Biomarkers For Endometriosis
20230108685 · 2023-04-06
Inventors
Cpc classification
G01N33/564
PHYSICS
A61P15/00
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
G01N2800/364
PHYSICS
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
G01N33/564
PHYSICS
Abstract
The presence of certain auto antibodies and miRNAs indicates that a subject has endometriosis. The auto-antibodies recognise antigens listed in Table 1. The miRNAs are also listed in Table 1.
Claims
1. A method for analysing a subject sample, comprising a step of determining the level of x different biomarkers in the sample, wherein the levels of the biomarkers provide a diagnostic indicator of whether the subject has endometriosis; wherein x is 1 or more and wherein the x different biomarkers are selected from the group consisting of hsa-miR-150 and the other biomarkers listed in Table 1.
2. The method of claim 1, wherein the x different biomarkers are selected from the group consisting of ebv-miR-BART2-5p, hsa-let-7f, hsa-let-7g, hsa-miR-1260, hsa-miR142-3p, hsa-miR-197, hsa-miR-215, hsa-miR-223, hsa-miR-30b, hsa-miR-320c, hsa-miR34a, hsa-miR-497, hsa-miR-630, hsa-miR-663 and hsa-miR-720.
3. The method of claim 1 or claim 2, wherein x is 2 or more.
4. The method of claim 3, wherein x is 5 or more.
5. The method of claim 4, wherein x is 10 or more.
6. The method of any preceding claim, wherein the method also includes a step of determining if a sample from the subject contains autoantibodies against CA125 and/or CA19-9.
7. The method of any preceding claim, wherein the method involves comparing levels of the biomarkers in the subject sample to levels in (i) a sample from a patient with endometriosis and/or (ii) a sample from a patient without endometriosis.
8. The method of any preceding claim, wherein the method involves analysing levels of the biomarkers in the sample with a classifier algorithm which uses the measured levels of to distinguish between patients with endometriosis and patients without endometriosis.
9. The method of any preceding claim, wherein the subject is (i) pre-symptomatic for endometriosis or (ii) already displaying clinical symptoms of endometriosis.
10. The method of any preceding claim, wherein the sample is a body fluid.
11. The method of claim 10, wherein the sample is cervical discharge or peritoneal fluid.
12. The method of any preceding claim, wherein the presence of antibodies is determined using an immunoassay.
13. The method of claim 10, wherein the immunoassay utilises an antigen comprising an amino acid sequence (i) having at least 90% sequence identity to an amino acid sequence disclosed in Table 1, and/or (ii) comprising at least one epitope from an amino acid sequence disclosed in Table 1.
14. The method of claim 12 or claim 13, wherein the immunoassay utilises a fusion polypeptide with a first region and a second region, wherein the first region can react with an auto-antibody in a sample and the second region can react with a substrate to immobilise the fusion polypeptide thereon.
15. The method of any preceding claim, wherein the subject is a human.
16. The method of any one of claims 3 to 15, wherein the 2 or more different biomarkers are: a) a panel comprising or consisting of 2 different biomarkers, namely: (i) a biomarker selected from Table 1 and (ii) a further biomarker selected from Table 2. b) a panel comprising or consisting of 2 different biomarkers, namely: (i) a biomarker selected from Table 1 and (ii) a further biomarker selected from Table 3. c) a panel comprising or consisting of 2 different biomarkers, namely: (i) group of 2 biomarkers from Table 1 and (ii) a further biomarker selected from Table 4. d) a panel comprising or consisting of 3 different biomarkers, namely: (i) a group of 2 biomarkers selected from Table 11 and (ii) a further biomarker selected from Table 1. e) a panel comprising or consisting of 3 different biomarkers, namely: (i) a group of 2 biomarkers selected from Table 11 and (ii) a further biomarker selected from Table 2. f) a panel comprising or consisting of 3 different biomarkers, namely: (i) a group of 2 biomarkers selected from Table 11 and (ii) a further biomarker selected from Table 3. g) a panel comprising or consisting of 3 different biomarkers, namely: (i) a group of 2 biomarkers selected from Table 11 and (ii) a further biomarker selected from Table 4. h) a panel comprising or consisting of 4 different biomarkers, namely: (i) a group of 3 biomarkers selected from Table 12 and (ii) a further biomarker selected from Table 1. i) a panel comprising or consisting of 4 different biomarkers, namely: (i) a group of 3 biomarkers selected from Table 12 and (ii) a further biomarker selected from Table 2. j) a panel comprising or consisting of 4 different biomarkers, namely: (i) a group of 3 biomarkers selected from Table 12 and (ii) a further biomarker selected from Table 3. k) a panel comprising or consisting of 4 different biomarkers, namely: (i) a group of 3 biomarkers selected from Table 12 and (II) a further biomarker selected from Table 4. l) a panel comprising or consisting of 5 different biomarkers, namely: (i) a group of 3 biomarkers selected from Table 13 and (ii) a further biomarker selected from Table 1. m) a panel comprising or consisting of 5 different biomarkers, namely: (i) a group of 4 biomarkers selected from Table 13 and (ii) a further biomarker selected from Table 2. n) a panel comprising or consisting of 5 different biomarkers, namely: (i) a group of 4 biomarkers selected from Table 13 and (ii) a further biomarker selected from Table 3. o) a panel comprising or consisting of 5 different biomarkers, namely: (i) a group of 4 biomarkers selected from Table 13 and (ii) a further biomarker selected from Table 4. p) a panel comprising or consisting of 6 different biomarkers, namely: (i) a group of 5 biomarkers selected from Table 14 and (ii) a further biomarker selected from Table 1. q) a panel comprising or consisting of 6 different biomarkers, namely: (i) a group of 5 biomarkers selected from Table 14 and (ii) a further biomarker selected from Table 2. r) a panel comprising or consisting of 6 different biomarkers, namely: (i) a group of 5 biomarkers selected from Table 14 and (ii) a further biomarker selected from Table 3. s) a panel comprising or consisting of 6 different biomarkers, namely: (i) a group of 5 biomarkers selected from Table 14 and (ii) a further biomarker selected from Table 4. t) a panel comprising or consisting of 7 different biomarkers, namely: (i) a group of 6 biomarkers selected from Table 15 and (ii) a further biomarker selected from Table 1. u) a panel comprising or consisting of 7 different biomarkers, namely: (i) a group of 6 biomarkers selected from Table 15 and (ii) a further biomarker selected from Table 2. v) a panel comprising or consisting of 7 different biomarkers, namely: (i) a group of 6 biomarkers selected from Table 15 and (ii) a further biomarker selected from Table 3. w) a panel comprising or consisting of 7 different biomarkers, namely: (i) a group of 6 biomarkers selected from Table 15 and (ii) a further biomarker selected from Table 4. x) a panel comprising or consisting of a group of 12 different biomarkers selected from Table 10.
17. A diagnostic device for use in diagnosis of endometriosis, wherein the device permits determination of the level(s) of 1 or more Table 1 biomarkers.
18. A kit comprising reagents for measuring the levels of at least 2 different Table 1 biomarkers.
19. The use of a Table 1 biomarker as a diagnostic biomarker for endometriosis.
20. A method for raising an antibody response in a subject, comprising eliciting to the subject an immunogen which elicits antibodies which recognise an auto-antigen listed in Table 1.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
MODES FOR CARRYING OUT THE INVENTION
[0217] Study 1
[0218] 1. Detection of Auto-Antibodies in Serum of Subjects Suffering from Endometriosis
[0219] a. Array Preparation
[0220] The examples refer to use of a “functional protein” array technology which has the ability to display native, discontinuous epitopes [111,112]. Proteins are full-length, expressed with a folding tag in insect cells and screened for correct folding before being arrayed in a specific, oriented manner designed to conserve native epitopes. Each array contains approximately 1550 human proteins representing ˜1500 distinct genes chosen from multiple functional and disease pathways printed in quadruplicate together with control proteins. In addition to the proteins on each array, four control proteins for the BCCP-myc tag (BCCP, BCCP-myc, β-galactosidase-BCCP-myc and β-galactosidase-BCCP) were arrayed, along with additional controls including Cy3-labeled biotin-BSA, dilution series of biotinylated-IgG and biotinylated-IgM and buffer-only spots.
[0221] Incubation of the arrays with serum samples slows detection of binding of serum immunoglobulins to specific proteins on the arrays, enabling the identification of both autoantibodies and their cognate antigens [112].
[0222] b. Biomarker Confirmation
[0223] Serum samples were obtained from two groups of subjects: [0224] 1. serum samples from subjects diagnosed with endometriosis (n=36). [0225] 2. serum samples from age-matched healthy donors (n=35).
[0226] For autoantibody profiling, serum samples were incubated with arrays separately. All arrays were incubated for 2 hours at room temperature (RT, 20° C.), followed by washing three times in fresh Triton-BSA buffer at RT for 20 minutes. The washed slides were incubated in a labelled anti-human IgG antibody at RT for 2 hours. Slides were washed three times in Triton-BSA buffer for 5 minutes at RT, rinsed, and centrifuged for 2 minutes at 240 g.
[0227] The probed and dried arrays were scanned using an Agilent High-Resolution microarray scanner at 10 μm resolution. The resulting 20-bit tiff images were feature extracted using Agilent's Feature Extraction software version 10.5 or 10.7.3.1. The microarray scans produced images for each array that were used to determine the intensity of fluorescence bound to each protein spot which were used to normalize and score array data.
[0228] Raw median signal intensity (also referred to as the relative fluorescent unit, RFU) of each protein feature (also referred to as a spot or antigen) on the array was subtracted from the local median background intensity. Alternative analyses use other measures of spot intensity such as the mean fluorescence, total fluorescence, as known in the art. The results of QC analyses showed that the platform performed well within expected parameters with relatively low technical variation.
[0229] The raw array data was normalized by consolidating the replicates (median consolidation), followed by normal transformation and then global median normalisation. Outliers were identified and removed. There is no method of normalisation which is universally appropriate and factors such as study design and sample properties must be considered. For the current study median normalisation was used. Other normalisation methods include, amongst others, SAM, quantile normalisation [113], multiplication of net fluorescent intensities by a normalisation factor consisting of the product of the 1st quartile of alt intensities of a sample and the mean of the 1st quartiles of ail samples and the “VSN” method [114]. Such normalisation methods are known in the art of microarray analysis.
[0230] This normalised data was then used for the identification of individual candidate biomarkers and for the development of combinations of biomarkers (“panels”). Tools such as volcano plots (
[0231] 2 Detection of miRNA in Serum of Subjects Suffering from Endometriosis Using Microarrays
[0232] a. Array Preparation
[0233] For microarray fabrication and usage. Agilent Technologies' (‘Agilent’) miRNA microarray was used. The content of the microarray is continuously aligned with releases from the miRBase database [115, 116, 117, 118], representing all known miRNAs from human beings, as well as all know human viral mRNAs. These arrays are printed using Agilent's ink-jet in situ synthesis microarray fabrication machines.
[0234] b. Biomarker Confirmation
[0235] A set of 71 serum samples, sourced from patients with endometriosis (“case”; n=36) and normal (“control”; n=35) patients were processed to extract total RNA (including miRNA) using standard column filtration methodologies. The extracted serum samples were analysed using the Agilent miRNA microarray (G4870A-031181), according to their standard protocol, (manual part number G4170-90011, version 2.4). However, deviations from the standard protocol included labeling of the samples using 2.25 μl Cyanine 3-pCp, and hybridising the microarray slides for 44 hours.
[0236] The probed and dried arrays were then scanned using a microarray scanner capable of using an excitation wavelength suitable for the detection of the labelled miRNAs and to determine magnitude of miRNA binding to the complementary detection probe. The microarray scans produced images for each array that were used to determine the intensity of fluorescence bound to each oligonucleotide spot which were used to normalise and score array data.
[0237] The raw microarray scan image contains raw signal intensity (also referred to as the relative fluorescent unit, RFU) for each oligonucleotide spot (also referred to as a feature) on the array. These images were then feature extracted using Agilent's proprietary feature extraction software. Alternative analyses use other measures of spot intensity such as the mean fluorescence, total fluorescence, as known in the art.
[0238] The resulting average intensities of all oligonucleotide features on each array were then normalised to reduce the influence of technical bias (e.g. laser power variation, surface variation, input miRNA concentration, etc.) by a percentile normalisation procedure. Other methods for data normalisation suitable for the data include, amongst others, quantile normalisation [97]. Such normalisation methods are known in the art of microarray analysis.
[0239] A linear model was fitted to evaluate statistical differences in miRNA expression between cases and controls. Volcano plot analysis of the miRNA microarray data is shown in
[0240] The hierarchical clustering of the significant mRNAs according to the type of tissue (i.e. case vs. control) is shown in
[0241] 3 Validation of miRNA in Serum of Subjects Suffering from Endometriosis Using qPCR
[0242] For quantitative PCR (“qPCR”) usage, Life Technologies' (“LifeTech”) TaqMan® miRNA assays were used. These assays am continuously aligned with releases from the MiRBase database, representing all known miRNAs from human beings, as well as all know human viral mRNAs. These TaqMan® mRNA assays employ a novel target-specific stern-loop reverse transcription primer to address the challenge of the short length of mature miRNA. The primer extends the 3′ end of the target to produce a template that can be used in standard TagMan® assay-based real-time PCR. Also, the stem-loop structure in the tail of the primer confers a key advantage to these assays: specific detection of the mature, biologically active mRNA.
[0243] Using the significant markers identified in the miRNA microarray experiments, a sub-selection of miRNAs were analysed using the LifeTech TaqMan® miRNA qPCR assays, according to their standard protocol, (manual pact number 4465407, revision date 30 Mar. 2012 (Rev. B)).
[0244] The TagMan® miRNA assays were scanned using a ViiA™ 7 Real-Time PCR System using an excitation wavelength suitable for the detection of the labelled mRNAs (for example, but not limited to, 6-FAM™ Dye). The qPCR scans produced traces for each TaqMan® mRNA assay which can be used, if applicable, to determine the amount of specific mRNA within a given sample, relative to a passive reference dye (for example, but not limited to, ROX).
[0245] The raw qPCR traces contain raw signal intensity (also referred to as ΔRn) to which an assay threshold (horizontal line) is applied after the raw traces have been baseline norms lied, which is necessary to remove aberrant signal. This threshold line intersects the qPCR trace at the point on the qPCR trace where the trace is logarithmic. From this, the qPCR cycle (Ct) can be determined. These qPCR traces are analysed using LifeTech's proprietary analysis software. Alternative analyses and analysis techniques are known in the art.
[0246] The median Ct and mean quantity was taken across the three sample replicates for each TaqMan® mRNA assay. Testing for statistically significant associations between the two groups (case vs control) was carried out by applying linear models to the normalised sample data to identify general miRNA changes between case samples and control samples. Statistical differences were calculated using a t-test.
[0247] The data from the microarray and TaqMan® miRNA qPCR assays were analysed for Pearson correlation to assess the cross-platform robustness of the observed results (
[0248] 4. Multivariate Analysis: Combination of miRNA and Autoantibody Biomarkers in Serum of Subjects Suffering from Endometriosis
[0249] Panels of putative biomarkers were developed consisting of either autoantibodies alone, miRNAs alone or combinations containing both autoantibodies and miRNA species. Multivariate analysis was also performed incorporating data for galectin-3 and CA125 as variables however their inclusion did not improve on the performance of the miRNA and autoantibodies identified here. It is not possible to predict a priori which classifier will perform best with a given dataset, therefore data analysis was performed with 5 different feature ranking methods (1-5) plus forward and backward feature selection: [0250] 1. Entropy [0251] 2. Bhattacharyya [0252] 3. T-test [0253] 4. Wilcoxon [0254] 5. ROC [0255] 8. Forward selection [0256] 7. Backward selection
[0257] Other classification methods as known in the art could be used. Classifiers were then assessed for performance by referring to the combined sensitivity and specificity (S+S score) and area under the curve (AUC). Data were repeatedly split and analysis cycles repeated until a stable set of classifiers (“panels”) was identified. Nested cross validation was applied to the classification procedures in order to avoid overfilling of the study data. The performance of the classification was compared to a randomized set of case-control status samples (permutation assay) which should give no predictive performance and provides an indication of the background in the analysis. A figure close to 1.0 is expected for the null assay (equivalent to a sensitivity+specificity (S+S) score of 0.5+0.5, respectively) whereas an S+S score of 2.0 would indicate 100% sensitivity and 100% specificity. The difference between the values for the permutation analysis and the classifier performance indicates the relative strength of the classifier. The antigens and miRNAs identified from this study are provided in Tables 2 and 3.
[0258] Table 8 shows the protein biomarkers that provided good performance, as judged by p value, fold-change, sensitivity, specificity, AUC. The best performing protein biomarkers are shown in Table 7. Table 8 shows the miRNA biomarkers that provided good performance, as judged by p value, fold-change, sensitivity, specificity, AUC. The best performing mRNA biomarkers are shown in Table 9. The ROC curves for some oldie best performing miRNA biomarkers (hsa miR-150, hsa-miR-574-5p and hsa-miR-342-3p) are shown in
[0259] The analysis methods described above were used to build, test and identify combinations of biomarkers with greater sensitivity, specificity or AUC than the individual biomarkers disclosed in Table 1.
[0260] For each analysis, multiple combinations of putative biomarkers were derived and the performance of the derived panels was then ranked (rabies 11-15). Tables 11-15 show 2-mer, 3-mer, 4-mer, 5-mer and 8-mar panels that provide good performance. The ROC curves for some of the best performing combinations are shown in
[0261] The biomarkers with the greatest diagnostic power, as judged by p value, fold-change, sensitivity, specificity, AUC and/or frequency of appearance in the panels derived were identified and combined into a single list of antigens and miRNAs.
[0262] Study 2
[0263] 1. Detection of miRNA in Tissue Samples of Subjects Suffering from Endometriosis Using NanoString Technology
[0264] The fresh tissue samples used in this study include: peritoneal endometriosis (ES), ovarian endometriomas (OvES), normal endometrium (NE) and normal peritoneum (NP).
[0265] miRNA Extraction
[0266] Total RNA from specimens was extracted using the mirVana™ PARIS™ kit (Ambion) as per their supplied protocol. RNA quantification and integrity was assessed using the Eukaryote total RNA nano assay by Aligent Technologies™. Following validation, 100 ng of total RNA was used in the nCounter® miRNA Expression Assay (NanoString Technologies) enabling an ultrasensitive miRNA detection in total RNA across all biological levels of expression without the use of reverse transcription or amplification. 735 human and human-associated viral miRNAs derived from MiRBase were scanned. Unique multiplexed annealing of specific oligonucleoside tags were ligated onto their target miRNA followed by an enzymatic purification to remove all unligated tags. Excess unbound probes and RNA were washed using a two-step magnetic bead-based purification system on the nCounter Prep Station. Remaining miRNA was attached to a cartridge surface and polarised. The Cartridge was scanned and data collection was performed on the nCounter digital analyser. Digital images were processed and miRNA counts were tabulated.
[0267] Statistical Analysis
[0268] The R project (R version 2.12.1) (http://www.R-project.org) was used for statistical and clustering analysis. Quantified gene expression signal levels derived from the nCounter® miRNA Egression Assay (NanoString Technologies) were logarithmically transformed (base 2) and quantile-normalized prior to further exploration. In order to determine miRNA expression detectability threshold the log 2 signal values were ranked in increasing order and binned into 0.5 expression level categories. Subsequently, the differences in successive expression level frequencies were calculated and the expression value following the most significant signal increase was considered as miRNA expression detectability threshold. miRNA expressions at any level (above log 2 expression value of 3.25) were counted in each group and subsequently chi-square test was performed to assess if the numbers are significantly different from expected average. The global expression of miRNAs between all groups was not noted to be significantly different (chi square p-value 0.62664147).
[0269] Analysis of variance (ANOVA) was performed per each gene across all samples assigned to appropriate groups in order to identify differentially expressed mRNAs. The Benjamin & Hochberg multiple hypothesis testing correction was applied to control the false discovery rate (FDR). Genes that remained statistically significant (corrected p-value <0.05) were selected for unsupervised hierarchical clustering performed based on distances calculated by means of Spearman correlation coefficient and ward agglomeration method.
[0270] Subsequently, pairwise t-tests with corrections for multiple testing were applied as a post hoc analysis. T-test was performed between a particular sample group and all other sample groups. For example, ES samples were compered against all other groups (OvES, NP and NE), OvES samples were compared against all other groups (ES, NP and NE) etc. Computed t-statistics and signal intensity fold changes were further used to determine significantly up- and down-regulated miRNAs in each sample group and to generate Venn diagrams depicting the overlap between miRNAs differentially expressed in investigated groups (
[0271] Area A in
[0272] Area C in
[0273] Area F in
[0274] Area B in
[0275] Area D in
[0276] Area E in
[0277] 2 Validation of miRNA in Tissue Samples of Subjects Suffering From Endometriosis Using qPCR
[0278] PCR was performed to validate the microarray data. TaqMan® MicroRNA Assays (Applied Biosystems) were used.
[0279] cDNA was synthesized from total RNA using a commercially available specific EBV-miR-bart2-5p assay. RNU-44 and hsa-miR-26b were used as the mature miRNA endogenous controls. The miRNA 26b is a commonly expressed vertebrate mRNA and was used as a control primer for the reactions. Real time PCR amplification was performed on triplicates of each sample using the TaqMan2X Universal PCR Master Mix (Applied Biosystems).
