Hexokinase 1 isoform B for use as a prognosis marker and specific target against cancer
12578339 ยท 2026-03-17
Inventors
Cpc classification
G01N33/5758
PHYSICS
G01N2500/04
PHYSICS
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Disclosed is an isoform of hexokinase 1 (HK1), namely hexokinase 1b (HK1b), for use as a prognosis marker and as a specific target for use in treatment of cancer.
Claims
1. Double stranded molecules for inhibiting the expression of HK1b isoform when introduced in a cell, comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence corresponding to SEQ ID No:1 and an antisense strand comprises a nucleotide sequence corresponding to SEQ ID No:4, wherein the sense strand comprises a nucleotide sequence corresponding to SEQ ID No:2 and an antisense strand comprises a nucleotide sequence corresponding to SEQ ID No:5, or wherein the sense strand comprises a nucleotide sequence corresponding to SEQ ID No:3 and an antisense strand comprises a nucleotide sequence corresponding to SEQ ID No:6.
2. A double stranded molecule according to claim 1 for use as a medicament.
3. A double stranded molecule according to claim 1 for use in prophylaxis and/or treatment of cancer.
4. A double stranded molecule according to claim 1 in combination with a chemotherapy agent selected from a group comprising cisplatin, carboplatin, oxaliplatin for use in prophylaxis and/or treatment of cancer.
5. A pharmaceutical composition comprising a double stranded molecule according to claim 1 and at least one pharmaceutically acceptable excipient.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
DETAILED DESCRIPTION OF THE INVENTION
(21) An embodiment of the invention is a method to detect or diagnose cancer in a subject, said method comprising determining en expression level of HK1b isoform in a subject derived biological sample, wherein an increase of said level compared to normal control level of said isoform indicates that said subject suffers from developing cancer, wherein the expression level is determined by immunoblotting followed by quantification of the band intensities with densitometry. Densitometry methods are well known for a person skilled in the art, for example for densitometry a software such as ImageJ or Quantity One can be used.
(22) In a preferred embodiment, at least 10% or more increase in the expression level of HK1b isoform in a subject derived sample is considered as an increased level.
(23) In a preferred embodiment, a subject derived biological sample comprises a biopsy specimen, saliva, sputum, blood, serum, plasma, pleural effusion or urine.
(24) In a preferred embodiment, cancer is NSCLC.
(25) Another embodiment of the invention is a method of screening for a candidate substance for use in treatment of cancer or the inhibition of cell growth (Method 1) said method comprising the steps of: (a) contacting a test substance with HK1b isoform (SEQ ID No: 7 and SEQ ID No:8) or functional equivalent thereof; (b) detecting the binding activity between the HK1b isoform (SEQ ID No: 7 and SEQ ID No:8) or functional equivalent thereof and the test substance; and (c) selecting the test substance that binds to the HK1b isoform (SEQ ID No: 7 and SEQ ID No:8) or functional equivalent thereof.
(26) Another embodiment of the invention is a method of screening for a candidate substance for use in treatment of cancer or the inhibition of cell growth (Method 2) said method comprising the steps of: (a) contacting a test substance with HK1b isoform (SEQ ID No: 7 and SEQ ID No:8) or functional equivalent thereof; (b) detecting the biological activity of the HK1b isoform (SEQ ID No: 7 and SEQ ID No:8) or functional equivalent thereof in (a); and (c) selecting the test substance that suppresses the biological activity of HK1b isoform (SEQ ID No: 7 and SEQ ID No:8) or functional equivalent thereof in comparison with the biological activity detected in the absence of the test substance.
(27) In Method 2 of the invention the biological activity is glycolysis.
(28) In another embodiment, the present invention relates to double stranded molecules comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence corresponding to SEQ ID No:1 and an antisense strand comprises a nucleotide sequence corresponding to SEQ ID No:4, wherein said sense strand and antisense strand hybridize to each other to form a double stranded molecule and wherein the said double stranded molecule, when introduced into a cell expressing HK1b isoform, inhibits the expression of HK1b isoform.
(29) In another embodiment, the present invention relates to double stranded molecules comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence corresponding to SEQ ID No:2 and an antisense strand comprises a nucleotide sequence corresponding to SEQ ID No:5, wherein said sense strand and antisense strand hybridize to each other to form a double stranded molecule and wherein the said double stranded molecule, when introduced into a cell expressing HK1b isoform, inhibits the expression of HK1b isoform.
