Genetically engineered strain for producing porcine myoglobin and food-grade fermentation and purification thereof

11639515 · 2023-05-02

Assignee

Inventors

Cpc classification

International classification

Abstract

The disclosure discloses a genetically engineered strain for producing porcine myoglobin and fermentation and purification thereof, and belongs to the technical field of genetic engineering. The disclosure realizes efficient secretion and expression of porcine myoglobin by integrating the gene of porcine myoglobin in P. pastoris. On this basis, optimization of the medium and culture conditions of recombinant P. pastoris can significantly increase the titer of porcine myoglobin, so that the titer can reach 285.42 mg/L under fermenter conditions. In addition, by creatively adding different concentrations of ammonium sulfate to fermentation broth step by step, the purity of myoglobin obtained by final concentration is up to 88.0%, and the purification rate is up to 66.1%. The disclosure realizes efficient expression and high purification of porcine myoglobin from various steps such as synthesis, fermentation and purification of porcine myoglobin, and provides broad prospects for industrial production of porcine myoglobin.

Claims

1. A genetically engineered P. pastoris strain comprising an expression vector, wherein the expression vector comprises a nucleotide sequence encoding an amino acid sequence of porcine myoglobin which is set forth in SEQ ID NO:13; wherein the nucleotide sequence is SEQ ID NO:1; wherein the expression vector comprises a glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter or a G1 promoter, wherein the nucleotide sequence encoding the G1 promoter is set forth in SEQ ID NO: 12; and wherein the expression vector comprises a signal peptide nucleotide sequence selected from the group consisting of: an α-factor signal peptide nucleotide sequence set forth in SEQ ID NO:44, an α-amylase signal peptide nucleotide sequence set forth as SEQ ID NO:2, a glucoamylase signal peptide nucleotide sequence set forth as SEQ ID NO:3, an inulinase signal peptide nucleotide sequence set forth as SEQ ID NO:4, an invertase signal peptide nucleotide sequence set forth as SEQ ID NO:5, a lysozyme signal peptide nucleotide sequence set forth as SEQ ID NO:6, a killer protein signal peptide nucleotide sequence set forth as SEQ ID NO:7, a serum albumin signal peptide nucleotide sequence set forth as SEQ ID NO:8, an sp23 signal peptide nucleotide sequence set forth as SEQ ID NO:9, an nsB signal peptide nucleotide sequence set forth as SEQ ID NO: 10, and a pre-Ost1-alpha factor signal peptide nucleotide sequence set forth as SEQ ID NO:11.

2. The genetically engineered strain according to claim 1, wherein the P. pastoris is P. pastoris X33 or P. pastoris KM71.

3. A method of producing porcine myoglobin which comprises fermenting the genetically engineered strain of P. pastoris according to claim 1 under conditions conducive to expressing the porcine myoglobin gene.

4. The method according to claim 3, further comprising inoculating the genetically engineered strain of P. pastoris into a shake flask or a fermenter comprising fermentation medium, wherein the fermentation medium comprises YPD medium, YPG medium, or BMGY medium.

5. The method according to claim 4, further comprising growing a seed solution of the genetically engineered strain of P. pastoris prior to the inoculating step, wherein the seed solution is inoculated into the shake flask or the fermenter, and wherein the seed culture comprises the genetically engineered strain of P. pastoris which is grown in fermentation medium to an OD.sub.600 of 6-10, wherein the seed solution added to the shake flask or the fermenter at an amount of 1% to 5% of the total volume, and wherein fermenting is conducted at a temperature of 25° C. to 35° C., a pH of 4.0 to 7.0, a shake speed of 150 rpm to 300 rpm, and for a time period of at least 60 hours.

6. The method according to claim 5, wherein the fermentation medium comprises 20 mg/L to 40 mg/L hemin.

7. The method according to claim 5, wherein in the fermentation medium comprises: a) 10 g/L to 20 g/L glycerol, 10 g/L to 20 g/L glucose, or 10 g/L to 20 g/L sorbitol, and b) 15 g/L to 25 g/L tryptone, 15 g/L to 25 g/L corn syrup, 15 g/L to 25 g/L beef extract, 15 g/L to 25 g/L diammonium hydrogen phosphate, or 15 g/L to 25 g/L ammonium sulfate.