[0280] Significant differential expression of the ebv-miR-BART2-5p miRNA was observed between normal endometrium from controls, normal endometrium from subjects having endometriosis and endometriosis (
[0281] It will be understood that the invention has been described by way of example only and modifications may be made whist remaining within the scope and spirit of the invention.
TABLE-US-00001 TABLE 1 Biomarkers useful with the invention No..sup.(i) Symbol.sup.(ii) Name.sup.(iii) Type 1. ACTB Homo sapiens actin beta Auto-antigen 2. ADD1 Homo sapiens adducin 1 (alpha) Auto-antigen 3. ADSL Homo sapiens adenylosuccinate lyase Auto-antigen 4. AK2 Homo sapiens adenylate kinase 2 transcript variant AK2A Auto-antigen 5. KLK3 Homo sapiens kallikrein 3 (prostate specific antigen) Auto-antigen transcript variant 1 8. ATF1 Homo sapiens activating transcription factor 1 Auto-antigen 7. CKM Homo sapiens creatine kinase muscle Auto-antigen 8. CLK2 Homo sapiens CDC-like kinase 2 transcript variant phclk2 Auto-antigen 9. DDB2 Homo sapiens damage-specific DNA binding protein 2 Auto-antigen 48 kDa 10. DTYMK Homo sapiens deoxythymidylate kinase (thymidylate Autoantigen kinase) 11. DUSP4 Homo sapiens dual specificity phosphatase 4 transcript Auto-antigen variant 1 12. E2F6 Homo sapiens E2F transcription factors Auto-antigen 13. EXT2 Homo sapiens exostoses (multiple) 2 Auto-antigen 14. FGFR4_ext Homo sapiens fibroblast growth factor receptor 4 transcript Auto-antigen variant 3 15. FIGF Homo sapiens c-fos induced growth factor (vascular Auto-antigen endothelial growth factor D) 16. FKBP3 Homo sapiens FK506 binding protein 3 25 kDa Auto-antigen 17. GALK1 Homo sapiens galactokinase 1 Auto-antigen 18. GK2 Homo sapiens glycerol kinase 2 Auto-antigen 19. GRB7 Homo sapiens growth factor receptor-bound protein 7 Auto-antigen 20. GTF2B Homo sapiens general transcription factor IIB Auto-antigen 21. GTF2H1 Homo sapiens general transcription factor IIH polypeptide Auto-antigen 1 62 kDa 22. GTF2H2 Homo sapiens general transcription factor IIH polypeptide Auto-antigen 2 44 kDa 23. HSPD1 Homo sapiens heat shock 60 kDa protein 1 (chaperonin) Auto-antigen 24. IDI1 Homo sapiens Isopentenyl-diphosphate delta isomerase Auto-antigen 25. IFI16 Homo sapiens interferon, gamma-inducible protein 16, Auto-antigen 26. LDHA Homo sapiens lactate dehydrogenase A Auto-antigen 27. LYL1 Homo sapiens lymphoblastic leukemia derived sequence 1 Auto-antigen 28. MARK3 Homo sapiens MAP/microtubule affinity-regulating kinase Auto-antigen 3 29. MPP3 Homo sapiens membrane protein palmitoylated 3 (MAGUK Auto-antigen p55 subfamily member 3) 30. TRIM37 Homo sapiens tripartite motif-containing 37, Auto-antigen 31. NCF2 Homo sapiens neutrophil cytosolic factor 2 (65 kDa, chronic Auto-antigen granulomatous disease, autosomal 2), 32. RPL10A Homo sapiens ribosomal protein L10a Auto-antigen 33. NFYA Homo sapiens nuclear transcription factor Y alpha Auto-antigen 34. NRAS Homo sapiens neuroblastoma RAS viral (v-ras) oncogene Auto-antigen homolog 35. NTRK3_ext Homo sapiens neurotrophic tyrosine kinase receptor type 3 Auto-antigen transcript variant 3 36. OAS2 Homo sapiens 2′-5′-oligoadenylate synthetase 2 69/71 kDa Auto-antigen 37. endometriosis Homo sapiens pyruvate carboxylase Auto-antigen 38. CDK17 Homo sapiens endometriosisTAIRE protein kinase 2 Auto-antigen 39. PDE4A Homo sapiens Homo sapiens phosphodiesterase 4A, Auto-antigen cAMP-specific (phosphodiesterase E2 dunce homolog, Dro 40. PHF1 Homo sapiens PHD finger protein 1 transcript variant 2 Auto-antigen 41. PKM2 Homo sapiens pyruvate kinase muscle transcript variant 1 Auto-antigen 42. MAP2K5 Homo sapiens mitogen-activated protein kinase kinase 5, Auto-antigen transcript variant A 43. PRPS2 Homo sapiens phospharibosyl pyrophosphate synthetase Auto-antigen 2 44. RAN Homo sapiens RAN member RAS oncogene family Auto-antigen 45. RB1 Homo sapiens retinoblastoma 1 (including osteosarcoma) Auto-antigen 46. RBMS1 Homo sapiens Homo sapiens RNA binding motif single Auto-antigen stranded interacting protein 1 transcript variant 47. RET_a Home sapiens ret proto-oncogene (multiple endocrine Auto-antigen neoplasia and medullary thyroid carci 48. RORC Homo sapiens RAR-related orphan receptor C Auto-antigen 49. RPL18 Homo sapiens ribosomal protein L18 Auto-antigen 50. RPL18A Homo sapiens ribosomal protein L18a Auto-antigen 51. RPL28 Homo sapiens ribosomal protein L28 Auto-antigen 52. RPL31 Homo sapiens ribosomal protein L31 Auto-antigen 53. RPL32 Homo sapiens ribosomal protein L32 Auto-antigen 54. S100A6 Home sapiens S100 calcium binding protein A6 (calcyclin) Auto-antigen 55. SCP2 Home sapiens sterol carrier protein 2 transcript variant 2 Auto-antigen 56. SIAH1 Homo sapiens seven in absentia homolog 1 (Drosophila) Auto-antigen transcript variant 2 57. SMARCD1 Homo sapiens SWI/SNF related matrix associated actin Auto-antigen dependent regulator of chromatin subfamily d member 1 58. SMARCE1 Home sapiens SWI/SNF related matrix associated actin Auto-antigen dependent regulator of chromatin 59. SOD2 Hamo sapiens superoxide dismutase 2 mitochondrial Auto-antigen 60. SOX2 Homo sapiens SRY (sex determining region Y)-box 2 Auto-antigen 61. SRPK1 Homo sapiens SFRS protein kinase 1 Auto-antigen 62. TPM1 Homo sapiens tropomyosin 1 (alpha) Auto-antigen 63. NR2C1 Homo sapiens nuclear receptor subfamily 2 group C Auto-antigen member 1 64. TRIPS Homo sapiens thyroid hormone receptor interactor 6, Auto-antigen 65. UBA1 Homo sapiens Homo sapiens ubiquitin-activating enzyme Auto-antigen E1 (A1S9T and BN75 temperature sensitivity compl 66. VCL Homo sapiens vinculin Auto-antigen 67. ZNF41 Homo sapiens zinc finger protein 41 transcript variant 2 Auto-antigen 66. PAX8 Homo sapiens paired box gene 8 transcript variant PAX8A Auto-antigen 69. NRIP1 Homo sapiens nuclear receptor interacting protein 1 Auto-antigen 70. PIP4K2B Homo sapiens phosphatidylinositol-4-phosphate 5-kinase Auto-antigen type II beta transcript variant 2 71. UXT Homo sapiens ubiquitously-expressed transcript Auto-antigen 72. API5 Homo sapiens apoptosis inhibitor 5 Auto-antigen 73. MKNK1 Homo sapiens MAP kinase-interacting serine/threonine Auto-antigen kinase 1 74. SUCLA2 Homo sapiens succinate-CoA ligase ADP-forming beta Auto-antigen subunit 75. LDB1 Homo sapiens LIM domain binding 1 Auto-antigen 76. NAE1 Homo sapiens amyloid beta precursor protein binding Auto-antigen protein 1 transcript variant 1 77. PAPSS2 Homo sapiens 3′-phosphoadenosine 5′-phosphosulfate Auto-antigen synthase 2 78. USP10 Homo sapiens ubiquitin specific protease 10 Auto-antigen 79. PRPF4 Homo sapiens Homo sapiens PRP4 pre- Auto-antigen 80. AIM2 Homo sapiens absent in melanoma 2 Auto-antigen 81. TBPL1 Homo sapiens TBP-like 1 Auto-antigen 82. TRAF4 Homo sapiens TNF receptor-associated factor 4 transcript Auto-antigen variant 1 83. SOCS5 Homo sapiens suppressor of cytokine signaling 5 Auto-antigen 84. ZSCAN12 Homo sapiens zinc finger protein 305 Auto-antigen 85. HDAC4 Homo sapiens cDNA Auto-antigen 86. KIAA0101 Homo sapiens KIAA0101 gene product Auto-antigen 87. IP6K1 Homo sapiens Inositol hexaphosphate kinase 1 Auto-antigen 88. RNF40 Homo sapiens ring finger protein 40 transcript variant 1 Auto-antigen 89. GPHN Homo sapiens gephyrin Auto-antigen 90. HRSP12 Homo sapiens translational inhibitor protein p14.5 Auto-antigen 91. STUB1 Homo sapiens STIP1 homology and U-Box containing Auto-antigen protein 1 92. TRAIP Homo sapiens TRAF interacting protein Auto-antigen 93. PLK4 Homo sapiens serine/threonine kinase 18 Auto-antigen 94. CCNI Homo sapiens cyclin i Auto-antigen 95. 1L24 Homo sapiens interleukin 24 transcript variant 1 Auto-antigen 96. CDK20 Homo sapiens cell cycle related kinase Auto-antigen 97. PABendometriosis 1 Homo sapiens poly(A) binding protein cytoplasmic 1 Auto-antigen 98. MED4 Homo sapiens vitamin D receptor interacting protein Auto-antigen 99. NMET Homo sapiens non-metastatic cells 7 protein expressed in Auto-antigen (nucleoside-diphosphate kinase) transcript variant 1 100. PHF11 Homo sapiens PHD finger protein 11 Auto-antigen 101. IRAK4 Homo sapiens interleukin-1 receptor-associated kinase 4 Auto-antigen mRNA (cDNA clone MGC: 13330 ) 102. TXNDC3 Homo sapiens thioredoxin domain containing 3 Auto-antigen (spermatozoa) 103. TAOK3 Homo sapiens STE20-like kinase Auto-antigen 104. STYXL1 Homo sapiens dual specificity phosphatase 24 (putative) Autoantigen 105. ASB1 Homo sapiens ankyrin repeat and SOCS box-containing 1 Autoantigen 106. MST4 Homo sapiens Mst3 and SOK1-related kinase (MASK) Autoantigen 107. PELO Homo sapiens pelota homolog (Drosophila) Autoantigen 108. ETNK2 Homo sapiens ethanolamine kinase 2 Autoantigen 109. RFK Homo sapiens riboflavin kinase Autoantigen 110. C9orf86 Homo sapiens chromosome 9 open reading frame 86 Auto-antigen 111. DDX55 Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide Autoantigen 55 112. CCNB1IP1 Homo sapiens CDNA Autoantigen 113. KLHL12 Homo sapiens kelch-like protein C3IP1 Autoantigen 114. SAV1 Homo sapiens Salvador homolog 1 (Drosophila) Autoantigen 115. CAMKV Homo sapiens hypothetical protein MGC8407 Autoantigen 116. NSBP1 Homo sapiens nucleosomal binding protein 1, Autoantigen 117. ALPK1 Homo sapiens alpha-kinase 1 mRNA (cDNA clone Autoantigen MGC:71554) 118. ELMOD3 Homo sapiens RNA binding motif end ELMO domain 1 Autoantigen 119. AIFM2 Homo sapiens apoptosis-inducing factor (AIF)-like Autoantigen mitochondrion-associated inducer of death 120. RHOT2 Homo sapiens ras homolog gene family member T2 Autoantigen 121. PYGO2 Homo sapiens pygopus 2 Auto-antigen 122. ebv-mR-BART12 ebv-mIR-BART12 miRNA 123. ebv-mR-BART14 ebv-mIR-BART14 miRNA 124. ebv-miR-BART16 ebv-mIR-BART16 miRNA 125. ebv-miR-BART20-5p ebv-mIR-BART20-5p miRNA 126. ebv-miR-BART2-5p ebv-mIR-BART2-5p miRNA 127. MIRLET7B hsa-let-7b* miRNA 128. MIRLET7F1 haa-let-7f miRNA 129. MIRLET7F2 hsa-let-7f-1* miRNA 130. MIRLET7G hsa-let-7g miRNA 131. MIR103A1 hsa-miR-103a miRNA 132. MIR10b hsa-miR-10b miRNA 133. MIR1183 hsa-miR-1183 miRNA 134. MIR1202 hsa-miR-1202 miRNA 135. MIR1207 hsa-miR-1207-5p miRNA 136. MIR122 hsa-miR-122 miRNA 137. MIR1224 hsa-miR-1224-5p miRNA 138. MIR1225 hsa-miR-1225-3p miRNA 139. MIR1225 hsa-miR-1225-5p miRNA 140. MIR1228 hsa-miR-1226* miRNA 141. MIR1228 hsa-miR-1228* miRNA 142. MIR1234 hsa-miR-1234 miRNA 143. MIR1237 hsa-miR-1237 miRNA 144. MIR1238 hsa-miR-1238 miRNA 145. MIR125a hsa-miR-125a-5p miRNA 146. MIR1280A hsa-miR-1260 miRNA 147. MIR1280b hsa-miR-1250b miRNA 148. MIR1280 hsa-miR-1280 miRNA 149. MIR1281 hsa-miR-1281 miRNA 150. MIR1290 hsa-miR-1290 miRNA 151. MIR1291 hsa-miR-1291 miRNA 152. MIR129-1/MIR129-2 hsa-miR-129-3p miRNA 153. MIR1301 hsa-miR-1301 miRNA 154. MIR135A1/ hsa-miR-135a miRNA MIR135A2 155. MIR135A1/ hsa-miR-135a* miRNA MIR135A2 156. MIR141 hsa-miR-141 miRNA 157. MIR142 hsa-miR-142-3p miRNA 158. MIR149 hsa-miR-149 miRNA 159. MIR150 hsa-miR-150 miRNA 160. MIR150 hsa-miR-150* miRNA 161. MIR1539 hsa-miR-1539 miRNA 162. MIR181A2 hsa-miR-181a miRNA 163. MIR1825 hsa-miR-1825 miRNA 164. MIR186 hsa-miR-185 miRNA 165. MIR18a hsa-miR-18a miRNA 166. MIR18b hsa-miR-18b miRNA 167. MIR191 haa-miR-191* miRNA 168. MIR197 hsa-miR-197 miRNA 169. MIR198 hsa-miR-198 miRNA 170. MIR205 hsa-miR-205 miRNA 171. MIR2116 hsa-miR-2116* miRNA 172. MIR215 hsa-miR-215 miRNA 173. MIR22 hsa-miR-22 miRNA 174. MIR223 hsa-miR-223 miRNA 175. MIR2276 hsa-miR-2276 miRNA 176. MIR23c hsa-miR-23c miRNA 177. MIR26A1/MIR26A2 hsa-miR-26a miRNA 178. MIR28 hsa-miR-28-3p miRNA 179. MIR28 hsa-miR-28-5p miRNA 180. MIR2981/MIR2982 hsa-miR-29b miRNA 181. MIR30a hsa-miR-30a miRNA 182. MIR30b hsa-miR-30b miRNA 183. MIR3131 hsa-miR-3131 miRNA 184. MIR3138 hsa-miR-3138 miRNA 185. MIR3149 hsa-miR-3149 miRNA 186. MIR3156-1/ hsa-miR-3156-6p miRNA MIR3156-2/ MIR3158-3 187. MIR3180-1/ hsa-miR-3180-5p miRNA MIR3180-2/ MIR3180-3/ MIR3180-4/ MIR3180-5 188. MIR3194 hsa-miR-3194-5p miRNA 189. MIR3195 hsa-miR-3195 miRNA 190. MIR3196 hsa-miR-3196 miRNA 191. MIR32 hsa-miR-32 miRNA 192. MIR320C1/ hsa-miR-320c miRNA MIR320C2 193. MIR324 hsa-miR-324-3p miRNA 194. MIR328 hsa-miR-328 miRNA 195. MIR331 hsa-miR-331-5p miRNA 196. MIR33b hsa-miR-33b* miRNA 197. MIR342 hsa-miR-342-3p miRNA 198. MIR34a hsa-miR-34a miRNA 199. MIR3610 hsa-miR-3610 miRNA 200. MIR3648 hsa-miR-3648 miRNA 201. MIR3652 haa-miR-3652 miRNA 202. MIR3663 hsa-miR-3663-5p miRNA 203. MIR3667 hsa-miR-3667-5p miRNA 204. MIR382 hsa-miR-382 miRNA 205. MIR3911 hsa-miR-3911 miRNA 206. MIR3937 hsa-miR-3937 miRNA 207. MIR4257 hsa-miR-4257 miRNA 208. MIR425 hsa-miR-425* miRNA 209. MIR4270 hsa-miR-4270 miRNA 210. MIR4274 hsa-miR-4274 miRNA 211. MIR4281 hsa-miR-4281 miRNA 212. MIR4284 hsa-miR-4284 miRNA 213. MIR4288 hsa-miR-4286 miRNA 214. MIR429 hsa-miR-429 miRNA 215. MIR4290 hsa-miR-4290 miRNA 216. MIR4313 hsa-miR-4313 miRNA 217. MIR4323 hsa-miR-4323 miRNA 218. MIR466 hsa-miR-466 miRNA 219. MIR483 hsa-miR-483-3p miRNA 220. MIR484 hsa-miR-484 miRNA 221. MIR485 hsa-miR-485-3p miRNA 222. MIR486 hsa-miR-488-5p miRNA 223. MIR488 hsa-miR-488 miRNA 224. MIR497 hsa-miR-497 miRNA 225. MIR511-1 hsa-miR-511 miRNA 226. MIR511-2 hsa-miR-512 miRNA 227. MIR520C hsa-miR-520c-3p miRNA 228. MIR550A1/ hsa-miR-550a miRNA MIR550A2/ MIR550A3 229. MIR556 hsa-miR-556-3p miRNA 230. MIR557 hsa-miR-557 miRNA 231. MIR561 hsa-miR-561 miRNA 232. MIR572 hsa-miR-572 miRNA 233. MIR574 hsa-miR-574-3p miRNA 234. MIR574 hsa-miR-574-5p miRNA 235. MIR595 hsa-miR-595 miRNA 236. MIR630 hsa-miR-630 miRNA 237. MIR642b hsa-miR-642b miRNA 238. MIR646 hsa-miR-646 miRNA 239. MIR659 hsa-miR-659 miRNA 240. MIR660 haa-miR-660 miRNA 241. MIR663A hsa-miR-663 miRNA 242. MIR664 hsa-miR-664 miRNA 243. MIR720 hsa-miR-720 miRNA 244. MIR762 hsa-miR-762 miRNA 245. MIR766 hsa-miR-766 miRNA 246. MIR877 hsa-miR-877* miRNA 247. MIR888 hsa-miR-888 miRNA 248. MIR933 hsa-miR-933 miRNA 249. MIR940 hsa-miR-940 miRNA 250. MIR95 hsa-miR-95 miRNA 251. hsv1-miR-H1* hsv1-miR-H1*/hsv1-miR-H1-3p miRNA 252. hsv1-miR-H2-3p hsv1-miR-H2-3p miRNA 253. hsv1-miR-H6-3p hsv1-miR-H6-3p miRNA 254. hsv1-miR-H7* hsv1-miR-H7* miRNA 255. hsv1-miR-H8 hsv1-miR-HB miRNA 256. hsv2-miR-H22 hsv2-miR-H22 miRNA 257. hsv2-miR-H hsv2-miR-H25 miRNA 258. hsv2-mIR-H6 hsv2-miR-H6 miRNA 259. hsv2-miR-H6* hsv2-miR-H6* miRNA 260. kshv-miR-K12-10a kshv-miR-K12-10a miRNA 261. kshv-miR-K12-12* kshv-miR-K12-12* miRNA 262. kshv-miR-K12-8* kshv-miR-K12-8* miRNA 263. MIR564 hsa-miR-564 miRNA 264. MIRLET7D hsa-let-7d-5p miRNA 265. MIRLET7D hsa-let-7d-3p miRNA 266. MIR29A hsa-miR-29a miRNA 267. MIR219 hsa-miR-219-1-3p miRNA 268. MIR296 hsa-miR-296-3p miRNA 269. MIR337 hsa-miR-337-5p miRNA 270. MIR369 hsa-miR-369-3p miRNA 271. MIR4S0 hsa-miR-450b-5p miRNA 272. MIR483 hsa-miR-483-5p miRNA 273. MIR507 hsa-miR-507 miRNA 274. MiR517C hsa-miR-517c miRNA 275. MIR519A hsa-miR-519a miRNA 276. MIR5190 hsa-miR-519d miRNA 277. MIR520G hsa-miR-520g miRNA 278. MIR576 hsa-miR-576-5p miRNA 279. MIR577 hsa-miR-577 miRNA 280. MIR604 hsa-miR-604 miRNA 281. MIR610 haa-miR-610 miRNA 282. MIR619 hsa-miR-619 miRNA 283. MIR1256 hsa-miR-1256 miRNA 284. MIR1278 hsa-miR-1278 miRNA 285. MIR1297 hsa-miR-1297 miRNA 286. MIRUS33 hemv-miR-US33-Sp miRNA 287. MIRH1 hsv1-miR-H1-5p miRNA 288. MIR877 hsa-miR-877 miRNA 289. LET7E hsa-let-7e-5p miRNA 290. LET7E hsa-let-7e-3p miRNA 291. MIR9 hsa-miR-9 miRNA 292. MIR92B hsa-miR-92b miRNA 293. MIR96 hsa-miR-96-5p miRNA 294. MIR96 hsa-miR-96-3p miRNA 295. MIR106A hsa-miR-106a-5p miRNA 296. MIR106A hsa-miR-106a-3p miRNA 297. MIR17 hsa-miR-17-5p miRNA 298. MIR17 hsa-miR-17-3p miRNA 299. MIR106B hsa-miR-106b-5p miRNA 300. MIR106B hsa-miR-106b-3p miRNA 301. MIR127 hsa-miR-127-3p miRNA 302. MIR128 hsa-miR-128 miRNA 303. MIR154 hsa-miR-154 miRNA 304. MIR155 hsa-miR-155 miRNA 305. MIR183 hsa-miR-183-5p miRNA 305. MIR183 hsa-miR-183-3p miRNA 307. MIR194 hsa-miR-194 miRNA 308. MIR196B hsa-miR-196b-5p miRNA 309. MIR196B hsa-miR-196b-3p miRNA 310. MIR203 hsa-miR-203 miRNA 311. MIR204 hsa-miR-204 miRNA 312. MIR221 hsa-miR-221-5p miRNA 313. MIR221 hsa-miR-221-3p miRNA 314. MIR378 hsa-miR-378a miRNA 315. MIR376C hsa-miR-378c miRNA 316. MIR377 hsa-miR-377 miRNA 317. MIR379 hsa-miR-379 miRNA 318. MIR423 hsa-miR-423-3p miRNA 319. MIR424 hsa-miR-424-5p miRNA 320. MIR424 hsa-miR-424-3p miRNA 321. MIR425 hsa-miR-425-5p miRNA 322. MIR425 hsa-miR-425-3p miRNA 323. MIR454 hsa-miR-454-5p miRNA 324. MIR454 hsa-miR-454-3p miRNA 325. MIR486 hsa-miR-486-3p miRNA 326. MIR509 hsa-miR-509-3p miRNA 327. MIR514 hsa-miR-514 miRNA 328. MIR542 hsa-miR-542-3p miRNA 329. MIR545 hsa-miR-545-5p miRNA 330. MIR545 hsa-miR-545-3p miRNA 331. MIR626 hsa-miR-626 miRNA 332. MIR758 hsa-miR-758-5p miRNA 333. MIR758 hsa-miR-758-3p miRNA 334. MIR876 hsa-miR-876-3p miRNA 335. MIR1185 hsa-miR-1185 miRNA 336. MIR1266 hsa-miR-1266-5p miRNA 337. MIR1266 hsa-miR-1266-3p miRNA 338. MIR199A hsa-miR-199a-3p miRNA 339. MIR199B hsa-miR-199b-3p miRNA 349. MIR625 hsa-miR-625-5p miRNA 341. MIRS25 hsa-miR-825-3p miRNA 342. MIR631 hsa-miR-631 miRNA 343. MIR635 hsa-miR-635 miRNA
[0282] Columns
[0283] (i) This number is the SEQ ID NO as shown in the sequence listing. For an auto-antigen biomarker, the SEQ ID NO in the sequence listing provides the coding sequence for the auto-antigen biomarker. For a miRNA biomarker, the SEQ ID NO in the sequence listing provides the sequence of the mature, expressed miRNA biomarker, as shown in Tables 3 and 4.
