FLUORESCENT DYE, AND PREPARATION METHOD AND USES THEREOF

Abstract

A fluorescent dye, a preparation method and uses thereof, wherein the fluorescent dye has the advantages of sensitivity and specificity to viscosity response, low background fluorescence and the like, and can also be used as a fluorescence activated and lightened-up probe for fluorescence labeling, quantification or detection of proteins, enzymes or nucleic acids.

Claims

1-10. (canceled)

11. A fluorescent dye, which is shown as Formula (I), ##STR00088## wherein: Ar is arylene or heteroarylene, and optionally, hydrogen atoms in Ar are independently substituted by halogen atoms; D- is HO— or N(X.sub.1)(X.sub.2)—, and X.sub.1 and X.sub.2 are independently selected from hydrogen, alkyl or modified alkyl; X.sub.1 and X.sub.2 are optionally interconnected, and form an alicyclic heterocycle with N atoms; and X.sub.1 and X.sub.2 are optionally and independently form an alicyclic heterocycle with Ar; Y is O or S; R.sub.1 is hydrogen or alkyl; and R.sub.2 is a halogen atom, —OH or —CN; wherein: the “alkyl” is C.sub.1-C.sub.10 straight or branched alkyl; the “modified alkyl” is independently a group obtained by replacing any carbon atom in C.sub.1-C.sub.16 straight or branched alkyl with one or more groups selected from halogen atom, —OH, —CO—, —O—, —CN, —SO.sub.3H—, primary amino group, secondary amino group and tertiary amino group, or the carbon-carbon single bond is optionally and independently replaced by a carbon-carbon double bond or a carbon-carbon triple bond; the replacement of carbon atoms refers to that carbon atoms or the carbon atoms and hydrogen atoms thereon together are replaced by a corresponding group; the “halogen atom” is independently F, Cl, Br or I; the “alicyclic heterocycle” is a saturated or unsaturated 4- to 15-membered monocyclic or polycyclic alicyclic heterocycle containing one or more heteroatoms of N, O, S or Si on the ring, and the alicyclic heterocycle containing S heteroatom(s) on the ring include the ones that contain —S—, —SO— or —SO.sub.2— on the ring; the alicyclic heterocycle is optionally substituted by a halogen atom, an alkyl, an aryl or a modified alkyl; the “arylene” is independently a 5- to 13-membered monocyclic or dicyclic or fused dicyclic or fused polycyclic subaromatic group; the “heteroarylene” is independently a 5- to 13-membered monocyclic or dicyclic or fused dicyclic or fused polycyclic sub-heteroaromatic group containing one or more heteroatoms selected from N, O, S or Si on the ring; the “primary amino group” is R′NH.sub.2 group; the “secondary amino group” is R′NHR″ group; the “tertiary amino group” is R′NR″R′″ group; each R′, R″, R″ is independently a single bond, hydrogen, alkyl, or alkylene; the “alkylene” is C.sub.1-C.sub.10 straight or branched alkylene.

12. The fluorescent dye according to claim 11, wherein the “alkyl” is selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tertiary butyl, sec-butyl, n-amyl, 1-methyl butyl, 2-methyl butyl, 3-methyl butyl, isoamyl, 1-ethyl propyl, neoamyl, n-hexyl, 1-methyl amyl, 2-methyl amyl, 3-methyl amyl, isohesyl, 1,1-dimethyl butyl, 2,2-dimethyl butyl, 3,3-dimethyl butyl, 1,2-dimethyl butyl, 1,3-dimethyl butyl, 2,3-dimethyl butyl, 2-ethyl butyl, n-heptyl, 2-methyl hexyl, 3-methyl hexyl, 2,2-dimethyl amyl, 3,3 dimethyl amyl, 2,3-dimethyl amyl, 2,4-dimethyl amyl, 3-ethyl amyl or 2,2,3-methyl butyl.

13. The fluorescent dye according to claim 11, wherein the “modified alkylene” is a group containing one or more groups selected from —OH, —O—, —NH.sub.2, ethylene glycol unit, —CN —O—CO—, —NH—CO—, —SO.sub.2—O—, —SO—, Me.sub.2N—, Et.sub.2N—, —CH═CH—, —C≡CH—, F, Cl, Br, I, and cyano group.

14. The fluorescent dye according to claim 11, wherein Ar is a structure selected from the following Formulae (II-1) to (II-7): ##STR00089##

15. The fluorescent dye according to claim 11, wherein the compound represented by Formula (I) is selected from the compounds below: ##STR00090## ##STR00091## ##STR00092## ##STR00093## ##STR00094## ##STR00095## ##STR00096## ##STR00097## ##STR00098## ##STR00099##

16. A method for preparing the fluorescent dye according to claim 11, including a step of aldol condensation reaction between a compound of Formula (a) and a compound of Formula (b): ##STR00100##

17. A method for viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection using the fluorescent dye according to claim 11.

18. A reagents for viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, containing the fluorescent dye according to claim 11.

19. A fluorescent activated and lighted-up probe, comprising the fluorescent dye according to claim 11.

20. A method for protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection using the fluorescent activated and lighted-up probe according to claim 19.

21. A reagents for protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, containing the fluorescent activated and lighted-up probe according to claim 19.

Description

DESCRIPTION OF DRAWINGS

[0036] FIG. 1 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-1 (1×10.sup.−5 M);

[0037] FIG. 2 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-2 (1×10.sup.−5 M);

[0038] FIG. 3 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-3 (1×10.sup.−5 M);

[0039] FIG. 4 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-4 (1×10.sup.−5 M);

[0040] FIG. 5 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-5 (1×10.sup.−5 M);

[0041] FIG. 6 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-6 (1×10.sup.−5 M);

[0042] FIG. 7 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-17 (1×10.sup.−5 M);

[0043] FIG. 8 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-18 (1×10.sup.−5 M);

[0044] FIG. 9 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-19 (1×10.sup.−5 M);

[0045] FIG. 10 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-20 (1×10.sup.−5 M);

[0046] FIG. 11 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-21 (1×10.sup.−5 M);

[0047] FIG. 12 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor IV-22 (1×10.sup.−5 M);

[0048] FIG. 13 is a diagram showing the fluorescence background contrast of molecular rotors IV-39, IV-40, IV-44 and IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-7, IV-8 (1×10.sup.−6 M) in PBS;

[0049] FIG. 14 is a diagram showing the fluorescence background contrast of molecular rotors IV-41, IV-43 and IV-17, IV-18, IV-19, IV-20, IV-21, IV-22 (1×10.sup.−6 M) in PBS;

[0050] FIG. 15 is a diagram showing the fluorescence background contrast of molecular rotors IV-42 and IV-36 (1×10.sup.−6 M) in PBS;

[0051] FIG. 16 is a diagram showing the fluorescence background contrast of molecular rotors IV-45, IV-46 and IV-3 (1×10.sup.−6 M) in PBS;

[0052] FIG. 17 is a diagram showing the fluorescence background contrast of molecular rotors IV-47, IV-48 IV-20 (1×10.sup.−6 M) in PBS;

[0053] FIG. 18 is a diagram showing the fluorescence background contrast of molecular rotors IV-49, IV-50 IV-5 (1×10.sup.−6 M) in PBS;

[0054] FIG. 19 is a diagram showing the fluorescence background contrast of molecular rotors IV-51 IV-1 (1×10.sup.−6 M) in PBS;

[0055] FIGS. 20A and 20B are the application of molecular rotors IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, IV-22 in labeling intracellular RNA aptamer, wherein FIG. 20A are cells expressing the target RNA aptamer, and FIG. 20B are cells not expressing the target RNA aptamer;

[0056] FIGS. 21A and 21B are a flow detection diagram for molecular rotors IV-21 and IV-41 for labeling mRNA.

EMBODIMENTS

Examples

Example 1

[0057] ##STR00012##

[0058] To a stirred solution of Compound 1 (0.504 g, 2 mmol), anhydrous zinc chloride (0.545 g, 4 mmol) in 100 mL THF, 4-Cyanobenzaidehyde (0.626 g, 5 mmol) was added. The complete solution were stirred at 80° C. under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the solution allowing the reaction to cool to room temperature. The solvent is evaporated to dryness, to give a crude product, then purified by silica gel column chromatography to afford a target compound (0.292 g, 40%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ11.07 (s, 1H), 8.10 (d, J=8.5 Hz, 2H), 8.06 (dd, J=7.8, 2.1 Hz, 2H), 8.03 (s, 1H), 7.94 (d, J=8.3 Hz, 2H), 7.44 (d, J=15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H).MS(ESI): m/z Calcd. For C.sub.20H.sub.13F.sub.2N.sub.3O.sub.2 365.0976; found 364.0902, [M−H].sup.−.

