COMPOSITIONS AND METHODS FOR INCREASING SODIUM CURRENT IN CARDIAC CELLS
20230151364 · 2023-05-18
Inventors
Cpc classification
C12N2310/113
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
A method of increasing sodium current in a cardiac cell generally includes introducing into the cardiac cell an miR-488 inhibitor in an amount effective to decrease miR-488 suppression of SCN5A mRNA transcription, thereby increasing sodium current in the cardiac cell. A method of increasing translation of SCN5A mRNA in a cell generally includes introducing into the cell an miR-488 inhibitor in an amount effective to decrease miR-488 suppression of SCN5A mRNA transcription. A method of decreasing arrhythmia in a cardiac cell generally includes introducing into the cardiac cell an miR-488 inhibitor in an amount effective to decrease miR-488 suppression of SCN5A mRNA transcription. A method of treating arrhythmia in a patient having, or at risk of having, arrhythmia generally includes administering to the patient an miR-488 inhibitor in an amount effective to decrease the likelihood or extent of arrhythmia in the patient. In some embodiments of all methods, the miR-488 inhibitor can be an miR-488 antagomir or an miR-488 sponge.
Claims
1. A method of increasing sodium current in cardiac cells, the method comprising: introducing into the cardiac cell an miR-488 inhibitor in an amount effective to decrease miR-488 suppression of SCN5A mRNA transcription, thereby increasing sodium current in the cardiac cell.
2. A method of increasing translation of SCN5A mRNA in a cell, the method comprising: introducing into the cell an miR-488 inhibitor in an amount effective to decrease miR-488 suppression of SCN5A mRNA transcription.
3. A method of decreasing arrhythmia in a cardiac cell, the method comprising: introducing into the cardiac cell an miR-488 inhibitor in an amount effective to decrease miR-488 suppression of SCN5A mRNA transcription, thereby decreasing arrhythmia in the cardiac cell.
4. A method of treating arrhythmia in a patient having, or at risk of having, arrhythmia, the method comprising: administering to the patient an miR-488 inhibitor in an amount effective to decrease the likelihood or extent of arrhythmia in the patient.
5. The method of claim 4, wherein the patient has experienced myocardial infarction.
6. The method of claim 1, wherein the miR-488 inhibitor comprises an miR-488 antagomir or an miR-488 sponge.
7. The method of claim 2, wherein the miR-488 inhibitor comprises an miR-488 antagomir or an miR-488 sponge.
8. The method of claim 3, wherein the miR-488 inhibitor comprises an miR-488 antagomir or an miR-488 sponge.
9. The method of claim 4, wherein the miR-488 inhibitor comprises an miR-488 antagomir or an miR-488 sponge.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0009] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0030] This disclosure describes compositions and methods that improve the ability of cells to make and use proteins that allow the cells to conduct a sodium current across the cell membrane. In a clinical setting, the methods may be useful to improve the function of cardiac cells and decrease the likelihood and/or extent of arrhythmia that can occur, for example, following myocardial infarction.
[0031] Cardiac ischemia is associated with arrhythmic risk, but effective therapies are limited. The cardiac voltage-gated sodium channel α-subunit (SCN5A) coding region encodes the Na.sub.v1.5 channel subunit. Na.sub.v1.5 channels mediate sodium current in cardiac cells. Ischemic cardiomyopathy is associated with reduced Na.sub.v1.5, and reduced Na.sub.v1.5 contributes to arrhythmic risk. This disclosure shows that hypoxia reduces Na.sub.v1.5 through effects on a microRNA (miR), miR-448. The expression of miR-448 is increased in ischemic cardiomyopathy. miR-448 has a conserved binding site in the 3′-UTR of SCN5A. miR-448 binding to this site suppresses SCN5A expression and sodium currents. Hypoxia-induced HIF1α and NF-κB are transcriptional regulators for MIR448. Hypoxia also relieved MIR448 transcriptional suppression by RE1 silencing transcription factor (REST). Inhibition of miR-448 reduced arrhythmic risk after myocardial infarction. These results indicate that ischemia drives miR-448 expression, reduced Na.sub.v1.5 current, and increases risk of arrhythmic. Arrhythmic risk is reduced by inhibiting Na.sub.v1.5 downregulation, suggesting a new approach to antiarrhythmic therapy.