[0284] (ii) The “Symbol” column gives the gene symbol which has been approved by the HGNC. The HONG aims to give unique and meaningful names to every miRNA end human gene. An additional dash-number suffix indicates pre-miRNAs that lead to identical mature miRNAs but that are located at different places in the genome.
[0285] (iii) The names for auto-antigens are taken from the Official Full Name provided by NCBI. An auto-antigen may have been referred to by one or more pseudonyms in the prior art. The invention relates to these auto-antigens regardless of their nomenclature. The names of the miRNA are taken from the specialist database, miRBase, according to version 16 (released, August 2010).
TABLE-US-00002 TABLE 2 No. .sup.(i) Symbol .sup.(ii) ID .sup.(iii) Name.sup.(vi) HGNC .sup.(v) GI .sup.(vi) 1. ACTS 80 Homo sapiens actin beta 132 12854910 2. ADD1 118 Homo sapiens adducin 1 (alpha) 243 33889910 3. ADSL 158 Homo sapiens adenylosuccinate lyase 291 12652984 4. AK2 204 Homo sapiens adenylate kinase 2 transcript 362 39645192 variant AK2A 5. KLK3 354 Home sapiens kallikrein 3 (prostate specific 6384 34193547 antigen) transcript variant 1 6. ATF1 466 Homo sapiens activating transcription factor 1 783 20810444 7. CKM 1158 Homo sapiens creatine kinase muscle 1994 13938818 8. CLK2 1196 Homo sapiens CDC-like kinase 2 transcript 2059 33873844 variant phcik2 9. DDB2 1643 Homo sapiens damage-specific DNA binding 2718 34783036 protein 2 48 kDa 10. DTYMK 1841 Homo sapiens deoxythymidylate kinase 3061 38114725 (thymidylate kinase) 11. DUSP4 1846 Homo sapiens dual specificity phosphatase 4 3070 33369553 transcript variant 1 12. E2F6 1876 Homo sapiens E2F transcription factors 3120 14249933 13. EXT2 2132 Home sapiens exostoses (multiple) 2 3513 14603195 14. FGFR4_ 2264 Homo sapiens fibroblast growth factor 3691 33873872 ext receptor 4 transcript variant 3 15. FIGF 2277 Homo sapiens c-fos induced growth factor 3708 20379761 (vascular endothelial growth factor D) 16. FKBP3 2287 Homo sapiens FK506 binding protein 3 25 kDa 3719 16740853 17. GALK1 2584 Home sapiens galactokinase 1 4118 12654058 18. GK2 2712 Homo sapiens glycerol kinase 2 4291 20987489 19. GRB7 2886 Homo sapiens growth factor receptor-bound 4567 33870450 protein 7 20. GTF28 2959 Homo sapiens general transcription factor IIB 4648 18088836 21. GTF2H1 2965 Homo sapiens general transcription factor IIH 4655 33991027 polypeptide 1 62 kDa 22 GTF2H2 2966 Homo sapiens general transcription factor IIH 4656 40674449 polypeptide 2 44 kDa 23. HSPD1 3329 Homo sapiens heat shock 60 kDa protein 1 5281 38197215 (chaperonin) 24. IDI1 3422 Homo sapiens isopentenyl-diphosphate delta 5387 34782883 isomerase 25. IFI16 3428 Homo sapiens interferon, gamma-inducible 5395 16877621 protein 16, 26. LDHA 3939 Homo sapiens lactate dehydrogenase A 6535 45501321 27. LYL1 4066 Homo sapiens lymphoblastic leukemia derived 6734 33988028 sequence 1 28. MARK3 4140 Homo sapiens MAP/microtubule affinity- 6897 19353235 regulating kinase 3 29. MPP3 4356 Homo sapiens membrane protein 7221 34785138 palmitoylated 3 (MAGUK p55 subfamily member 3) 30. TRIM37 4591 Homo sapiens tripartite motif-containing 37, 7523 23271191 31. NCF2 4688 Homo sapiens neutrophil cytosolic factor 2 7661 12804468 (65 kDa, chronic granulomatous disease, autosomal 2). 32. RPL10A 4736 Homo sapiens ribosomal protein L10a 10299 13905015 33. NFYA 4800 Homo sapiens nuclear transcription factor Y 7804 24660183 alpha 34. NRAS 4693 Homo sapiens neuroblastoma RAS viral (v- 7989 13528839 ras) oncogene homolog 35. NTRK3_ 4916 Homo sapiens neurotrophic tyrosine kinase 8033 15489167 ext receptor type 3 transcript variant 3 36. OAS2 4939 Homo sapiens 2′-5′-oligoadenylate synthetase 8067 29351562 269/71 kDa 37. endometri- 5091 Hamo sapiens pyruvate carboxylase 8636 33871110 osis 38. CDK17 5128 Homo sapiens endometriosisTAIRE protein 8750 21542570 kinase 2 39. PDE4A 5141 Homo sapiens Homo sapiens 8780 18043808 phosphodiesterase 4A, CAMP-specific (phosphodiesterase E2 dunce homolog, Dro 40. PHF1 5252 Homo sapiens PHD finger protein 1 transcript 8919 33874006 variant 2 41. PKM2 5315 Homo sapiens pyruvate kinase muscle 9021 14043290 transcript variant 1 42. MAP2K5 5607 Homo sapiens mitogen-activated protein 6845 33871775 kinase kinase 5, transcript variant A 43. PRPS2 5634 Home sapiens phosphoribosyl pyrophosphate 9465 26251732 synthetase 2 44, RAN 5901 Homo sapiens RAN member RAS oncogene 9846 33871120 family 45. RB1 5925 Homo sapiens retinoblastoma 1 (including 9884 24660139 osteosarcoma) 46. RBMS1 5937 Homo sapiens Homo sapiens RNA binding 9907 33869903 motif single stranded Interacting protein 1 transcript variant 47. RET_a 5979 Homo sapiens ret proto-oncogene (multiple 9967 13279040 endocrine neoplasia and medullary thyroid carci 48. RORC 6097 Homo sapiens RAR-related orphan receptor C 10280 21594879 49. RPL18 6141 Homo sapiens ribosomal protein L18 10310 38197133 50. RPL18A 6142 Homo sapiens ribosomal protein L18a 10311 38196939 51. RPL28 6158 Homo sapiens ribosomal protein L28 10330 15079502 52. RPL31 6160 Homo sapiens ribosomal protein L31 10334 40226052 53. RPL32 6161 Homo sapiens ribosomal protein L32 10338 15079341 54. S100A6 6277 Homo sapiens S100 calcium binding protein 10496 33876209 A6 (calcyclin) 55. SCP2 6342 Homo sapiens sterol carrier protein 2 10806 45501107 transcript variant 2 56. SIAH1 6477 Homo sapiens seven in absentia homolog 1 10857 27503513 (Drosophila) transcript variant 2 57. SMARCD1 6602 Homo sapiens SWI/SNF related matrix 11106 33874464 associated actin dependent regulator of chromatin subfamily d member 1 58. SMARCE1 6605 Homo sapiens SWI/SNF related matrix 11109 13937940 associated actin dependent regulator of chromatin 59. SOD2 6648 Homo sapiens superoxide dismutase 2 11180 15214594 mitochondrial 60. SOX2 6657 Homo sapiens SRY (sex determining region 11195 33869633 Y)-box2 61. SRPK1 6732 Homo sapiens SFRS protein kinase 1 11305 23458344 62. TPM1 7168 Homo sapiens tropomyosin 1 (alpha) 12010 33873609 63. NR2C1 7181 Homo sapiens nuclear receptor subfamily 2 7971 25304018 group C member 1 64. TRIP6 7205 Homo sapiens thyroid hormone receptor 12311 13436460 interactor 6, 65. UBA1 7317 Homo sapiens Homo sapiens ubiquitin- 12489 33989140 activating enzyme E1 (A1S9T and BN75 temperature sensitivity compl 66. VCL 7414 Homo sapiens vinculin 12865 24657578 67. ZNF41 7592 Homo sapiens zinc finger protein 41 transcript 13107 21955337 variant 2 68. PAX8 7849 Homo sapiens paired box gene 8 transcript 8622 33987990 variant PAXBA 69. NRIP1 8204 Homo sapiens nuclear receptor interacting 8001 25955638 protein 1 70. PIP4K2B 8396 Homo sapiens phosphatidylinositol 8998 20071985 phosphate 5-kinase type II beta transcript variant 2 71. UXT 8409 Homo sapiens ubiquitously-expressed 12641 14424496 transcript 72. API5 8539 Homo sapiens apoptosis inhibitor 5 594 17389324 73. MKNK1 8569 Homo sapiens MAP kinase-interacting 7110 33877125 serine/threonine kinase 1 74. SUCLA2 8803 Homo sapiens succinate-CoA ligase ADP- 11448 34783884 forming beta subunit 75. LDB1 8861 Homo sapiens LIM domain binding 1 6532 38197187 76. NAE1 8883 Homo sapiens amyloid beta precursor protein 621 38197227 binding protein 1 transcript variant 1 77. PAPSS2 9060 Homo sapiens 3′-phosphoadenosine 5′- 8504 33859502 phosphosulfate synthase 2 78. USP10 9100 Homo sapiens ubiquitin specific protease 10 12B08 12653004 79. PRPF4 9128 Hamo sapiens Homo sapiens PRP4 pre- 17349 33876345 80. AIM2 9447 Hamo sapiens absent in melanoma 2 357 15012076 81. TBPL1 9519 Homo sapiens TBP-like 1 11589 33958482 82. TRAF4 9618 Homo sapiens TNF receptor-associated factor 12034 12804686 4 transcript variant 1 83. SOCS5 9655 Homo sapiens suppressor of cytokine 15852 23273933 signaling 5 84. ZSCAN12 9753 Homo sapiens zinc finger protein 305 13172 27371192 85. HDAC4 9759 Homo sapiens CDNA 14003 25058272 86. KIAA0101 9768 Homo sapiens KIAA0101 gene product 28961 33873244 87. IP6K1 9807 Homo sapiens inositol hexaphosphate kinase 18360 15277916 1 88. RNF40 9810 Homo sapiens ring finger protein 40 transcript 16867 13543993 variant 1 89. GPHN 10243 Homo sapiens gephyrin 15465 34783414 90. HRSP12 10247 Homo sapiens translational inhibitor protein 16897 18397462 p14.5 91. STUB1 10273 Homo sapiens STIP1 homology and U-Box 11427 14043118 containing protein 1 92. TRAIP 10293 Homo sapiens TRAF interacting protein 30764 17939475 93. PLK4 10733 Homo sapiens serine/threonine kinase 18 11397 23243308 94. CCNL 10983 Homo sapiens cyclin I 1595 38197480 95. IL24 11009 Homo sapiens interleukin 24 transcript variant 11346 15307184 1 96. CDK20 23552 Homo sapiens cell cycle related kinase 21420 33988018 97. PABendo- 26966 Homo sapiens poly(A) binding protein 8554 33872187 metriosis cytoplasmic 1 1 98. MED4 29079 Homo sapiens vitamin D receptor interacting 17903 13528773 protein 99. NME7 29922 Homo sapiens non-metastatic cells 7 protein 20461 13937770 expressed in (nucleoside-diphosphate kinase) transcript variant 1 100. PHF11 51131 Homo sapiens PHD finger protein 11 17024 33880652 101. IRAK4 51135 Homo sapiens interleukin-1 receptor- 17967 15426431 associated kinase 4 mRNA (cDNA clone MGC: 13330) 102. TXNDC3 51314 Homo sapiens thioredoxin domain containing 16473 22477641 3 (spermatozoa) 103. TAOK3 51347 Homo sapiens STE20-like kinase 18133 33877128 104. STYXL1 51657 Homo sapiens dual specificity phosphatase 24 18165 33869206 (putative) 105. ASB1 51665 Homo sapiens ankyrin repeat and SOCS box- 16011 33878672 containing 1 100. MST4 51765 Homo sapiens Mst3 and SOK1-related kinase na 109633024 (MASK) 107. PELO 53918 Homo sapiens pelota homolog (Drosophila) 8829 33870521 108. ETNR2 55224 Homo sapiens ethanolamine kinase 2 25575 33873304 109. RFK 55312 Homo sapiens riboflavin kinase 30324 13937919 110. C9or86 55684 Homo sapiens chromosome 9 open reading 24703 18089283 frame 86 111. ODX55 57696 Homo sapiens DEAD (Asp-Glu-Ala-Asp) box 20085 34190881 polypeptide 55 112. CCNB1IP1 57820 Homo sapiens cDNA 19437 12654750 113. KLHL12 59349 Homo sapiens keich-like protein C3IP1 19360 13112018 114. SAV1 60485 Homo sapiens Salvador homolog 1 17795 18088227 (Drosophila) 115. CAMKV 79012 Homo sapiens hypothetical protein MGC8407 28788 33875513 116. NSBP1 79366 Homo sapiens nucleosomal binding protein 1, 8013 13529139 117. ALPK1 80216 Homo sapiens alpha-kinase 1 mRNA (cDNA 20917 38174241 clone MGO:71554) 118. ELMOD3 84173 Homo sapiens RNA binding motif and ELMO 26158 33877554 domain 1 119. AIFM2 84883 Homo sapiens apoptosis-inducing factor (AIF)- 21411 13543983 like mitochondrion-associated inducer of death 120. RHOT2 89941 Homo sapiens ras homolog gene family 21189 15928948 member T2 121. PYGO2 90780 Home sapiens pygopus 2 30257 33991480
[0286] Columns
[0287] (i) This number is the SEQ ID NO: for the coding sequence for the auto-antigen biomarker, as shown in the sequence listing.
[0288] (ii) The “ID” column shows the Entrez GeneID number for the antigen marker. An Entrez GeneID value is unique across all taxa.
[0289] (iii) The “Symbol” column gives the gene symbol which has been approved by the HGNC. The HGNC aims to give unique and meaningful names to every miRNA and human gene.
[0290] (iv) This name is taken from the Official Full Name provided by NCBI. An auto-antigen may have been referred to by one or more pseudonyms in the prior art. The invention relates to these auto-antigens regardless of their nomenclature.
[0291] (v) The HUGO Gene Nomenclature Committee aims to give unique and meaningful names to every human gene. The HGNC number thus identifies a unique human gene. An additional dash-number suffix indicates pre-miRNAs that lead to identical mature miRNAs but that are located at different places in the genome.
[0292] (v) A “GI” number, or “GenInfo Identifier”, is a series of digits assigned consecutively to each sequence record processed by NCBI when sequences are added to its databases. The GI number bears no resemblance to the accession number of the sequence record. When a sequence is updated (e.g. for correction, or to add more annotation or information) it receives a new GI number. Thus the sequence associated with a given GI number is never changed.