8. The method according to claim 4, wherein the seed solution of the genetically engineered strain of P. pastoris is cultured to an OD.sub.600 of 8-10, and wherein the seed solution is then inoculated into the fermentation medium at an amount of 5% to 10% of the total volume, and fermenting is performed at 25° C. to 35° C., an aeration rate of 1.0 VVM to 2.0 VVM, a pH of 4.0 to 7.0, and a dissolved-oxygen (DO) level of 20% to 30%, for a time period of at least 70 hour.

9. The method according to claim 8, wherein when the DO level is not less than 30%, and wherein 50 mg/L to 150 mg/L of hemin is added to the fermentation medium.

10. The method according to claim 9, wherein the fermentation medium comprises: 10 g to 30 g tryptone, 5 g to 15 g glycerol, 5 g to 15 g yeast extract, and 1×10.sup.−4 g to 5×10.sup.−4 g biotin.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1 shows a SDS-PAGE analysis and a titer diagram of porcine myoglobin produced by fermentation of recombinant strains P. pastoris X33-α GAP-Mb, P. pastoris GS115-α GAP-Mb, P. pastoris KM71-α GAP-Mb, and P. pastoris SMD1168-α GAP-Mb.

(2) FIG. 2 shows a SDS-PAGE analysis and a titer diagram of porcine myoglobin produced by fermentation of recombinant strains with different signal peptides, and lanes 1 to 9 represent P. pastoris X33-SP23-Mb, X33-HSA-Mb, X33-α-amylase-Mb, X33-nsB-Mb, X33-Inulinase-Mb, X33-Invertase-Mb, X33-Glucoamylase-Mb, X33-Killer protein-Mb and X33-Lysozyme-Mb respectively.

(3) FIG. 3 is a comparative SDS-PAGE analysis and a titer diagram of porcine myoglobin produced by fermentation of recombinant strains P. pastoris X33-G1-Mb and P. pastoris X33-α GAP-Mb containing G1 promoters.

(4) FIG. 4A shows a titer diagram of porcine myoglobin corresponding to different fermentation media at the shake flask level.

(5) FIG. 4B shows a titer diagram of porcine myoglobin corresponding to different carbon sources at the shake flask level, and lanes 1 to 3 represent glucose, sorbitol and glycerol respectively.

(6) FIG. 4C shows a titer diagram of porcine myoglobin corresponding to different nitrogen sources at the shake flask level, and lanes 1 to 5 represent ammonium sulfate, diammonium hydrogen phosphate, corn syrup, beef extract and tryptone respectively.

(7) FIG. 5A shows a titer diagram of porcine myoglobin produced by fermentation under different hemin addition concentration at the shake flask level.

(8) FIG. 5B shows a titer diagram of porcine myoglobin produced by fermentation under different temperature at the shake flask level.

(9) FIG. 6 shows results of optimization of dissolved oxygen at the fermenter level.

(10) FIG. 7 shows results of optimization of the hemin fed-batch concentration at the fermenter level.

(11) FIG. 8 shows comparison results of culture at the fermenter level of recombinant P. pastoris containing GAP and G1 promoters respectively.

(12) FIG. 9 shows a SDS-PAGE electrophoretogram of concentrated proteins salted out with different concentration of ammonium sulfate in Example 3.

(13) FIG. 10 shows a SDS-PAGE electrophoretogram of proteins purified by desalting-gel filtration chromatography and desalting-DEAE anion exchange chromatography.

(14) FIG. 11 shows a comparison diagram of purification rates of porcine myoglobin purified by different methods.

(15) FIG. 12A shows a comparison diagram of purity of porcine myoglobin purified by different methods, and lanes 1 to 5 represent ultrafiltration concentration-Q anion exchange chromatography, desalting-DEAE anion exchange chromatography, desalting-gel filtration chromatography, ultrafiltration concentration solution 1, and ultrafiltration concentration solution 2 respectively.

(16) FIG. 12B shows a SDS-PAGE of protein purified by ultrafiltration concentration-Q anion exchange chromatography, and lanes 1 to 9 represent 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% and 90% concentration of NaCl respectively.

(17) FIG. 13 is a diagram showing extraction and analysis of heme tracked in porcine myoglobin.

DETAILED DESCRIPTION

(18) Determination of yeast OD.sub.600: 1 mL of yeast solution is added into a centrifuge tube, and the corresponding yeast solution is pipetted, diluted with sterile water the corresponding multiple, and measured in a UV spectrophotometer. The step is repeated three times.