Example 2

[0059] ##STR00013##

[0060] This compound was obtained by following the general procedure for CompoundIV-1, (0.475 g, 65%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ11.04 (s, 1H), 8.49 (d, J=1.9 Hz, 1H), 8.21 (dt, J=8.0, 1.4 Hz, 1H), 8.10-8.02 (m, 2H), 8.00 (s, 1H), 7.88 (dt, J=7.7, 1.4 Hz, 1H), 7.67 (t, J=7.8 Hz, 1H), 7.43 (d, J=16.0 Hz, 1H), 7.01 (s, 1H), 3.29 (s, 3H).MS(ESI): m/z Calcd. For C.sub.20H.sub.13F.sub.2N.sub.3O.sub.2 365.0976; found 364.0903, [M−H].sup.−.

Example 3

[0061] ##STR00014##

[0062] This compound was obtained by following the general procedure for CompoundIV-1, (0.221 g, 31%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ10.94 (s, 1H), 10.11 (s, 1H), 8.07-8.01 (m, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.74 (d, J=8.7 Hz, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.90 (s, 1H), 6.87-6.83 (m, 2H), 3.26 (s, 3H).MS(ESI): m/z Calcd. For C.sub.19H.sub.14F.sub.2N.sub.2O.sub.3 356.0972; found 355.0901, [M−H].sup.−.

Example 4

[0063] ##STR00015##

[0064] This compound was obtained by following the general procedure for CompoundIV-1, (0.207 g, 29%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ9.70 (s, 1H), 8.05 (d, J=8.9 Hz, 2H), 7.98-7.89 (m, 1H), 7.30 (t, J=6.2 Hz, 1H), 7.26 (d, J=8.9 Hz, 1H), 7.15 (d, J=15.8 Hz, 1H), 6.97 (s, 1H), 6.87 (d, J=7.5 Hz, 1H), 3.27 (s, 3H).MS(ESI): m/z Calcd. For C.sub.19H.sub.14F.sub.2N.sub.2O.sub.3 356.0972; found 355.0900, [M−H].sup.−.

Example 5

[0065] ##STR00016##

[0066] This compound was obtained by following the general procedure for CompoundIV-1, (0.186 g, 26%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ8.16 (d, J=8.5 Hz, 2H), 7.99-7.86 (m, 3H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 6.83-6.72 (m, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H).MS(ESI): m/z Calcd. For C.sub.19H.sub.13F.sub.3N.sub.2O.sub.2 358.0929; found 357.0856, [M−H].sup.−.

Example 6

[0067] ##STR00017##

[0068] This compound was obtained by following the general procedure for CompoundIV-1, (0.222 g, 31%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ11.02 (s, 1H), 8.09-8.03 (m, 2H), 8.01 (d, J=15.8 Hz, 1H), 7.85 (dt, =10.6, 2.1 Hz, 1H), 7.72 (d, =7.8 Hz, 1H), 7.51 (td, =8.0, 6.1 Hz, 1H), 7.34 (d, J=15.9 Hz, 1H), 7.28 (td, J=8.7, 2.7 Hz, 1H), 7.00 (s, 1H), 3.28 (s, 3H).MS(ESI): m/z Calcd. For C.sub.19H.sub.13F.sub.3N.sub.2O.sub.2 358.0929; found 357.0857, [M−H].sup.−.

Example 7

[0069] ##STR00018##

[0070] To a stirred solution of compound IV-5 (0.716 g, 2.0 mmol), TBSCI (0.450 g, 3.0 mmol), in 50 mL dry DMF, and imidazole (0.204 g, 3.0 mmol) was added. The complet solution was stirred for 3 hours at room temperature under Ar atmosphere. The mixture was poured into 150 mL water and extracted with DCM. The organic layer was dried over anhydrous MgSO.sub.4, filtered, and concentrated under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford the compound 2 (0.927 g, 98%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ8.16 (d, J=8.5 Hz, 2H), 7.99-7.86 (m, 3H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 6.83-6.72 (m, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H), 1.50 (s, 9H), 0.2 (s, 6H).MS(ESI): m/z Calcd. For C.sub.25H.sub.28F.sub.3N.sub.2O.sub.2Si 473.2; found 473.2, [M+H].sup.+.

##STR00019##

[0071] Compound 2 (0.473 g, 1 mmol), Lawesson's reagent (0.808 g, 2 mmol) was in 250 mL three neck boles and dissolved in 100 mi toluene. Two drops of aniline was added. The reaction mixture was reflexed until the TLC showed the complete the reaction. The solvent was removed under reduce pressure to give the crude product which was redissolved in 50 mL DCM, then TBAF (0.313 g, 1.2 mmol) was added. The mixture was stirred at rt under Ar atomophere. After complete the reaction, the solvent was removed under reduce pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound IV-7 (0.209 g, 56%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ8.17 (d, J=8.5 Hz, 2H), 7.98-7.86 (m, 3H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 6.83-6.72 (m, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H).MS(ESI): m/z Calcd. For C.sub.18H.sub.13F.sub.3N.sub.2NaOS 397.0598; found 397.0597, [M+Na].sup.+.

Example 8

[0072] ##STR00020##

[0073] This compound was obtained by following the general procedure for Compound IV-1 Compound 2, (0.932 g, 99%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ8.10 (d, J=8.5 Hz, 2H), 8.06 (dd, J=7.8, 2.1 Hz, 2H), 8.03 (s, 1H), 7.94 (d, J=8.3 Hz, 2H), 7.44 (d, J=15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H), 1.51 (s, 9H), 0.29 (s, 9H).MS(ESI): m/z Calcd. For C.sub.26H.sub.28F.sub.2N.sub.3O.sub.2Si 480.2; found 480.2, [M+H].sup.+.

##STR00021##

[0074] This compound was obtained by following the general procedure for Compound IV-7, (0.332 g, 49%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ11.00 (s, 1H), 8.11 (d, J=8.5 Hz, 2H), 8.07 (dd, J=7.8, 2.1 Hz, 2H), 8.04 (s, 1H), 7.94 (d, J=8.3 Hz, 2H), 7.44 (d, J=15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H).HMS(ESI): m/z Calcd. For C.sub.20H.sub.13F.sub.2N.sub.3NaOS 404.0645; found 404.0646, [M+Na].sup.+.

Example 9

[0075] ##STR00022##

[0076] To a stirred solution of 3-Fluoro-4-hydroxybenzaldehyde (0.560 g, 4.0 mmol) and 5 mL 33% methylamine aqueous solution in 40 mL anhydrous ethanol, 10 g Na.sub.2SO.sub.4 was added in one portion. The obtained mixture was stirred and kept at room temperature for 24 hr, then filtered and dried with additional Na.sub.2SO.sub.4. The solvent was removed under reduce pressure to give the intermediate which was used directly without any further purification. After re-dissolved in 10 mL anhydrous methanol, compound 4 (0.790 g, 5.0 mmol) was added. The complex was stirred and kept at room temperature for 12 hr, the precipitated product was filtered and washed with cooled methanol for three times to give the yellow compound 5. (0.796 g, 85%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ10.52 (s, 1H), 8.19 (m, 1H), 7.76 (m, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 3.09 (s, 3H), 2.34 (s, 3H). MS(ESI): m/z Calcd. For C.sub.12H.sub.10FN.sub.2O.sub.2234.2; found 234.2, [M−H].sup.−.

##STR00023##

[0077] This compound was obtained by following the general procedure for CompoundIV-1, (0.239 g, 21%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ10.52 (s, 1H), 8.11 (d, J=8.5 Hz, 2H), 8.07 (d, J=7.8 Hz, 2H), 7.84 (d, J=8.0 Hz, 1H), 7.67 (d, J=8.4 Hz, 1H), 7.32 (m, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 6.78 (m, 1H), 2.34 (s, 3H). HR-MS(ESI): m/z Calcd. For C.sub.20H.sub.13FN.sub.3O.sub.2346.0997; found 346.0998, [M−H].sup.−.

Example 10

[0078] ##STR00024##

[0079] This compound was obtained by following the general procedure for Compound 5, (0.812 g, 91%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ7.28 (s, 1H), 7.19 (d, J=8.0 Hz, 2H), 3.59 (t, J=5.6 Hz, 3H), 3.12 (s, 3H), 1.23 (q, J=5.6 Hz, 3H). MS(ESI): m/z Calcd. For C.sub.13H.sub.11ClFN.sub.2O.sub.2281.0; found 281.0, [M−H].sup.−.

##STR00025##

[0080] This compound was obtained by following the general procedure for CompoundIV-1, (0.239 g, 21%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ7.84 (s, 2H), 7.28 (s, 1H), 7.19 (d, J=8.0 Hz, 2H), 3.12 (s, 3H), 1.23 (q, J=5.6 Hz, 3H). HR-MS(ESI): m/z Calcd. For C.sub.21H.sub.14ClFN.sub.3O.sub.2395.0837; found 394.0764, [M−H].sup.−.

Example 11

[0081] ##STR00026##

[0082] This compound was obtained by following the general procedure for Compound 5, (0.812 g, 91%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ7.28 (s, 1H), 7.19 (d, J=8.0 Hz, 2H), 3.81 (s, 3H), 3.12 (s, 3H), 3.12 (s, 3H), 1.58 (m, 1H), 1.11 (d, 6H). MS(ESI): m/z Calcd. For C.sub.15H.sub.15BrFN.sub.2O.sub.2353.0; found 3.0, [M−H].sup.−.