TABLE-US-00003 TABLE 3 No. (i) miRNA name.sup.(ii) Symbol.sup.(iii) HGNC.sup.(iv) Sequence 122. ebv-miR-BART12 ebv-miR- UCCUGUGGUGUUUGGUGUGGUU BART12 123. ebv-miR-BART14 ebv-miR- UAAAUGCUGGAGUAGUAGGGAU BART14 124. ebv-miR-BART16 ebv-miR- UUAGAUAGAGUGGGUGUGUGCUCU BART16 125. ebv-miR-BART20- eby-miR- UAGCAGGCAUGUCUUCAUUCC 5p BART20-6 126. ebv-miR-BART2- ebv-miR- UAUUUUCUGCAUUCGCCCUUGC 5p BART2-5p 127. hsa-let-7b* MIRLET7B HGNC:31479 UGAGGUAGUAGGUUGUGUGGUU 128. hsa-let-7f MIRLET7F1 HGNC:31483 UGAGGUAGUAGAUUGUAUAGUU 129. hsa-let-7f-1* MIRLET7F2 HGNC:31484 UGAGGUAGUAGAUUGUAUAGUU 130. hsa-let-7g MIRLET7G HGNC:31485 UGAGGUAGUAGUUUGUACAGUU 131. hsa-miR-103a MIR103A1 HGNC:31490 AGCAGCAUUGUACAGGGCUAUGA 132. hsa-miR-10b MIR10b HGNC:31498 UACCCUGUAGAACCGAAUUUGUG 133. hsa-miR-1183 MIR1183 HGNC:35264 CACUGUAGGUGAUGGUGAGAGUGGGCA 134. hsa-miR-1202 MIR1202 HGNC:35268 GUGCCAGCUGCAGUGGGGGAG 135. hsa-miR-1207-5p MIR1207 HGNC:35273 UGGCAGGGAGGCUGGGAGGGG 136. hsa-miR-122 MIR122 HGNC:31501 UGGAGUGUGACAAUGGUGUUUG 137. hsa-miR-1224-5p MIR1224 HGNC:33923 GUGAGGACUCGGGAGGUGG 138. hsa-miR-1225-3p MIR1225 HGNC:33931 GUGGGUACGGCCCAGUGGGGGG 130. hsa-miR-1225-5p MIR1225 HGNC:33931 GUGGGUACGGCCCAGUGGGGGG 140. hsa-miR-1226* MIR1226 HGNC:33922 UCACCAGCCCUGUGUUCCCUAG 141. hsa-miR-1228* MIR1228 HGNC:33928 UCACACCUGCCUCGCCCCCC 142. hsa-miR-1234 MIR1234 HGNC:33926 UOGGCCUGACCACCCACCCCAC 143. hsa-miR-1237 MIR1237 HGNC:33927 UCCUUCUGCUCCGUCCCCCAG 144. hsa-miR-1238 MIR1238 HGNC:33933 CUUCCUCGUCUGUCUGCCCC 145. hsa-miR-125a-5p MIR125a HGNC:31505 UCCCUGAGACCCUUUAACCUGUGA 140. hsa-miR-1260 MIR1280A HGNC:35325 AUCCCACCUCUGCCACCA 147. hsa-miR-1260b MIR1260b HGNO:38258 AUCCCACCACUGCCACCAU 146. hsa-miR-1280 MIR1280 HGNC:35368 UCCCACCGCUGCCACCC 140. hsa-miR-1281 MIR1281 HGNC:35359 UCGCCUCCUCCUCUCCC 150. hsa-miR-1290 MIR1290 HGNC:35283 UGGAUUUUUGGAUCAGGGA 151. hsa-miR-1291 MIR1291 HGNC:35284 UGGCCCUGACUGAAGACCAGCAGU 152. hsa-miR-129-3p MIR129-1/ HGNC:31512/ CUUUUUGCGGUCUGGGCUUGC MIR129-2 31513 153. hsa-miR-1301 MIR1301 HGNC:35253 UUGCAGCUGCCUGGGAGUGACUUC 154. hsa-miR-135a MIR135A1/ HGNC:31520/ UAUGGCUUUUUAUUCCUAUGUGA MIR135A2 31521 155. hsa-miR-135a* MIR135A1/ HGNC:31520/ UAUGGCUUUUUAUUCCUAUGUGA MIR135A2 31521 156. hsa-miR-141 MIR141 HGNC:31528 UAACACUGUCUGGUAAAGAUGG 157. hsa-miR-142-3p MIR142 HGNC:31529 CAUAAAGUAGAAAGCACUACU 158. hsa-miR-149 MIR149 HGNC:31536 UCUGGCUCCGUGUCUUCACUCCC 159. hsa-miR-150 MIR150 HGNO:31537 UCUCCCAACCCUUGUACCAGUG 160. hsa-miR-150* MIR150 HGNC:31537 UCUCCCAACCCUUGUACCAGUG 161. hsa-miR-1539 MIR1539 HGNC:35383 UCCUGCGCGUCCCAGAUGCCC 162. hsa-miR-181a MIR181A2 HGNC:31549 AACAUUCAACGCUGUCGGUGAGU 163. hsa-miR-1825 MIR1825 HGNC:35389 UCCAGUGCCCUCCUCUCC 164. hsa-miR-186 MIR186 HGNC:31557 CAAAGAAUUCUCCUUUUGGGCU 165. hsa-miR-18s MIR18a HGNC:31548 UAAGGUGCAUCUAGUGCAGAUAG 166. hsa-miR-18b MIR18 HGNC:32025 UAAGGUGCAUCUAGUGCAGUUAG 167. hsa-miR-191* MIR191 HGNC:31561 CAACGGAAUCCCAAAAGCAGCUG 168. hsa-miR-197 MIR197 HGNC:31569 UUCACCACCUUCUCCACCCAGC 169. hsa-miR-198 MIR198 HGNC:31570 GGUCCAGAGGGGAGAUAGGUUC 170. hsa-miR-205 MIR205 HGNC:31583 UCCUUCAUUCCACCGGAGUCUG 171. hsa-miR-2116* MIR2116 HGNC:37310 GGUUCUUAGCAUAGGAGGUCU 172. hsa-miR-215 MIR215 HGNC:31592 AUGACCUAUGAAUUGACAGAC 173. hsa-miR-22 MIR22 HGNC:31599 AAGCUGCCAGUUGAAGAACUGU 174. hsa-miR-223 MIR223 HGNC:31603 UGUCAGUUUGUCAAAUACCCCA 175. hsa-miR-2276 MIR2276 HGNC:37313 UCUGCAAGUGUCAGAGGCGAGG 176. hsa-miR-230 MIR23C HGNC:38913 AUCACAUUGCCAGUGAUUACCC 177. hsa-miR-26a MIR26A1/ HGNC:31610/ UUCAAGUAAUCCAGGAUAGGCU MIR2BA2 31811 178. hsa-miR-28-3p MIR28 HGNC:31615 AAGGAGCUCACAGUCUAUUGAG 179. hsa-miR-28-5p MIR28 HGNC:31615 AAGGAGCUCACAGUCUAUUGAG 160. hsa-miR-29b MIR29B1/ HGNC:31619/ UAGGACCAUUUGAAAUGAGUGUU MIR29B2 31620 181. hsa-miR-30 MIR30a HGNC:31624 UGUAAACAUCCUCGACUGGAAG 182. hsa-miR-30b MIR30b HGNC:31625 UGUAAACAUCCUACAGUCAGGU 183. hsa-miR-3131 MIR3131 HGNC:38347 UCGAGGACUGGUGGAAGGGCCUU 184. hsa-miR-3138 MIR3138 HGNC:38341 UGUGGACAGUGAGGUAGAGGGAGL 185. hsa-miR-3149 MIR3149 HGNC:38251 UUUGUAUGGAUAUGUGUGUGUAU 186. hsa-miR-3156-5p MIR3156-1/ HGNC:38241/ AAAGAUCUGGAAGUGGGAGACA MIR3156- 38213/ 2/ 38229 MIR3156-3 187. hsa-miR-3180-5p MIR3180-1/ HGNC:38382/ UGGGGCGGAGCUUCCGGAG MIR3180-2/ 38343/ MIR3180-3/ 38239/ MIR3180-4/ 38920/ MIR3180-5 38989 188. hsa-miR-3194-5p MIR3194 HGNC:38346 GGCCAGCCACCAGGAGGGCUG 189. hsa-miR-3195 MIR3195 HGNO:38250 CGCGCCGGGCCCGGGUU 190. hsa-miR-3196 MIR3196 HGNC:38198 CGGGGCGGCAGGGGCCUC 191. hsa-miR-32 MIR32 HGNC:31631 UAUUGCACAUUACUAAGUUGCA 192. hsa-miR-320c MIR320C1/ HGNC:35248/ AAAAGCUGGGUUGAGAGGGU MIR320C2 35387 193. hsa-miR-324-3p MIR324 HGNC:31767 CGCAUCCCCUAGGGCAUUGGUGU 194. hsa-miR-328 MIR328 HGNC:31770 cugecccUcUCUGCCCUUCCGL 195. hsa-miR-331-5p MIR331 HGNC:31772 CUAGGUAUGGUCCCAGGGAUCC 196. hsa-miR-33b* MIR33b HGNC:32791 GUGCAUUGCUGUUGCAUUGC 197. hsa-miR-342-3p MIR342 HGNG:31778 AGGGGUGCUAUCUGUGAUUGA 198. hsa-miR-34a MIR34a HGNC:31635 UGGCAGUGUCUUAGCUGGUUGU 199. hsa-miR-3610 MIR3610 HGNC:38942 GAAUCGGAAAGGAGGCGCCG 200. hsa-miR-3648 MIR3648 HGNC:38941 AGCCGCGGGGAUCGCCGAGGG 201. hsa-miR-3652 MIR3652 HGNC:38894 CGGCUGGAGGUGUGAGGA 202. hsa-miR-3663-5p MIR3663 HGNC:38958 GCUGGUCUGCGUGGUGCUCGG 203. hsa-miR-3667-5p MIR3667 HGNC:38990 AAAGACCCAUUGAGGAGAAGGU 204. hsa-miR-382 MIR382 HGNC:31875 GAAGUUGUUCGUGGUGGAUUCG 205. hsa-miR-3011 MIR3911 HGNC:38962 UGUGUGGAUCCUGGAGGAGGCA 206. hsa-miR-3937 MIR3937 HGNC:38970 ACAGGCGGCUGUAGCAAUGGGGG 207. hsa-miR-4257 MIR4257 HGNC:38312 QCAGAGGUGGGGACUGAG 208. hsa-miR-425* MIR425 HGNC:31882 AAUGACACGAUCACUCCCGUUGA 209. hsa-miR-4270 MIR4270 HGNC:38377 UCAGGGAGUGAGGGGAGGGC 210. hsa-miR-4274 MIR4274 HGNC:38194 CAGCAGUCCCUCCCCCUG 211. hsa-miR-4281 MIR4281 HGNC:38357 GGGUCCCGGGGAGGGGGG 212. hsa-miR-4284 MIR4284 HGNC:38322 GGGCUCACAUCACCCCAU 213. hsa-miR-4286 MIR4286 HGNC:38186 ACCCCACUCCUGGUACC 214. hsa-miR-429 MIR429 HGNC:13784 UAAUACUGUCUGGUAAAACCGU 215. hsa-miR-4290 MIR4290 HGNC:38360 UeCCCUCCUUUCUUOCCUC 216. hsa-miR-4313 MIR4313 HGNC:38310 AGCCCCCUGGCCCCAAACCG 217. hsa-miR-4323 MIR4323 HGNC:38394 CAGCCCCACAGCCUCAGA 216. hsa-miR-466 MIR466 HGNC:38359 AUACACAUACACGCAACACACAU 219. hsa-miR-483-3p MIR483 HGNC:32340 AAGACGGGAGGAAAGAAGGGAG 220. hsa-miR-484 MIR484 HGNC:32341 UCAGGCUCAGUCCCCUCCCGAU 221. hsa-miR-485-3p MIR485 HGNC:32087 AGAGGCUGGCCGUGAUGAAUUC 222. hsa-miR-486-5p MIR486 HGNC:32342 UCCUGUACUGAGCUGCCCCGAG 223. hsa-miR-488 MIR488 HGNC:32073 UUGAAAGGCUAUUUCUUGGUC 224. hsa-miR-497 MIR497 HGNC:32088 CAGCAGCACACUGUGGUUUGU 225. hsa-miR-511 MIR511-1 HGNC:32077 GUGUCUUUUGCUCUGCAGUCA 226. hsa-miR-512 MIR511-2 HGNC:32078 GUGUCUUUUGCUCUGCAGUCA 227. hsa-miR-5200-3p MIR520c HGNC:32108 CUCUAGAGGGAAGCACUUUCUG 228. hsa-miR-550a MIR550A1/ HGNC:32804/ AGUGCCUGAGGGAGUAAGAGCCC MIR550A2/ 32805/ MIRS50A3 41878 229. hsa-miR-556-3p MIR556 HGNC:32812 GAUGAGCUCAUUGUAAUAUGAG 230. hsa-miR-567 MIR557 HGNC:32813 GUUUGCACGGGUGGGCCUUGUCU 231. hsa-miR-561 MIRS61 HGNC:32817 CAAAGUUUAAGAUCCUUGAAGU 232. hsa-miR-572 MIR572 HGNC:32828 GUCCGCUCGGCGGUGGCCCA 233. hsa-miR-574-3p MIR574 HGNC:32830 UGAGUGUGUGUGUGUGAGUGUGU 234. hsa-miR-574-5p MIR574 HGNC:32830 UGAGUGUGUGUGUGUGAGUGUGU 235. hsa-miR-595 MIR595 HGNC:32851 GAAGUGUGCCGUGGUGUGUCU 236. hsa-miR-630 MIR630 HGNC:32886 AGUAUUCUGUACCAGGGAAGGU 237. hsa-miR-642b MIR642b HGNC:38902 AGACACAUUUGGAGAGGGACCC 238. hsa-miR-646 MIR646 HGNC:32902 AAGCAGCUGCCUCUGAGGC 239. hsa-miR-659 MIR659 HGNC:32915 CUUGGUUCAGGGAGGGUCCCCA 240. hsa-miR-660 MIR680 HGNC:32916 UACCCAUUGCAUAUCGGAGUUG 241. hsa-miR-663 MIRG63A HGNC:32919 AGGCGGGGCGCCGCGGGACCGC 242. hsa-miR-664 MIR684 HGNC:35370 UAUUCAUUUAUCCCCAGCCUACA 243. hsa-miR-720 MIR720 HGNC:35375 UCUCGCUGGGGCCUCCA 244. hsa-miR-762 MIR762 HGNC:37303 GGGGCUGGGGCCGGGGCCGAGC 245. hsa-miR-766 MIR766 HGNC:33139 ACUCCAGCCCCACAGCCUCAGC 246. hsa-miR-877* MIR877 HGNC:33660 GUAGAGGAGAUGGCGCAGGG 247. hsa-miR-888 MIR88B HGNC:33648 UACUCAAAAAGCUGUCAGUCA 248. hsa-miR-933 MIR933 HGNC:33676 UGUGCGCAGGGAGACCUCUCCC 249. hsa-miR-940 MIR940 HGNC:33683 AAGGCAGGGCCCCCGCUCCCC 250. hsa-miR-95 MIR95 HGNC:31647 UUCAACGGGUAUUUAUUGAGCA 251. hsv1-miR-H1*/ hsv1-miR- UACACCCCCCUGCCUUCCACCCU hsv1-miR-H1-3p H1* 252. hsv-miR-H2-p hsv1-miR- CCUGAGCCAGGGACGAGUGCGACU H2-3p 253. hsv1-miR-H6-3p hsv1-miR- CACUUCCCGUCCUUCCAUCCC H6-3p 254. hsv1-miR-H7* hsv1-miR- UUUGGAUCCCGACCCCUCUUC H7* 255. hsv1-miR-H8 hsv1-miR- UAUAUAGGGUCAGGGGGUUC H8 256. hsv2-miR-H22 hsv2-miR- AGGGGUCUGGACGUGGGUGGGC H22 257. hsv2-miR-H25 hsv2-miR- CUGCGCGGCGGAGACCGGGAC H25 258. hsv2-miR-H6 hsv2-miR- AAUGGAAGGCGAGGGGAUGC H6 259. hsv2-miR-H6* hsv2-miR- CCCAUCUUCUGCCCUUCCAUCCU H6* 260. kshv-miR-K12-10a kshv-miR- UAGUGUUGUCCCCCCGAGUGGC K12-10a 261. kshv-miR-K12-12* kshv-miR- UGGGGGAGGGUGCCCUGGUUGA K12-12* 262. kshv-miR-K12-8* kshv-miR- ACUCCCUCACUAACGCCCCGCU K12-8*
[0293] Columns for Tables 3 and 4
[0294] (i) The SEQ ID NO: for the sequence of the mature, expressed miRNA biomarker.
[0295] (ii) The “mRNA name” column gives the name of the human mRNA as provided by the specialist database, miRBase, according to version 15 (released. August 2010).
[0296] (iii) The “Symbol” column gives the gene symbol which has been approved by the HGNC. The HGNC aims to give unique and meaningful names to every miRNA and human gene. An additional dash-number suffix indicates pre-miRNAs that lead to identical mature miRNAs but that are located at different places in the genome.
[0297] (iv) The HGNC aims to give unique and meaningful names to every mRNA (and human gene). The HGNC number thus identifies a unique human gene. Inclusion on to HUGO is for human genes only.
TABLE-US-00004 TABLE 4 No. miRNA name.sup.(i) Symbol.sup.(ii) HGNC.sup.(iii) Sequence 126 ebv-miR-BART2-5p ebv-miR- N/A UAUUUUCUGCAUUCGCCCUUGC BART2-5p 263. hsa-miR-564 MIR564 32820 AGGGACGGUGUCAGCAGGC 264. hsa-let-7d-5p MIRLET7D 31481 AGAGGUAGUAGGUUGCAUAGUU 265. hsa-let-7d-3p MIRLET7D 31481 CUAUACGACCUGCUGCCUUUCU 266. hsa-miR-29a MIR29A 31616 UAGCACCAUCUGAAAUCGGUUA 157 hsa-miR-142-3p MIR142 31529 CAUAAAGUAGAAAGCACUACU 168 hsa-miR-197 MIR197 31589 UUCACCACCUUCUCCACCCAGC 172 hsa-miR-215 MIR215 31592 AUGACCUAUGAAUUGACAGAC 267. hsa-miR-219-1-3p MIR-219-1 31597 AGAGUUGAGUCUGGACGUCCCG 268. hsa-miR-296-3p MIR296 31617 GAGGGUUGGGUGGAGGCUCUCC 192 hsa-miR-320c MIR320C 35248 AAAAGCUGGGUUGAGAGGGU 269. hsa-miR-337-5p MIR337 31774 GAACGGCUUCAUACAGGAGUU 270. hsa-miR-369-3p MIR369 31783 AAUAAUACAUGGUUGAUCUUU 271. hsa-miR-450b-5p MIR450B 33642 UUUUGCAAUAUGUUCCUGAAUA 272. hsa-miR-483-5p MIR483 32340 AAGACGGGAGGAAAGAAGGGAG 273. hsa-miR-507 MIR507 32144 UUUUGCACCUUUUGGAGUGAA 274. hsa-miR-517c MIR517C 32124 AUCGUGCAUCCUUUUAGAGUGU 275. hsa-miR-519a MIR519A1/ 32128/ AAAGUGCAUCCUUUUAGAGUGU MIR519A2 32132 276. hsa-miR-519d MIR519D 32112 CAAAGUGCCUCCCUUUAGAGUG 277. hsa-miR-520g MIR520G 32116 ACAAAGUGCUUCCCUUUAGAGUGU 278. hsa-miR-576-5p MIR576 32832 AUUCUAAUUUCUCCACGUCUUU 279. hsa-miR-577 MIR577 32833 UAGAUAAAAUAUUGGUACCUG 280. hsa-miR-604 MIR504 32860 AGGCUGCGGAAUUCAGGAC 281. hsa-miR-610 MIR610 32866 UGAGCUAAAUGUGUGCUGGGA 282. hsa-miR-619 MIR619 32875 GACCUGGACAUGUUUGUGCCCAGU 283. hsa-miR-1256 MIR1256 35321 AGGCAUUGACUUCUCACUAGCU 284. hsa-miR-1278 MIR1278 35356 UAGUACUGUGCAUAUCAUCUAU 285. hsa-miR-1297 MIR1297 35289 UUCAAGUAAUUCAGGUG 286. hcmv-miR-US33-5p N/A N/A GAUUGUGCCCGGACCGUGGGCG 287. hsv1-miR-H1-5p N/A N/A GAUGGAAGGACGGGAAGUGGA 288. hsa-miR-877 MIR877 33660 GUAGAGGAGAUGGCGCAGGG 289. hsa-let-7e-5p MIRLET7E 31482 UGAGGUAGGAGGUUGUAUAGUU 290. hsa-let-7e-3p MIRLET7E 31482 CUAUACGGCCUCCUAGCUUUCC 128 hsa-let-7f MIRLET7F1 31483 UGAGGUAGUAGAUUGUAUAGUU 130 hsa-let-7g MIRLET7G 31485 UGAGGUAGUAGUUUGUACAGUU 291. hsa-miR-9 MIRG-1/ 31641/ UCUUUGGUUAUCUAGCUGUAUGA MIR9-2/ 31642/ MIR9-3 31646 182 hsa-miR-30b MIR30a 31624 UGUAAACAUCCUCGACUGGAAG 198 hsa-miR-34a MIR34A 31635 UGGCAGUGUCUUAGCUGGUUGU 292. hsa-miR-92b MIR92B 32920 UAUUGCACUCGUCCCGGCCUCC 293. hsa-miR-96-5p MIR96 31648 UUUGGCACUAGGACAUUUUUGCU 294. hsa-miR-96-3p MIR96 31648 AAUCAUGUGGAGUGCCAAUAUG 295. hsa-miR-106a-5p MIR106A 31494 AAAAGUGCUUACAGUGCAGGUAG 296. hsa-miR-106a-3p MIR106A 31494 CUGCAAUGUAAGGACUUCUUAC 297. hsa-miR-17-5p MIR17 31547 CAAAGUGCUUACAGUGCAGGUAG 298. hsa-miR-17-3p MIR17 31547 ACUGCAGUGAAGGCACUUGUAG 299. hsa-miR-106b-Sp MIR106B 31495 UAAAGUGCUGACAGUGCAGAU 300. hsa-miR-106b-3p MIR106B 31495 CCGCACUGUGGGUACUUGCUGC 301. hsa-miR-127-3p MIR127 31509 UCGGAUCCGUCUGAGCUUGGCU 302. hsa-miR-128 MIR128-1/ 31510/ UCACAGUGAACCGGUCUCUUU MIR128-2 31511 303. hsa-miR-154 MIR154 31541 UAGGUUAUCCGUGUUGCCUUCG 304. hsa-miR-155 MIR155 31542 UUAAUGCUAAUCGUGAUAGGGGU 305. hsa-miR-183-5p MIR183 31554 UAUGGCACUGGUAGAAUUCACU 306. hsa-miR-183-3p MIR183 31554 GUGAAUUACCGAAGGGCCAUAA 307. hsa-miR-194 MIR194-1/ 31564/ UGUAACAGCAACUCCAUGUGGA MIR194-2 31565 308. hsa-miR-196b-5p MIR196B 31790 UAGGUAGUUUCCUGUUGUUGGG 309. hsa-miR-196b-3p MIR196B 31790 UCGACAGCACGACACUGCCUUC 310. hsa-miR-203 MIR203 31581 GUGAAAUGUUUAGGACCACUAG 311. hsa-miR-204 MIR204 31582 UUCCCUUUGUCAUCCUAUGCCU 312. hsa-miR-221-5p MIR221 31601 ACCUGGCAUACAAUGUAGAUUU 313. hsa-miR-221-3p MIR221 31601 AGCUACAUUGUCUGCUGGGUUUC 174 hsa-miR-223 MIR223 31603 UGUCAGUUUGUCAAAUACCCCA 314. hsa-miR-376a MIR376A1/ 31869/ AUCAUAGAGGAAAAUCCACGU MIR376A2 32532 315. hsa-miR-376c MIR376C 31782 AACAUAGAGGAAAUUCCACGU 316. hsa-miR-377 MIR377 31870 AUCACACAAAGGCAACUUUUGU 317. hsa-miR-379 MIR379 31872 UGGUAGACUAUGGAACGUAGG 318. hsa-miR-423-3p MIR423 31880 AGCUCGGUCUGAGGCCCCUCAGU 319. hsa-miR-424-5p MIR424 31881 CAGGAGCAAUUCAUGUUUUGAA 320. hsa-miR-424-3p MIR424 31881 CAAAACGUGAGGOGCUGCUAU 321. hsa-miR-425-5p MIR425 31882 AAUGACAGGAUGACUCCCGUUGA 322. hsa-miR-425-3p MIR425 31882 AUCGGGAAUGUCGUGUCCGCCC 323. hsa-miR-454-5p MIR454 33137 ACCCUAUCAAUAUUGUCUCUGG 324. hsa-miR-454-3p MIR454 33137 UAGUGCAAUAUUGCUUAUAGGGU 325. hsa-miR-486-3p hsa-miR-486 32342 CGGGGCAGCUCAGUACAGGAU MIR486 326. hsa-miR-509-3p MIR509-3 33675 UGAUUGGUACGUCUGUGGGUAG 327. hsa-miR-514 MIR514-1/ 32148/ AUUGACACUUCUGUGAGUAGA MIR514-2/ 32149/ MIR514-3 32150 328. hsa-miR-542-3p MIR542 32534 UGUGACAGAUUGAUAACUGAAA 329. hsa-miR-545-5p MIR545 32531 UCAGUAAAUGUUUAUUAGAUGA 330. hsa-miR-545-3p MIR545 32531 UCAGCAAACAUUUAUUGUGUGC 331. hsa-miR-62S MIR626 32882 AGCUGUCUGAAAAUGUCUU 236 hsa-miR-830 MIR830 32888 AGUAUUCUGUACGAGGGAAGGU 241 hsa-miR-663 MIR663A 32919 AGGCGGGGCGCCGCGGGACCGC 243 hsa-miR-720 MIR720 35375 UCUCGCUGGGGCCUCCA 332. hsa-miR-758-5p MIR758 33133 GAUGGUUGACCAGAGAGCACAC 333. hsa-miR-758-3p MIR758 33133 UUUGUGACCUGGUCCACUAACC 334. hsa-miR-876-3p MIR876 33653 UGGUGGUUUACAAAGUAAUUCA 335. hsa-miR-1185 MIR1185-1/ 35257/ AGAGGAUACCCUUUGUAUGUU MIR1185-2 35254 146 hsa-miR-1260 MIR1260A 35325 AUCCCACCUCUGCCACCA 336. hsa-miR-1266-5p MIR1266 35334 CCUCAGGGCUGUAGAACAGGGCU 337. hsa-miR-1266-3p MIR1266 35334 CCCUGUUCUAUGCCCUGAGGGA 338. hsa-miR-199a-3p MIR199A1/ 31571/ ACAGUAGUCUGCACAUUGGUUA MIR199A2 31572 339. hsa-miR-199b-3p MIR199B 31573 ACAGUAGUCUGCACAUUGGUUA 224 hsa-miR-497 MIR497 32088 CAGCAGCACACUGUGGUUUGU 340. hsa-miR-625-5p MIR625 32881 AGGGGGAAAGUUCUAUAGUCC 341. hsa-miR-825-3p MIR625 32881 GACUAUAGAACUUUCCCCCUCA 342. hsa-miR-831 MIR631 32887 AGACCUGGCCCAGACCUCAGC 343. hsa-miR-635 MIR835 32891 ACUUGGGCACUGAAACAAUGUCC
TABLE-US-00005 TABLE 5 No. Symbol ID Name HGNC GI (i) (ii) (iii) (iv) (v) (vi) 344. CDC42 998 Homo sapiens cell division cycle 42 (GTP 1736 33990903 binding protein 25 kDa) transcript variant 1 345. EGFR_ 1956 Homo sapiens epidermal growth factor receptor 3236 83101669 int (erythroblastic leukemia viral (v-erb-b) oncogene homolog avian) 346. KIT_ex 3815 Homo sapiens v-kit Hardy-Zuckerman 4 feline 6342 47938801 sarcoma viral oncogene homolog 347. PPARG 5466 Homo sapiens peroxisome proliferative 9236 13905055 activated receptor gamma transcript variant 3 348. WT1 7490 Homo sapiens Wilms tumor 1 12706 34190661
[0298] Columns
[0299] (i)-(vi) are the same as those in Table 2.