[0032] Regulation of Na.sub.v1.5 expression depends on equilibrium between different stages of protein expression: e.g., gene transcription, RNA processing, post-transcriptional regulation by miRNA or RNA binding proteins, protein synthesis, protein assembly, post-translational modification, and protein trafficking. Cardiac sodium channel downregulation can therefore be mediated by transcriptional regulation, post-transcriptional mRNA splicing, modulation of mRNA stability, translational regulation, and post-translational modification. However, the mechanism through which ischemia causes Na.sub.v1.5 downregulation has been unclear. This disclosure reports that miR-488 is upregulated in cardiac ischemia and contributes to the downregulation of Na.sub.v1.5. miR-488 is a microRNA. MicroRNAs (miRNAs) are small (20-22 nucleotides) non-coding RNA molecules that function in RNA silencing and post-transcriptional regulation of gene expression.
miR-448 is Upregulated with Cardiac Ischemia
[0033] Cardiac miR-448 expression was significantly increased in heart tissues from patients with ischemic cardiomyopathy compared to healthy controls. miR-448 level scaled with arrhythmic risk (
SCN5A is a Direct Target of miR-448
[0034] Sequence analysis revealed a complementary binding sequence for miR-448 within the 3′-UTR of SCN5A mRNA. This binding site is highly conserved in many mammals including human and mouse (
SCN5A Expression was Regulated by miR-448
[0035] Next, the ability of miR-448 to regulate the expression and the function of Na.sub.v1.5 (encoded by SCN5A) was investigated. In RL14 human cardiomyocytes, SCN5A mRNA expression was reduced by the miR-448 mimic and induced by anti-miR-448 (inhibitor) (
[0036] Human iPSC-cardiomyocytes (CMs) were used to determine the effect of the miR-448 mimic on Na.sub.v1.5-mediated sodium current. The SCN5A mRNA levels were reduced by transfection of the miR-448 mimic (
Hypoxia-Induced miR-448 Controlled SCN5A
[0037] To investigate the regulation of SCN5A in hypoxic condition, RL14 cells were stimulated with deferoxamine (DFX). SCN5A mRNA expression was decreased by deferoxamine stimulation in a dose-dependent and time-dependent manner and Na.sub.v1.5 protein level was also decreased by deferoxamine (
[0038] A DNA construct with four miR-448 binding sites following the luciferase coding region (miR-448 decoy, illustrated in
HIF1α and NF-κB Regulated miR-448 in Hypoxia
[0039] The MIR448 gene is located in an intron of the HTR2C gene, but MIR448 is regulated independently from HTR2C. Regulation of miR-448 expression by hypoxia investigated. A transcription factor binding site prediction tool (Lee et al., 2013, Biotechniques 54:141-153) suggested binding sequences for HIF1α and NF-κB within a 1 Kb from transcription initiation site of MIR448. HIF1α and NF-κB are well-known hypoxia response factors. Deferoxamine treatment of RL14 cardiomyocytes for six hours increased the protein level and the translocation into the nucleus of HIF1α and NF-κB (
REST Suppressed miR-448
[0040] Within the 1 Kb MIR448 promoter was a predicted RE1 Silencing Transcription Factor (REST) binding site. REST was initially identified as a transcriptional repressor that regulates neuronal genes in non-neuronal tissues. REST regulates other genes in response to changes in oxygen tension by direct binding to an RE1/NRSE site on their promoter regions. In normoxia, MIR448 expression was increased by REST gene silencing (
miR-448 Inhibition Raised Na.sub.v1.5 and Reduced Arrhythmia in Myocardial Infarction
[0041] Ischemia reduces Na.sub.v1.5, and reduced Na.sub.v1.5 is arrhythmogenic. Ischemia-induced miR-448 contributes to the reduction in Na.sub.v1.5. Therefore, the effect of inhibiting miR-448 on Na.sub.v1.5 levels and arrhythmic risk in ischemic cardiomyopathy was tested. Mice underwent LAD ligation to create myocardial ischemia and infarction. An miR-448 sponge was used to inhibit the function of miR-448. In human cardiomyocytes, sponge treatment rescued SCN5A mRNA levels decreased by miR-448 treatment, indicating the efficacy of this sponge approach (
[0042] To test the role of miR-448 in regulating SCN5A expression in vivo, myocardial infarcted mice were injected with either AAV9-Control (Con) or AAV9-miR-448 sponge (448-Spo) viral particles two weeks before coronary artery ligation. To confirm gene expression in the heart through AAV9 injection, GFP expression was examined in the heart tissue of mice treated with an AAV9 vector encoding the GFP gene. The green fluorescence ratio increased compared to WT with AAV9-GFP treatment, and the GFP level also increased in the heart treated with AAV-GFP (
[0043] Mouse echocardiography was performed to confirm the myocardial infraction (MI) by LAD ligation. The ejection fraction (EF) of the MI+AAV9-Con group was reduced compared to the sham group, indicating that MI was present. AAV9-448-Spo treatment did not affect EF % change (
[0044] Arrhythmia is among the leading causes of death from ischemic cardiomyopathy. Arrhythmias are thought to be caused by structural and electrical remodeling. Electrical remodeling in the ventricle typically results from downregulation of ion channels by a variety of mechanisms including, for example, transcription, RNA processing, RNA stability, translation efficiency, and post-translational dysregulation. Reversing the ion channel downregulation can improve arrhythmic risk and may represent an alternative approach to ion channel blocking antiarrhythmic drugs.