(19) Determination of protein content: A Bradford protein concentration assay kit developed by Beyotime Institute of Biotechnology is used for detection. Refer to the instructions for use of the kit for the specific operation steps.

(20) YPD medium: Each liter of YPD medium contains 20 g of tryptone, 20 g of glucose and 10 g of yeast extract; and 20 g of agar powder is added for per liter of solid medium.

(21) YPG medium: Each liter of YPG medium contains 20 g of tryptone, 20 g of glucose and 10 g of glycerol; and 20 g of agar powder is added for per liter of solid medium.

(22) BMGY medium: Each liter of BMGY medium contains 20 g of tryptone, 10 g of glycerol, 10 g of yeast extract, and 4×10.sup.−4 g of biotin.

(23) Composition of the fermentation medium of a fermenter: BMGY medium and hemin with the final concentration of 40 mg/L.

(24) Composition of the fermentation medium in a shake flask: BMGY medium and hemin with the final concentration of 40 mg/L.

(25) Determination of protein content: A Bradford protein concentration assay kit developed by Beyotime Institute of Biotechnology is used for detection. Refer to the instructions for use of the kit for the specific operation steps.

(26) TABLE-US-00001 TABLE 1 Primers used in the examples Primer Sequence HSA-F1 GTGGGTTACCTTTATCTCTTTGTTGTTTCTTTTCTCTTCTGCTTACT SEQ ID NO: 14 CTATGGGTTTGTCTGATGGTGAATGG HSA-F2 TATTTGTCCCTATTTCAATCAATTGAACAACTATAATTCGAAACGAT SEQ ID NO: 15 GAAGTGGGTTACCTTTATCTCTTTGTTGTTT HSA-R ATAGTTGTTCAATTGATTGAAATAGGGACAAAT SEQ ID NO: 16 SP23-F1 TCTGCTTTGTTGTTGTTGTTCACTTTGGCTTTCGCTATGGGTTTGTC SEQ ID NO: 17 TGATGGTGAATGG SP23-F2 ATTTCAATCAATTGAACAACTATTTCGAAACGATGAAGATCTTGTCT SEQ ID NO: 18 GCTTTGTTGTTGTTGTTCACTTTGGCT SP23-R CGTTTCGAAATAGTTGTTCAATTGATTGAAAT SEQ ID NO: 19 pre-Ost1-F1 TCTCTTGGATTGTGGGATTGTTCCTATGTTTTTTCAACGTGTCTTCT SEQ ID NO: 20 GCTGCTCCAGTCAACACTACAACAGAAGATG pre-Ost1-F2 ATTTCAATCAATTGAACAACTATTTCGAAACGATGAGGCAGGTTTGG SEQ ID NO: 21 TTCTCTTGGATTGTGGGATTGTTCCTATGTT pre-Ost1-R CGTTTCGAAATAGTTGTTCAATTGATTGAAAT SEQ ID NO: 22 Glu-F1 GTCTTTTAGATCCTTGTTGGCTTTGTCTGGTTTGGTTTGTTCTGGTT SEQ ID NO: 23 TGGCTATGGGTTTGTCTGATGGTGAATGG Glu-F2 ATTTGTCCCTATTTCAATCAATTGAACAACTATAATTCGAAACGATG SEQ ID NO: 24 TCTTTTAGATCCTTGTTGGCTTTGTCTGGT Glu-R ATAGTTGTTCAATTGATTGAAATAGGGACAAAT SEQ ID NO: 25 Inu-F1 AAGTTAGCATACTCCTTGTTGCTTCCATTGGCAGGAGTCAGTGCTAT SEQ ID NO: 26 GGGTTTGTCTGATGGTGAATGG Inu-F2 ATTTGTCCCTATTTCAATCAATTGAACAACTATAATTCGAAACGATG SEQ ID NO: 27 AATTAGCATACTCCTTGTTGCTTCCATTG Inu-R ATAGTTGTTCAATTGATTGAAATAGGGACAAAT SEQ ID NO: 28 Invert-F1 CTTTTGCAAGCTTTCCTTTTCCTTTTGGCTGGTTTTGCAGCCAAAAT SEQ ID NO: 29 ATCTGCAATGGGTTTGTCTGATGGTGAATGG Invert-F2 ATTTGTCCCTATTTCAATCAATTGAACAACTATAATTCGAAACGATG SEQ ID NO: 30 CTTTTGCAAGCTTTCCTTTTCCTTTTGGCTG Invert-R ATAGTTGTTCAATTGATTGAAATAGGGACAAAT SEQ ID NO: 31 Lyso-F1 CCCAATGTGTCTTGTTTTGGTCTTGTTGGGATTGACTGCTTTGTTGG SEQ ID NO: 32 GTATCTGTCAAGGTATGGGTTTGTCTGATGGTGAATGG Lyso-F2 ATTTGTCCCTATTTCAATCAATTGAACAACTATAATTCGAAACGATG SEQ ID NO: 33 CTGGGTAAGAACGACCCAATGTGTCTTGTTTTGGTCTTG Lyso-R ATAGTTGTTCAATTGATTGAAATAGGGACAAAT SEQ ID NO: 34 Killer-F1 CAAGTATTAGTTAGATCCGTCAGTATATTATTTTTCATCACATTACT SEQ ID NO: 35 ACATCTAGTCGTAGCTATGGGTTTGTCTGATGGTGAATGG Killer-F2 ATTTGTCCCTATTTCAATCAATTGAACAACTATAATTCGAAACGATG SEQ ID NO: 36 ACTAAGCCAACCCAAGTATTAGTTAGATCCGTCAGTATA Killer-R ATAGTTGTTCAATTGATTGAAATAGGGACAAAT SEQ ID NO: 37 nsB-F1 CTGGTGTTGCTGGTGTTTTGGCTACTTGTGTTGCTGCTACTCCATTG SEQ ID NO: 38 GTTAAGAGAATGGGTTTGTCTGATGGTGAATGG nsB-F2 ATTTCAATCAATTGAACAACTATTTCGAAACGATGAAGTTGTTGGTC SEQ ID NO: 39 TTTGACTGGTGTTGCTGGTGTTTTGGCTACTTGT nsB-R CGTTTCGAAATAGTTGTTCAATTGATTGAAAT SEQ ID NO: 40 α-amalyse-F1 GGTGGTCTTTGTTTCTGTACGGTCTTCAGGTCGCTGCACCTGCTTTG SEQ ID NO: 41 GCTATGGGTTTGTCTGATGGTGAATGGCAAT α-amalyse-F2 ATTTGTCCCTATTTCAATCAATTGAACAACTATAATTCGAAACGATG SEQ ID NO: 42 GTCGCTTGGTGGTCTTTGTTTCTGTACGGTCTT α-amalyse-R ATAGTTGTTCAATTGATTGAAATAGGGACAAAT SEQ ID NO: 43