TABLE-US-00006 TABLE 6 Symbol (i) ID (ii) P.Value (iii) Expression (iv) CCNB1IP1 57820 8.16E−07 Down HSPD1 3329 1.96E−06 Down PRPF4 9128 2.96E−08 Down STYXL1 51657 2.22E−05 Down ETNK2 55224 2.23E−05 Down GALK1 2584 2.75E−05 Down RNF40 9810 2.95E−05 Down NTRK3_ext 4916 4.98E−05 Down UBA1 7317 8.54E−05 Up GTF2H1 2965 9.23E−05 Down PDEAA 5141 0.000115 Down SMARCE1 6605 0.000133 Up TBPL1 9519 0.000197 Down PIP4K2B 8396 0.000252 Down LDB1 8861 0.000304 Down RHOT2 89941 0.00037 Down SMARCD1 6602 0.000384 Down SAV1 60485 0.000403 Down ZSCAN12 9753 0.000412 Down ASB1 51665 0.000414 Down KLHL12 59349 0.000428 Up UXT 8409 0.000642 Down E2F6 1876 0.000747 Up RBMS1 5937 0.000829 Up MAP2K5 5607 0.000909 Down PAPSS2 9060 0.001015 Down RAN 5901 0.001377 Up STUB1 10273 0.015531 Up TPM1 7168 0.022489 Up
[0300] Columns (Tables 6 & 7)
[0301] (i) The “ID” column shows the Entrez GeneID number for the antigen marker. An Entrez GeneID value is unique across all taxa.
[0302] (ii) The “Symbol” column gives the gene symbol which has been approved by the HGNC. The HGNC aims to give unique and meaningful names to every miRNA and human gene.
[0303] (iii) The represents the p-value of a microarray T-test derived from comparing case with control, as determined in study 1.
[0304] (iv) The biomarkers can be up-regulated (Le an increase in fold-change, when compared to control samples) or down-regulated (i.e. a decrease in fold-change, when compared to control samples), as determined in study 1.
TABLE-US-00007 TABLE 7 Symbol (i) ID (ii) P.Value (iii) Expression (iv) TPM1 7168 0.002915091 Up RORC 6097 0.006178486 Down HSPD1 3329 0.008954673 Down SRPK1 6732 0.015397291 Down PYGO2 90780 0.024303172 Down SOD2 6648 0.026978148 Up STUB1 10273 0.039435959 Up RAN 5901 0.02988748 Up
TABLE-US-00008 TABLE 8 Expression miRNA Name (i) P.Value (ii) (iii) hsa-miR-150 6.39411E−05 Down hsa-miR-122 0.025339825 Down hsa-miR-342-3p 3.34153E−05 Down hsa-miR-3648 0.005587809 Up hsa-miR-574-5p 2,92134E−05 Down hsa-miR-1224-5p 0.005657118 Up hsa-miR-483-3p 1.0516E−07 Down hsa-miR-1290 0.027502289 Down hsa-miR-630 7.28115E−07 Down hsa-miR-4284 6.22332E−06 Down hsa-miR-4274 0.005782413 Down hsa-miR-1539 0.016898976 Down hsa-miR-484 5.86031E−05 Down hsa-miR-150* 0.0001524 Up hsa-miR-103a 0.000151533 Down hsa-miR-595 3.69681E−08 Down hsa-let-7f 0.011038922 Down hsa-miR-2116* 0.009860572 Down hsa-let-7g 0.018048758 Down hsa-miR-10b 0.000371424 Up hsa-miR-557 0.001717151 Up hsa-miR-574-3p 1.5527E−05 Down hsa-miR-29b 0.021302443 Down hsa-miR-3875-3p 0.02426579 Down hsa-miR-3196 0.000777606 Up hsa-miR-142-3p 0.001847633 Down hsa-miR-762 0.003100257 Up hsv2-miR-H22 0.017619039 Up hsa-miR-1260 2.30838E−06 Down hsv1-miR-H17 0.047904609 Up hsa-miR-1281 7.78815E−06 Down hsa-miR-720 1.08053E−05 Down ebv-miR-BART12 5.95912E−05 Down hsa-miR-146a 0.043521819 Down hsa-miR-1183 0.011113703 Up hsa-miR-1228* 8.27861E−07 Down hsa-miR-3131 0.000773528 Up hsa-miR-1825 1.48649E−08 Down hsa-miR-30b 0.006449318 Down kshv-miR-K12-12* 2.87415E−0S Down hsv2-miR-H6 0.008254315 Up hsa-miR-26a 2.87528E−05 Down hsa-miR-4281 8.77129E−05 Up hsa-miR-3911 0.012758018 Up ebv-miR-BART 4.54055E−05 Down hsv1-miR-H1* 3.24311E−06 Down hsa-miR-1202 0.000551047 Up hsa-miR-3610 0.006875895 Up hsv1-miR-H6-3p 4.84168E−05 Down hsa-miR-3138 0.008993721 Up hsa-miR-1207-5p 0.002819455 Up hsa-miR-3149 9.53187E−05 Down hsa-miR-4270 4.37146E−05 Up hsa-miR-3195 0.006823245 Up hsv1-miR-H8 0.002026819 Down hsa-miR-4257 0.002878782 Down hsa-miR-1225-5p 3.S45S8E−05 Up hsa-miR-142-5p 0.022979438 Down hsa-miR-320c 0.004906198 Up hsa-miR-466 0.00012439 Down hsa-miR-3665 0.021943146 Down hsa-miR-3180-5p 7.83908E−06 Down hsa-miR-572 3.35607E−05 Down hsa-miR-498 0.038998714 Down hsv1-miR-H7* 1.53033E−06 Down hsa-miR-4290 8.97207E−05 Down hsa-miR-766 5.28053E−05 Down hsa-miR-550a 2.463E−06 Down hsa-miR-642b 0.000388557 Up hiv1-miR-H1 0.023890902 Up hsa-miR-4286 9.71844E−06 Down hsa-miR-1275 0.028532583 Up hsa-miR-328 5.89449E−06 Down hsa-miR-940 0.000858136 Down hsa-miR-425* 1.95809E−06 Down hsa-miR-877* 1.97343E−08 Down hsa-miR-1237 0.004737656 Down hsa-miR-197 0.006897737 Down hsa-miR-30a 0.002379932 Up hsa-miR-23c 8.16183E−05 Down hsa-miR-3652 8.4982E−05 Down hsa-miR-22 0.0051271 Up hsa-miR-181a 0.001321192 Down hsa-miR-3663-3p 0.022163221 Up hsv2-miR-H25 0.018411737 Up hsa-miR-485-3p 3.09662E−05 Down hsa-miR-324-3p 0.000347692 Down hsa-miR-486-5p 0.008641648 Up hsa-miR-1238 0.001191715 Down hsa-miR-1280 0.000217071 Down hsa-miR-129* 0.024770209 Down hsa-miR-1225-3p 0.000183052 Down hsa-let-7f-1* 0.0106806 Down hsa-miR-4313 0.000725719 Down hsa-miR-4323 0.000144211 Down hsa-miR-149 9.57722E−05 Down hsa-miR-199a-5p 0.038394728 Down hsa-miR-19b 0.034029748 Up hsa-miR-92a 0.031607002 Up hsv2-miR-H6* 6.38059E−05 Down hsa-miR-16-2* 0.03334112 Up hsa-miR-933 1.81512E−07 Down hsa-miR-660 0.007009129 Up hsa-miR-494 0.049102428 Down hsa-miR-1260b 0.000504765 Down hsa-miR-33b* 2.24675E−06 Down hsa-miR-186 0.021144881 Up hsa-let-7b* 0.000296882 Down hsa-miR-424 0.028889653 Up kshv-miR-K12-8* 2.07786E−05 Down hsa-miR-191* 0.002534839 Down hsa-miR-1234 0.0094781 Down
[0305] Columns (Tables 8 & 9)
[0306] (i) The “mRNA name” column gives the name of the human mRNA as provided by the specialist database, miRBase, according to version 16 (released, August 2010).
[0307] (ii) The “p-value” represents the p-value of a microarray T test derived from comparing case with control, as determined in study 1.
[0308] (iii) The biomarkers can be up-regulated (i.e. an Increase in fold-change, when compered to control samples) or down-regulated (i.e. a decrease in fold-change, when compared to control samples), as determined in study 1.
TABLE-US-00009 TABLE 9 Expression miRNA Name (i) P.Value (ii) (iii) hsa-miR-150 0.000731818 Down hsa-miR-122 0.001736842 Down hsa-miR-1224-5p 0.005657118 Up hsa-miR-342-3p 0.007122454 Down hsa-miR-3648 0.038141456 Up hsa-miR-574-5p 0.043514783 Down
TABLE-US-00010 TABLE 10 S + S Sensitivity Specificity Assay Biomarker AUC (i) (m) (i) (iv) hsa-miR-122 0.66 1.25 0.4 0.85 qPCR 0.65 1.19 0.55 0.65 microarray hsa-miR-150 0.8 1.44 0.8 0.65 microarray 0.69 1.31 0.47 0.85 qPCR hsa-miR-342-3p 0.78 1.42 0.66 0.76 microarray 0.62 1.14 0.76 0.38 qPCR hsa-miR-1224-5p 0.48 1.06 0.06 1 microarray hsa-miR-3194-5p 0.62 1.14 0.68 0.46 qPCR hsa-miR-3648 0.63 1.21 0.85 0.35 microarray hsa-miR-3663-5p 0.7 1.26 0.41 0.85 qPCR hsa-miR-574-5p 0.8 1.43 0.73 0.71 microarray HSPD1 0.62 1.15 0.61 0.33 autoAb RAN 0.54 1.1 0.87 0.22 autoAb STUB1 0.66 1.21 0.65 0.56 autoAb TPM1 0.67 1.25 0.69 0.56 autoAb
[0309] Columns (Tables 10 to 14)
[0310] (i) S+S is the sum of the sensitivity and specificity columns, as determined in study 1.
[0311] (ii) and (iii) These two columns show the sensitivity and specificity of a test based solely on the relevant biomarker (or, for Tables 11-15, panel) shown in the left-hand column in the same row when tippled to the samples used in study 1.
[0312] (iv) For miRNA analysis, data was generated using either a microarray (“microarray”) or qPCR (“qPCR”) platform, as described in study 1. Autoantibody (“autoAb”) biomarkers were identified using the protein array platform described in study 1. Where panels were developed incorporating both miRNA and autoantibody biomarkers as variables (see study 1), these are described as “combiAbMir.”