(30) In another embodiment, the present invention relates to double stranded molecules comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence corresponding to SEQ ID No:3 and an antisense strand comprises a nucleotide sequence corresponding to SEQ ID No:6, wherein said sense strand and antisense strand hybridize to each other to form a double stranded molecule and wherein the said double stranded molecule, when introduced into a cell expressing HK1b isoform, inhibits the expression of HK1b isoform.
(31) A method for prophylaxis and/or treatment of cancer in a subject said method comprises administering to said subject a pharmaceutically effective amount of a double-stranded molecule against HK1b isoform.
(32) An embodiment of the invention relates to a double stranded molecule comprising a sense strand of SEQ ID No:1 and an antisense strand of SEQ ID no: 4 for use as a medicament, preferably for use in prophylaxis and/or treatment of cancer.
(33) An embodiment of the invention relates to a double stranded molecule comprising a sense strand of SEQ ID No:2 and an antisense strand of SEQ ID no: 5 for use as a medicament, preferably for use in prophylaxis and/or treatment of cancer.
(34) An embodiment of the invention relates to a double stranded molecule comprising a sense strand of SEQ ID No:3 and an antisense strand of SEQ ID no:6 for use as a medicament, preferably for use in prophylaxis and/or treatment of cancer.
(35) A method for prophylaxis and/or treatment of cancer in a subject said method comprises administering to the subject a pharmaceutically effective amount of a double-stranded molecule against HK1b isoform in combination with a chemotherapy agent selected from a group comprising cisplatin, carboplatin, oxaliplatin.
(36) Another embodiment of the invention relates to a pharmaceutical composition comprising; a double stranded molecule comprising a sense strand of SEQ ID No:1 and an antisense strand of SEQ ID no: 4 or a double stranded molecule comprising a sense strand of SEQ ID No:2 and an antisense strand of SEQ ID no: 5 or a double stranded molecule comprising a sense strand of SEQ ID No:3 and an antisense strand of SEQ ID no:6 and at least one pharmaceutically acceptable excipient wherein the double stranded molecule inhibits glycolysis and the expression of HK1b isoform when introduced into a cell expressing HK1b isoform.
Definitions
(37) The words a, an, and the as used herein mean at least one unless otherwise specifically indicated.
(38) The term amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that similarly functions to the naturally occurring amino acids.
(39) Amino acids may be referred to herein by their commonly known three letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
(40) The terms gene, polynucleotides, oligonucleotide, nucleic acids, and nucleic acid molecules are used interchangeably unless otherwise specifically indicated and, similarly to the amino acids, are referred to by their commonly accepted single-letter codes. Similar to the amino acids, they encompass both naturally-occurring and non-naturally occurring nucleic acid polymers. The polynucleotide, oligonucleotide, nucleotides, nucleic acids, or nucleic acid molecules may be composed of DNA, RNA or a combination thereof.
(41) In the context of the present invention, the phrase HK1b isoform encompasses polynucleotides that encode human HK1b isoform or any of the functional equivalents of the human HK1b isoform. In the present invention the HK1b isoform or a functional equivalent thereof can be obtained from nature as naturally occurring proteins via conventional cloning methods or through chemical synthesis based on the selected nucleotide sequence (e.g. SEQ ID No: 7 and SEQ ID No:8)
(42) The terms isolated or purified used in relation to a substance (e.g., polypeptide, antibody, polynucleotide, etc.) indicate that the substance is removed from its original environment (e.g., the natural environment if naturally occurring) and thus altered from its natural state.
(43) An isolated or purified antibody refers to antibodies that are substantially free of cellular material for example, carbohydrate, lipid, or other contaminating proteins from the cell or tissue source from which the protein (antibody) is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized.
(44) As used herein, the term biological sample refers to a whole organism or a subset of its tissues, cells or component parts (e.g., body fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen). Biological sample further refers to a homogenate, lysate, extract, cell culture or tissue culture prepared from a whole organism or a subset of its cells, tissues or component parts, or a fraction or portion thereof. Lastly, biological sample refers to a medium, for example, a nutrient broth or gel in which an organism has been propagated, which contains cellular components, for example, proteins or polynucleotides. In the context of the present invention, a biological sample may preferably contain tissues or cells extracted from the lung, cervix, bladder, esophagus, or prostate, or an osteosarcoma or soft tissue tumor.
(45) Unless otherwise defined, the term cancer refers to cancers over-expressing the HK1b isoform.