[0045] Changes in SCN5A expression, either upregulation or downregulation, can cause arrhythmias, and SCN5A is downregulated in ischemic cardiomyopathy. Nevertheless, the mechanisms by which ischemia reduces SCN5A expression have not been fully explored but include mRNA destabilization. This disclosure describes investigating SCN5A mRNA instability during cardiac hypoxia and showed that the level of miR-448 increased during ischemia, miR-448 bound to SCN5A mRNA, and this binding reduced SCN5A mRNA, protein, and current. Moreover, this disclosure shows HIF1α and NF-κB upregulation and REST downregulation controlled miR-448 levels in response to hypoxia. Downregulation of SCN5A in ischemic cardiomyopathy was associated with increased arrhythmic risk, and miR-448 inhibition could restore Na.sub.v1.5 levels and reduce arrhythmic risk.
[0046] Other miRs are known to regulate SCN5A. For example, SCN5A can be controlled by miRs targeting the gene coding region and the 3′-UTR. Also, miR-24 and miR-1270 can regulate expression by directly binding to binding sites created by single nucleotide polymorphisms (SNPs) of SCN5A. Also, miR-192-5p increases in atrial fibrillation (AF) and inhibits expression of SCN5A. Furthermore, miR-200c directly or indirectly regulates various cardiac genes including SCN5A. This disclosure shows that miR-448 directly bound to the SCN5A 3′-UTR and regulated the Na.sub.v1.5 current.
[0047] This disclosure shows that miR-448 increases in hypoxic conditions and the miR-448 promoter region includes binding sites for hypoxia-related factors. The response to hypoxic stress is coupled tightly to the interaction between HIF1α and NF-κB signaling. Maximal HIF1α expression depends on transcriptional regulation by NF-κB and post-translational regulation by hypoxia. This disclosure shows that HIF1α and NF-κB binding sites were −530˜-450 upstream from the miR-448 gene transcription initiation site and were involved in regulating miR-448 expression during hypoxia.
[0048] RE1 Silencing Transcription Factor (REST) can regulate genes in response to changes in oxygen tension. Reducing expression of REST contributes to gene upregulation in hypoxia. The MIR448 promoter analysis presented in this disclosure shows that the binding sequence for REST is within the 1 Kb region of the MIR448 promoter and that REST gene silencing in normoxia leads to an increase in miR-448 expression and a decrease in SCN5A expression. Therefore, there appears to be an interplay of relief of REST inhibition and increased of HIF1α and NF-κB induction to regulate miR-448 and, therefore, SCN5A. Consensus binding sequence analysis shows that REST may also be a target of miR-448, suggesting a more complex negative feedback loop.
[0049] In summary, miR-448 negatively regulated the cardiac sodium channel by direct binding to 3′-UTR of SCN5A mRNA. The effect of miR-448 increased in ischemia. Inhibition of miR-448 raised Na.sub.v1.5 and reduced arrhythmic risk after myocardial infarction, suggesting a new paradigm in antiarrhythmic therapy.
[0050] Thus, this disclosure describes, in one aspect, a method of increasing translation of SCN5A mRNA in a cell. Generally, the method includes introducing into the cell an miR-488 inhibitor in an amount effective to decrease miR-488 suppression of SCN5A mRNA transcription. In some of these embodiments, the cell can be a cardiac cell. In such cases, increasing translation of SCN5A increases Na.sub.v1.5 in the cell and reduces the extent and/or likelihood of arrhythmia in the cardiac cell.
[0051] In another aspect, this disclosure describes a method of treating arrhythmia in a patient having, or at risk of having, arrhythmia. Generally, the method includes administering to the patient an miR-488 inhibitor in an amount effective to decrease the likelihood and/or extent of arrhythmia in the patient.