##STR00027##

[0083] This compound was obtained by following the general procedure for CompoundIV-1, (0.209 g, 22%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ8.15 (d, J=8.8 Hz, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.74 (d, J=8.7 Hz, 2H), 7.28 (s, 1H), 7.19 (d, J=8.0 Hz, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.87-6.83 (m, 2H), 3.12 (s, 3H), 1.58 (m, 1H), 1.11 (d, 6H). HR-MS(ESI): m/z Calcd. For C.sub.23H.sub.19BrFN.sub.3O.sub.2467.0645; found 466.0572, [M−H].sup.−.

Example 12

[0084] ##STR00028##

[0085] This compound was obtained by following the general procedure for Compound 5, (0.812 g, 91%)○.sup.1H NMR (400 MHz, CD3OD) δ10.52 (s, 1H), 7.76 (d, J=8.5 Hz, 2H), 6.95 (s, 1H), 3.79 (t, J=5.2 Hz, 2H), 3.35 (s, 3H), 2.39 (t, J=4.8 Hz, 2H), 1.40 (m, 2H), 1.20 (t, J=4.8 Hz, 3H). MS(ESI): m/z Calcd. For C.sub.14H.sub.214FIN.sub.2O.sub.2388.0; found 388.0, [M−H].sup.−.

##STR00029##

[0086] This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ10.52 (s, 1H), 7.98-7.86 (m, 3H), 7.76 (d, J=8.5 Hz, 2H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 3.79 (t, J=5.2 Hz, 2H), 3.35 (s, 3H), 2.39 (t, J=4.8 Hz, 2H), 1.40 (m, 2H), 1.20 (t, J=4.8 Hz, 3H). HR-MS(ESI): m/z Calcd. For C.sub.21H.sub.17ClFIN.sub.2O.sub.2510.0007; found 408.9936, [M−H].sup.−.

Example 13

[0087] ##STR00030##

[0088] This compound was obtained by following the general procedure for Compound 5, (0.732 g, 93%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ10.52 (s, 1H), 7.76 (d, J=8.5 Hz, 2H), 6.95 (s, 1H), 3.10 (s, 3H), 2.39 (s, 3H). MS(ESI): m/z Calcd. For C.sub.12H.sub.10Cl.sub.2N.sub.2O.sub.3284.0; found 283.0, [M−H].sup.−.

##STR00031##

[0089] This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ10.52 (s, 1H), 8.07-8.01 (m, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.76 (d, J=8.5 Hz, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.95 (s, 1H), 6.87-6.83 (m, 2H), 3.10 (s, 3H), 2.39 (s, 3H).HR-MS(ESI): m/z Calcd. For C.sub.19H.sub.13BrCl.sub.2N.sub.2O.sub.2449.9537; found 448.9455, [M−H].sup.−.

Example 14

[0090] ##STR00032##

[0091] This compound was obtained by following the general procedure for Compound 5, (0.732 g, 93%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ10.52 (s, 1H), 8.19 (m, 1H), 7.76 (m, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 3.01 (q, J=4.8 Hz, 2H), 2.34 (s, 3H), 1.21 (t, J=4.8 Hz, 3H). MS(ESI): m/z Calcd. For C.sub.13H.sub.13ClN.sub.2O.sub.2264.1; found 263.1, [M−H].sup.−.

##STR00033##

[0092] This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ10.52 (s, 1H), 8.19 (m, 1H), 8.07-8.01 (m, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.76 (m, 1H), 7.01 (d, J=15.7 Hz, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 6.87-6.83 (m, 2H), 3.01 (q, J=4.8 Hz, 2H), 2.34 (s, 3H), 1.21 (t, J=4.8 Hz, 3H). HR-MS(ESI): m/z Calcd. For C.sub.21H.sub.13ClIN.sub.2O.sub.2486.9716; found 486.9715, [M−H].sup.−.

Example 15

[0093] ##STR00034##

[0094] This compound was obtained by following the general procedure for Compound 5, (0.732 g, 93%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ10.52 (s, 1H), 8.19 (m, 1H), 7.76 (m, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 3.05 (s, 3H), 2.34 (s, 3H). MS(ESI): m/z Calcd. For C.sub.12H.sub.11BrN.sub.2O.sub.2294.0; found 293.0, [M−H].sup.−.

##STR00035##

[0095] This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ10.52 (s, 1H), 8.19 (m, 1H), 7.95 (d, J=15.7 Hz, 1H), 7.76 (m, 1H), 7.49 (m, 1H), 7.40-7.22 (m, 3H), 7.01 (d, J=15.7 Hz, 1H), 6.99 (t, J=8.8 Hz, 1H), 6.89 (s, 1H), 3.05 (s, 2H), 2.34 (s, 3H). HR-MS(ESI): m/z Calcd. For C.sub.19H.sub.14BrClN.sub.2O.sub.2415.9927; found 414.9854, [M−H].sup.−.

Example 16

[0096] ##STR00036##

[0097] This compound was obtained by following the general procedure for Compound 5, (0.732 g, 93%)○.sup.1H NMR (400 MHz, CD3 OD) δ10.52 (s, 1H), 7.76 (d, J=8.5 Hz, 2H), 6.95 (s, 1H), 2.39 (s, 3H). MS(ESI): m/z Calcd. For C.sub.11H.sub.8Cl.sub.2N.sub.2O.sub.2270.0; found 271.0, [M+H].sup.−.

##STR00037##

[0098] This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ10.52 (s, 1H), 8.07-8.01 (m, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.76 (d, J=8.5 Hz, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.95 (s, 1H), 6.87-6.83 (m, 2H), 2.39 (s, 3H).HR-MS(ESI): m/z Calcd. For C.sub.18H.sub.11BrCl.sub.2N.sub.2O.sub.2435.9381; found 436.9459, [M+H].sup.−.

Example 17

[0099] ##STR00038##

[0100] This compound was obtained by following the general procedure for CompoundIV-1, (0.286 g, 28%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6): δ8.15 (d, J=8.6 Hz, 2H), 7.82 (d, J=15.8 Hz, 1H), 7.31-7.22 (m, 2H), 7.21-7.17 (m, 1H), 7.10 (d, J=15.8 Hz, 1H), 6.94 (s, 1H), 6.88-6.73 (m, 3H), 3.59 (t, J=5.8 Hz, 2H), 3.51 (t, J=6.0 Hz, 2H), 3.26 (s, 3H), 3.05 (s, 3H). HR-MS (ESI): m/z Calcd. For C.sub.22H.sub.24N.sub.3O.sub.3 378.1818; found 378.1819, [M+H].sup.+.

Example 18

[0101] ##STR00039##

[0102] This compound was obtained by following the general procedure for CompoundIV-1, (0.486 g, 60%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6): δ8.43 (d, J=1.8 Hz, 1H), 8.16 (t, J=8.5 Hz, 3H), 7.93 (d, J=15.9 Hz, 1H), 7.85 (dt, J=7.8, 1.4 Hz, 1H), 7.66 (t, J=7.8 Hz, 1H), 7.40 (d, J=15.9 Hz, 1H), 6.98 (s, 1H), 6.86-6.71 (m, 2H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). HR-MS(ESI): m/z Calcd. For C.sub.23H.sub.23N.sub.4O.sub.2 387.1821; found 387.1822, [M+H].sup.+.

Example 19

[0103] ##STR00040##

[0104] This compound was obtained by following the general procedure for CompoundIV-1, (0.286 g, 38%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6): δ8.17 (d, J=8.6 Hz, 2H), 7.91 (d, J=15.8 Hz, 1H), 7.79 (dt, J=10.6, 2.1 Hz, 1H), 7.66 (d, J=7.8 Hz, 1H), 7.50 (td, J=8.0, 6.2 Hz, 1H), 7.34-7.20 (m, 2H), 6.97 (s, 1H), 6.84-6.73 (m, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.22H.sub.23N.sub.3O.sub.3F 380.1774; found 380.1775, [M+H].sup.30.

Example 20

[0105] ##STR00041##

[0106] This compound was obtained by following the general procedure for CompoundIV-1, (0.222 g, 30%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): 8.14 (d, J=8.5 Hz, 2H), 7.84 (d, J=15.7 Hz, 1H), 7.68 (d, J=8.4 Hz, 2H), 6.97 (d, J=15.8 Hz, 1H), 6.88 (s, 1H), 6.84 (d, J=8.5 Hz, 2H), 6.79 (d, J=8.8 Hz, 2H), 3.59 (q, J=5.4 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.24 (s, 3H), 3.05 (s, 3H). MS(ESI): m/z Calcd. For C.sub.22H.sub.24N.sub.3O.sub.3 378.1818; found 378.1819, [M+H].sup.+.

Example 21

[0107] ##STR00042##

[0108] This compound was obtained by following the general procedure for CompoundIV-1, (0.352 g, 56%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6): δ8.18 (d, J=8.5 Hz, 2H), 8.08-8.02 (m, 2H), 7.98-7.90 (m, 3H), 7.40 (d, J=15.9 Hz, 1H), 7.00 (s, 1H), 6.86-6.72 (m, 2H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.6 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.23H.sub.23N.sub.4O.sub.2 387.1821; found 387.1820, [M+H].sup.+.