Example 1: Construction of Recombinant Porcine Myoglobin-Expressing Pichia pastoris and Expression of Protein

(27) The porcine myoglobin gene (with the nucleotide sequence shown in SEQ ID NO:1) was ligated to a multiple cloning site of an integrated expression vector pGAPZα A to construct a recombinant plasmid pGAPZα A-Mb.

(28) The constructed recombinant plasmid pGAPZα A-Mb was transformed into Escherichia coli DH5α to obtain a transformation solution. The transformation solution was spread on an LB plate containing 20 μg/mL Zeocin, and cultured at 37° C. until single colonies grew. The single colonies were picked and verified by PCR and sequencing, and plasmids were extracted from positive colonies verified correct. The extracted plasmids were transformed into P. pastoris X33, P. pastoris GS115, P. pastoris KM71 and P. pastoris SMD1168 by electroporation to construct recombinant strains P. pastoris X33-α GAP-Mb, P. pastoris GS115-α GAP-Mb, P. pastoris KM71-α GAP-Mb, and P. pastoris SMD1168-α GAP-Mb respectively.

(29) The constructed recombinant P. pastoris strains were fermented to produce proteins respectively: a P. pastoris seed solution with an OD.sub.600 of 6-8 was inoculated into 48 mL of YPD medium containing hemin with the final concentration of 20 mg/L at an inoculation amount of 2% (2 mL/100 mL), and fermented at 30° C., 220 rpm for at least 60 h. The expression of porcine myoglobin in the fermentation supernatant was detected by SDS-PAGE and the Bradford protein concentration assay kit.