[0052] Treating arrhythmia by administering an miR-488 inhibitor can be prophylactic or, alternatively, can be initiated after the subject exhibits one or more symptoms or clinical signs of arrhythmia. Treatment that is prophylactic—e.g., initiated before a subject manifests a symptom or clinical sign of arrhythmia is referred to herein as treatment of a subject that is “at risk” of having arrhythmia. As used herein, the term “at risk” refers to a subject that may or may not actually experience arrhythmia. Thus, for example, a subject “at risk” of having arrhythmia is a subject possessing one or more risk factors associated with arrhythmia such as, for example, genetic predisposition, ancestry, age, sex, geographical location, lifestyle, or medical history. in some cases, a patient “at risk” for having arrhythmia can be a patient who has a medical history that includes myocardial infarction.
[0053] Accordingly, a composition that includes an miR-488 inhibitor can be administered before, during, or after the subject first exhibits a symptom or clinical sign of arrhythmia. Treatment initiated before the subject first exhibits a symptom or clinical sign of arrhythmia may result in decreasing the likelihood that the subject experiences clinical evidence of arrhythmia compared to a subject to which the composition is not administered, decreasing the severity of symptoms and/or clinical signs of arrhythmia, and/or completely resolving the condition. Treatment initiated after the subject first exhibits a symptom or clinical sign associated with arrhythmia may result in decreasing the severity of symptoms and/or clinical signs of arrhythmia compared to a subject to which the composition is not administered, and/or completely resolving the condition.
[0054] Thus, the method includes administering an effective amount of an miR-488 inhibitor to a subject having, or at risk of having, arrhythmia. In this aspect, an “effective amount” is an amount effective to reduce, limit progression, ameliorate, or resolve, to any extent, a symptom or clinical sign of arrhythmia.
[0055] The miR-488 inhibitor may be formulated with a pharmaceutically acceptable carrier to form a pharmaceutical composition. As used herein, “carrier” includes any plasmid or viral vector, nanoparticle, microsome, lipid vector, chemical modification, solvent, dispersion medium, vehicle, coating, diluent, antibacterial, and/or antifungal agent, isotonic agent, absorption delaying agent, buffer, carrier solution, suspension, colloid, and the like. The use of such media and/or agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions. As used herein, “pharmaceutically acceptable” refers to a material that is not biologically or otherwise undesirable, i.e., the material may be administered to an individual along with an miR-488 inhibitor without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
[0056] The pharmaceutical composition may be formulated in a variety of forms adapted to a preferred route of administration. Thus, a composition can be administered via known routes including, for example, oral, parenteral (e.g., intradermal, transcutaneous, subcutaneous, intramuscular, intravenous, intraperitoneal, organ injection, local injection, etc.), or topical (e.g., intranasal, intrapulmonary, intramammary, intravaginal, intrauterine, intradermal, transcutaneous, rectally, etc.). A pharmaceutical composition can be administered to a mucosal surface, such as by administration to, for example, the nasal or respiratory mucosa (e.g., by spray or aerosol). A composition also can be administered via a sustained or delayed release.
[0057] Thus, the miR-488 inhibitor may be provided in any suitable form including but not limited to a solution, a suspension, an emulsion, a spray, an aerosol, or any form of mixture. The composition may be delivered in formulation with any pharmaceutically acceptable excipient, carrier, or vehicle. For example, the formulation may be delivered in a conventional topical dosage form such as, for example, a cream, an ointment, an aerosol formulation, a non-aerosol spray, a gel, a lotion, and the like. The formulation may further include one or more additives including such as, for example, an adjuvant, a skin penetration enhancer, a colorant, a fragrance, a flavoring, a moisturizer, a thickener, and the like.
[0058] A formulation may be conveniently presented in unit dosage form and may be prepared by methods well known in the art of pharmacy. Methods of preparing a composition with a pharmaceutically acceptable carrier include the step of bringing the miR-488 inhibitor into association with a carrier that constitutes one or more accessory ingredients. In general, a formulation may be prepared by uniformly and/or intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product into the desired formulations.
[0059] The amount of miR-488 inhibitor administered can vary depending on various factors including, but not limited to, the specific miR-488 inhibitor, the weight, physical condition, and/or age of the subject, and/or the route of administration. Thus, the absolute amount of miR-488 inhibitor included in a given unit dosage form can vary widely, and depends upon factors such as the species, age, weight and physical condition of the subject, and/or the method of administration. Accordingly, it is not practical to set forth generally the amount that constitutes an amount of miR-488 inhibitor effective for all possible applications. Those of ordinary skill in the art, however, can readily determine the appropriate amount with due consideration of such factors.