(46) Herein the term prophylaxis refers to to any activity that reduces the burden of mortality or morbidity from disease. Prophylaxis encompass activities aimed at the prevention and prophylaxis of the progression of a disease and the emergence of symptoms as well as reducing the negative impact of an already established disease by restoring function and reducing disease-related complications. Alternatively, prevention and prophylaxis can include a wide range of prophylactic therapies aimed at alleviating the severity of the particular disorder, e.g. reducing the proliferation and metastasis of tumors.
(47) To the extent that certain embodiments of the present invention encompass the treatment and/or prophylaxis of cancer and/or the prevention of postoperative recurrence, such methods may include any of the following steps: the surgical removal of cancer cells, the inhibition of the growth of cancerous cells, the involution or regression of a tumor, the induction of remission and suppression of occurrence of cancer, the tumor regression, and the reduction or inhibition of metastasis. Effective treatment and/or the prophylaxis of cancer decreases mortality and improves the prognosis of individuals having cancer, decreases the levels of tumor markers in the blood, and alleviates detectable symptoms accompanying cancer. A treatment may also deemed efficacious if it leads to clinical benefit such as, reduction in expression of the HK1b isoform, or a decrease in size, prevalence, or metastatic potential of the cancer in the subject.
(48) In an aspect, a sense strand of a double helix molecule named as SEQ ID No:1 has the following sequence; AAGCGAUUUAAAGCGAGCGGAUU.
(49) In an aspect, a sense strand of a double helix molecule named as SEQ ID No:2 has the following sequence; AAAGCGAUUUAAAGCGAGCGGUU.
(50) In an aspect, a sense strand of a double helix molecule named as SEQ ID No:3 has the following sequence; GCGAUUUAAAGCGAGCGGAGUU.
(51) In an aspect, an antisense strand of a double helix molecule named as SEQ ID No:4 has the following sequence; UCCGCUCGCUUUAAAUCGCUUUU.
(52) In an aspect, an antisense strand of a double helix molecule named as SEQ ID No:5 has the following sequence; CCGCUCGCUUUAAAUCGCUUUUU.
(53) In an aspect, an antisense strand of a double helix molecule named as SEQ ID No:6 has the following sequence; AAAGCGAUUUAAAGCGAGCGGUU.
(54) In an aspect, a sense strand of a HK1b isoform, which is a double helix molecule, named as SEQ ID No:7 has the following amino acid sequence; GCGATTTAAAGCGAGCGGAG.
(55) In an aspect, an antisense strand of a HK1b isoform, which is a double helix molecule, named as SEQ ID No:8 has the following amino acid sequence; CTCCGCTCGCTTTAAATCGC.
(56) The invention will now be described with the following examples given purely as a means for exemplifying the scope of the present invention, therefore it is to be understood that the present invention is not limited to the particular sizes, shapes, dimensions, materials, methodologies, protocols, etc. described herein, as these may vary in accordance with routine experimentation and optimization.
(57) It is also to be understood that the terminology used in the description is for the purpose of describing the particular versions or embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.
(58) The disclosure of each publication, patent or patent application mentioned in this specification is specifically incorporated by reference herein in its entirety. However, nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
(59) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below.
(60) In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
Examples
1) Materials and Method
(61) a) Cell Culture and Treatment
(62) Human non-small cell lung cancer (NSCLC) cell lines, including A549, H1299, were obtained from Dr. Engin Ulukaya's laboratory (University of Istinye) and propagated in monolayer culture in RPMI 1640 supplemented with 10% FBS, 1% penicillin-streptomycin, and 1% L-glutamine. All cells were maintained in a humidified atmosphere containing 5% CO.sub.2 at 37 C. All cell lines were tested for Mycoplasma routinely every 3 months using MycoProbe Mycoplasma Detection Kit (R&D Systems). All cell lines were used between 10 passages window.
(63) B) Gene Knockout and Knockdown in Lung Cancer Cells
(64) A549-HK1b isoform-knockout cells were generated by using the CRISPR/Cas9 genome editing system. Briefly, the sgRNAs specific for HK1b isoform only was designed to target the eighth exon of human HK1 gene. pX458 vector with GFP selection marker from addgene, as described previously [19], was used to deliver Cas9 and a sgRNA targeting HK1b (namely sgHK1b) into the target cells.
(65) The CRISPR guide sequences targeting HK1b were;
(66) TABLE-US-00001 sense:GCGATTTAAAGCGAGCGGAG antisense:CTCCGCTCGCTTTAAATCGC
(67) The expression of GFP sorted single-cell clones expressing sgHK1b were screened for p53 or HK1b isoform elimination and specific indel mutations at target loci was confirmed with PCR, DNA fragmentation analyses, and Sanger sequencing.