(30) As shown in FIG. 1, the recombinant strains P. pastoris X33-α GAP-Mb (with a titer of 24.25 mg/L) and P. pastoris KM71-α GAP-Mb (with a titer of 20.01 mg/L) could express porcine hemoglobin, while P. pastoris GS115-α GAP-Mb and P. pastoris SMD1168-α GAP-Mb could not express porcine myoglobin. Lanes 1 to 4 corresponded to P. pastoris X33-α GAP-Mb, P. pastoris GS115-α GAP-Mb, P. pastoris SMD1168-α GAP-Mb, and P. pastoris KM71-α GAP-Mb respectively.

Example 2: Transformation of Recombinant Porcine Myoglobin-Expressing P. pastoris and Expression of Protein

(31) (1) Transformation of Signal Peptides

(32) Signal peptides α-amalyse (with the nucleotide sequence shown in SEQ ID NO:2), Glucoamylase (with the nucleotide sequence shown in SEQ ID NO:3), Inulinase (with the nucleotide sequence shown in SEQ ID NO:4), Invertase (with the nucleotide sequence shown in SEQ ID NO:5), Lysozyme (with the nucleotide sequence shown in SEQ ID NO:6), Killer protein (with the nucleotide sequence shown in SEQ ID NO:7), Serum albumin-HSA (with the nucleotide sequence shown in SEQ ID NO:8), sp23 (with the nucleotide sequence shown in SEQ ID NO:9), nsB (with the nucleotide sequence shown in SEQ ID NO:10) and pre-Ost1-alpha factor (with the nucleotide sequence shown in SEQ ID NO:11) were synthesized, and inserted into plasmids pGAPZα A-Mb respectively to replace original α-factor signal sequences.

(33) {circle around (1)} Construction of a pGAPZα A-α-amalyse GAP-Mb plasmid: a pGAPZαA-Mb plasmid was used as a template, and primary amplification was performed using primers α-amalyse-F1 and α-amalyse-R to obtain a primary PCR product; and then the primary PCR product was used as a template, secondary amplification was performed using primers α-amalyse-F2 and α-amalyse-R, and the PCR product was recovered. The correct pGAPZαA-α-amalyse-Mb plasmid was obtained by DNA sequencing and verification.

(34) {circle around (2)} Construction of a pGAPZα A-Glucoamalyse GAP-Mb plasmid: specific construction steps are as described in the aforementioned plasmid construction method. Primers Glu-F1 and Glu-R were used for performing primary PCR; primers Glu-F2 and Glu-R were used for performing secondary PCR; and the plasmid was constructed.

(35) {circle around (3)} Construction of a pGAPZα A-Inu GAP-Mb plasmid: specific construction steps are as described in the aforementioned plasmid construction method. Primers Inu-F1 and Inu-R were used for performing primary PCR; primers Inu-F2 and Inu-R were used for performing secondary PCR; and the plasmid was constructed.

(36) {circle around (4)} Construction of a pGAPZα A-Invertase GAP-Mb plasmid: specific construction steps are as described in the aforementioned plasmid construction method. Primers Invert-F1 and Invert-R were used for performing primary PCR; primers Invert-F2 and Invert-R were used for performing secondary PCR; and the plasmid was constructed.

(37) {circle around (5)} Construction of a pGAPZAα A-Lysoenzyme GAP-Mb plasmid: specific construction steps are as described in the aforementioned plasmid construction method. Primers Lyso-F1 and Lyso-R were used for performing primary PCR; primers Lyso-F2 and Lys-R were used for performing secondary PCR; and the plasmid was constructed.

(38) {circle around (6)} Construction of a pGAPZα A-Killer protein GAP-Mb plasmid: specific construction steps are as described in the aforementioned plasmid construction method. Primers Killer protein-F1 and Killer protein-R were used for performing primary PCR; primers Killer protein-F2 and Killer protein-R were used for performing secondary PCR; and the plasmid was constructed.

(39) {circle around (7)} Construction of a pGAPZα A-HSA GAP-Mb plasmid: specific construction steps are as described in the aforementioned plasmid construction method. Primers HSA-F1 and HSA-R were used for performing primary PCR; primers HSA-F2 and HSA-R were used for performing secondary PCR; and the plasmid was constructed.

(40) {circle around (8)} Construction of a pGAPZα A-sp23 GAP-Mb plasmid: specific construction steps are as described in the aforementioned plasmid construction method. Primers sp23-F1 and sp23-R were used for performing primary PCR; primers sp23-F2 and sp23-R were used for performing secondary PCR; and the plasmid was constructed.