[0060] In some embodiments, the method can include administering sufficient miR-488 inhibitor to provide a dose of, for example, from about 100 ng/kg to about 80 mg/kg. If delivered to the subject using a vector, the miRNA inhibitor may be administered in an amount up to 5×10.sup.11 plaque forming units per kg or up to 1×10.sup.15 vector genome (vg)/kg. In some of these embodiments, the method includes administering sufficient miR-488 inhibitor to provide a dose of from about 10 μg/kg to about 80 mg/kg to the subject, for example, a dose of from about 100 g/kg to about 1 mg/kg. In other embodiments, the method includes administering sufficient miR-488 inhibitor to provide a dose of from about 1×10.sup.11 to about 1×10.sup.13 vg/kg.
[0061] A single dose may be administered all at once, continuously for a prescribed period of time, or in multiple discrete administrations. When multiple administrations are used, the amount of each administration may be the same or different. For example, a dose of 1 mg/kg per day may be administered as a single administration of 1 mg/kg, continuously over 24 hours, as two 0.5 mg/kg administrations, or as a first administration of 0.75 mg/kg followed by a second administration of 0.25 mg/kg. When multiple administrations are used to deliver a single dose, the interval between administrations may be the same or different.
[0062] In some embodiments, the miR-488 inhibitor may be administered, for example, from a single dose to multiple doses per week, although in some embodiments the method can involve a course of treatment that includes administering doses of the miR-488 inhibitor at a frequency outside this range. When a course of treatment involves administering multiple within a certain period, the amount of each dose may be the same or different. For example, a course of treatment can include a loading dose initial dose, followed by a maintenance dose that is lower than the loading dose. Also, when multiple doses are used within a certain period, the interval between doses may be the same or be different.
[0063] In certain embodiments, the miR-488 inhibitor may be administered from about once per month to continuously. For example, an miR-488 inhibitor may be administered once following acute myocardial infarction. In contrast, an miR-488 inhibitor may be administered chronically for treating cardiomyopathy.
[0064] In all aspects, the miR-488 inhibitor may be any polynucleotide, compound, or molecule that interferes with the ability of miR-488 to suppress translation of SCN5A mRNA. Exemplary miR-488 inhibitors include, but are not limited to, a commercially-available miR-488 inhibitor, an miR-488 antagomir, an miR-488 sponge, am miRN mask, or any combination of two or more miR-488 inhibitors.
[0065] miRNA inhibitors are also known as anti-miRNAs. miRNA inhibitors are single-stranded RNA molecules. As illustrated in
[0066] Antagomirs are single-stranded RNA molecules with specific chemical modifications. As illustrated in
[0067] An miRNA sponge, illustrated in
[0068] In the preceding description and following claims, the term “and/or” means one or all of the listed elements or a combination of any two or more of the listed elements; the terms “comprises,” “comprising,” and variations thereof are to be construed as open ended i.e., additional elements or steps are optional and may or may not be present; unless otherwise specified, “a,” “an,” “the,” and “at least one” are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
[0069] In the preceding description, particular embodiments may be described in isolation for clarity. Unless otherwise expressly specified that the features of a particular embodiment are incompatible with the features of another embodiment, certain embodiments can include a combination of compatible features described herein in connection with one or more embodiments.
[0070] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
[0071] The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
EXAMPLES
Cell Culture and Transfection
[0072] Human fetal cardiomyocyte cell line RL14 (ATCC RL-14, ATCC, Manassas, Va.) cells were grown in DMEM/F-12 nutrient mixture (GE Healthcare Life Sciences, Logan, Utah) supplemented with 12.5% (v/v) fetal bovine serum (Gibco, Grand Island, N.Y.) and penicillin-streptomycin (10,000 U/mL; Gibco, Grand Island, N.Y.). HEK293T cells were maintained in DMEM high glucose supplemented with 10% fetal bovine serum and penicillin-streptomycin. hiPSC-cardiomyocytes (iCELL Cardiomyocytes) were obtained from Cellular Dynamics International (Madison, Wis.). iCELL cardiomyocytes were seeded and maintained using iCELL Cardiomyocyte Plating Medium and Maintenance Medium (FUJIFILM Cellular Dynamics, Inc., Madison, Wis.). For hypoxic conditions, the cells were cultured in an hypoxic incubator chamber (STEMCELL Technologies, Vancouver, BC) using pre-incubated culture media or were treated with hypoxic-mimetic chemicals, deferoxamine (DFX) and cobalt chloride (CoCl.sub.2) (Sigma-Aldrich, St. Louis, Mo.) as previously described (Chachami et al., 2004, Am J Respir Cell Mol Biol 31:544-551; Woo et al, 2006, Biochem Biophys Res Commun 343:8-14).