Example 22

[0109] ##STR00043##

[0110] This compound was obtained by following the general procedure for CompoundIV-1, (0.252 g, 32%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6): δ8.16 (d, J=8.5 Hz, 2H), 7.93 (t, J=4.4 Hz, 2H), 7.90 (d, J=6.1 Hz, 1H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 6.83-6.72 (m, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H). MS(ESI): m/z Calcd. For C.sub.22H.sub.23FN.sub.3O.sub.2 380.1774; found 380.1775, [M+H].sup.+.

Example 23

[0111] ##STR00044##

[0112] This compound was obtained by following the general procedure for CompoundIV-1, (0.252 g, 32%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6): δ8.43 (d, J=1.8 Hz, 1H), 8.16 (t, J=8.5 Hz, 3H), 7.93 (d, J=15.9 Hz, 1H), 7.85 (dt, J=7.8, 1.4 Hz, 1H), 7.66 (t, J=7.8 Hz, 1H), 7.40 (d, J=15.9 Hz, 1H), 6.98 (s, 1H), 6.86-6.71 (m, 2H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.23H.sub.23N.sub.4O.sub.2 387.2; found 387.2, [M+H].sup.+.

##STR00045##

[0113] 2 ml Allyl bromide was added to the mixture of compound 13 (0.774 g, 2.0 mmol), K.sub.2CO.sub.3 (0.276 g, 2.0 mmol) in acetonitrile (100 ml) with constant stirring. This reaction mixture was heated to reflux. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the reaction mixture was filtered then the solvent was removed under reduce pressure to Ove the crude product, then purified by silica gel column chromatography to afford a target compound 14. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ8.43 (d, J=1.8 Hz, 1H), 8.16 (t, J=8.5 Hz, 3H), 7.93 (d, J=15.9 Hz, 1H), 7.85 (dt, J=7.8, 1.4 Hz, 1H), 7.66 (t, J=7.8 Hz, 1H), 7.40 (d, J=15.9 Hz, 1H), 6.98 (s, 1H), 6.86-6.71 (m, 2H), 3.81 (s, 2H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.41 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.26H.sub.27N.sub.4O.sub.2 427.2; found 427.2, [M+H].sup.+.

##STR00046##

[0114] This compound was obtained by following the general procedure for CompoundIV-7, (0.152 g, 72%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6): δ8.43 (d, J=1.8 Hz, 1H), 8.16 (t, J=8.5 Hz, 3H), 7.93 (d, J=15.9 Hz, 1H), 7.85 (dt, J=7.8, 1.4 Hz, 1H), 7.66 (t, J=7.8 Hz, 1H), 7.40 (d, J=15.9 Hz, 1H), 6.98 (s, 1H), 6.86-6.71 (m, 2H), 3.81 (s, 2H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.41 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.26H.sub.27N.sub.4OS 443.1906; found 443.1905, [M+H].sup.+.

Example 24

[0115] ##STR00047##

[0116] This compound was obtained by following the general procedure for CompoundIV-5, (0.692 g, 82%)○.sup.1H NMR (400 MHz, CD.sub.3OD): δ=8.02 (d, J=2.4 Hz, 1H), 7.44 (dd, J=8.7 Hz, J=2.4 Hz, 1H), 7.09 (s, 1H), 6.51 (d, J=8.7 Hz, 1H), 3.56 (t, J HH=7.6 Hz, 2H), 3.08 (s, 6H), 1.66 (m, 2H), 2.38 (s, 3H), 0.95 (t, J=7.6 Hz, 3H). MS(ESI): m/z Calcd. For C.sub.15H.sub.21N.sub.4O 273.2; found 273.2, [M+H].sup.+.

##STR00048##

[0117] This compound was obtained by following the general procedure for CompoundIV-1, (0.452 g, 34%)○.sup.1H NMR (400 MHz, CD.sub.3OD): δ=8.02 (d, J=2.4 Hz, 1H), 7.95 (m, 2H), 7.68-7.50 (m, 1H), 7.44 (dd, J=8.7 Hz, J=2.4 Hz, 1H), 7.34-7.06 (m, 2H), 7.09 (s, 1H), 7.00 (d, J=15.7 Hz, 1H), 6.51 (d, J=8.7 Hz, 1H), 3.56 (t, J HH=7.6 Hz, 2H), 3.08 (s, 6H), 1.66 (m, 2H), 2.38 (s, 3H), 0.95 (t, J=7.6 Hz, 3H). MS(ESI): m/z Calcd. For C.sub.22H.sub.24FN.sub.4O 379.2; found 379.2, [M+H].sup.+.

##STR00049##

[0118] This compound was obtained by following the general procedure for CompoundIV-7, (0.152 g, 72%)○.sup.1H NMR (400 MHz, CD.sub.3OD): δ=8.02 (d, J=2.4 Hz, 1H), 7.95 (m, 2H), 7.68-7.50 (m, 1H), 7.44 (dd, J=8.7 Hz, J=2.4 Hz, 1H), 7.34-7.06 (m, 2H), 7.09 (s, 1H), 7.00 (d, J=15.7 Hz, 1H), 6.51 (d, J=8.7 Hz, 1H), 3.56 (t, J HH=7.6 Hz, 2H), 3.08 (s, 6H), 1.66 (m, 2H), 2.38 (s, 3H), 0.95 (t, J=7.6 Hz, 3H). HR-MS(ESI): m/z Calcd. For C.sub.22H.sub.24FN.sub.4S 395.1706; found 395.1705, [M+H].sup.+.

Example 25

[0119] ##STR00050##

[0120] This compound was obtained by following the general procedure for CompoundIV-5, (0.892 g, 80%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ8.41 (d, J=1.5 Hz, 1H), 7.97 (d, J=1.5 Hz, 1H), 7.31 (s, 1H), 5.86 (s, 1H), 3.46 (t, J=6.6 Hz, 4H), 3.15 (s, 3H), 2.32 (s, 3H), 1.61 (m, 4H), 1.32 (m, 12H), 0.89 (t, 6H). MS(ESI): m/z Calcd. For C.sub.22H.sub.36N.sub.5O 386.3; found 386.3, [M+H].sup.+.

##STR00051##

[0121] This compound was obtained by following the general procedure for CompoundIV-1, (0.452 g, 34%)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ8.41 (d, J=1.5 Hz, 1H), 7.97 (d, J=1.5 Hz, 1H), 7.85 (d, J=15.7 Hz, 1H), 7.49 (m, 1H), 7.40-7.22 (m, 3H), 7.31 (s, 1H), 7.01 (d, J=15.7 Hz, 1H), 5.86 (s, 1H), 3.46 (t, J=6.6 Hz, 4H), 3.15 (s, 3H), 2.32 (s, 3H), 1.61 (m, 4H), 1.32 (m, 12H), 0.89 (t, 6H). MS(ESI): m/z Calcd. For C.sub.29H.sub.39ClN.sub.5O 508.2843; found 508.2842, [M+H].sup.+.

Example 26

[0122] ##STR00052##

[0123] This compound was obtained by following the general procedure for CompoundIV-5, (0.812 g, 81%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ7.93 (s, 2H), 7.31 (s, 1H), 4.24 (t, J=6.8 Hz, 2H), 3.44 (s, 3H), 2.82 (s, 2H), 2.43 (s, 3H). MS(ESI): m/z Calcd. For Cl.sub.4H.sub.12N.sub.6O 285.1; found 285.1, [M+H].sup.+.

##STR00053##

[0124] This compound was obtained by following the general procedure for CompoundIV-1, (0.312 g, 26%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ=8.02 (d, J=15.7 Hz, 1H), 7.93 (m, 3H), 7.68-7.50 (n, 1H), 7.31 (s, 1H), 7.24-7.06 (m, 2H), 7.01 (d, J=15.7 Hz, 1H), 4.24 (t, J=6.8 Hz, 2H), 3.44 (s, 3H), 2.82 (s, 2H), 2.43 (s, 3H). MS(ESI): m/z Calcd. For C.sub.21H.sub.20IN.sub.6O 499.0743; found 499.0742, [M+H].sup.+.

Example 27

[0125] ##STR00054##

[0126] This compound was obtained by following the general procedure for CompoundIV-5, (0.932 g, 85%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ=7.59 (s, 2H), 6.71 (s, 1H), 3.24 (t, J=5.6 Hz, 4H), 3.06 (t, J=8.4 Hz, 2H), 2.67 (t, J=6.2 Hz, 4H), 2.29 (s, 3H), 1.86-1.82 (m, 4H) 1.46 (m, 2H), 1.21 (t, J=8.4 Hz, 3H). MS(ESI): m/z Calcd. For C.sub.20H.sub.25N.sub.3O 323.2; found 324.2, [M+H].sup.+.

