kromer, et al., J Neurosci 25:4375-4384, 2005. Kuhla, et al., Ann N Y Acad Sci 1043:211-216, 2005. Kuhla, et al., J Neurosci Res. 83:1591-600, 2006. Kullmann, et al., Prog Biophys Mol Biol 87:33-46, 2005. Kumar & Punekar Mycological Research 101:403-409, 2007. Kumar, et al., Psychopharmacology (Berl) 205:529-564, 2009. Kurz, et al., Cellular and Molecular Life Sciences 68:721-733, 2011. LaFrance, et al., Int Rev Neurobiol. 83:347-383, 2008. Landgraf, et al., Neurosci Biobehav Rev. 31:89-102, 2007. LeDoux, Curr Biol 17:R868-874, 2007. LeDoux, Annu Rev Neurosci 23:155-184, 2000. Leonardo, et al., Annu Rev Psychol. 57:117-137, 2006. Lever, et al., Nature. 231:368-371, 1971. Li, et al., Cell Biochem Funct. 29(1):30-5, 2011. Lissek, et al., Behav Res Ther. 43:1391-1424, 2005. Liu, et al., J Psychiatr Res. 37:249-259, 2003. Lo & Thornalley, Biochem Pharmacol 44: 2357-63, 1992. Lo, et al., J Biol Chem. 269:32299-32305, 1994. Loh, et al., Curr Alzheimer Res. 3:327-337, 2006. Lohaus & Dittmar, Arzneimittelforschung 31:1311-6, 1981. Loos, et al., Genes Brain Behav. 8:817-828, 2009. Low, et al., Science 290: 131-4, 2000. Lu, et al., Clin Biochem. 44:307-311, 2011. Luscher, et al., Mol Psychiatry. 16:383-406, 2011. Ma, et al., J Org Chem. 74:264-273, 2009. Macdonald, et al., J Physiol. 588:1861-1869, 2010. Maguire, et al., Nat Neurosci. 8:797-804, 2005. Maitra, A. The Endocrine System. In Robbins and Cotran Pathologic Basis of Disease. V. Kumar, A. Abbas, N. Fausto, and J. Aster, editors. Philadelphia: Elsevier, 2010. Mansfield, et al., J Appl Physiol. 49:390-397, 1980. Manto, M. Cerebellum. 7:505-516, 2008. Markou, et al., Neuropsychopharmacology. 34:74-89, 2009. Martin, et al., Hum Mol Genet. 16:2892-2899, 2007. Martin, et al., J Biol Chem. 285:9823-9834, 2010. Masterjohn, et al., J Nutr Biochem. 23(3):292-8, 2012. McCall & Frierson D, Genetics 99:285-307, 1981. McCallum, et al. J Biomol Screen (2013). McKenney & Short, Surg Clin North Am. 91:1139-1148, vii, 2011. McKernan, et al., Nat Neurosci. 3:587-92, 2000. McLean & Anderson, Clin Psychol Rev 29:496-505, 2009. McLellan & Thornalley, Analytica Chimica Acta. 263:137-142, 1992. Mehta, et al., Curr Psychiatry Rep. 12:135-144, 2010. Miller, Science. 329:502-4, 2010. Milner & Crabbe, Genes Brain Behav 7:496-505, 2002. Morcos, et al., Aging Cell. 7:260-269, 2008. More & Vince, J Med Chem. 52:4650-6, 2009. Moser, et al., J Pharmacol Exp Ther. 336:588-95, 2011. Movassaghi & Schmidt, Abstracts of Papers of the American Chemical Society. 234, 2007. Mulley, et al., Hum Mol Genet. 14 Spec No. 2:R243-249, 2005. Murthy, et al., J Med Chem. 37:2161-6, 1994. Naegele, Epilepsia 48 Suppl 2:107-117, 2007. Namjoshi, et al., J Org Chem. 76(11):4721-4727, 2011 Nandhikonda, et al., J Med Chem 55:4640-51, 2012 Nerl, et al., Neurology. 34:310-314, 1984. Nillni, et al. Clin psychol Rev. 31:1183-1191, 2011. NIMH, Anxiety Disorders. Bethesda: National Institutes of Health, 2009. Noe, Semin Neurol. 31:54-64, 2011. Nusser, et al., J Neurosci. 18:1693-703, 1998. Nusser, et al., Eur J Neurosci. 11:1685-1697, 1999. O'Leary, O. F., and Cryan, J. F. The Tail-Suspension Test: A Model for Characterizing Antidepressant Activity in Mice. In Mood and Anxiety Related Phenotypes in Mice. T. D. Gould, editor. New York: Humana Press. 119-137, 2009. Oehldrich, et al., J Org Chem. 42:889-894, 1977. Ohmori & Iwamoto, J Chromatogr. 