Cell Transfection
[0073] Syn-hsa-miR-448 miScript miRNA mimic, anti-hsa-miR-448 miScript miRNA inhibitor, and its negative controls were purchased from Qiagen (Valencia, Calif.). REST siRNA and its negative control were obtained from Integrated DNA Technologies (Coralville, Iowa). The cells were transfected using HiPerFect Transfection Reagent (Qiagen, Valencia, Calif.) following the recommendations of the manufacturer. Plasmid DNA was transfected into cultured cells using SuperFect transfection reagent (Qiagen, Valencia, Calif.) following the manufacturer's protocol.
Plasmid Constructions
[0074] Gene fragments for SCN5A 3′-UTR with or without mutations at the miR-448 binding site were obtained from Integrated DNA Technologies (IDT, Coralville, Iowa). They were cloned into pGL3-Promoter vectors downstream of the luciferase open reading frame to create pGL3-Promoter-Luciferase SCN5A 3′-UTR wild type (WT) or mutation (Mut) vectors. A gene fragment for miR-448 acted as a decoy, was obtained from IDT, and was cloned into pcDNA3.1 (+) luciferase vector downstream of the luciferase open reading frame to create a pcDNA3.1(+)-Luciferase-miR-448 decoy vector. The miR-448 decoy sequence was designed and confirmed using the “miRNAsong” web tool (Barta et al., 2016, Sci Rep 6:36625). A gene fragment for a 1 Kb promoter region of miR-448 was obtained from Integrated DNA Technologies (Coralville, Iowa) and cloned into the pGL3-Basic vector upstream of the luciferase open reading frame to create a pGL3-MIR448 promoter-Luciferase vector. Then, −687 bp, −151 bp, and −92 bp DNA fragments were amplified by PCR with specific primers and were cloned into the pGL3-Basic vector. All DNA constructs were confirmed by DNA sequencing.
[0075] Each DNA construct was transfected into cardiomyocytes, and the cells were stimulated with deferoxamine for six hours. Luciferase mRNA level was detected by qPCR. The mRNA level of luciferase was normalized with the mRNA level of EGFP which was co-transfected as a control.
RNA Preparation and Real-Time Reverse Transcription Polymerase Chain Reaction
[0076] Total RNA was prepared using RNeasy Plus Mini Kit or miRNeasy Mini Kit (Qiagen, Valencia, Calif.) according to the manufacturer's instructions. Reverse transcription was performed with a First Strand cDNA Synthesis kit (Promega, Madison, Wis.). cDNA for miRNA detection was generated by the miScript II RT Kit (Qiagen, Valencia, Calif.). A reverse transcription quantitative real-time PCR was performed with SYBR Green PCR Master Mix (Thermo Fisher Scientific, Waltham, Mass.) using the 7500Fast Real-Time PCR system (Thermo Fisher Scientific, Waltham, Mass.) and miScript SYBR Green PCR Kit with miScript primer assays to detect the expression of miRNA. The primer sequences were as follows:
TABLE-US-00001 SCN5A F (SEQ ID NO: 4) 5′-TGGTTGTCATCCTCTCCATCGT-3′ R (SEQ ID NO: 5) 5′-ATGAGGGCAAAGAGCAGCGT-3′ GAPDH F (SEQ ID NO: 6) 5′-GAAGGTGAAGGTCGGAGTCAAC-3′ R (SEQ ID NO: 7) 5′-CAGAGTTAAAAGCAGCCCTGGT-3′
[0077] Hs_miR-448_1 miScript Primer Assay (5′-UUGCAUAUGUAGGAUGUCCCAU-3′; (SEQ ID NO:1; Qiagen, Valencia, Calif.) was used for detecting miR-448, and the Hs_RNU6-2_11 miScript Primer Assay (Qiagen, Valencia, Calif.) was used as an endogenous control. The relative fold change was calculated by the 2.sup.−ΔΔCt method, and the measurements were normalized with respect to the endogenous control (RNU6, GAPDH).