##STR00055##

[0127] This compound was obtained by following the general procedure for CompoundIV-5, (0.932 g, 85%) ○.sup.1H NMR (400 MHz, CDCl.sub.3) δ=8.31 (dd, J=8.3 Hz, J=2.1 Hz, 1H), 8.16 (s, 1H), 7.94 (d, J=8.3 Hz, 1H), 7.95 (d, J=15.7 Hz, 1H), 7.59 (s, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.71 (s, 1H), 3.24 (t, J=5.6 Hz, 4H), 3.06 (t, J=8.4 Hz, 2H), 2.67 (t, J=6.2 Hz, 4H), 2.29 (s, 3 II), 1.86-1.82 (m, 4H), 1.46 (m, 2H), 1.21 (s, J=8.4 Hz, 3H). MS(ESI): m/z Calcd. For C.sub.28H.sub.28N.sub.4O.sub.2 436.2263; found 437.2340, [M+H].sup.+.

Example 28

[0128] ##STR00056##

[0129] To a stirred solution of compound IV-21 (0.792 g, 2.0 mmol), p-toluenesulfonyl chloride (0.476 g, 2.5 mmol) in 100 mL dry DCM, TEA (0.303 g, 3.0 mmol) was added at rt under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the reaction was poured into 200 mL water, and extracted with DCM three times. The organic layer was dried over anhydrous MgSO.sub.4, filtered, and concentrated under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound 27 (0.822 g, 76%)..sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ8.18 (d, J=8.5 Hz, 2H), 8.08-8.02 (m, 2H), 7.98-7.90 (m, 3H), 7.40 (d, J=15.9 Hz, 1H), 7.18 (d, J=8.2 Hz, 2H), 7.00 (s, 1H), 6.86-6.72 (m, 2H), 6.47 (d, J=8.2 Hz, 2H), 4.06 (t, J=6.1 Hz, 2H), 3.49 (t, J=6.1 Hz, 2H), 3.28 (s, 3H), 2.77 (s, 3H), 2.31 (s, 3H). MS(ESI): m/z Calcd. For C.sub.30H.sub.29N.sub.4O.sub.4S 541.2; found 541.2, [M+H].sup.+.

##STR00057##

[0130] To a stirred solution of compound 20 (0.541 g, 1.0 mmol) in 20 mL dry DMF, sodium sulfite (0.630 g, 5.0 mmol) was added, the mixture solution was heated to 50° C. and stirred for 24 hrs under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the solvent was removed under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound 27 (0.301 g, 60%). .sup.1H-NMR(400 MHz, DMSO-d.sub.6): 58.18 (d, J=8.5 Hz, 2H), 8.08-8.02 (m, 2H), 7.98-7.90 (m, 3H), 7.40 (d, J=15.9 Hz, 1H), 7.00 (s, 1H), 6.86-6.72 (m, 2H), 3.85 (m, 4H), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.6 Hz, 2H), 3.28 (s, 3H), 3.16 (m, 4H), 2.77 (s, 3H). MS(ESI): m/z Calcd. For C.sub.23H.sub.21N.sub.4O.sub.4S 499.1289; found 499.1288, [M−H].sup.−.

Example 29

[0131] ##STR00058##

[0132] To a stirred solution of compound IV-21 (0.386 g, 1.0 mmol), compound 31 (0.265 g, 1.2 mmol), EDCl (0.382 g, 2.0 mmol) in 30 mL dry DMF, DMAP (0.183 g, 1.5 mmol) was added. The mixture solution was stirred at rt under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the solvent was removed under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound IV-29 (0.490 g, 83%). .sup.1H-NMR(400 MHz, DMSO-d.sub.6): δ8.18 (d, J=8.5 Hz, 2H), 8.08-8.02 (m, 2H), 7.98-7.90 (m, 3H), 7.40 (d, J=15.9 Hz, 1H), 7.00 (s, 1H), 6.86-6.72 (m, 2H), 4.17 (s, 2H), 3.75 (s, 3H), 3.6-3.7 (m, 10H), 3.57 (m, 2H), 3.52 (t, J=5.6 Hz, 2H), 3.38 (s, 3H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.32H.sub.39N.sub.4O.sub.7S 591.2819; found 591.2820, [M+H].sup.+.

Example 30

[0133] ##STR00059##

[0134] This compound was obtained by following the general procedure for CompoundIV-5, (0.612 g, 87%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ8.15 (d, J=9.0 Hz, 2H), 8.14 (d, J=9.0 Hz, 2H), 7.21 (s, 1H), 4.23 (s, 2H), 4.11 (s, 3H), 3.38 (t, J=6.4 Hz, 2H), 3.01 (s, 3H), 2.92 (t, J=6.4 Hz, 2H), 2.41 (s, 3H). MS(ESI): m/z Calcd. For C.sub.18H.sub.25N.sub.4O.sub.3 345.2; found 345.2, [M+H].sup.+.

##STR00060##

[0135] This compound was obtained by following the general procedure for CompoundIV-1, (0.422 g, 36%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ8.15 (d, J=9.0 Hz, 2H), 8.14 (d, J=9.0 Hz, 2H), 7.95 (d, J=16.0 Hz, 1H), 7.82 (d, J=8.4 Hz, 2H), 7.32 (d, J=8.4 Hz, 2H), 7.21 (s, 1H), 7.01 (d, J=16.0 Hz, 1H), 4.23 (s, 2H), 4.11 (s, 3H), 3.38 (t, J=6.4 Hz, 2H), 3.01 (s, 3H), 2.92 (t, J=6.4 Hz, 2H).MS(ESI): m/z Calcd. For C.sub.25H.sub.28BrN.sub.4O.sub.3 511.1345; found 511.1344, [M+H].sup.+.

Example 31

[0136] ##STR00061##

[0137] This compound was obtained by following the general procedure for CompoundIV-23, (0.912 g, 89%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6): δ8.17 (d, J=8.6 Hz, 2H), 7.91 (d, J=15.8 Hz, 1H), 7.79 (dt, J=10.6, 2.1 Hz, 1H), 7.66 (d, J=7.8 Hz, 1H), 7.50 (td, J=8.0, 6.2 Hz, 1H), 7.34-7.20 (m, 2H), 7.18 (d, J=8.2 Hz, 2H), 6.97 (s, 1H), 6.84-6.73 (m, 2H), 6.47 (d, J=8.2 Hz, 2H), 4.06 (t, J=6.1 Hz, 2H), 3.49 (t, J=6.1 Hz, 2H), 3.27 (s, 3H), 3.06 (s, 3H), 2.77 (s, 3H), 2.31 (s, 3H). MS(ESI): m/z Calcd. For C.sub.29H.sub.29FN.sub.3O.sub.4S 534.2; found 534.2, [M+H].sup.+.

##STR00062##

[0138] To a stirred solution of compound 23 (0.534 g, 1.0 mmol) in 35 mL dry DMF, NaN.sub.3 (0.195 g, 3.0 mmol) was added carefully. The mixture solution heated to 50° C. over night under Ar atomophere. The solution was cooled down to rt and poured into 100 ml water and extracted with DCM for three times. The organic layer was dried over anhydrous MgSO.sub.4, filtered, and concentrated under reduced pressure to give the crude product, which was used for next step without further purification.

[0139] To a stirred solution of crud production and Ph.sub.3P (0.524 g, 2.0 mmol) in 30 mL THF, 2 mL water was added. The mixture solution was stirred at rt under Ar atomophere over night. After completion of reaction, the solvent was removed under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound (0.301 g, 79%). .sup.1H-NMR(400 MHz, DMSO-d.sub.6): δ8.17 (d, J=8.6 Hz, 2H), 7.91 (d, J=15.8 Hz, 1H), 7.79 (dt, J=10.6, 2.1 Hz, 1H), 7.66 (d, J=7.8 Hz, 1H), 7.50 (td, J=8.0, 6.2 Hz, 1H), 7.34-7.20 (m, 2H), 6.97 (s, 1H), 6.84-6.73 (m, 2H), 3.38 (t, J=6.4 Hz, 2H), 2.92 (t, J=6.4 Hz, 2H), 3.27 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.22H.sub.24FN.sub.4O 379.1934; found 379.1935, [M+H].sup.+.

Example 32

[0140] ##STR00063##

[0141] To a stirred solution of compound 24 (0.534 g, 1.0 mmol) in 50 mL ethanol, Dimethylamine aqueous solution, the complet mixture was heated to reflux under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the reaction cooled down to rt and the solvent was removed under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound (0.276 g, 68%). .sup.1H-NMR(400 MHz, DMSO-d.sub.6): δ8.17 (d, J=8.6 Hz, 2H), 7.91 (d, J=15.8 Hz, 1H), 7.79 (dt, J=10.6, 2.1 Hz, 1H), 7.66 (d, J=7.8 Hz, 1H), 7.50 (td, J=8.0, 6.2 Hz, 1H), 7.34-7.20 (m, 2H), 6.97 (s, 1H), 6.84-6.73 (m, 2H), 3.47 (t, J=7.6 Hz, 2H), 2.96 (s, 3H), 2.49 (t, J=7.6 Hz, 2H), 2.31 (s, 6H). MS(ESI): m/z Calcd. For C.sub.24H.sub.28FN.sub.4O 407.2247; found 407.2246, [M+H].sup.+.