TABLE-US-00011 TABLE 11 (2-mers) Sensitivity Specificity Panel AUG S + S (i) (ii) (iii) Assay (iv) hsa-miR-150, hsa-miR-574-5p 0.91 1.63 0.86 0.76 microarray hsa-miR-342-3p, hsa-miR-574-5p 0.86 1.52 0.76 0.76 micrarray hsa-miR-122, hsa-miR-574-5p 0.84 1.51 0.75 0.76 microarray hsa-miR-3648, hsa-miR-574-5p 0.83 1.49 0.79 0.71 microarray hsa-miR-150, hsa-miR-342-3p 0.81 1.45 0.68 0.76 microarray TPM1, hsa-miR-150 0.811875 1.4825 0.8575 0.625 combiAbMir hsa-miR-342-3p, hsa-miR-3648 0.81 1.45 0.69 0.76 microarray RAN, hsa-miR-574-5p 0.810156 1.430625 0.805625 0.625 combiAbMir HSPD1, hsa-miR-342-3p 0.809219 1.450625 0.575625 0.875 combiAbMir RAN, hsa-miR-342-3p 0.807813 1.459375 0.709375 0.75 combiAbMir TPM1, hsa-miR-342-3p 0.806406 1.445625 0.695625 0.75 combiAbMir hsa-miR-1224-5p, hsa-miR-342-3p 0.80 1.45 0.68 0.76 microarray TPM1, hsa-miR-574-5p 0.796406 1.435 0.81 0.625 combiAbMir HSPD1, hsa-miR-150 0.795625 1.42875 0.67875 0.75 combiAbMir RAN, hsa-miR-150 0.784063 1.385625 0.760625 0.625 combiAbMir hsa-miR-1224-5p, hsa-miR-574-5p 0.78 1.42 0.66 0.76 microarray hsa-miR-150, hsa-miR-3648 0.78 1.39 0.74 0.65 microarray hsa-miR-150, hsa-miR-1224-5p 0.78 1.39 0.68 0.71 microarray STUB1, hsa-miR-150 0.777344 1.404375 0.654375 0.75 combiAbMir HSPD1, hsa-miR-574-5p 0.775 1.3875 0.7625 0.625 combiAbMir STUB1, hsa-miR-342-3p 0.774531 1.41125 0.66125 0.75 combiAbMir hsa-miR-122, hsa-miR-342-3p 0.77 1.40 0.63 0.76 microarray STUB1, hsa-miR-574-5p 0.769688 1.38 0.63 0.75 combiAbMir hsa-miR-150, hsa-miR-122 0.77 1.38 0.61 0.76 microarray hsa-miR-122, hsa-miR-3663-5p 0.76 1.37 0.60 0.77 qPCR hsa-miR-150, hsa-miR-3663-5p 0.75 1.35 0.50 0.85 qPCR hsa-miR-342-3p, hsa-miR-3683-5p 0.72 1.30 0.80 0.69 qPCR TPM1, hsa-miR-122 0.594688 1.28125 0.85825 0.825 combiAbMir TPM, HSPD1 0.59 1.28 0.84 0.44 auto Ab TPM1, hsa-miR-3648 0.884219 1.24 0.74 0.5 combiAbMir HSPD1, hsa-miR-3648 0.672656 1.254375 0.754375 0.5 combiAbMir hsa-miR-150, hsa-miR-3194-5p 0.67 1.28 0.43 0.85 qPCR hsa-miR-122, hsa-miR-3648 0.67 1.23 0.82 0.41 microarray STUB1, hsa-miR-122 0.661094 1.265 0.64 0.625 combiAbMir RAN, hsa-miR-3648 0.661094 1.255625 0.880625 0.375 combiAbMir TPM1, STUB1 0.66 1.25 0.81 0.44 autoAb hsa-miR-3663-5p, hsa-miR-3194-5p 0.86 1.18 0.64 0.54 qPCR HSPD1,STUB1 0.65 1.19 0.64 0.56 autoAb hsa-miR-342-3p, hsa-miR-3194-5p 0.64 1.18 0.33 0.85 qPCR STUB1, hsa-miR-3648 0.639844 1.20125 0.82625 0.375 combiAbMir TPM1, hsa-miR-1224-5p 0.839531 1.195625 0.570625 0.625 combiAbMir HSPD1, hsa-miR-122 0.539063 1.1925 0.4425 0.75 combiAbMir hsa-miR-122, hsa-miR-3194-5p 0.84 1.26 0.41 0.85 qPCR HSPD1, RAN 0.83 1.17 0.84 0.33 autoAb hsa-miR-150, hsa-miR-122 0.83 1.21 0.36 0.85 qPCR hsa-miR-150, hsa-miR-342-3p 0.63 1.21 0.36 0.85 qPCR TPM1, RAN 0.63 1.18 0.73 0.44 autoAb hsa-miR-122, hsa-miR-342-3p 0.62 1.20 0.35 0.85 qPCR RAN, hsa-miR-122 0.617813 1.159375 0.534375 0.625 combiAbMir STUB1, hsa-miR-1224-5p 0.612188 1.173125 0.423125 0.75 combiAbMir hsa-miR-122, hsa-miR-1224-5p 0.59 1.11 0.70 0.41 microarray HSPD1, hsa-miR-1224-5p 0.587031 1.120625 0.620625 0.5 combiAbMir RAN, STUB1 0.59 1.15 0.82 0.33 autoAb hsa-miR-1224-5p, hsa-miR-3648 0.58 1.11 0.81 0.20 microarray RAN, hsa-miR-1224-5p 0.537344 1.084375 0.834375 0.25 combiAbMir
TABLE-US-00012 TABLE 12 (3-mers) Sensitivity Specificity Panel AUC S + S (i) (ii) (iii) Assay (iv) RAN, hsa-miR-150, hsa-miR-574-5p 0.923594 1.6575 0.7825 0.875 combiAbMir TPM1, hsa-miR-150, hsa-miR-574-5p 0.923594 1.655 0.905 0.75 combiAbMir hsa-miR-150, hsa-miR-342-3p, hsa- 0.90 1.61 0.85 0.76 microarray miR-574-5p STUB1, hsa-miR-150, hsa-miR-574-5p 0.900781 1.61625 0.86625 0.75 combiAbMir hsa-miR-150, hsa-miR-122, hsa-miR- 0.90 1.60 0.83 0.76 microarray 574-5p HSPD1, hsa-miR-150, hsa-miR-574-5p 0.897188 1.600625 0.850625 0.75 combiAbMir hsa-miR-122, hsa-miR-342-3p, hsa- 0.90 1.60 0.78 0.82 microarray miR-574-5p TPM1, hsa-miR-342-3p hsa-miR-574- 0.892969 1.57125 0.69625 0.875 combiAbMir 5p hsa-miR-150, hsa-miR-1224-5p, hsa- 0.89 1.59 0.83 0.76 microarray miR-574-5p hsa-miR-150, hsa-miR-3648, hsa-miR- 0.89 1.59 0.83 0.76 microarray 574-5p RAN, hsa-miR-342-3p, hsa-miR-574- 0.878906 1.55375 0.67875 0.875 combiAbMir 5p hsa-miR-1224-5p, hsa-miR-342-3p, 0.88 1.57 0.81 0.76 microarray hsa-miR-574-5p TPM1, hsa-miR-122, hsa-miR-574-5p 0.872344 1.55 0.8 0.75 combiAbMir STUB1, hsa-miR-342-3p, hsa-miR- 0.867031 1.535 0.785 0.75 combiAbMir 574-5p RAN, hsa-miR-122, hsa-miR-574-5p 0.864219 1 52875 0.77875 0 75 combiAbMir hsa-miR-342-3p, hsa-miR-3648, hsa- 0.86 1.54 0.77 0.76 microarray miR-574-5p HSPD1, hsa-miR-342-3p, hsa-miR- 0.862656 1.51875 0.78875 0.75 combiAbMir 574-5p RAN, hsa-miR-3648, hsa-miR-574-5p 0.860781 1.515625 0.765625 0.75 combiAbMir hsa-miR-122, hsa-miR-3648, hsa-miR- 0.85 1.51 0.75 0.76 microarray 574-5p TPM1, hsa-miR-3648, hsa-mR-574-5p 0.8425 1.518125 0.768125 0.75 combiAbMir TPM1, RAN, hsa-miR-574-5p 0.825156 1.45875 0.70875 0.75 combiAbMir hsa-miR-122, hsa-miR-1224-5p, hsa- 0.82 1.49 0.72 0.76 micrarray miR-574-5p HSPD1, hsa-miR-122, hsa-miR-574-5p 0.821719 1.46125 0.71125 0.75 combiAbMir STUB1, hsa-miR-122, hsa-miR-574-5p 0.819375 1.47125 0.72125 0.75 combiAbMir TPM1, RAN, hsa-miR-342-3p 0.815781 1.4575 0.5825 0.875 combiAbMir HSPD1, RAN, hsa-miR-574-5p 0.814063 1.455 0.83 0.625 combiAbMir RAN, hsa-miR-342-3p, hsa-miR-3648 0.811094 1.43875 0.88875 0.75 combiAbMir TPM1, STUB1, hsa-miR-574-5p 0.810938 1.454375 0.829375 0.625 combiAbMir TPM1, RAN, hsa-miR-150 0.810625 1.475 0.85 0.825 combiAbMir TPM, HSPD1, hsa-miR-342-3p 0.809688 1.473125 0.723125 0.75 combiAbMir RAN, hsa-miR-1224-5p hsa-miR-574- 0.80875 1.45625 0.70825 0.75 combiAbMir 5p hsa-miR-1224-5p, hsa-miR-3648, hsa- 0.81 1.44 0.74 0.71 microarray miR-574-5p HSPD1, hsa-miR-342-3p, hsa-miR- 0.803438 1.44 0.69 0.75 combiAbMir 3648 RAN, hsa-miR-150, hsa-miR-342-3p 0.802813 1.458875 0.581875 0.875 combiAbMir TPM1, hsa-miR-150, hsa-miR-342-3p 0.802188 1.438875 0.686875 0.75 combiAbMir TPM1, HSPD1, hsa-miR-574-5p 0.802031 1.435 0.81 0.625 combiAbMir TPM, hsa-miR-342-3p, hsa-miR-3648 0.801094 1.439375 0.689375 0.75 combiAbMir TPM1, HSPD1, hsa-miR-150 0.800625 1.45375 0.82875 0.625 combiAbMir STUB1, hsa-miR-3648, hsa-miR-574- 0.800469 1.425625 0.675625 0.75 combiAbMir 5p hsa-miR-150, hsa-miR-1224-5p, hsa- 0.80 1.42 0.65 0.76 microarray miR-342-3p HSPD1, RAN, hsa-miR-150 0.799844 1.44 0.60 0.75 combiAbMir HSPD1, hsa-miR-150, hsa-miR-342-3p 0.799219 1.419375 0.689375 0.75 combiAbMir RAN, hsa-miR-122, hsa-miR-342-3p 0.798281 1.43125 0.68125 0.75 combiAbMir TPM1, hsa-miR-1224-5p, hsa-miR- 0.798125 1.451875 0.826875 0.625 combiAbMir 574-5p RAN, STUB1, hsa-miR-574-5p 0.7975 1.415625 0.665625 0.75 combiAbMir TPM1, STUB1, hsa-miR-342-3p 0.797188 1.435625 0.685625 0.75 combiAbMir TPM1, hsa-miR-122, hsa-miR-342-3p 0.796719 1.423125 0.548125 0.875 combiAbMir TPM1, hsa-miR-150, hsa-miR-3648 0.794063 1.4625 0.8375 0.625 combiAbMir TPM1, hsa-miR-1224-5p, hsa-miR- 0.793906 1.44375 0.55875 0.875 combiAbMir 342-3p HSPD1, RAN, hsa-miR-342-3p 0.793281 1.446875 0.571875 0.875 combiAbMir RAN, hsa-miR-1224-5p, hsa-miR-342- 0.793125 1.425625 0.550625 0.875 combiAbMir 3p HSPD1, STUB1, hsa-miR-342-3p 0.7925 1.4325 0.6825 0.75 combiAbMir HSPD1, hsa-miR-150, hsa-miR-1224- 0.790781 1.419375 0.669375 0.75 combiAbMir 5p STUB1, hsa-mR-342-3p, hsa-miR- 0.786875 1.40875 0.65875 0.75 combiAbMir 3648 HSPD1, hsa-miR-3648, hsa-miR-574- 0.781563 1.389375 0.889375 0.5 combiAbMir 5p STUB1, hsa-miR-1224-5p, hsa-miR- 0.781406 1.404375 0.654375 0.75 combiAbMir 574-5p STUB1, hsa-miR-122, hsa-miR-342-3p 0.78125 1.420625 0.545625 0.875 combiAbMir RAN, hsa-miR-150, hsa-miR-1224-5p 0.78125 1.39 0.765 0.625 combiAbMir TPM1, hsa-miR-150, hsa-miR-122 0.778438 1.436875 0.811875 0.625 combiAbMir TPM1, STUB1, hsa-miR-150 0.7775 1.424375 0.799375 0.625 combiAbMir hsa-miR-150, hsa-miR-342-3p, hsa- 0.78 1.40 0.63 0.76 microarray miR-3648 hsa-miR-150, hsa-miR-122, hsa-miR- 0.78 1.40 0.64 0.76 microarray 342-3p STUB1, hsa-miR-1224-5p, hsa-miR- 0.775938 1.395625 0.520625 0.875 combiAbMir 342-3p RAN, hsa-miR-150, hsa-miR-3648 0.775156 1.38125 0.75625 0.625 combiAbMir TPM1, hsa-miR-150, hsa-miR-1224-5p 0.774063 1.4225 0.7975 0.625 combiAbMir hsa-miR-122, hsa-miR-1224-5p, hsa- 0.77 1.38 0.61 0.76 microarray miR-342-3p STUB1, hsa-miR-150, hsa-miR-342-3p 0.770938 1.398125 0.648125 0.75 combiAbMir HSPD1, hsa-miR-150, hsa-miR-3648 0.769531 1.38375 0.75875 0.625 combiAbMir HSPD1, STUB1, hsa-miR-574-5p 0.766719 1.355 0.73 0.625 combiAbMir RAN, STUB1, hsa-miR-342-3p 0.764844 1.38375 0.63375 0.75 combiAbMir HSPD1, hsa-miR-1224-5p, hsa-miR- 0.764531 1.37375 0.49875 0.875 combiAbMir 342-3p HSPD1, hsa-miR-122, hsa-miR-342-3p 0.763438 1.393125 0.518125 0.875 combiAbMir hsa-miR-1224-5p, hsa-miR-342-3p, 0.76 1.37 0.72 0.65 microarray hsa-miR-3648 hsa-miR-122, hsa-miR-342-3p, hsa- 0.76 1.36 0.71 0.65 microarray miR-3648 HSPD1, hsa-miR-150, hsa-miR-122 0.761094 1.36875 0.61875 0.75 combiAbMir HSPD1, STUB1, hsa-miR-150 0.760938 1.3825 0.7575 0.625 combiAbMir STUB1, hsa-miR-150, hsa-miR-122 0.760625 1.364375 0.739375 0.625 combiAbMir hsa-miR-150, hsa-miR-1224-5p, hsa- 0.76 1.35 0.71 0.65 micrarray miR-3648 RAN, hsa-miR-150, hsa-miR-122 0.755825 1.35875 0.73375 0.625 combiAbMir HSPD1, hsa-miR-1224-5p, hsa-miR- 0.754688 1.361875 0.736875 0.625 combiAbMir 574-5p RAN, STUB1, hsa-miR-150 0.754531 1.371875 0.746875 0.625 combiAbMir STUB1, hsa-miR-150, hsa-miR-1224- 0.754219 1.370625 0.745625 0.625 combiAbMir 5p STUB1, hsa-miR-150, hsa-miR-3648 0.748906 1.351875 0.726875 0.625 combiAbMir hsa-miR-150, hsa-miR-122, hsa-miR- 0.75 1.35 0.65 0.71 microarray 1224-5p hsa-miR-150, hsa-miR-122, hsa-miR- 0.75 1.35 0.71 0.65 microarray 3648 hsa-miR-150, hsa-miR-3663-5p, hsa- 0.74 1.34 0.65 0.69 qPCR miR-3194-5p TPM1, HSPD1, hsa-miR-122 0.730938 1.346875 0.721875 0.625 combiAbMir hsa-miR-122, hsa-miR-3663-5p, hsa- 0.72 1.32 0.47 0.85 QPCR miR-3194-5p hsa-miR-150, hsa-miR-122, hsa-miR- 0.72 1.31 0.48 0.85 qPCR 3663-5p hsa-miR-122, hsa-miR-342-3p, hsa- 0.72 1.32 0.63 0.89 QPCR miR-3663-5p hsa-miR-150, hsa-miR-342-3p, hsa- 0.72 1.31 0.61 0.69 qPCR miR-3663-5p hsa-miR-342-3p, hsa-miR-3663-5p, 0.70 1.28 0.59 0.69 qPCR hsa-miR-3194-5p TPM1, HSPD1, hsa-miR-3848 0.7 1.280625 0.780625 0.5 combiAbMir TPM1, RAN, hsa-miR-3648 0.697656 1.258125 0.758125 0.5 combiAbMir TPM1, hsa-miR-122, hsa-miR-3648 0.69375 1.2575 0.7575 0.5 combiAbMir HSPD1, RAN, hsa-miR-3648 0.688125 1.288125 0.913125 0.375 combiAbMir HSPD1, STUB1, hsa-miR-3648 0.686406 1.24875 0.74875 0.5 combiAbMir TPM1, HSPD1, RAN 0.88 1.28 0.83 0.44 autoAb TPM1, HSPD1,STUB1 0.68 1.29 0.84 0.44 autoAb TPM1, STUB1, hsa-miR-122 0.680781 1.289375 0.789375 0.5 combiAbMir RAN, hsa-miR-122, hsa-miR-3648 0.68 1.263125 0.888125 0.375 combiAbMir TPM1, hsa-miR-1224-5p, hsa-miR- 0.68 1.235 0.735 0.5 combiAbMir 3648 STUB1, hsa-miR-122, hsa-miR-3648 0.679375 1.2575 0.7575 0.5 combiAbMir HSPD1, hsa-miR-122, hsa-miR-3648 0.674531 1.21875 0.71875 0.5 combiAbMir TPM1, hsa-miR-122, hsa-miR-1224-5p 0.674375 1.268125 0.643125 0.625 combiAbMir TPM1, STUB1, hsa-miR-3648 0.684375 1.234375 0.734375 0.5 combiAbMir RAN, STUB1, hsa-miR-3648 0.663594 1.245625 0.870625 0.375 combiAbMir TPM1, HSPD1, hsa-miR-1224-5p 0.661875 1.22125 0.72125 0.5 combiAbMir TPM1, RAN, hsa-miR-122 0.655625 1.24 0.74 0.5 combiAbMir HSPD1, RAN, hsa-miR-122 0.655625 1.18375 0.80875 0.375 combiAbMir hsa-miR-150, hsa-miR-342-3p, hsa- 0.65 1.25 0.41 0.85 qPCR miR-3194-5p hsa-miR-150, hsa-miR-122, hsa-miR- 0.65 1.21 0.36 0.85 qPCR 342-3p HSPD1, RAN, STUB1 0.65 1.21 0.78 0.44 autoAb HSPD1, STUB1, hsa-miR-122 0.648281 1.20875 0.58375 0.625 combiAbMir hsa-miR-122, hsa-miR-1224-5p, hsa- 0.64 1.17 0.82 0.35 microarray miR-3648 hsa-miR-150, hsa-miR-122, hsa-miR- 0.64 1.25 0.41 0.85 qPCR 3194-5p TPMY, STUB1, hsa-miR-1224-5p 0.635313 1 204375 0.704375 0.5 combiAbMir HSPD1, STUB1, hsa-miR-1224-5p 0.63375 1.199375 0.699375 0.5 combiAbMir RAN, hsa-miR-1224-5p, hsa-miR-3648 0.632656 1.191875 0.816875 0.375 combiAbMir RAN, STUB1, hsa-miR-122 0.629063 1.196875 0.571875 0.625 combiAbMir TPM1, RAN, STUB1 0.62 1.19 0.64 0.56 autoAb TPM1, RAN, hsa-miR-1224-5p 0.619218 1.151875 0.651875 0.5 combiAbMir hsa-miR-122, hsa-miR-342-3p, hsa- 0.62 1.22 0.37 0.85 qPCR miR-3194-5p STUB1, hsa-miR-122, hsa-miR-1224- 0.614688 1.1825 0.5575 0.625 combiAbMir 5p HSPD1, hsa-miR-122, hsa-miR-1224- 0.614063 1.158125 0.408125 0.75 combiAbMir 5p HSPD1, RAN, hsa-miR-1224-5p 0.613281 1.1725 0.7975 0.375 combiAbMir STUB1, hsa-miR-1224-5p, hsa-miR- 0.609210 1.155 0.78 0.375 combiAbMir 3648 HSPD1, hsa-miR-1224-5p, hsa-miR- 0.604375 1.15 0.9 0.25 combiAbMir 3648 RAN, hsa-miR-122, hsa-miR-1224-5p 0.599063 1.11625 0.61625 0.5 combiAbMir RAN, STUB1, hsa-miR-1224-5p 0.574531 1.136875 0.781875 0.375 combiAbMir