431:239-47, 1988. Okumoto, et al., Annu Rev Plant Biol. 63:663-706, 2012 Overall, et al., Front Neurosci 3:55, 2009. Pagel & Parnes, Prim Care Companion J Clin Psychiatry. 3(3):118-125, 2001. Palanza, Neurosci Biobehav Rev. 25:219-233, 2001. Palmer & Dulawa, Front Neurosci. 4:177, 2010 Palmer, et al., Brain Res. 1237:62-74, 2008 Papale, et al., J Biol Chem. 285:16553-16561, 2010. Pare, et al., J Neurophysiol. 92:1-9, 2004. Parker & Palmer, Front Genet 2:32, 2011 Parker, et al., Behav Genet. 42:437-48, 2012. Payne, et al., Epilepsia. 52:1941-1948, 2011. Payne, et al., Hum Hered. 32:404-407, 1982. Peirce, et al., BMC Genet. 5:7, 2004. Peng, et al., Sensors (Basel) 12:15907-46, 2012 Perucca, et al., Lancet Neurol. 10:446-456, 2011. Petty & Schlesser, J Affect Disord. 3:339-343, 1981. Petty & Sherman, J Affect Disord. 6:131-138, 1984. Philip, et al., Genome Res. 21:1223-38, 2011. Pitkanen, Epilepsy Res. 50:141-160, 2002. Plant, et al., J Clin Invest. 116:430-435, 2006. Plant, et al., J Gen Physiol. 137:441-454, 2011. Plant, et al., Stroke. 33:2324-2328, 2002. Plant, et al., Neurobiol Aging. 27:1673-1683, 2006. Plomin, et al., Behav Genet. 21:99-116, 1991. Politi, et al., Neurosci Lett. 396:163-166, 2006. Pollack, J Clin Psychiatry. 70 Suppl 2:32-38, 2009. Ponder, et al., Behav Genet. 38:277-91, 2008. Ponder, et al., Genes Brain Behav. 6:736-49, 2007. Ponder, et al., Mamm Genome. 18: 221-8, 2007. Porsolt, et al., Arch Int Pharmacodyn Ther. 288:11-30, 1987. Pourmotabbed & Creighton, J Biol Chem. 261:14240-14244, 1986. Queisser, et al., Diabetes. 59:670-678, 2010. Racker, J Biol Chem. 190:685-96, 1951. Rader & Pure, Circ Res. 86:1013-1015, 2000. Rakhade & Jense, Nat Rev Neurol. S 5:380-391, 2009. Randella, et al., J Pharmacol Toxicol Meth. 51:153-157, 2005. Rauh, et al., Trends Pharmacol Sci. 11:325-329, 1990. Rees, M. I. 2010. The genetics of epilepsythe past, the present and future. Seizure 19:680-683. Rehnstrom, eta., Am J Med Genet B Neuropsychiatr Genet. 147B:124-127, 2008. Reiner-Benaim, et al., Bioinformatics. 23:2239-2246, 2007. Ridderstrom, et al., JBiot Chem. 271:319-23, 1996. Ridderstrom, et al., J. Biol. Chem. 273:21623-21628, 1998. Rivas, et al., J Med Chem. 52:1795-8, 2009 Rossetti & Lowenstein, Lancet Neurol. 10:922-930, 2011. Roux, et al., Curr Protoc Pharmacol. Chapter 10, Unit 10 10, 2005. Rubenstein, J Child Psychol Psychiatry. 52:339-355, 2011. Rudolph, et al., Nature. 401:796-800, 1999. Rudolph & Knoflach, Nat Rev Drug Discov. 10:685-697, 2011. Rudolph & Mohler, Annu Rev Pharmacol Toxicol. 44:475-98, 2004. Sacco, et al., BMC Med Genet. 8:11, 2007. Sah, et al., Physiol Rev. 83:803-834, 2003. Sakamoto, et al., Clin Cancer Res. 7:2513-8, 2001. Samocha, et al., Genes Brain Behav. 9:759-67, 2010. Santel, et al., PLoS One 3:e3508, 2008 Saraiva, et al., Tetrahedron. 65:3563-3572, 2009 Savic, et al., Neuropsychopharmacology 33:332-339, 2008 Savic, et al., PLoS One. 6:e26897, 2011 Scharfman, et al., Epilepsia. 48 Suppl 2:33-41, 2007. Schauwecker, Epilepsy Res. 97:1-11, 2011. Schauwecker, Neurobiol Dis. 45:297-304, 2012. Schleicher & Friess, Kidney Int. Suppl:S17-26, 2007. Schmidt, Epilepsy Behav. 15:56-65, 2009. Schmidt, et al., Neuropsychopharmacology. 35(12): 2378-2391, 2010. Schmittgen & Livak, Nat Protoc. 3:1101-1108, 2008. Schumacher, et al., J Med Genet. 48:361-368, 2011. Semba, et al., J Gerontol A Biol Sci Med Sci. 65:963-975, 2010. Shen, et al., Biol Psychiatry. 68:512-520, 2010. Shifman, et al., PLoS Biol. 4:e395, 2006. Shin, et al., Neuropsychopharmacology. 