Example 33

[0142] ##STR00064##

[0143] This compound was obtained by following the general procedure for CompoundIV-5, (0.842 g, 89%)○.sup.1H-NMR (400 MHz, CDCl.sub.3) δ=7.97 (d, J=8.6 Hz, 1H), 7.88 (s, 1H), 6.85 (s, 1H), 6.56 (d, J=8.6 Hz, 1H), 5.40 (s, 1H), 3.07 (s, 3H), 2.84 (s, 3H), 2.31 (s, 3H), 1.94 (s, 3H), 1.32 (s, 6H). MS(ESI): m/z Calcd. For C.sub.19H.sub.24N.sub.3O 310.2; found 310.2, [M+H].sup.+.

##STR00065##

[0144] This compound was obtained by following the general procedure for CompoundIV-1, (0.222 g, 21%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ=7.97 (d, J=8.6 Hz, 1H), 7.90 (d, J=16.0 Hz, 1H), 7.88 (s, 1H), 7.87 (d, J=4.0 Hz, 2H), 7.43 (d, J=4.0 Hz, 2H), 7.01 (d, J=16.0 Hz, 1H), 6.85 (s, 1H), 6.56 (d, J=8.6 Hz, 1H), 5.40 (s, 1H), 3.07 (s, 3H), 2.84 (s, 3H), 1.94 (s, 3H), 1.32 (s, 6H).MS(ESI): m/z Calcd. For C.sub.27H.sub.26N.sub.4O 422.2107; found 423.2186, [M+H].sup.+.

Example 34

[0145] ##STR00066##

[0146] This compound was obtained by following the general procedure for CompoundIV-5, (0.732 g, 81%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ=7.40 (dd, J=8.32, 1.93 Hz, 1H), 7.29 (d, J=1.89 Hz, 1H), 7.15 (s, 1H), 6.68 (d, J=8.35 Hz, 1H), 4.23-4.31 (m, 2H), 3.40-3.49 (m, 2H), 3.21 (s, 3H), 3.03 (s, 3H), 2.42 (s, 3H). MS(ESI): m/z Calcd. For C.sub.15H.sub.18N.sub.3O.sub.2 227.1; found 227.1, [M+H].sup.+.

##STR00067##

[0147] This compound was obtained by following the general procedure for CompoundIV-1, (0.222 g, 21%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ=7.95 (d, J=16.0 Hz, 1H), 7.87 (d, J=4.0 Hz, 2H), 7.43 (d, J=4.0 Hz, 2H), 7.40 (dd, J=8.32, 1.93 Hz, 1H), 7.29 (d, J=1.89 Hz, 1H), 7.15 (s, 1H), 7.01 (d, J=16.0 Hz, 1H), 6.68 (d, J=8.35 Hz, 1H), 4.23-4.31 (m, 2H), 3.40-3.49 (m, 2H), 3.03 (s, 3H), 2.42 (s, 3H).MS(ESI): m/z Calcd. For C.sub.22H.sub.20FN.sub.3O.sub.2 377.1540; found 378.1681, [M+H].sup.+.

Example 35

[0148] ##STR00068##

[0149] This compound was obtained by following the general procedure for CompoundIV-1, (0.732 g, 39%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ8.19 (d, J=8.5 Hz, 2H), 8.07 (m, 4H), 8.04 (s, 1H), 7.94 (d, J=8.3 Hz, 2H), 7.44 (d, J=15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H). MS(ESI): m/z Calcd. For C.sub.20H.sub.17N.sub.4O.sub.3359.1; found 359.1, [M+H].sup.+.

##STR00069##

[0150] To a stirred solution of compound 28 (0.718 g, 2.0 mmol) in 100 mL ethyl acetate, Anhydrous stannous chloride (0.758 g, 4.0 mmol) was added. The complet mixture was heated to reflux under Ar atomophere. The progress of reaction was monitored on silica gel TLC. After completion of reaction, the reaction was poured into 150 mL water, and extracted with ethyl acetate for three times. The ° manic layer was dried over anhydrous MgSO.sub.4, filtered, and concentrated under reduced pressure to give the crude product, then purified by silica gel column chromatography to afford a target compound (0.586 g, 89%). .sup.1H NMR (400 MHz, CDCl.sub.3) 8.19 (d, J=8.5 Hz, 2H), 7.97 (m, 4H), 8.04 (s, 1H), 7.94 (d, J=8.3 Hz, 2H), 7.44 (d, J=15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H). MS(ESI): m/z Calcd. For C.sub.20H.sub.17N.sub.4O 329.1402; found 329.1403, [M+H].sup.+.

Example 36

[0151] ##STR00070##

[0152] This compound was obtained by following the general procedure for CompoundIV-5, (0.756 g, 74%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ8.15 (1H, s), 7.81 (2H, m), 7.65 (1H, d, J=9.0 Hz), 7.16 (1H, dd, J=9.0, J=3.0 Hz), 6.95 (s, 1H), 6.88 (1H, d, J=3.0 Hz), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.19H.sub.21N.sub.3O.sub.2 323.2; found 324.2, [M+H].sup.+.

##STR00071##

[0153] This compound was obtained by following the general procedure for CompoundIV-1, (0.272 g, 24%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ8.15 (1H, s), 7.81 (2H, m), 7.65 (1H, d, J=9.0 Hz), 7.49 (m, 1H), 7.40-7.22 (m, 3H), 7.16 (1H, dd, J=9.0, J=3.0 Hz), 6.95 (s, 1H), 6.88 (1H, d, J=3.0 Hz), 3.60 (t, J=5.9 Hz, 2H), 3.52 (t, J=5.9 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.26H.sub.25N.sub.3O.sub.3 427.1896; found 428.1974, [M+H].sup.+.

Example 37

[0154] ##STR00072##

[0155] This compound was obtained by following the general procedure for CompoundIV-13, (0.322 g, 79%)○.sup.1H NMR(400 MHz, DMSO-d.sub.6): δ8.16 (d, J=8.5 Hz, 2H), 7.93 (t, J=4.4 Hz, 2H), 7.90 (d, J=6.1 Hz, 1H), 7.31 (t, J=8.9 Hz, 2H), 7.18 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 6.83-6.72 (m, 2H), 4.21 (s, 2H), 3.59 (t, J=5.9 Hz, 2H), 3.51 (t, J=5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H). MS(ESI): m/z Calcd. For C.sub.25H.sub.25FN.sub.3O.sub.2 418.1931; found 418.1932, [M+H].sup.+.

Example 38

[0156] ##STR00073##

[0157] This compound was obtained by following the general procedure for CompoundIV-5, (0.816 g, 89%) ○.sup.1H NMR (400 MHz, CDCl.sub.3) δ9.02 (d, 1H, J=2.1 Hz), 8.59 (d, 1H, J=2.1 Hz), 7.93 (d, 1H, J=9.1 Hz), 7.34 (dd, 1H, J=9.1, 2.5 Hz), 7.21 (s, 1H), 7.00 (d, 1H, J=2.5 Hz), 3.11 (s, 6H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.17H.sub.18N.sub.4O 294.1; found 295.1, [M+H].sup.+.

##STR00074##

[0158] This compound was obtained by following the general procedure for CompoundIV-1, (0.272 g, 24%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ=9.02 (d, 1H, J=2.1 Hz), 8.59 (d, 1H, J=2.1 Hz), 7.95 (d, J=16.0 Hz, 1H), 7.93 (d, 1H, J=9.1 Hz), 7.49 (m, 1H), 7.40-7.22 (m, 3H), 7.34 (dd, 1H, J=9.1, 2.5 Hz), 7.21 (s, 1H), 7.15 (d, J=16.0 Hz, 1H), 7.00 (d, 1H, J=2.5 Hz), 3.11 (s, 6H), 3.06 (s, 3H). MS(ESI): m/z Calcd. For C.sub.25H.sub.21N.sub.5O 407.1821; found 408.1825, [M+H].sup.+.

Comparative Example 1

[0159] ##STR00075##

[0160] This compound was obtained by following the general procedure for CompoundIV-1, (0.275 g, 75%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ11.00 (s, 1H), 8.08-8.04 (m, 2H), 8.02 (d, J=15.9 Hz, 1H), 7.92-7.87 (m, 2H), 7.49-7.45 (m, 2H), 7.26 (d, J=15.9 Hz, 1H), 6.98 (s, 1H), 3.29 (s, 3H). MS(ESI): m/z Calcd. For C.sub.19H.sub.13F.sub.2N.sub.3O.sub.2 339.0951; found 339.0950, [M−H].sup.−.

Comparative Example 2

[0161] ##STR00076##

[0162] This compound was obtained by following the general procedure for CompoundIV-1, (0.327 g, 55%)○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ9.70 (s, 1H), 8.05 (d, J=8.9 Hz, 2H), 7.98-7.89 (m, 1H), 7.30 (t, J=6.2 Hz, 1H), 7.26 (d, J=8.9 Hz, 1H), 7.15 (d, J=15.8 Hz, 1H), 6.97 (s, 1H), 6.87 (d, J=7.5 Hz, 1H), 3.27 (s, 3H). MS(ESI): m/z Calcd. For C.sub.18H.sub.12F.sub.2N.sub.3O.sub.2 340.0903; found 340.090, [M−H].sup.−.