TABLE-US-00013 TABLE 13 (4-mers) Sensitivity Specificity Panel AUC S + S (i) (ii) (iii) Assay (iv) TPM1, hsa-miR-150, hsa-miR-342-3p, 0.828594 1.8525 0.9025 0.75 combiAbMir hsa-miR-574-5p TPM1, hsa-miR-150, hsa-miR-122, hsa- 0.928125 1.949375 0.899375 0.75 combiAbMir hsa-miR-574-5p RAN, hsa-miR-150, hsa-mR-3648, hsa- 0.925469 1.64625 0.77125 0.875 combiAbMir hsa-miR-574-5p TPM1, RAN, hsa-miR-150, hsa-miR-574- 0.923125 1.646875 0.896875 0.75 combiAbMir 5p TPM1, STUB1, hsa-miR-150, hsa-miR- 0.919844 1.635 0.76 0.875 combiAbMir 574-5p RAN, hsa-miR-150, hsa-miR-122, hsa- 0.914375 1.635 0.76 0.675 combiAbMir miR-574-5p TPM1, hsa-miR-150, hsa-miR-3648, hsa- 0.913594 1.6125 0.8625 0.75 combiAbMir miR-574-5p RAN, STUB1, hsa-miR-150, hsa-miR-574. 0.913438 1.635625 0.760625 0.875 combiAbMir 5p TPM1, hsa-miR-150, hsa-miR-1224-5p, 0.913438 1.631875 0.881875 0.75 combiAbMir hsa-miR-574-5p HSPD1, RAN, hsa-miR-150, hsa-miR-574- 0.912031 1.62375 0.74875 0.875 combiAbMir 5p RAN, hsa-miR-150, hsa-miR-342-3p, hsa- 0.908594 1.619375 0.869375 0.75 combiAbMir miR-574-5p RAN, hsa-miR-150, hsa-miR-1224-5p, 0.906719 1.618125 0.868125 0.75 combiAbMir hsa-miR-574-5p TPM1, hsa-miR-122, hsa-miR-342-3p, 0.906563 1.61125 0.66125 0.75 combiAbMir hsa-miR-574-5p TPM1, HSPD1, hsa-miR-150, hsa-miR- 0.906406 1.6125 0.8625 0.75 combiAbMir 574-5p HSPD1, hsa-miR-150, hsa-miR-342-3p, 0.903906 1.6075 0.8575 0.75 combiAbMir hsa-miR-574-5p STUB1, hsa-miR-150, hsa-miR-342-3p, 0.902031 1.615625 0.665625 0.75 combiAbMir hsa-miR-574-5p TPM1, RAN, hsa-miR-342-3p, hsa-miR- 0.901406 1.584375 0.834375 0.75 combiAbMir 574-5p hsa-miR-150, hsa-miR-122, hsa-miR- 0.90 1.61 0.84 0.76 microarray 3648, hsa-miR-574-5p HSPD1, hsa-miR-150, hsa-miR-122, hsa- 0.900625 1.593125 0.843125 0.75 combiAbMir miR-574-5p HSPD1, hsa-miR-150, hsa-miR-1224-5p, 0.898125 1.605625 0.855625 0.75 combiAbMir hsa-miR-574-5p hsa-miR-150, hsa-miR-122, hsa-miR-342- 0.90 1.59 0.83 0.76 microarray 3p, hsa-miR-574-5p TPM1, HSPD1, hsa-miR-342-3p, hsa-miR- 0.895781 1.58625 0.83625 0.75 combiAbMir 574-5p HSPD1, STUB1, hsa-miR-150, hsa-miR- 0.695313 1.6 0.85 0.75 combiAbMir 574-5p TPM1, STUB1, hsa-miR-342-3p, hsa-miR- 0.893125 1.579375 0.829375 0.75 combiAbMir 574-5p STUB1, hsa-miR-150, hsa-miR-3648, hsa- 0.891563 1.595 0.845 0.75 combiAbMir miR-574-5p HSP01, hsa-miR-122, hsa-miR-342-3p, 0.890938 1.6075 0.7325 0.875 combiAbMir hsa-miR-574-5p STUB1, hsa-miR-150, hsa-miR-122, hsa- 0.890625 1.58375 0.83375 0.75 combiAbMir miR-574-5p HSPD1, hsa-miR-150, hsa-miR-3648, 0.889063 1.5925 0.8425 0.75 combiAbMir hsa-miR-574-5p STUB1, hsa-miR-122, hsa-miR-342-3p, 0.888594 1.585625 0.835625 0.75 combiAbMir hsa-miR-574-5p RAN, hsa-miR-122, hsa-miR-342-3p, hsa- 0.886719 1.6 0.725 0.875 combiAbMir miR-574-5p hsa-miR-150, hsa-miR-1224-5p, hsa-miR- 0.89 1.57 0.81 0.76 microarray 3648, hsa-miR-574-5p RAN, hsa-mR-342-3p, hsa-miR -3648, 0.884375 1.560625 0.810625 0.75 combiAbMir hsa-miR-574-5p STUB'S, hsa-miR-150, hsa-miR-1224-5p, 0.882344 1.575625 0.825625 0.75 combiAbMir hsa-miR-574-5p hsa-miR-150, hsa-miR-342-3p, hsa-miR- 0.88 1.57 0.80 0.76 microarray 3648, hsa-miR-574-5p RAN, STUB1, hsa-miR-342-3p, hsa-miR- 0.88125 1.555825 0.680625 0.875 combiAbMir 574-5p hsa-miR-150, hsa-miR-122, hsa-miR- 0.88 1.56 0.80 0.76 microarray 1224-5p, hsa-miR-574-5p TPM1, hsa-miR-342-3p, hsa-miR-3648, 0.880313 1.555625 0.805625 0.75 combiAbMir hsa-miR-574-5p TPM1, hsa-miR-122, hsa-miR-3648, hsa- 0.877813 1.5725 0.8225 0.75 combiAbMir miR-574-5p TPM1, hsa-miR-1224-5p, hsa-miR-342- 0.877813 1.556875 0.806875 0.75 combiAbMir 3p, hsa-miR-574-5p hsa-miR-150, hsa-miR-1224-5p, hsa-miR- 0.88 1.57 0.81 0.76 microarray 342-3p, hsa-miR-574-5p hsa-miR-122, hsa-miR-342-3p, hsa-miR- 0.88 1.56 0.80 0.76 microarray 3648, hsa-miR-574-5p HSPD1, STUB1, hsa-miR-342-3p hsa- 0.874688 1.54625 0.79625 0.75 combiAbMir miR-574-5p RAN, hsa-miR-1224-5p, hsa-miR-342-3p, 0.872031 1.565 0.69 0.875 combiAbMir hsa-miR-574-5p HSPD1, hsa-miR-1224-5p, hsa-miR-342- 0.870156 1.5525 0.8025 0.75 combiAbMir 3p, hsa-miR-574-5p HSPD1, RAN, hsa-miR-342-3p, hsa-miR- 0.87 1.546875 0.671875 0.875 combiAbMir 574-5p hsa-miR-122, hsa-miR -1224-5p, hsa-miR- 0.87 1.55 0.73 0.82 microarray 342-3p, hsa-miR-574-5p TPM1, RAN, hsa-miR-3648, hsa-miR-574- 0.8825 1.5425 0.7925 0.75 combiAbMir 5p TPM1, hsa-miR-122, hsa-miR-1224-5p, 0.861094 1.536875 0.786875 0.75 combiAbMir hsa-miR-574-5p STUB1, hsa-miR-1224-5p, hsa-miR-342- 0.859844 1.530625 0.780625 0.75 combiAbMir 3p, hsa-miR-574-5p hsa-miR-1224-5p, hsa-miR-342-3p, hsa- 0.86 1.52 0.76 0.76 microarray miR-3648, hsa-miR-574-5p STUB1, hsa-miR-342-3p, hsa-miR-3648, 0.855156 1.5025 0.7525 0.75 combiAbMir hsa-miR-574-5p RAN, hsa-miR-122, hsa-miR-3648, hsa- 0.854219 1.5 0.75 0.75 combiAbMir miR-574-5 TPM1, HSPD1, hsa-miR-122, hsa-miR- 0.852969 1.5 0.75 0.75 combiAbMir 574-5p HSPD1, hsa-miR-342-3p, hsa-miR-3648, 0.850625 1.50625 0.75625 0.75 combiAbMir hsa-miR-574-5p TPM1, RAN, hsa-miR-122, hsa-miR-574- 0.848281 1.4975 0.7475 0.75 combiAbMir 5p TPM1, STUB1, hsa-miR-122, hsa-miR- 0.847813 1.509375 0.759375 0.75 combiAbMir 574-5p HSPD1, hsa-miR-122, hsa-miR-3648, 0.846719 1.496875 0.621875 0.875 combiAbMir hsa-miR-574-5p STUB1, hsa-miR-122, hsa-miR-3648, hsa- 0.841406 1.49875 0.74875 0.75 combiAbMir miR-574-5p HSPD1, RAN, hsa-miR-122, hsa-miR-574- 0.839531 1.470625 0.720625 0.75 combiAbMir 5p RAN, hsa-miR-122, hsa-miR-1224-5p, 0.837069 1.50375 0.75375 0.75 combiAbMir hsa-miR-574-5p HSPD1, hsa-miR-122, hsa-miR-1224-5p, 0.837188 1.4925 0.6175 0.875 combiAbMir hsa-miR-574-5p hsa-miR-122, hsa-miR-1224-5p, hsa-miR- 0.83 1.50 0.73 0.76 microarray 3648, hsa-miR-574-5p TPM1, HSPD1, RAN, hsa-miR-342-3p 0.832656 1.505 0.755 0.75 combiAbMir HSPD1, RAN, hsa-miR-3648, hsa-miR- 0.832656 1.440625 0.690625 0.75 combiAbMir 574-5p TPM1, RAN, hsa-miR-150, hsa-miR-342- 0.832188 1.486875 0.736875 0.75 combiAbMir 3p RAN, hsa-miR-1224-5p, hsa-miR-3648, 0.830625 1.468125 0.718125 0.75 combiAbMir hsa-miR-574-5p 0.828125 1.485 0.735 0 75 combiAbMir TPM1, RAN, hsa-miR-342-3p, hsa-miR- 3648 TPM1, STUB1, hsa-miR-3648, hsa-miR- 0.827969 1.476875 0.726875 0.75 combiAbMir 574-5p RAN, STUB1, hsa-miR-122, hsa-miR-574- 0.8275 1.470625 0.720625 0.75 combiAbMir 5p HSPD1, STUB1, hsa-miR-122, hsa-miR- 0.826563 1.470625 0.720625 0.75 combiAbMir 574-5p RAN, STUB1, hsa-miR-3648, hsa-miR- 0.823125 1.428125 0.678125 0.75 combiAbMir 574-5p TPMY, HSPD1, STUB1, hsa-miR-342-3p 0.822656 1.483125 0.733125 0.75 combiAbMir TPM1, hsa-miR-1224-5p, hsa-miR-3648, 0.822031 1.4675 0.7175 0.75 combiAbMir hsa-miR-574-5p TPM1, HSPD1, hsa-miR-122, hsa-miR- 0.821563 1.485625 0.735625 0.75 combiAbMir 342-3p TPM1, HSPD1, RAN, hsa-miR-150 0.818906 1.47375 0.84875 0.625 combiAbMir TPM1, HSPD1, hsa-miR-342-3p, hsa-miR- 0.817813 1.45375 0.70375 0.75 combiAbMir 3648 TPM1, HSPD1, hsa-miR-3648, hsa-miR- 0.817031 1.44375 0.81875 0.625 combiAbMir 574-5p TPM1, HSPD1, hsa-miR-150, hsa-miR- 0.815938 1.4775 0.7275 0.75 combiAbMir 342-3p TPM1, HSPD1, RAN, hsa-miR-574-5p 0.815 1.430625 0.805625 0.625 combiAbMir TPM1, HSPD1, STUB1, hsa-miR-574-5p 0.812656 1.433125 0.808125 0.625 combiAbMir HSPD1, RAN, hsa-miR-342-3p, hsa-miR- 0.810781 1.43875 0.68875 0.75 combiAbMir 3648 TPM1, HSPD1, hsa-miR-150, hsa-miR- 0.810625 1.455625 0.830625 0.625 combiAbMir 122 TPM1, RAN, STUB1, hsa-miR-150 0.810156 1.470625 0.845625 0.625 combiAbMir TPM1, RAN, hsa-miR-1224-5p, hsa-miR- 0.806094 1.44875 0.69875 0.75 combiAbMir 342-3p TPM1, RAN, hsa-miR-150, hsa-miR-1224- 0.805469 1.469375 0.844375 0.625 combiAbMir 5p RAN, hsa-miR-150, hsa-miR-342-3p, hsa- 0.805 1.424375 0.674375 0.75 combiAbMir miR-3648 TPM1, STUB1, hsa-miR-122, hsa-miR- 0.803438 1.449375 0.699375 0.75 combiAbMir 342-3p RAN, hsa-miR-150, hsa-miR-122, hsa- 0.802188 1.434375 0.559375 0.875 combiAbMir miR-342-3p STUB1, hsa-miR-122, hsa-miR-1224-5p, 0.801875 1.463125 0.713125 0.75 combiAbMir hsa-miR-574-5p HSPD1, RAN, hsa-miR-150, hsa-miR- 0.800781 1.4575 0.7075 0.75 combiAbMir 1224-5p TPM1, hsa-miR-122, hsa-miR-342-3p, 0.800781 1.434375 0.684375 0.75 combiAbMir hsa-miR-3648 TPM1, RAN, hsa-miR-1224-5p, hsa-miR- 0.8 1.42625 0.80125 0.625 combiAbMir 574-5p TPM1, HSPD1, hsa-mR-1224-5p, hsa- 0.799375 1.44375 0.69375 0.75 combiAbMir miR-342-3p TPM1, RAN, STUB1, hsa-miR-574-5p 0.798281 1.415 0.79 0.625 combiAbMir TPM1, HSPD1, hsa-miR-150, hsa-miR- 0.796875 1.45125 0.82625 0.625 combiAbMir 3648 HSPD1, RAN, hsa-miR-1224-5p, hsa-miR- 0.795938 1.43125 0.80625 0.625 combiAbMir 574-5p HSPD1, RAN, hsa-miR-150, hsa-miR-342- 0.795625 1.449375 0.574375 0.875 combiAbMir 3p TPM1, HSPD1, STUB1, hsa-miR-150 0.794844 1.44125 0.31625 0.625 combiAbMir HSPD1, hsa-miR-150, hsa-miR-342-3p, 0.79375 1.419375 0.669375 0.75 combiAbMir hsa-miR-3848 HSPD1, STUB1, hsa-miR-3648, hsa-miR- 0.792813 1.4025 0.7775 0.625 combiAbMir 574-5p HSPD1, hsa-miR-150, hsa-miR-122, hsa- 0.792656 1.426875 0.551875 0.875 combiAbMir miR-342-3p HSPD1, hsa-miR-1224-5p, hsa-miR-3648, 0.7925 1.416875 0.791875 0.625 combiAbMir hsa-miR-574-5p RAN, STUB1, hsa-miR-342-3p, hsa-miR- 0.7925 1.41125 0.66125 0.75 combiAbMir 3648 TPM1, RAN, hsa-miR-150, hsa-miR-3648 0.792344 1.4325 0.8075 0.825 combiAbMir HSPD1, RAN, STUB1, hsa-miR-574-5p 0.790938 1.400625 0.775625 0.625 combiAbMir TPM1, hsa-miR-150, hsa-miR-342-3p, 0.790469 1.405625 0.780625 0.625 combiAbMir hsa-miR-3848 TPM1, HSPD1, hsa-miR-150, hsa-miR- 0.790313 1.421875 0.796875 0.625 combiAbMir 1224-5p TPM1, HSPD1, hsa-miR-1224-5p, hsa- 0.790313 1.415625 0.790625 0.625 combiAbMir miR-574-5p HSPD1, STUB1, hsa-miR-150, hsa-miR- 0.790156 1.43125 0.68125 0.75 combiAbMir 342-3p HSPD1, RAN, STUB1, hsa-miR-342-3p 0.788438 1.424375 0.549375 0.875 combiAbMir TPM1, STUB1, hsa-miR-150, hsa-miR- 0.788281 1.41375 0.66375 0.75 combiAbMir 342-3p TPM1, hsa-miR-150, hsa-miR-1224-5p, 0.7875 1.406875 0.781875 0.625 combiAbMir hsa-miR-342-3p HSPD1, STUB1, hsa-miR-160.hsa-miR- 0.787031 1.435625 0.685625 0.75 combiAbMir 122 HSPD1, STUB1, hsa-miR-342-3p, hsa- 0.785938 1.414375 0.664375 0.75 combiAbMir miR-3648 RAN, hsa-miR-150, hsa-miR-1224-5p, 0.785313 1.42 0.545 0.875 combiAbMir hsa-miR-342-3p TPM1, STUB1, hsa-miR-342-3p, hsa-miR- 0.785313 1.40375 0.65375 0.75 combiAbMir 3648 HSPD1, hsa-miR-1224-5p, hsa-miR-342- 0.785156 1.410625 0.660625 0.75 combiAbMir 3p hsa-miR-3648 hsa-miR-150, hsa-miR-122, hsa-miR-342- 0.78 1.39 0.75 0.65 microarray 3p, hsa-miR-3648 TPM1, STUB1, hsa-miR-1224-5p, hsa- 0.783506 1.424375 0.674375 0.75 combiAbMir miR-342-3p STUB1, hsa-miR-1224-5p hsa-miR-3648, 0.78375 1.404375 0.654375 0.75 combiAbMir hsa-miR-574-5p HSPD1, hsa-miR-150, hsa-miR-122, hsa- 0.783281 1.419375 0.689375 0.75 combiAbMir miR-1224-5p hsa-miR-150, hsa-miR-1224-5p, hsa-miR- 0.78 1.40 0.75 0.65 microarray 342-3p, hsa-miR-3648 TPM1, STUB1, hsa-miR-1224-5p, hsa- 0.732188 1.43125 0.68125 0.75 combiAbMir miR-574-5p HSPD1, RAN, hsa-miR-1224-5p, hsa-miR- 0.702188 1.4275 0.5525 0.875 combiAbMir 342-3p TPM1, hsa-miR-150, hsa-miR-122, hsa- 0.782188 1.4075 0.6575 0.75 combiAbMir miR-342-3p HSPD1, RAN, hsa-miR-122, hsa-miR-342- 0.782188 1.405625 0.530625 0.875 combiAbMir 3p TPM1, RAN, hsa-miR-122, hsa-miR-342- 0.781875 1.418125 0.543125 0.875 combiAbMir 3p RAN, STUB1, hsa-miR-1224-5p, hsa-miR- 0.781719 1.413125 0.663125 0.75 combiAbMir 574-5p HSPD1, RAN, hsa-miR-150, hsa-miR- 0.781719 1.396875 0.771875 0.625 combiAbMir 3648 TPM1, hsa-miR-1224-5p, hsa-miR-342- 0.780938 1.39625 0.77125 0.625 combiAbMir 3p, hsa-miR-3648 RAN, STUB1, hsa-miR-1224-5p, hsa-miR- 0.780469 1.396875 0.648875 0.75 combiAbMir 342-3p TPM1, RAN, STUB1, hsa-miR-342-3p 0.780313 1.408125 0.658125 0.75 combiAbMir RAN, hsa-miR-122, hsa-miR-342-3p, hsa- 0.779063 1.37625 0.75125 0.625 combiAbMir miR-3648 0.778125 1.40125 0.65125 0.75 combiAbMir HSPD1, STUBI, hsa-miR-150 hsa-miR- 1224-5p TPM1, hsa-miR-122, hsa-miR-1224-5p, 0.777969 1.409375 0.650375 0.75 combiAbMir hsa-miR-342-3p HSPD1, RAN, hsa-miR-150, hsa-miR-122 0.777188 1.395 0.77 0.625 combiAbMir HSPD1, hsa-miR-150, hsa-miR-1224-5p, 0.778875 1.395625 0.645825 0.75 combiAbMir hsa-miR-342-3p TPM1, hsa-miR-150, hsa-miR-1224-5p, 0.773281 1.415625 0.790625 0.625 combiAbMir hsa-miR-3648 RAN, hsa-miR-122, hsa-miR-1224-5p, 0.772344 1.40625 0.53125 0.875 combiAbMir hsa-miR-342-3p HSPD1, RAN, STUB1, hsa-miR-150 0.772344 1.384375 0.634375 0.75 combiAbMir HSPD1, STUB1, hsa-miR-122, hsa-miR- 0.772188 1.381875 0.506875 0.875 combiAbMir 342-3p TPM1, STUB1, hsa-miR-150, hsa-miR- 0.770469 1.426875 0.801875 0.625 combiAbMir 122 HSPD1, hsa-miR-122, hsa-miR-342-3p, 0.770156 1.370625 0.620625 0.75 combiAbMir hsa-miR-3848 RAN, hsa-miR-1224-5p, hsa-miR-342-3p, 0.769688 1.38125 0.75625 0.625 combiAbMir hsa-miR-3648 RAN, hsa-mR-150, hsa-miR-1224-5p, 0.769063 1.37375 0.74875 0.625 combiAbMir hsa-miR-3648 hsa-miR-150, hsa-miR-122, hsa-miR- 0.77 1.38 0.62 0.76 microarray 1224-5p, hsa-miR-342-3p TPM1, hsa-miR-150, hsa-miR-122, hsa- 0.76875 1.40625 0.78125 0.625 combiAbMir miR-1224-5p HSPD1, STUB1, hsa-miR-1224-5p, hsa- 0.768125 1.398125 0 523125 0.875 combiAbMir miR-342-3p RAN, STUB1, hsa-miR-122, hsa-miR-342- 0.767969 1.37875 0.62875 0.75 combiAbMir 3p HSPD1, hsa-miR-150, hsa-miR-122, hsa- 0.767344 1.37625 0.75125 0.625 combiAbMir miR-3648 HSPD1, STUB1, hsa-miR-1224-5p, hsa- 0.766094 1.378125 0.628125 0.75 combiAbMir miR-574-5p TPM1, RAN, hsa-miR-150, hsa-miR-122 0.765938 1.405 0.78 0.625 combiAbMir TPM1, STUB1, hsa-miR-150, hsa-miR- 0.764219 1.415 0.79 0.625 combiAbMir 1224-5p HSPD1, hsa-miR-122, hsa-miR-1224-5p, 0.763594 1.37375 0.49875 0.875 combiAbMir hsa-miR-342-3p RAN, STUB1, hsa-miR-150, hsa-miR- 0.763281 1.385 0.76 0.625 combiAbMir 1224-5p HSPD1, hsa-miR-150, hsa-miR-1224-5p, 0.758438 1.37 0.745 0.625 combiAbMir hsa-miR-3648 RAN, STUB1, hsa-miR-150, hsa-miR-342- 0.757813 1.376875 0.501875 0.875 combiAbMir 3p STUB1, hsa-miR-122, hsa-miR-1224-5p, 0.757344 1.351875 0.601875 0.75 combiAbMir hsa-miR-342-3p RAN, STUB1, hsa-miR-150, hsa-miR- 0.755781 1.373125 0.748125 0.625 combiAbMir 3648 hsa-miR-122, hsa-miR-1224-5p, hsa-miR- 0.76 1.35 0.66 0.71 microarray 342-3p, hsa-miR-3848 TPM1, STUB1, hsa-mR-150, hsa-miR- 0.755469 1.3925 0.7675 0.625 combiAbMir 3648 RAN, hsa-miR-150, hsa-miR-122, hsa- 0.753594 1.35125 0.72625 0.625 combiAbMir miR-1224-5 TPM1, hsa-miR-150, hsa-miR-122, hsa- 0.753438 1.37625 0.75125 0.625 combiAbMir miR-3648 RAN, STUB1, hsa-miR-150, hsa-miR-122 0.7525 1.355 0.73 0.625 combiAbMir STUB1, hsa-miR-122, hsa-miR-342-3p, 0.7525 1.34375 0.59375 0.75 combiAbMir hsa-miR-3648 STUB1, hsa-miR-150, hsa-miR-122, hsa- 0.75125 1.35375 0.60375 0.75 combiAbMir miR-342-3p STUB1, hsa-miR-150, hsa-miR-1224-5p, 0.749688 1.34625 0.47125 0.875 combiAbMir hsa-miR-342-3p HSPD1, STUB1, hsa-miR-150, hsa-miR- 0.74875 1.3525 0.7275 0.625 combiAbMir 3648 STUB1, hsa-miR-150, hsa-miR-122, hsa- 0.74875 1.34375 0.71875 0.625 combiAbMir miR-3648 STUB1, hsa-miR-1224-5p, hsa-miR-342- 0.746406 1.344375 0.719375 0.625 combiAbMir 3p, hsa-miR-3648 STUB1, hsa-miR-150, hsa-miR-342-3p, 0.742969 1.3325 0.5825 0.75 combiAbMir hsa-miR-3648 RAN, hsa-miR-150, hsa-miR-122, hsa- 0.740938 1.323125 0.698125 0.625 combiAbMir miR-3648 hsa-miR-150, hsa-miR-122, hsa-miR- 0.74 1.32 0.68 0.65 microarray 1224-Sp, hsa-miR-3648 STUB1, hsa-miR-150, hsa-miR-122, hsa- 0.736719 1,325 0.575 0.75 combiAbMir miR-1224-5p STUB1, hsa-miR-150, hsa-miR-1224-5p, 0.730313 1.31375 0.68875 0.625 combiAbMir hsa-miR-3648 hsa-miR-150, hsa-miR-122, hsa-miR- 0.73 1.30 0.45 0.85 qPCR 3663-5p, hsa-miR-3194-5p hsa-miR-150, hsa-miR-122, hsa-miR-342- 0.72 1.31' 0.47 0 85 qPCR 3p, hsa-miR-3663-5p hsa-miR-150, hsa-miR-342-3p, hsa-miR- 0.72 1.31 0.61 0.69 QPCR 3663-5p, hsa-miR-3194-5p TPM1, RAN, hsa-miR-122, hsa-miR-3648 0.720156 1.309375 0.809375 0.5 combiAbMir TPM1, HSPD1, RAN, hsa-miR-122 0.718438 1.318125 0.693125 0.625 combiAbMir TPM1, HSPD1, RAN, hsa-miR-3648 0.715469 1.28125 0.78125 0.5 combiAbMir TPM1, RAN, hsa-miR-1224-5p, hsa-miR- 0.710156 1.280625 0.780625 0.5 combiAbMir 3648 TPM1, hsa-miR-122, hsa-miR-1224-5p, 0.709063 1.27875 0.77875 0.5 combiAbMir hsa-miR-3648 hsa-miR-122, hsa-miR-342-3p, hsa-miR- 0.71 1.29 0.60 0.69 qPCR 3663-5p, hsa-miR-3194-5p TPM1, HSPD1, STUB1, hsa-miR-3648 0.704531 1.27625 0.77625 0.5 combiAbMir TPM1, HSPD1, hsa-miR-122, hsa-miR- 0.6875 1.283125 0.658125 0.625 combiAbMir 3648 TPM1, HSPD1, STUB1, hsa-miR-122 0.896719 1.298125 0.673125 0.825 combiAbMir HSPD1, RAN, hsa-miR-122, hsa-miR- 0.692656 1 270625 0.770625 0.5 combiAbMir 3648 TPM1, HSPD1, hsa-miR-1224-5p, hsa- 0.688281 1.25875 0.75875 0.5 combiAbMir miR-3648 TPM1, STUB1, hsa-miR-122, hsa-miR- 0.887656 1.269375 0.769375 0.5 combiAbMir 3648 TPM1, HSPD1, RAN, STUB1 0.69 1.28 0.83 0.44 autoAb TPM1, HSPD1, hsa-miR-122, hsa-miR- 0.684063 1.28625 0.66125 0.625 combiAbMir 1224-5p HSPD1, RAN, hsa-miR-1224-5p, hsa-miR- 0.682656 1.234375 0.734375 0.5 combiAbMir 3648 TPM1, HSPD1, STUB1, hsa-miR-1224-5p 0.682344 1.28625 0.78625 0.5 combiAbMir TPM1, RAN, STUB1, hsa-miR-3648 0.68 1.25 0.75 0.5 combiAbMir HSPD1, STUB1, hsa-miR-122, hsa-miR- 0.678125 1.249375 0.749375 0.5 combiAbMir 3648 RAN, STUB1, hsa-miR-122, hsa-miR- 0.669531 1.255 0.755 0.5 combiAbMir 3648 TPM1, RAN, STUB1, hsa-miR-122 0.689219 1.273125 0.773125 0.5 combiAbMir HSPD1, RAN, STUB1, hsa-miR-3848 0.869063 1.235 0.86 0.375 combiAbMir STUB1, hsa-miR-122, hsa-miR-1224-5p, 0.66875 1.234375 0.734375 0.5 combiAbMir hsa-miR-3648 TPM1, HSPD1, RAN, hsa-miR-1224-5p 0.666094 1.2425 0.7425 0.5 combiAbMir HSPD1, RAN, STUB1, hsa-miR-122 0.663281 1.2375 0.7375 0.5 combiAbMir TPM1, STUB1, hsa-miR-1224-5p, hsa- 0.66125 1.2 0.7 0.5 combiAbMir miR-3648 TPM1, STUB1, hsa-miR-122, hsa-miR- 0.8575 1.270625 0.770625 0.5 combiAbMir 1224-5p TPM1, RAN, hsa-miR-122, hsa-miR-1224- 0.651406 1.221875 0.596875 0.625 combiAbMir 5p HSPD1, hsa-miR-122, hsa-miR-1224-5p 0.849219 1.1925 0.8175 0.375 combiAbMir hsa-miR-3648 hsa-miR-150, hsa-miR-122, hsa-miR-342- 0.65 1.25 0.41 0.85 QPCR 3p, hsa-miR-3194-5p HSPD1, STUB1, hsa-miR-122, hsa-miR- 0.642031 1.19375 0.56875 0.625 combiAbMir 1224-5p HSPD1, STUB1, hsa-miR-1224-5p, hsa- 0.63125 1.16625 0.79125 0.375 combiAbMir miR-3648 HSPD1, RAN, hsa-miR-122, hsa-miR- 0.628438 1.1475 0.6475 0.5 combiAbMir 1224-5p RAN, STUB1, hsa-mR-1224-5p, hsa-miR- 0.622656 1.210625 0.835625 0.375 combiAbMir 3648 HSPD1, RAN, STUB1, hsa-miR-1224-5p 0.618906 1.156875 0.701875 0.375 combiAbMir RAN, hsa-miR-122, hsa-miR-1224-5p, 0.617656 1.18 0.805 0.375 combiAbMir hsa-miR-3648 TPM1, RAN, STUB1, hsa-miR-1224-5p 0.614531 1.1775 0.8025 0.375 combiAbMir RAN, STUB1, hsa-miR-122, hsa-miR- 0.603125 1.141875 0.516875 0.625 combiAbMir 1224-5p