(68) For siRNA-mediated gene knockdown, three different siRNA oligos targeting the HK1b were designed to target the eighth exon of human HK1 gene as follows:
(69) TABLE-US-00002 siRNA#1 sense:AAGCGAUUUAAAGCGAGCGGAUU antisense:UCCGCUCGCUUUAAAUCGCUUUU siRNA#2 sense:AAAGCGAUUUAAAGCGAGCGGUU antisense:CCGCUCGCUUUAAAUCGCUUUUU siCRISPR(siRNA#3) sense:GCGAUUUAAAGCGAGCGGAGUU antisense:CUCCGCUCGCUUUAAAUCGCUU
(70) For functional ablation experiments, equal number of cells (110.sup.5) was plated and for the transient knockdown, cells were transfected with siRNA duplexes by a reverse transfection method using Lipofectoamine RNAiMAX (Life Technologies). Cells were harvested 48 hours later for qRT-PCR for transcriptional analyzing.
(71) C) Patient Tissue Collection and Immunohistochemical Staining
(72) This study was approved by the Ethics Committee of Istanbul Medipol University. 18 cases of clinically and immunohistologically verified NSCLC primary tumor and normal lung tissues were collected from affiliated hospital of Istanbul Medipol University (Istanbul, Turkey), and were agreed by all patients. The patients' attributes are shown in Table 1. The sections were stained with indicated antibodies, and staining of HK1, p53, and Ki-67 was scored pathologists based on the percentage of positive cells and staining intensity. Patients' clinical characteristics are listed in Table 1.
(73) TABLE-US-00003 Patient Gender Used in # Age (Years) Histological type Grade Stage p53 experiment 1 Male 64 ADC 2 pT2aN1 pozitif (%95) WB 2 Male 67 ADC 3 pT3N0 negatif (%1) WB 3 Female 75 ADC 2 pT1bN0 negatif (%1) WB 4 Male 68 ADC 3 pT2bN1 pozitif (%90) WB,q-PCR 5 Female 53 ADC 1 pT2aN0 negatif (%1) IHC,WB,q-RT 6 Male 54 ADC 3 pT2aN2 negatif (%0) IHC,WB,q-RT 7 Male 54 ADC 3 pT3N0 negatif (%1) WB,q-RT 8 Male 62 Solid ADC 3 ypT2bN0 pozitif (%95) IHC,WB 9 Male 66 Enteric type ADC 2 pT1aN1 negatif (%0) IHC,WB 10 Male 65 Invasive mucinous ADC 1 pT4N1 negatif (%0) IHC,WB 11 Male 66 Enteric type ADC 2 pT2bN0 pozitif (%95) IHC,WB 12 Male 72 Acinar dominant type ADC 2 pT2N1 pozitif (%90) WB 13 Male 68 Solid ADC 3 pT2N1 pozitif (%90) IHC,WB,q-RT 14 Female 76 Acinar dominant type ADC 2 pT2aN0 negatif (%0) WB 15 Male 48 Enteric type ADC 2 pT2aN1 negatif (%0) IHC,WB,q-RT 16 Male 62 Basaloid SCC 2 pT3N0 pozitif (%100) WB,q-RT 17 Male 40 SCC 3 pT2aN2 negatif (%1) WB,q-RT 18 Male 69 Solid ADC 3 pT2aN1 negatif (%0) IHC
D) the Cancer Genome Atlas NSCLC Cohort Analyses
(74) Publicly available The Cancer Genome Atlas (TCGA) RNA-seq data on adenocarcinoma (n=511) and SCC (n 501) was used as an external cohort to verify DEGs between adenocarcinoma and SCC based on the RG cohort and to further analyze the expression of the HK1b isoform (transcript variant-8) between normal and TCGA Lung adenocarcinoma samples (RefSeq id NM_001322366). Lung Adenocarcinoma project contains 426 RNA sequencing of lung tumor tissues and matched with 602 normal lung tissues from the GTEx Project. For each database the supplied expected transcript read counts that are generated using the RSEM software package is used for the comparison. The read counts are normalized using the DESeq2 variance stabilized normalization method.