Western Blot
[0078] Cells were washed twice with ice-cold PBS and disrupted in Cell Lysis Buffer (Cell Signaling Technology, Danvers, Mass.) with Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific, Waltham, Mass.) on ice for 30 minutes. Cell lysates were centrifuged at 14,000 rpm for 15 minutes at 4° C., and the resultant supernatants were subjected to Western blotting. The total protein concentration was quantified using the BCA Protein Assay Kit (Pierce, Thermo Fisher Scientific, Waltham, Mass.). Proteins were separated by electrophoresis on a 4-15% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad Laboratories, Inc., Hercules, Calif.), after which samples were transferred onto a polyvinylidene difluoride (PVDF) membrane. The membrane was treated with 5% skim milk for one hour and incubated with Na.sub.v1.5 antibody (1:1000 dilution; ab56240, Abcam, Cambridge, Mass.), HIF1α (1:1000 dilution; ab72775, Abcam, Cambridge, Mass.), NF-κB (1:1000 dilution; ab32536, Abcam, Cambridge, Mass.), REST (1:1000 dilution; ab21635, Abcam, Cambridge, Mass.), or β-actin (1:5000 dilution; A5441, Sigma-Aldrich, St. Louis, Mo.) overnight at 4° C.
[0079] After TBST washing, the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (1:5000) for 90 min at room temperature. The proteins were visualized with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific, Waltham, Mass.) using the CHEMIDOC XRS+ System (Bio-Rad Laboratories, Inc., Hercules, Calif.). The images were analyzed using ImageJ software to measure band density. Band density was normalized with 3-actin from three independent experiments.
Electrophysiology
[0080] hiPSC-cardiomyocytes (CMs) were trypsinized (0.25% trypsin-EDTA, Invitrogen) for 10 minutes and plated in 35-mm culture dishes at a cell density of ˜100 cells/dish on the day before the experiments. Na.sup.+ channel currents were measured by using the whole-cell patch-clamp technique in the voltage-clamp configuration at room temperature. hiPSC-CMs were not selected by action potential morphology, but the differentiation technique resulted in predominantly ventricular-like cells. To measure Na.sup.+ channel currents, pipettes (2 to 4 MΩ) were filled with a pipette solution containing (in mmol/L): CsCl 80, cesium aspartate 80, EGTA 11, MgCl2 1, CaCl2) 1, HEPES 10, and Na2ATP 5 (adjusted to pH 7.4 with CsOH). The bath solution consisted of (in mmol/L): NaCl 10, NMDG 100, TEA-Cl 20, CsCl 5, CaCl.sub.2) 2, MgCl2 1.2, HEPES 10, and glucose 5 (adjusted to pH 7.4 with CsOH). The holding potential was −100 mV. A voltage step protocol ranging from −80 to +60 mV with steps of 10 mV was applied to establish the presence of the Na.sup.+ channel currents. The peak current density was used to plot current-voltage (I-V) curves. As before, nifedipine (10 μM, Sigma) was added in the bath solution to block L-type Ca.sup.2+ channel currents. Steady state activation and inactivation were characterized by Boltzmann functions.
Human Samples
[0081] Deidentified control heart tissue was a gift of Prof. J. A. Wasserstrom of Northwestern University. All control heart tissue was derived from patients suffered brain death because of a cerebral vascular accident and had no concomitant cardiac conditions before the heart was harvested.
[0082] Deidentified HF heart tissues were obtained from Lillehei Heart Institute tissue bank at the University of Minnesota. HF patients had a history of ischemic cardiomyopathy that was confirmed by histological specimens prepared concomitantly with acquisition of the specimen. In the control and HF groups, specimens were from the left ventricle. Arrhythmic status was determined by record review.
Mouse Cardiac Ischemia Model
[0083] In order to create ischemia, mice underwent left anterior coronary artery (LAD) ligation as previously described (Zhou et al., 2018, Heart Rhythm 15:1072-1080). Eight-week-old male C57BL/6 mice were randomly divided into the MI group and MI+miR-448 sponge AAV9 group. To investigate whether miR-448 inhibition is sufficient to prevent arrhythmia in vivo, adeno-associated virus serotype 9 (AAV9) viral particles bearing either an empty vector or anti-miR-448 were systemically injected into mice via the right jugular vein (VectorBuilder Inc, IL) at a dose of 5×10.sup.11 viral genomes (vg) per animal before LAD ligation. All animal protocols used in this study were approved by the IACUC (Institutional Animal Care and Use Committee) of University of Minnesota. Animal care and interventions were undertaken in accordance with the National Institute of Health (NIH) Guide for the Care and Use of Experimental Animals.