TABLE-US-00014 TABLE 14 (5-mers) S + Sensitivity Specificity Panel AUC S (i) (ii) (iii) Assay (iv) hsa-miR-150, hsa-miR-122, hsa-miR-1224-5p, 0.90 1.59 0.77 0.82 microarray hsa-miR-342-3p, hsa-miR-574-5p hsa-miR-150, hsa-miR-122, hsa-miR-342-3p, 0.89 1.57 0.80 0.76 microarray hsa-miR-3648, hsa-miR-574-5p hsa-miR-150, hsa-miR-122, hsa-miR-1224-5p, 0.88 1.57 0.80 0.76 microarray hsa-miR-3648, hsa-miR-574-5p hsa-miR-122, hsa-miR-1224-5p, hsa-miR-342- 0.88 1.57 0.81 0.76 micrarray 3p, hsa-miR-3648, hsa-miR-574-5p hsa-miR-150, hsa-miR-1224-5p, hsa-miR-342- 0.88 1.56 0.80 0.76 microarray 3p, hsa-miR-3648, hsa-miR-574-5p hsa-miR-150, hsa-miR-122, hsa-miR-1224-5p, 0.77 1.38 0.73 0.65 microarray hsa-miR-342-3p, hsa-miR-3648 hsa-miR-150, hsa-miR-122, hsa-miR-342-3p, 0.71 1.28 0.44 0.85 qPCR hsa-miR-3663-5p, hsa-miR-3194-5p
TABLE-US-00015 TABLE 15 (6-mers) S + Sensitivity Specificity Assay Panel AUC S (i) (ii) (iii) (iv) hsa-miR-150, hsa-miR-122, hsa-miR-1224- 0.89 1.58 0.81 0.76 microarray 5p, hsa-miR-342-3p, hsa-miR-3648, hsa-miR-574-5
TABLE-US-00016 TABLE 16 The levels of expression of the following 2 miRNAS are significantly different in ES samples compared to that in OvES, NE and NP samples in Study 2 (area A in FIG. 9), as determined in study 2: Expression in ES samples compared to that in OvES, NE miRNA and NP samples ebv-miR-BART2-5p Up hsa-miR-564 Down
TABLE-US-00017 TABLE 17 The levels of expression of the following miRNAS are significantly different in OvES samples compared to that in ES, NE and NP samples in Study 2 (area F in FIG. 9), as determined in study 2: Expression in OvES samples compared to that in ES, NE and miRNA NP samples hsa-let-7d-5p/3p Up hsa-miR-29a Down hsa-miR-142-3p Down hsa-miR-197 Up hsa-miR-215 Down hsa-miR-219-1-3p Up hsa-miR-296-3p Up hsa-miR-320c Down hsa-miR-337-5p Down hsa-miR-369-3p Down hsa-miR-450b-5p Down hsa-miR-483-5p Up hsa-miR-507 Down hsa-miR-517c/hsa-mR-519a Down hsa-miR-519d Up hsa-miR-520g Down hsa-miR-576-5p Up hsa-miR-577 Down hsa-miR-604 Up hsa-miR-610 Down hsa-miR-619 Down hsa-miR-1256 Down hsa-miR-1278 Down hsa-miR-1297 Down hcmv-miR-US33-5p Down hsv1-miR-H1-5p Up
TABLE-US-00018 TABLE 18 The level of expression of the following miRNA in OvES and ES samples is significantly different from that in NE and NP samples in Study 2 (area C in FIG. 9), as determined in study 2: Expression in OvES and ES samples compared to that in NE miRNA and NP samples hsa-miR-877 Down
TABLE-US-00019 TABLE 19 The levels of expression of the following miRNAs in OvES and NE samples are significantly different from that in ES and NP samples in Study 2 (area E in FIG. 9), as determined in study 2: Expression in OvES and NE samples compared to that in ES miRNA and NP samples hsa-let-7e-5p/3p Up hsa-let-7f Up hsa-let-7g Up hsa-miR-9 Up hsa-miR-30b Up hsa-miR-34a Up hsa-miR-92b Up hsa-miR-96-5p/3p Up hsa-miR-106a-5p/3p Up hsa-miR-17-5p/3p Up hsa-miR-106b-5p/3p Up hsa-miR-127-3p Up hsa-miR-128 Up hsa-miR-154 Up hsa-miR-155 Up hsa-miR-183-5p/3p Up hsa-miR-194 Up hsa-miR-196b-5p/3p Up hsa-miR-203 Up hsa-miR-204 Up hsa-miR-221-5p/3p Up hsa-miR-223 Up hsa-miR-376a Up hsa-miR-376c Up nsa-miR-377 Up hsa-miR-379 Up hsa-miR-423-3p Up hsa-miR-424-5p/3p Up hsa-miR-425-5p/3p Up hsa-miR-454-5p/3p Up hsa-miR-486-3p Up hsa-miR-509-3p Up hsa-miR-514 Up hsa-miR-542-3p Up hsa-miR-545-5p/3p Up hsa-miR-626 Up hsa-miR-630 Up hsa-miR-663 Up hsa-miR-720 Up hsa-miR-758-5p/3p Up hsa-miR-876-3p Up hsa-miR-1185 Up hsa-miR-1260 Up hsa-miR-1266-5/3 Up
TABLE-US-00020 TABLE 20 The levels of expression of the following miRNAs are significantly different in OvES, ES and NP samples compared to that in NE samples in Study 2 (area B in FIG. 9), as determined in study 2: Expression in OvES, ES and NP miRNA compared to that in NE samples hsa-miR-199a-3p Up hsa-miR-199b-3p Up hsa-miR-497 Up hsa-miR-625-5p/3p Up
TABLE-US-00021 TABLE 21 The levels of expression of the following miRNAs are significantly different in OvES, ES and NE samples compared to that in NP samples in Study 2 (area D in FIG. 9), as determined in study 2: Expression in OVES, ES and NE samples compared to that in NP miRNA samples hsa-miR-631 Up hsa-miR-635 Up [0313] [1] Strathy et al, Fertil Steril. 1982; 38(6):067-672. [0314] [2] Nnoaham et al, Fertil Steril. 2011; 96(2):366-373 e368. [0315] [3] Hadfield et al, Hum Reprod. 1996; 11(4):878-880. [0316] [4] Endometrioses Research Center. Understanding endometriosis: past present and future. The National women's health information council: 2005. [0317] [5] Nnoaham et al, Human Reproduction. 2010; 25(suppl 1):i9-i11. [0318] [6] Augoulea et al, Gynecol Endocrinol. 2009; 25(2):75-81. [0319] [7] Missmer S A & Cramer D W. Obstet Gynecol Clin North Am. 2003; 30(1):1-19, vii. [0320] [8] Moen M H & Schei B. Acts Obstet Gynecol Scand. 1997; 76(6):559-562. [0321] [9] Risk factors for pelvic endometriosis in women with pelvic pain or infertility. Gruppo Italiano per lo Studio dell′ endometriosi. Eur J Obstet Gynecol Reprod Biol. 1999; 83(2):195-199. [0322] [10] Missmer et al, Fertil Steril. 2004; 82(6):1501-1506. [0323] [11] Parazzini et al, J Epidemiol Community Health. 1995; 49(1):61-64. [0324] [12] Missmer et al, Obstet Gynecol. 2004:104(5 Pt 1)-965-974. [0325] [13] Moen M H & Magnus P. Acta Obstet Gynecol Scand. 1993; 72(7):560-564. [0326] [14] Moen M H. Acta Obstet Gynecol Scand. 1994; 73(1):59-62. [0327] [15] Vessey et a, BMJ. 1993; 308(8871):182-184. [0328] [16] Vitonis et al, Epidemiology. 2010; 21(1):16-23. [0329] [17] Sangi-Haghpeykar H & Poindexter A N, 3rd. Obstet Gynecol. 1995; 85(6):963-992. [0330] [18] Koninckx et al. Hum Reprod. 1994; 9(6):1001-1002. [0331] [19] Sinaii et al, Hum Reprod. 2002; 17(10):2715-2724. [0332] [20] Mataliotakis et al, J BUON. 2009; 14(4):699-701. [0333] [21] Kvaskoff M et al, Int J Epidemiol. 2009; 38(4):1143-1153. [0334] [22] Hornstein et al, Hum Reprod. 1997; 12(1):143-145. [0335] [23] Signorile et al, J Exp Clin Cancer Res. 200928:49. [0336] [24] Sanfillippo et al, Am J Obstet Gynecol. 1986; 154(1):39-43. [0337] [25] Simpson et al, Obstet Gynecol Clin North Am. 2003; 30(1):21-40, vi. [0338] [26] Cullen T S. Adenomyoma of the Uterus. W B Saunders. Philadelphia; 1908. [0339] [27] Levander G & Normann P. Acta Obstet Gynecol Scand. 1955; 34(4):366-398. [0340] [28] Javert C T. Cancer. 1949:2(3):399-410. [0341] [29] Sampson J A. Am J Pathol. 1927; 3(2):93-110 143. [0342] [30] Gargett C E. Hum Reprod Update. 2007; 13(1):87-101. [0343] [31] Donnez J et al, Obstet Gynecol Clin North Am. 2003; 30(1):83-93, viii. [0344] [32] Garai et al, Front Biosci. 2006; 11:595-619. [0345] [33] Noble et al, J Clin Endocrinol Metab. 1996; 81(1):174-179. [0346] [34] Taylor R N & Yu J, Torres P B, at al. Reprod Sci. 2009; 18(2):140-148. [0347] [35] Oosterlynck et al, Fertil Steril. 1991; 56(1):45-51. [0348] [36] Vinatiler et al, Eur J Obstet Gynecol Reprod Biol. 2001; 96(1):21-34. [0349] [37] Tabibzadeh et al, Hum Reprod. 1996; 11(3):633-640. [0350] [38] Lessey et al, J Clin Endocrinol Metab. 1994; 79(2):643-649. [0351] [39] Sharpe-Timms et al, Fertil Steril. 1998; 69(6):1128-1134. [0352] [40] McLaren et al, Hum Reprod. 1997; 12(6):1307-1310. [0353] [41] Al-Jefout et al. Hum Reprod. 2009; 24(12):3019-3024. [0354] [42] Kyama et al, Fertil Steril. 2011; 95(4):1338-1343 e1331-1333. [0355] [43] Kyama et al, Fertil Steril. 2006; 86(1):203-209. [0356] [44] Fassbender et al, Reprod Biol Endocrinol. 2010; 8:123. [0357] [45] Fassbender et al, Obstet Gynecol. 2012; 119(2 Pt 1):276-285. [0358] [46] Jing J. et al, Fertil Steril. 2009; 92(4):1221-1227. [0359] [47] Liu et al, Fertil Steril. 2007; 87(4):988-990. [0360] [48] Seeber et al, Fertil Steril. 2010; 93(7):2137-2144. [0361] [49] Wolfier et al, Fertil Steril. 2009; 91(6):2331-2337. [0362] [50] Zhang et al, Chin Med J (Engl). 2009; 122(4):373-376. [0363] [51] Pappworth et al. (2009) Mol Immunol 46:1042-9. [0364] [52] Guerra et al (2012) Arthritis Res Ther. 29:14(3):21 [0365] [53] Vanderlugt & Miller (1996) CurrOpinImmunol. 8:831-6. [0366] [54] Cheung et al (2000) Nucleic Acids Res. 28(1):361-3, http://alfred.med.yale.edu/alfred/ [0367] [55] McKusick (1998) Mendelian Inheritance in Man. A Catalog of Human Genes and Genetic Disorders. Baltimore: Johns Hopkins University Press. 1998 (12th edition). See also http://wwvw.ncbi.nlm.nih.gov/omim/. [0368] [56] Stenson et al. (2009) Genome Med 1:13. [0369] [57] Stamm et al. (2006) Nucleic Acids Res 34: D46-D55. [0370] [58] Griffiths-Jones (2004) Nucleic Acid Res 32 (Database Issue):D109-11. [0371] [59] Griffiths-Jones et al. (2006) Nucleic Acid Res 34 (Database Issue):D140-4. [0372] [60] Griffiths-Jones et al. (2008) Nucleic Acid Res 36 (Database Issue):D154-8. [0373] [61] Kozomara & Griffiths-Jones (2011) Nucleic Acid Res 39 (Database Issue):D152-7. http://www.mirbase.org/ [0374] [62] Maragkakis et al. (2009) Nucleic Acid Res 37 (Web Server Issue):W273-6. [0375] [63] Maragkakis of al. (2011) Nucleic Acid Res 39 (Web Server Issue):W145-8. http://diana.cslab.ece.ntua.gr/DianaTools/index.php?r=microtv4/index [0376] [64] Betel et al. (2008) Nucleic Acid Res 36 (Database Issue):D149-53. http://www.microma.org/microma/home.do [0377] [65] Wang & EI Naqa (2008) Bioinformatics 24:325-32. [0378] [66] Wang (2008) RNA 14:1012-7. http://mirdb.org/miRDB/index.html [0379] [67] Grimson et al. (2007) Mol Cell 27:91-105. http://www.targetscan.org/vert_50/ [0380] [68] Krek et al. (2005) Nat Genet 37:495-500. http://pictar.mdor-berlin.de/cgi-bin/PicTar_vertebrate.cgi [0381] [69] Geysen et al. (1984) PNAS USA 81:3998-4002. [0382] [70] Carter (1994) Methods Mol Biol 36:207-23. [0383] [71] Jameson, B A et al. 1988, CABIOS 4(1):181-186. [0384] [72] Maksyutov & Zagrebelnaya (1993) Comput Appl Biosci 9(3):291-7. [0385] [73] Hopp (1993) Peptide Research 6:183-190. [0386] [74] Welling et al. (1985) FEBS Left. 188:215-218. [0387] [75] Bublil et at (2007) Proteins 68(1):294-304. [0388] [76] Sun t al. (2009) Nucleic Acids Res 37:W612-6. [0389] [77] Raddrizzani & Hammer (2000) Brief Bioinform 1(2):179-89. [0390] [78] Chen et at (2007) Amino Acids 33(3):423-8. [0391] [79] Reimer (2009) Methods Mol Biol 524:335-44. [0392] [80] Boutell et at (2004) Proteomics 4:1950-8. [0393] [81] Tassinari et alt (2008) Curr Opin Mol Thor 10:107-15. [0394] [82] Stoevesandt et al (2009) Expert Rev Proteomics 6:145-57. [0395] [83] Tao et at (2007) Comb Chem High Throughput Screen 10:706-18. [0396] [84] Gnjatic et al. (2009) J Immunol Methods 341:50-8. [0397] [85] Hartmann et al (2009) Anal Bioanal Chem 393:1407-16. [0398] [86] Fall & Niessner (2009) Methods Mot Biol 509:107-22. [0399] [87] WO01/57198. [0400] [88] WO02/27327. [0401] [89] Blackburn & Hart (2005) Methods Mol Biol 310:197-216 [0402] [90] WO03/064656. [0403] [91] WO2004/046730. [0404] [92] Stahl et al. (2006) Immunol Lett 102:50-9. [0405] [93] Quintana (2008) PNAS USA 105:18889-94. [0406] [94] Koopmann & Blackburn (2003) Rapid Commun Mass Spectrom. 17:455-62. [0407] [95] WO01/61040. [0408] [96] Oleinikov et al (2003) J Proteome Res. 2:313-9. [0409] [97] Bolstad et a. (2003) Bioinformatics 19:185-93. [0410] [98] Meyer et at (2003) Neurocomputing 55:169-86. [0411] [99] Koza (1992), Genetic Programming: On the Programming of Computers by Means of Natural Selection, MIT Press. [0412] [100] Wang & Japkowicz (2008) Lecture Notes in Computer Science 4994/2008, 38-47. [0413] [101] Elkon & Casali (2008) Nat Clin Pract Rheumatol 4(9):491-8. [0414] [102] Dudoit, 8, et al. (2002) Statistica Sinica 12, 111-139 [0415] Yang, Y H, at al. Normalization for Two-color cDNA Microarray Data. Science and Statistics: A Festschrilt for Terry Speed, Monograph Series. [0416] [104] Yang, Y H et al. in Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. [0417] [105] Chada at al. (2003) CurrOpin Drug DiscovDevel. 6(2):169-73. [0418] [106] Chène (2003) Nature Reviews Cancer 3, 102-109. [0419] [107] Wang & EI-Deiry (2008) CurrOpinOncol. 20(1):90-4. [0420] [108] Gleave & Monia (2005) Nat Rev Cancer 5:468-79. [0421] [109] Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987) Supplement 30 [0422] [110] Smith & Waterman (1981) Adv. Appl. Math. 2: 482-489. [0423] [111] Boutell et al. (2004) Proteomics 4:1950-8. [0424] [112] Gnjatic at al. (2009) J Immunol Methods 341:50-8. [0425] [113] Bolstad et al. (2003) Bioinformatics 19:185-93. [0426] [114] Huber et al. (2002) Bioinformatics 18 suppl. 1 S96-S104. [0427] [115] Pradervand et al. (2010) Biotechniques 48:219-22. [0428] [116] WO93122480. [0429] [117] WO03/020415. [0430] [118] WO2005/037425