(75) E) RNA Isolation and Quantitative PCR
(76) RNA was isolated from human NSCLC cells and human clinical NSCLC tumor and normal samples by homogenization in Trizol reagent (Invitrogen) according to the manufacturer's instructions, followed by purification on an RNeasy column (Qiagen). RNA purity was assessed by Thermo NanoDrop 2000 (Thermo Fisher Scientific, Inc.) by standard absorbance ratios as A260/A2801.8 and A260/A2301.5. Complementary DNAs were synthesized from 2 g of total RNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Inc.) Real time Quantitative PCR (RT-qPCR) results obtained with Bio-Rad's iTaq Universal SYBR Green Supermix. The threshold cycle (Ct) for individual reactions were identified using iCycler IQ sequence analysis software (Bio-Rad). 3-actin was used for normalization of the data. All experiments were performed in triplicate.
(77) The following primers were used in this study with the following sequences:
(78) TABLE-US-00004 HK1aisoform: Fwd.,5-TGCCAAGCCCTGTTCTATGC-3, Rev.,5-CTGGGTCTTGAACGCACTG-3; HK1bisoform: Fwd.,5-CGCTGAAGACCCAGATTGACA-3, Rev,5-GCACCCGCAGAATTCGAAAG-3; HK1cisoform: Fwd,5-GCTGAGTGCCTGGGAGATTT-3, Rev.,5-TGGCATCATAGTCCTCATCTATTT-3, HK2: Fwd,5-CAACTTCCGTGTGCTTTGGG-3, Rev.,5-TGAGACCAGGAAACTCTCGT-3, p53 Fwd,5-GGAGCACTAAGCGAGCACTG Rev.,5-TCTCGGAACATCTCGAAGCG-3, H_-actin Fwd,5-AGAGCTACGAGCTGCCTGAC-3 Rev.,5-AGCACTGTGTTGGCGTACAG-3.
F) Reagents and Antibodies
(79) Rabbit monoclonal primary antibodies against HK1 (C35C4), HK2 (C64G5), Phospho-Akt (Ser 473), total Akt, Phospho-STAT3(Tyr705), total STAT3, Cleaved PARP (Asp214) (D64E10), PARP (46D11), Cleaved Caspase-3 (Asp175) (5A1E), Caspase-3 (D3R6Y), Phospho-GSK-3 (Ser9) (D85E12), total GSK-3p (D5C5Z), Phospho-p53 (Ser15), Phospho-mTOR (Ser2448) (D9C2), Phospho-AMPK (Thr172) (D4D6D), total AMPK (D63G4), Atg13 (E1Y9V), -Actin (13E5), and horseradish peroxidase (HRP)-conjugated rabbit and mouse secondary antibodies purchased from Cell Signaling Technologies (USA). Mouse monoclonal primary antibodies against p53 (DO-1), Bcl-2 (C-2), MAP LC3 (G-2), and BECN1 Antibody (G-11) purchased from Santa Cruz Biotechnologies (USA). Cisplatin (50 mg/100 mL) was purchased from Koak Farma.
(80) G) Cell Viability Assay
(81) Twenty-four hours following seeding (15,000 cells/well) in a 96-well plate, A549 and A549 HK1b.sup./ cells (70%-80% confluent) were treated with vehicle (PBS/Saline), or cisplatin with concentrations range from 0-100 M/ml and the cells incubated for a further 48 h. The cell viability was determined using the CellTiter-Blue assay kit (Promega) according to the manufacturer's instructions and absorbance measured at 595 nm with a microplate reader (Model 3550, Bio-Rad Laboratories, CA, USA). IC.sub.50 was defined as the concentration causing a 50% reduction in absorbance relative to the negative control. IC.sub.50 was determined by non-linear regression analysis using Graphpad Prism v8 (Graphpad Software, CA, USA).
(82) IC50 concentration of cisplatin are used in A549 (75 M) and A549 HK1b.sup./ (47 M) cells and after 48 hrs treatment cells were harvested by trypsinization, collected by centrifugation, washed once with 1 ml of PBS and stained with propidium iodide (BD Biosciences) according to the manufacturers' protocol and number of death cells was measured using fluorescence-activated cell sorting.
(83) H) Cell Proliferation by FACS Analysis
(84) A549 and A549 HK1b.sup./ cells were trypsinized and harvested at 50%-70% confluency. Cells were fixed with ice-cold 70% ethanol dropwise while vortexing and incubated at minus 20 degree for a minimum of 24 hr. Fixed cells were pelleted and washed twice with PBS. Anti-Human Ki-67, FITC kit is used to stain cells according to the manufacturers' protocol (BD Biosciences), Cells were analyzed with a FACS AriaII flow cytometer and processed using FlowJo software.