Telemetry Monitoring
[0084] Three randomly selected MI+control or MI+anti-miR-448 mice were implanted with ETA-F10 transmitters (Data Sciences International, St. Paul, Minn.). Mice were anesthetized with 4% and maintained on 2% inhaled isoflurane. A skin incision was made in the right abdominal region, and a transmitter was inserted subcutaneously. The two electrocardiographic leads were tunneled and positioned under the skin to generate a lead II electrocardiographic configuration. One week after transmitter implantation, electrocardiographic signals were recorded for 24 hours. Heart rate calculations and cardiac rhythm analysis were performed by using Dataquest ART, version 4.1 (Data Sciences International, St. Paul, Minn.) and LabChart 7 Pro, version 7.3.7 (AD Instruments, Inc., Colorado Springs, Colo.) (Kannankeril et al., 2006, Proc Natl Acad Sci USA, 103:12179-12184; Xie et al., 2018, J Am Heart Assoc 7(8)).
[0085] For arrhythmia provocations, isoproterenol (ISO) was injected into the peritoneum (IP; 0.2 mg/kg). After establishing the baseline rhythm for 24 hours, each mouse received ISO and the ECG was recorded for another two hours. ECGs were analyzed beginning 60 minutes before intraperitoneal injection of isoproterenol as a baseline, and then for 60 minutes after injection to identify isoproterenol-induced arrhythmias.
[0086] ECG signal analysis was performed blinded to treatment.
Immunohistochemistry
[0087] The heart tissues were fixed in 4% paraformaldehyde (pH7,4) for 24 hours, embedded in paraffin, and serially sectioned to 5 m thickness. For the dewaxing process, the paraffin sections were placed at 60° C. overnight and then transferred to xylene (10 minutes, three times), anhydrous ethanol (three minutes, twice), 95% ethanol (one minute, once), 70% ethanol (one minute, once), and distilled water (two minutes, once). The tissue sections were heated with citrate buffer (pH 6.0) for five minutes at 100° C. After rinsing using washing buffer, the sections were incubated in 3% hydrogen peroxide to quench endogenous peroxidase activity and blocked with 3% bovine serum albumin (BSA, Bio-Rad Laboratories, Inc., Hercules, Calif.) to prevent nonspecific antibody binding. Next, the tissue sections were incubated with primary antibodies against GFP (1:200 dilution; sc-9996, Santa Cruz Biotechnology, Dallas, Tex.) and Na.sub.v1.5 (1:200 dilution, ab56240, Abcam) at 4° C. overnight and HRP-conjugated secondary antibodies (Bio-Rad Laboratories, Inc., Hercules, Calif.) for 30 minutes at room temperature. Finally, the sections were incubated with 3, 3′-diaminobenzidine (DAB) peroxidase substrate kit (Vector Laboratories, Inc., Burlingame, Calif.) and counterstained with hematoxylin (Vector Laboratories, Inc., Burlingame, Calif.). After permanent mounting, the sections were imaged using a light microscope (Axioscope 7, Zeiss; Jena, Germany). In captured image, the regions of interest (ROI) were demarcated using ZEN Pro software (Zeiss). Quantitative analysis was performed using Image Pro Plus software (version 6.0; Media Cybernetics, Bethesda, Md.).
Statistics
[0088] Statistical significance between groups was performed using Student's t-tests (paired and unpaired), one-way analysis of variance (ANOVA) with Dunnett's multiple comparisons test where appropriate. For all analyses, a p-value of less than 0.05 was considered significant. All data were analyzed using Prism software (version 8.0, GraphPad Software, San Diego, Calif.) and R. The data presented represent the mean+ or ±standard deviation (SD). A p value <0.05 was considered statistically significant.
[0089] The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.
[0090] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0091] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.
[0092] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
TABLE-US-00002 hsa-miR-488 Sequence Listing Free Text SEQ ID NO: 1 uugcauaugu aggauguccc au SCN5A 3′-UTR (wt) SEQ ID NO: 2 gacaauccua uuuagcauau gcaa SCN5A 3′-UTR (mutant) SEQ ID NO: 3 gacaauccua uuuagcuaua cgua SCN5A forward primer SEQ ID NO: 4 TGGTTGTCATCCTCTCCATCGT SCN5A reverse primer SEQ ID NO: 5 ATGAGGGCAAAGAGCAGCGT GADPH forward primer SEQ ID NO: 6 GAAGGTGAAGGTCGGAGTCAAC GADPH reverse primer SEQ ID NO: 7 CAGAGTTAAAAGCAGCCCTGGT