35:169-191, 2010. Shinohara, et al., J Clin Invest. 101:1142-7, 1998 Shulman, et al., Trends Neurosci. 27:489-495, 2004. Sieghart & Sperk, Curr Top Med Chem. 2:795-816, 2002. Smoller, et al., Depress Anxiety. 26:965-975, 2009. Snow, et al., Tetrahedron Lett. 17:4447-4450, 1976. Sokoloff, et al., Genes Brain Behav. 10:604-14, 2011. Solomon & Herman, Physiol Behav. 97:250-258, 2009. Stefansson, et al., N Engl J Med. 357:639-47, 2007. Stein, J Clin Psychiatry. 70 Suppl 2:15-19, 2009. Stem, et al., Psychopharmacology (Berl) 85:367-370, 1985. Stem, et al., Prog Neuropyschopharmacol Biol Psychiatry. 11:659-671, 1987. Stevens, et al., Trends Mod Med. 13:512-519, 2007. Storey & Tibshirani, Proc Natl Acad Sci USA. 100:9440-9445, 2003. Tabor, et al., Nat Rev Genet. 3:391-397, 2002. Taft, et al., Trends Genet. 22:649-653, 2006. Takasawa, et al., Bioorg Med Chem Lett. 21:4337-42, 2011 Takasawa, et al., Bioorg Med Chem. 16:3969-75, 2008 Tarantino, et al., The Origins of Schizophrenia, (Columbia University Press, N Y, 2011). Tasan, et al., Neuroscience. 183:71-80, 2011. Thornalley, et al., J Med Chem 39:3409-3411, 1996. Thornalley, Mol Aspects Med 14, 287-371, 1993. Thornalley, Heredity (Edinb). 67 (Pt 2):139-142, 1991. Thornalley, Biochem Soc Trans. 31:1343-1348, 2003. Thornalley, Biochem Soc Trans. 31:1372-7, 2003. Thornalley, Trends Mol Med. 12:195-9, 2006. Thornalley, et al., Semin Cell Dev Biol. 22:318-325, 2011. Titlic, et al., Bratisl Lek Listy. 110:105-109, 2009. Toyosima, et al., Br J Psychiatry. 199:345-6, 2011. Trenkwalder, et al., Nat Rev Neurol. 6:337-46, 2010. C., Ulrich-Lai, et al., Proc Natl Acad Sci USA. 107:20529-34, 2010. U.S. Pat. No. 3,984,569 U.S. Pat. No. 4,552,754 U.S. Pat. No. 5,229,254 U.S. Pat. No. 5,230,985 U.S. Pat. No. 5,616,563 U.S. Pat. No. 5,969,174 U.S. Pat. No. 6,060,471 U.S. Pat. No. 7,235,656 U.S. Pat. No. 7,700,560 U.S. Pat. No. 8,268,854 B2 US Patent Publication 2010/0261711 A1 US Patent Publication 2012/0220596 A1 van der Heyden, et al., Psychopharmacology (Berl). 92:127-30, 1987. Vanin, et al., Anxiety Disorders: A Pocket Guide for Primary Care. NJ: Humana Press, 2008. Velez, et al., Behav Genet. 40:201-10, 2010 Veliskova, Neuroscientist. 13:77-88, 2007. Vince, et al., Biochem Biophys Res Commun. 35:593-8, 1969. Vince, et al., J Med Chem. 14:402-4, 1971. Vithlani, et al., Physiol Rev. 91:1009-22, 2010. Wang, et al., Neuroinformatics. 1:299-308, 2003. Wang, et al., J Hypertension. 26:765-72, 2008. Whitham, Comphrehensive Organic Chemistry 1:129, 1979. Wieland, et al., J Biol Chem. 267:1426-9, 1992. Williams, et al., Genome Biol. 2:RESEARCH0046, 2001. Williams, et al., PLoS One. 4:e4649, 2009. Willmore, Epilepsy Behav. 7 Supp 3: S25-8, 2005. Winawer, et al., Epilepsia. 52:2076-2083, 2011. Winkelmann, et al., Nat Genet. 39:1000-6, 2007. Winsky-Sommerer, Eur J Neurosci. 29:1779-94, 2009. Wittchen, et al. Eur Neuropsychopharmacol. 21:655-79, 2011. WO/1999/035128 WO/1999/037277 Wu, et al., Prog Neuropsychopharmacol Biol Psychiatry. 32:1740-4, 2008. Wyllie & Cull-Candy, J Physiol. 475:95-114, 1994. Xue, et al., Semin Cell Dev Biol. 22:293-301, 2011. Yadav, et al., Drug Metabol Drug Interact. 23:51-68, 2008. Yang, et al., Curr Protoc Neurosci. 5(5):20, 2005. Yeung, et al., Mot Pharmacol. 63:2-8, 2003. Yin, et al., Bioorg and Med. Chem. 21:7548-7564, 2010. Zhang, eta., Mol Cell Proteomics. 10(12):M111.008110, 2011.