(85) I) Western Blot Analysis
(86) Cells were harvested and washed in PBS solution, collected, and then subjected to lysis in RIPA buffer containing proteinase inhibitor cocktail and phosphatase inhibitor cocktail (Roche). The lysates were subjected to centrifugation at 10,000 g at 4 C for 20 minutes and the supernatants removed. The total protein (50 g) was fractioned by 10% SDS-PAGE and electrophoretically transferred to Immobilon-FL PVDF membranes. The membrane was blocked with blocking buffer (Li-Cor) at room temperature for 1 hour, and then incubated with appropriate primary antibody at 4 C overnight. After washing with PBS containing 0.05% Tween 2 (PBST), the membrane was incubated with 1:2500 dilutions of appropriate secondary antibody for 2 hours at room temperature. The membrane was washed with PBST again, and Pierce ECL Western Blotting Substrate (Thermo Scientific) was used for development of immunoreactive bands. For immunoblotting of tissue samples, proteins were extracted from tumor and adjacent non-tumor lung samples collected from human NSCLC patients, snap frozen in liquid nitrogen, and stored at 80 C. Then protein lysis buffer (described above) was added to samples. Samples were vortexed, homogenized and subjected to three freeze/thaw cycles in dry ice, centrifuged and supernatant collected, and stored at 80 C. for subsequent immunoblotting.
(87) J) Measurement of oxygen consumption rate and extracellular acidification rates
(88) For Seahorse XFe96 assays, cells were seeded at pre-optimized final concentration 1.510.sup.4 cells/well onto Seahorse XF-96-well plates and Glycolytic rate, Glycolysis stress and Mito Stress Tests were performed following the manufacturer's specifications (Seahorse Bioscience, North Billerica, MA). Each datum was determined minimally in triplicate. OCR and ECAR were reported as absolute rates (pmoles/min for OCR and mpH/min for ECAR) or normalized against cell counts, or expressed as a percentage of the baseline oxygen consumption.
(89) K) In Vivo Orthotopic Xenograft Tumorigenesis Assay
(90) NSG mice were purchased from The Jackson Laboratory and experiments were performed at the Istanbul Medipol University. All mice were maintained in a specific pathogen-free facility and all animal experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committees of the Istanbul Medipol University. A549 WT and A549 HK1b.sup./ cells were orthotopically injected into immunodeficient NSG male mice to induce orthotopic NSCLC tumor model. Relative tumor volume was measured in 8 weeks after implantation and, is calculated as follows: (lengthwidthheight)/6. End points were reached, and mice were killed once the tumor size measured 2 cm.
(91) L) Immunofluorescence and Microscopy
(92) Cells were seeded on 8-well chamber culture slides (Lab-Tek II, Thermo Fisher Scientific). After appropriate treatment or transfection, the cells were fixed with 4% paraformaldehyde (Wako) for 20 minutes at room temperature and permeabilized with 0.5% Triton-X100 in PBS buffer for 15 minutes. The cells were incubated overnight at 4 C with primary antibodies for HK1, p53 diluted in PBS with 3% BSA. After three 10-minute washes in PBS, the cells were incubated for 60 minutes at room temperature with fluorochrome-conjugated secondary antibodies. Culture slides were washed three times for 10 minutes in PBS. For imaging, cells were stored in Vectashield hard set mounting medium with DAPI (H1500, Vector Laboratories). Cell imaging was accomplished with a a FV-1000 confocal microscope (Olympus).
(93) M) Structure Preparation
(94) We used crystal structures of HK1b (PDB ID: 1QHA) and HK2 (PDB ID: 2NZT), whereas HK1c was modeled using SWISS-Homology-Modeling-Software. Unresolved parts of the crystal structures were modeled with Swiss-Modeller, and loop regions were refined with ModLoop. The protonation states of residues were determined using PROPKA. Glucose was used in beta conformation. ATP and Mg2+ were translated to each system from crystal structure of Glucokinase (PDB ID: 3FGU).
(95) N) Molecular Dynamics Simulations
(96) MD simulations were performed with GROMACS 5.1.4 employing CHARMM 36 force-field. Systems were subjected minimized using a conjugate gradient algorithm. All systems were energy relaxed with 1000 steps of steepest-descent. The systems were equilibrated using NVT ensemble with Berendsen-algorithm. The final structures were run in NPT ensemble at 1 atm and 310 K. MD simulations were run for 300-ns. All coordinates were saved at 2-ps intervals for analysis. Long-range electrostatic forces were handled using PME, and Van der Waals forces treated with a 0.9-nm-cut-off. Water molecules were modelled with TIP3P model.