Comparative Example 3

[0163] ##STR00077##

[0164] This compound was obtained by following the general procedure for CompoundIV-1, (0.342 g, 46%) ○.sup.1H NMR(400 MHz, DMSO-d.sub.6): δ=8.21 (d, 2H, J=8.8 Hz), 8.00 (d, 1H, J=16 Hz), 7.85 (d, 2H, J=8.0 Hz), 7.50-7.43 (m, 2H), 7.42 (d, J=2.6 Hz, 1H), 7.24 (s, 1H), 7.01 (s, 1H), 6.92 (d, 2H, J=8.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H). MS(ESI): m/z Calcd. For C.sub.22H.sub.24N.sub.3O.sub.2 362.1869; found 362.1868, [M+H].sup.+.

Comparative Example 4

[0165] ##STR00078##

[0166] This compound was obtained by following the general procedure for CompoundIV-1, (0.312 g, 43%)○.sup.1H NMR (400 MHz, CDCl.sub.3) δ=8.15 (1H, s), 8.00 (d, 1H, J=16 Hz), 7.85 (d, 2H, J=8.0 Hz), 7.81 (2H, m), 7.65 (1H, d, J=9.0 Hz), 7.20 (s, 1H), 7.50-7.43 (m, 3H), 7.42 (d, 1H, J=16 Hz), 7.16 (1H, dd, J=9.0, J=3.0 Hz), 6.88 (1H, d, J=3.0 Hz), 3.65 (t, J=7.2 Hz, 2H), 3.45 (t, J=7.2 Hz, 2H), 3.35 (s, 3H) 3.03 (s, 3H).MS(ESI): m/z Calcd. For C.sub.26H.sub.26N.sub.3O.sub.2 412.2025; found 412.2026, [M+H].sup.+.

Comparative Example 5

[0167] ##STR00079##

[0168] This compound was obtained by following the general procedure for CompoundIV-1, (0.412 g, 46%) ○.sup.1H NMR(400 MHz, DMSO-d.sub.6): δ=8,72 (s, 2H), 8.00 (d, 1H, J=16 Hz), 7.50-7.43 (m, 2H), 7.42 (d, J=2.6 Hz, 1H), 7.24 (s, 1H), 7.01 (s, 1H), 6.92 (d, 2H, J=8.8 Hz), 3.75 (t, J=6.8 Hz, 2H), 3.60 (t, 2H, J=6.8 Hz), 3.05 (s, 3H). MS(ESI): m/z Calcd. For C.sub.21H.sub.21IN.sub.6O 373.1777; found 373.1778, [M+H].sup.+.

Comparative Example 6

[0169] ##STR00080##

[0170] This compound was obtained by following the general procedure for CompoundIV-1, (0.192 g, 33%) ○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ7.96-7.99 (m, 4H), 7.33-7.37 (m, 3H), 6.98 (s, 1H), 3.24 (s, 3H). MS (ESI): m/z Calcd. For C.sub.19H.sub.12F.sub.4N.sub.2O.sub.2 376.0835; found 376.0830, [M−H].sup.−.

Comparative Example 7

[0171] ##STR00081##

[0172] This compound was obtained by following the general procedure for CompoundIV-1, (0.192 g, 33%) ○.sup.1H NMR (400 MHz, DMSO-d.sub.6) δ7.96-7.99 (m, 4H), 7.33-7.37 (m, 3H), 6.98 (s, 1H), 3.24 (s, 3H). MS (ESI): m/z Calcd. For C.sub.19H.sub.12F.sub.4N.sub.2O.sub.2 376.0835; found 376.0830, [M−H].sup.−.

Comparative Example 8

[0173] ##STR00082##

[0174] This compound was obtained by following the general procedure for CompoundIV-1, .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ ppm 10.70 (s, 1H), 8.35 (s, 2H), 8.15 (s, 2H), 7.82 (d, J=15.8 Hz, 1H), 7.22 (d, J=15.9 Hz, 1H), 6.95 (s, 1H), 3.27 (s, 3H); HRMS (ESI) m/z: 546.8647 found (calcd for C.sub.19H.sub.12Br.sub.2C.sub.12N.sub.2O.sub.3, [M+H].sup.+ 546.8644).

Comparative Example 9

[0175] ##STR00083##

[0176] This compound was obtained by following the general procedure for CompoundIV-1, .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ ppm 10.38 (s, 1H), 8.18 (d, J=2.0 Hz, 2H), 8.12 (s, 2H), 7.81 (d, J=4.8 Hz, 1H), 7.18 (d, J=4.8 Hz, 1H), 6.93 (s, 1H), 6.78 (d, J=2.0 Hz, 2H), 3.25 (s, 3H), 3.04 (s, 6H); HRMS (ESI) m/z: 505.9855 found (calcd for C.sub.21H.sub.19Br.sub.2N.sub.3O.sub.2, [M+H].sup.+ 505.9896).

Comparative Example 10

[0177] ##STR00084##

[0178] This compound was obtained by following the general procedure for CompoundIV-1, .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ ppm 10.38 (s, 1H), 8.16 (d, J=2.0 Hz, 2H), 8.11 (s, 2H), 7.80 (d, J=4.8 Hz, 1H), 7.18 (d, J=4.8 Hz, 1H), 6.91 (s, 1H), 6.74 (d, J=2.0 Hz, 2H), 3.44 (d, J=4.8 Hz, 2H), 3.25 (s, 3H), 1.14 (t, J=4.8 Hz, 6H); HRMS (ESI) m/z: 534.0154 found (calcd for C.sub.23H.sub.23Br.sub.2N.sub.3O.sub.2, [M+H].sup.+534.0209).

Comparative Example 11

[0179] ##STR00085##

[0180] This compound was obtained by following the general procedure for CompoundIV-1, (0.156 g, 18%) ○.sup.1H NMR (400 MHz, CD.sub.3OD) δ10.52 (s, 1H), 8.07-8.01 (m, 2H), 7.95 (d, J=15.7 Hz, 1H), 7.76 (d, J=8.5 Hz, 2H), 7.01 (d, J=15.7 Hz, 1H), 6.95 (s, 1H), 6.87-6.83 (m, 2H), 4.12 (s, 3H), 3.62 (s, 3H), 1.50 (s, 9H).HR-MS(ESI): m/z Calcd. For C.sub.24H.sub.21F.sub.3N.sub.2O.sub.4 457.5381; found 457.5380, [M−H].sup.−.

Comparative Example 12

[0181] ##STR00086##

[0182] This compound was obtained by following the published procedure (JACS, 2018, 140, 7381-7384.)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ8.17 (d, J=8.3 Hz, 2H), 7.79 (d, J=15.6 Hz, 1H), 7.55 (d, J=8.8 Hz, 2H), 6.84 (s, 1H), 6.80 (dd, J=9.9, 2.8 Hz, 2H), 6.75 (dd, J=8.8, 5.6 Hz, 2H), 6.66 (d, J=15.6 Hz, 1H), 4.82 (s, 2H), 4.38 (s, 2H), 3.59-3.43 (m 8H), 3.41-3.35 (m, 2H), 3.20-3.13 (m, 2H), 3.04 (s, 6H), 2.12-1.17 (m, 18H). HR-MS(ESI): m/z Calcd. For C.sub.37H.sub.44ClF.sub.3N.sub.4O.sub.6 732.2901; found 733.2980, [M−H].sup.−.

Comparative Example 13

[0183] ##STR00087##

[0184] This compound was obtained by following the published procedure (JACS, 2018, 140, 7381-7384.)○.sup.1H NMR (400 MHz, CD.sub.3OD) δ8.17 (d, J=8.3 Hz, 2H), 7.79 (d, J=15.6 Hz, 1H), 7.55 (d, J=8.8 Hz, 2H), 6.84 (s, 1H), 6.80 (dd, J=9.9, 2.8 Hz, 2H), 6.75 (dd, J=8.8, 5.6 Hz, 2H), 6.66 (d, J=15.6 Hz, 1H), 4.82 (s, 2H), 4.38 (s, 2H), 3.59-3.43 (m 8H), 3.41-3.35 (m, 2H), 3.20-3.13 (m, 2H), 3.04 (s, 6H), 2.12-1.17 (m, 18H). HR-MS(ESI): m/z Calcd. For C.sub.38H.sub.44ClF.sub.3N.sub.5O.sub.6 739.2948; found 740.3026, [M+H].sup.−.

Test Example 1

[0185] Fluorescent dyes IV-1 to IV-38 (molecular rotors) prepared in Embodiments 1 to 38 were respectively dissolved in dimethyl sulfoxide to respectively prepare mother liquor with a concentration of 1×10.sup.−2 M, wherein each mother liquor was respectively added to glycerin and methanol and blended, and thus respectively preparing a solution with a final concentration of 1×10.sup.−5 M; according to different fluorescent dyes, fluorescence emission spectra thereof were successively detected by means of the maximum excitation wavelength of each fluorescent dye under the same condition, and the results are shown in Table 1, indicating that the fluorescent dye of the present disclosure sensitively responds to viscosity variations.