(41) {circle around (9)} Construction of a pGAPZα A-nsB GAP-Mb plasmid: specific construction steps are as described in the aforementioned plasmid construction method. Primers nsB-F1 and nsB-R were used for performing primary PCR; primers nsB-F2 and nsB-R were used for performing secondary PCR; and the plasmid was constructed.

(42) {circle around (1)} Construction of a pGAPZα A-pre-Ost1 GAP-Mb plasmid: specific construction steps are as described in the aforementioned plasmid construction method. Primers pre-Ost1-F1 and pre-Ost1-R were used for performing primary PCR; primers pre-Ost1-F2 and pre-Ost1-R were used for performing secondary PCR; and the plasmid was constructed.

(43) The constructed recombinant plasmids pGAPZα A-α-amalyse GAP-Mb, pGAPZα A-Glucoamylase GAP-Mb, pGAPZα A-Inulinase GAP-Mb, pGAPZα A-Invertase GAP-Mb, pGAPZα A-Lysozyme GAP-Mb, pGAPZα A-Killer protein GAP-Mb, pGAPZα A-HSA GAP-Mb, pGAPZα A-sp23 GAP-Mb, pGAPZα A-nsB GAP-Mb, and pGAPZα A-pre-Ost1 GAP-Mb were transformed into E. coli DH5α respectively. The transformation solution was spread on an LB plate containing Zeocin, and cultured at 37° C. until single colonies grew. The single colonies were verified by PCR and sequencing, and plasmids were extracted from correct positive single colonies. The extracted plasmids were transformed into P. pastoris X33 strains by electroporation, to construct recombinant strains P. pastoris X33-α-amalyse GAP-Mb, P. pastoris X33-Glucoamylase GAP-Mb, P. pastoris X33-Inulinase GAP-Mb, P. pastoris X33-Invertase GAP-Mb, P. pastoris X33-Killer protein GAP-Mb, P. pastoris X33-HSA GAP-Mb, P. pastoris X33-sp23 GAP-Mb, P. pastoris X33-nsB GAP-Mb, and P. pastoris X33-pre-Ost1 GAP-Mb respectively.

(44) The constructed recombinant P. pastoris strains were fermented to produce proteins respectively: a P. pastoris seed solution with an OD.sub.600 of 6-8 was inoculated into 48 mL of YPD medium containing 20 mg/L of hemin at an inoculation amount of 2% (2 mL/100 mL), and fermented at 30° C., 220 rpm for at least 60 h. The expression of porcine myoglobin in the fermentation supernatant was detected by SDS-PAGE and the Bradford protein concentration assay kit.

(45) The results are shown in FIG. 2. Lanes 1 to 9 represent P. pastoris X33-SP23 GAP-Mb, X33-HSA GAP-Mb, X33-α-amylase GAP-Mb, X33-nsB GAP-Mb, X33-Inulinase GAP-Mb, X33-Invertase GAP-Mb, X33-Glucoamylase GAP-Mb, X33-Killer protein GAP-Mb, and X33-Lysozyme GAP-Mb respectively. Lanes in the gel diagram on the right represent P. pastoris X33-pre-Ost1-Mb, and X33-HSA GAP-Mb respectively.

(46) It can be seen from FIG. 2 that P. pastoris X33-α GAP-Mb, X33-SP23 GAP-Mb, X33-HSA GAP-Mb, and X33-pre-Ost1-Mb can secrete porcine myoglobin, with the titers of 21.90, 12.38, 8.84, and 19.01 mg/L respectively.

(47) (2) Transformation of Promoters

(48) A G1 promoter sequence (with the nucleotide sequence shown in SEQ ID NO:12) was synthesized. The plasmid pGAPZα-A-Mb was used as a template, and a GAP promoter was replaced with a G1 promoter by means of restriction enzyme ligation to obtain a recombinant plasmid pG1-Mb.

(49) The recombinant plasmid pG1-Mb was transformed into E. coli DH5a. The transformation solution was spread on an LB plate containing Zeocin, and cultured at 37° C. until single clones grew. After the single clones were verified by colony PCR and sequencing, plasmids were extracted from correct positive clones. The extracted plasmids were transformed into a P. pastoris X-33 strain by electroporation to construct a recombinant strain P. pastoris X33-G1-Mb.