(97) O) Statistical Analysis
(98) Unless otherwise stated, data are expressed as meanSEM. GraphPad Prism 8 software was used for graphing and statistical analysis. After calculating normality by Shapiro-Wilk test, Student t or Mann-Whitney test were used to compare two samples. For multiple group comparisons, One-way ANOVA analysis and followed by Tukey's multiple comparison tests were used. Statistical parameters including exact value of n, statistical test and significance are reported in the figures and figure legends. Values of p<0.05 were considered statistically significant.
(99) 2) Results
(100) A) HK1 Expression is Upregulated in Human NSCLs and is Associated with a Poor Clinical Outcomes in Patients
(101) To validate specific upregulation of HK1 in human NSCLC, we analyzed human NSCLC tumor tissues and adjacent non-tumor lung tissues for the expression of HK1 along with HK2 and p53 for comparison. We found that in a small cohort of patients, HK1, HK2 and p53 were upregulated in NSCLC tumor tissues as compared to normal lung tissue from the same patients by immunoblotting (
(102) B) Human NSCLC Cells Express Mainly Only One of the HK1 Isoforms-Hexokinase1b (HK1b) as a Poor Prognostic Factor
(103) The HK1 gene spans approximately 131 kb and consists of 25 exons. According to RefSeq gene annotations, alternative splicing of HK1 gene at its 5 end produces different transcripts in different cell types. The testis-specific exons are located at approximately 15 kb upstream of the erythroid-specific exon R. The first 5 exons of the HK-I gene encode the testis-specific sequences. The 6th exon is the erythroid-specific exon R [10]. When we exclude these tissue specific transcripts we have 3 remaining transcripts that we are focused on: HK1a, HK1b and HK1c. On the other hand the HK2 gene has one transcript in the RefSeq gene annotations (
(104) To identify new, HK1 isoform specific metabolic target for the treatment of NSCLC, we first analyzed HK1 isoforms (HK1a, HK1b, and HK1c) along with HK2 and p53 in NSCLC adenocarcinoma cell lines (p53 WT-A549 and p53 null-H1299). Semi-q-PCR data of both A549 and H1299 cells showed that HK1a isoform is not specific to NSCLC because of its absent expression. HK1b isoform predominantly expressed in p53 WT A549 cells, but not in p53/ H1299 cells. However, we observed no difference in the levels of HK1c and HK2 expressions between A549 and H1299 cells (
(105) C) the Effect of HK1b Deficiency on Metabolism, Proliferation, and Tumorigenesis in NSCLC Cells.
(106) It is known that the N-terminal of HK1 and HK2 is responsible for providing stability to overall enzyme and for binding to the outer mitochondrial membrane. Although HK1a, b, c and HK2 have structural similarities, differences in N-terminal sequence make them unique, and this reflects significantly to change in metabolism hence tumorigenesis. Herein, our finding of structural differences suggesting that HK1b isoform contained unique sequences that might mediate the stability of N-domain, which is shown by root-mean square fluctuation analysis, (
(107) All together these data suggest that HK1b might have major role in glycolysis hence NSCLC tumorigenesis. To understand the mechanisms and HK1b isoform functional role in proliferation, survival, and tumorigenesis, we analyzed the metabolic consequences of HK1b isoform deficiency. Changes in glycolysis and respiration were measured after deletion of HK1b using the Seahorse metabolic analyzer. Analysis of the mitochondrial respiration rate following HK1b knockout (KO) showed not significant change in oxygen consumption rate (OCR) and respiration (
(108) In order to evaluate the effect of reduced glycolysis on proliferation in vitro, flow cytometry analyses of Ki67, a marker for proliferation, was performed and A549 HK1b.sup./ cells showed an approximately 35% decrease of Ki-67 level (
(109) D) the Effect of HK1b KO and Cisplatin Treatment on Metabolism, Drug Effect, and Survival Pathway in NSCLC Cells