TABLE-US-00001 TABLE 1 Maximum Excitation Glycerin/Methanol Compounds Wavelength (nm) Fluorescence Intensity Ratio IV-1 618 987 IV-2 595 687 IV-3 565 951 IV-4 574 687 IV-5 570 861 IV-6 578 921 IV-7 570 873 IV-8 638 861 IV-9 615 697 IV-10 620 779 IV-11 595 698 IV-12 573 898 IV-13 590 711 IV-14 585 699 IV-15 586 730 IV-16 595 689 IV-17 575 655 IV-18 595 890 IV-19 577 821 IV-20 577 781 IV-21 624 655 IV-22 580 689 IV-23 617 915 IV-24 551 934 IV-25 591 918 IV-26 555 937 IV-27 600 890 IV-28 620 942 IV-29 618 829 IV-30 582 921 IV-31 581 902 IV-32 580 999 IV-33 605 729 IV-34 603 810 IV-35 561 776 IV-36 690 792 IV-37 580 801 IV-38 705 529

Test Example 2

[0186] Molecular rotors IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, IV-22 were added to a diethanol-glycerol mixed solution to prepare a solution with a final concentration of 1×10.sup.−5 M, wherein the solution was excited at 480 nm, fluorescence emission spectra at different viscosity conditions are shown as FIGS. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and molecular rotors of the same concentration have gradually increasing fluorescence intensity at different viscosity conditions, indicating that the fluorescence intensity of molecular rotors increases following the increasing fluorescence of environmental viscosity, and proving that molecular rotors are sensitive to viscosity and are a kinds of molecular rotors.

Test Example 3

[0187] Molecular rotors (IV-39, IV-40, IV-44 and IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-7, IV-8; IV-41, IV-43 and IV-17, IV-18, IV-19, IV-20, IV-21, IV-22; IV-42 and IV-36; IV-45, IV-46 and IV-3; IV-47, IV-48 and IV-20; IV-49, IV-50 and IV-5; IV-51 and IV-1) were dissolved in DMSO to prepare mother liquor of 1×10.sup.−3 M, wherein the afore-mentioned mother liquor was respectively taken and added to a PBS solution to prepare a solution with a final concentration of 1×10.sup.−6 M, and was respectively excited by the maximum excitation wavelength of each compound, so that fluorescent intensities thereof in PBS were detected and each sample was normalized with the strongest fluorescence in each group as 100, as respectively shown in FIG. 13, FIG. 14, FIG. 15, FIG. 16, FIG. 17, FIG. 18 and FIG. 19. According to the results shown in FIG. 13, FIG. 14 and FIG. 15, relative to the molecular rotors with no substitution on the aromatic ring of the electron-withdrawing group, molecular rotors with hydroxyl radical, cyano group, fluorine atom, chlorine atom, bromine atom, iodine atom substitutions on the aromatic ring of the electron-withdrawing group in the present disclosure have lower background fluorescence; according to the results shown in FIG. 16 and FIG. 17, relative to the molecular rotors with multiple substitutions on the aromatic ring of the electron-withdrawing group, molecular rotors with single substitution have relatively lower background fluorescence, and it may be that the electron cloud distribution of the aromatic structure on the electron-withdrawing group is changed by the multiple substitutions, which causes an increase in the fluorescence background; according to the results shown in FIG. 18 and FIG. 19, the background fluorescence is even lower when simple alkyl substitution occurs at R.sub.1, and it may be caused by relatively large volume of R.sub.1 or weak interaction between heteroatoms (e.g. oxygen atoms, nitrogen atoms) on modified alkyl group and the aromatic ring on the electron-withdrawing group, as a result, non-radioactive energy dissipation motion such as double bond rotation is inhibited and the fluorescence background of the compound is thus increased.

Test Example 4

[0188] Compounds IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, IV-22 specifically bound to RNA aptamer (UUGCCAUGUGUAUGUGGGAGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUU GUAAACACGCCGGAAGAUUGUAAACACGCCGAAAGGCGGACACUUCCGGCGGACACUUCCGGCGGAC ACUUCCGGCGGACACUUCCUCCCACAUACUCUGAUGAUCCUUCGGGAUCAUUCAUGGCAA), and the compound fluorescence after binding was noticeably activated and emitted bright fluorescence when being excited by excitation light at a suitable wavelength, see Table 2 for the optical properties after binding; the compounds could also bind to this aptamer in cells, and cells expressing the RNA aptamer had bright fluorescence, as shown in FIG. 20A; and cells not expressing the RNA aptamer had no fluorescence, as shown in FIG. 20B, indicating that dyes of this series can be used for nucleic acid labeling.

TABLE-US-00002 TABLE 2 Compounds Ex/nm Em/nm ε (M.sup.−1 cm.sup.−1) QY (−) IV-1 510 618 20667 0.17 IV-2 492 595 25000 0.36 IV-3 490 565 26000 0.27 IV-4 490 574 23333 0.37 IV-5 492 570 23000 0.33 IV-6 490 578 24000 0.37 IV-17 524 582 32000 0.47 IV-18 536 600 25000 0.43 IV-19 522 590 30000 0.43 IV-20 512 577 25500 0.36 IV-21 534 624 26222 0.28 IV-22 522 580 32000 0.46 Note: the fluorescence quantum yield was measured by the relative method with Rhodamine 6G as the standard (QY = 0.94).

Test Example 5

[0189] Stable cell line (293 T/17) of mRNA cytoskeletal protein, which is labeled by continuously-expressing RNA aptamer (AUGGAUGAUGAUAUCGCCGCGCUCGUCGUCGACAACGGCUCCGGCAUGUGCAAGGCCGGCUUCGC GGGCGACGAUGCCCCCCGGGCCGUCUUCCCCUCCAUCGUGGGGCGCCCCAGGCACCAGGGCGUGAU GGUGGGCAUGGGUCAGAAGGAUUCCUAUGUGGGCGACGAGGCCCAGAGCAAGAGAGGCAUCCUCA CCCUGAAGUACCCCAUCGAGCACGGCAUCGUCACCAACUGGGACGACAUGGAGAAAAUCUGGCACCA CACCUUCUACAAUGAGCUGCGUGUGGCUCCCGAGGAGCACCCCGUGCUGCUGACCGAGGCCCCCCUG AACCCCAAGGCCAACCGCGAGAAGAUGACCCAGAUCAUGUUUGAGACCUUCAACACCCCAGCCAUGU ACGUUGCUAUCCAGGCUGUGCUAUCCCUGUACGCCUCUGGCCGUACCACUGGCAUCGUGAUGGACU CCGGUGACGGGGUCACCCACACUGUGCCCAUCUACGAGGGGUAUGCCCUCCCCCAUGCCAUCCUGCG UCUGGACCUGGCUGGCCGGGACCUGACUGACUACCUCAUGAAGAUCCUCACCGAGCGCGGCUACAG CUUCACCACCACGGCCGAGCGGGAAAUCGUGCGUGACAUUAAGGAGAAGCUGUGCUACGUCGCCCU GGACUUCGAGCAAGAGAUGGCCACGGCUGCUUCCAGCUCCUCCCUGGAGAAGAGCUACGAGCUGCC UGACGGCCAGGUCAUCACCAUUGGCAAUGAGCGGUUCCGCUGCCCUGAGGCACUCUUCCAGCCUUC CUUCCUGGGCAUGGAGUCCUGUGGCAUCCACGAAACUACCUUCAACUCCAUCAUGAAGUGUGACGU GGACAUCCGCAAAGACCUGUACGCCAACACAGUGCUGUCUGGCGGCACCACCAUGUACCCUGGCAUU GCCGACAGGAUGCAGAAGGAGAUCACUGCCCUGGCACCCAGCACAAUGAAGAUCAAGAUCAUUGCU CCUCCUGAGCGCAAGUACUCCGUGUGGAUCGGCGGCUCCAUCCUGGCCUCGCUGUCCACCUUCCAG CAGAUGUGGAUCAGCAAGCAGGAGUAUGACGAGUCCGGCCCCUCCAUCGUCCACCGCAAAUGCUUC UAGCACUCGCUAGAGCAUGGUUAAGCUUGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCC GGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGAAAGGCGGACACUUCCGGCGGACACUU CCGGCGGACACUUCCGGCGGACACUUCC) and control cells (293T/17) grew under a conventional mammalian cell culture condition (37° C., 5% carbon dioxide, 100% relative humidity), and the cells were digested after a cell confluence of 90% and were centrifuged at 800 rpm; then the cells were re-suspended with PBS containing 0.2 μM of IV-21 and IV-41 molecules, and were incubated for 5 minutes before flow detection, see FIGS. 21A and 21B for the detection results; IV-21 molecules could specifically label mRNA of ACTB in cell lines expressing target RNA, and there was no obvious background fluorescence (as shown in FIG. 21A), while the background fluorescence of IV-41 molecules was higher than that of IV-21, and it was unclear whether ACTB was expressed (see FIG. 21B).