(110) The treatment options for NSCLC are based mainly on several factors but in general chemotherapy often is one of the first line therapies for NSCLC patients. Cisplatin is slightly more effective platinum widely used in the treatment of NSCLC. However, it has been reported that cisplatin has been associated with more side effects. Moreover, inhibitors targeting metabolic changes have been developed as a potential therapeutics and several are now in early-phase clinical trials However, the efforts have been made so far not successful because of adverse side effect of drugs. Therefore, there is a clinically unmet need for precise and effective metabolic therapeutic target in cancer cells to improve survival and reduce disease-related adverse events in NSCLC patients. We first hypothesized that HK1b elimination and cisplatin could synergize to decrease glycolysis further that could potentially be therapeutic for NSCLC since the loss of HK1b led to a reduction in glycolysis. We observed further reduction of basal glycolysis and glycolytic capacity even though not significant, and total absence of glycolytic reserve on cisplatin treated A549 HK1b.sup./ cells (
(111) We next investigated whether the HK1b deletion could sensitize NSCLC cells to cisplatin treatment and evaluated the drug effect of cisplatin with or without HK1b ablation. Cell viability assay was performed and A549 HK1b.sup./ cells showed significantly lower IC50 value (47 M) than the A549 WT control group (75 M) (
(112) In order to identify the underlying mechanism of the effects of HK1b deletion and cisplatin treatment on synergistic induction of apoptosis, we examined the proliferation and survival signaling pathways. Upon silencing of HK1b, we observed that AKT activation and its downstream target GSK3 were activated, but they were totally inhibited in combination with cisplatin treatment. HK1b deletion and cisplatin together inhibit significantly phosphorylation of mTOR (
(113) E) Combination of HK1b Ablation and Cisplatin Synergistically Increases Both Apoptotic and Autophagic Cell Death
(114) We found that HK1b deletion sensitizes to cisplatin and in combination induce higher number of apoptotic cells. To investigate the underlying mechanism of cell death we examined the different cell death pathways of A549 WT and A549 HK1b.sup./ cells with cisplatin or rapamycin treatment. Furthermore, we showed that HK1b ablation and cisplatin increase apoptosis through both activation and high level of expression of p53. Recent studies have revealed a complex and multifaceted relationship between autophagy and apoptosis. Moreover, glucose deprivation typically results in autophagy induction to maintain energy homeostasis. In order to determine whether the combination of HK1b deletion and cisplatin led to the activation of autophagy in A549 cells, we examined the autophagic signaling pathway also using rapamycin treatment as a control. As expected, HK1b elimination mitigates autophagy induction in response to glucose deprivation since formation of LC3II significantly elevated in A549 HK1b.sup./ cells. Furthermore, HK1b deletion with cisplatin or rapamycin treatment induces greater autophagy in A549 HK1b.sup./ cells. HK1b deletion and cisplatin inhibits phosphorylation of mTOR in A549 HK1b.sup./ cells significantly (
REFERENCES
(115) 1. Douglas hanahan & robert weinberg, cell, hallmarks of cancer The next generation Volume 144, Issue 5, 4 Mar. 2011, Pages 646-674 2. Understanding the Warburg Effect: The Metabolic Requirements of Cell Proliferation: Science. 2009 May 22; 324(5930): 1029-1033. doi:10.1126/science.1160809 3. Targeting Metabolism for Cancer Therapy-cell-Alba Luengo. 4. Goodwin, J., et al., The distinct metabolic phenotype of lung squamous cell carcinoma defines selective vulnerability to glycolytic inhibition. Nat Commun, 2017. 8: p. 15503. 5. Anna M. Puzio-Kuter. Genes & Cancer. 2011; 2(4), 385-391 6. Vousden, K and Ryan, K. Nature Reviews Cancer. 2009; 9, 691-700 7. Mathupala, et al. Oncogene. 2006; 25, 4777-4786 8. Subcellular Localization of Hexokinases I and II Directs the Metabolic Fate of Glucose-Plos one 9. Robey R B, Hay N. Mitochondrial hexokinases, novel mediators of the antiapoptotic effects of growth factors and Akt. Oncogene 2006; 25(34):4683-96 doi 10.1038/sj.onc.1209595. 10. Rose I A, Warms J V. Mitochondrial hexokinase. Release, rebinding, and location. The Journal of biological chemistry 1967; 242(7):1635-45. 11. Testis-Specific Expression of mRNAs for a Unique Human Type 1 Hexokinase Lacking the Porin-Binding Domain 12. Mori C, Welch J E, Fulcher K D, O'Brien D A, Eddy E M (1993): Unique hexokinase messenger ribonucleic acids lacking the porin-binding domain are developmentally expressed in mouse spermatogenic cells. Biol Reprod 49:191-203.