(50) The constructed recombinant strain P. pastoris X33-G1-Mb was fermented to produce proteins: a seed solution with an OD.sub.600 of 6-8 was inoculated into 48 mL of YPD medium containing hemin with the final concentration of 20 mg/L at an inoculation amount of 2% (2 mL/100 mL), and fermented at 30° C., 220 rpm for at least 60 h. The expression of porcine myoglobin in the fermentation supernatant was detected by SDS-PAGE and the Bradford protein concentration assay kit. The results are shown in FIG. 3. The recombinant strain constructed using the G1 promoter could express porcine myoglobin, and the protein titer was increased to 46.15 mg/L compared with the titer of 21.90 mg/mL of the recombinant strain containing the GAP promoter.

Example 3: Optimization of Fermentation Medium and Fermentation Conditions at Shake Flask Level

(51) 1. Preparation of a primary seed solution: the strain P. pastoris X33-α GAP-Mb constructed in Example 1 and stored at −80° C. was streaked on a plate. Single colonies were picked and inoculated in a 50 mL sterile culture tube containing 5 mL of YPD medium, and cultured at 30° C., 220 rpm on a shaker for 16-18 h to obtain the primary seed solution.

(52) 2. Preparation of a secondary seed solution: the primary seed solution was inoculated into a 250 mL shake flask containing 50 mL of YPD medium at an inoculation amount of 1% (1 mL/100 mL), and cultured at 30° C., 220 rpm on a shaker for 22 h to an OD.sub.600 of 8-10.

(53) 3. Fermentation Conditions:

(54) (1) Production of porcine myoglobin by fermentation of genetically engineered strain in different media

(55) The secondary seed solution was inoculated into 250 mL shake flasks containing 49 mL of fermentation medium (YPG, BMGY, and YPD media respectively) at an inoculation amount of 2% (2 mL/100 mL), and fermented at 30° C., 220 rpm for at least 60 h. The fermentation media contained 10 g/L of glycerol and hemin with the final concentration of 20 mg/L.

(56) The results are shown in FIG. 4A. The titer of porcine myoglobin was the highest when the recombinant strain was cultured in the BMGY medium.

(57) (2) Production of porcine myoglobin by fermentation of genetically engineered strain with different carbon sources

(58) The secondary seed solution was inoculated into 250 mL shake flasks containing 49 mL of fermentation medium (each liter of the medium contained 20 g of tryptone, 10 g of yeast extract, 4×10.sup.−4 g of biotin, and hemin with the final concentration of 20 mg/L) at an inoculation amount of 2% (2 mL/100 mL), and fermented for at least 60 h. 10 g/L of glycerol, 10 g/L of glucose, and 10 g/L of sorbitol were additionally added to the fermentation medium respectively.

(59) The results are shown in FIG. 4B. The titer of porcine myoglobin was the highest when the carbon source was glycerol.

(60) (3) Production of porcine myoglobin by fermentation of genetically engineered strain with different nitrogen sources

(61) The secondary seed solution was inoculated into 250 mL shake flasks containing 49 mL of fermentation medium (each liter of the medium contained 10 g of glycerol, 10 g of yeast extract, 4×10.sup.−4 g of biotin, and hemin with the final concentration of 20 mg/L) at an inoculation amount of 2% (2 mL/100 mL), and fermented for at least 60 h. 20 g/L of tryptone, 20 g/L of corn syrup, 20 g/L of beef extract, 20 g/L of diammonium hydrogen phosphate, and 20 g/L of ammonium sulfate were additionally added to the fermentation medium respectively.

(62) The results are shown in FIG. 4C. The titer of porcine myoglobin was the highest when the nitrogen source was tryptone.

(63) (4) Production of porcine myoglobin by fermentation of genetically engineered strain at different temperature

(64) The secondary seed solution was inoculated into a 250 mL shake flask containing 49 mL of fermentation medium (the fermentation medium was BMGY) at an inoculation amount of 2%, and fermented for at least 60 h. The fermentation medium contained 10 g/L glycerol and hemin with the final concentration of 20 mg/L.

(65) The results are shown in FIG. 5B. Protein expression was the highest when the yeast were fermented at 30° C.

(66) (5) Production of porcine myoglobin by fermentation of genetically engineered strain at different hemin levels

(67) The secondary seed solution was inoculated into a 250 mL shake flask containing 49 mL of fermentation medium (the fermentation medium was BMGY) at an inoculation amount of 2% (2 mL/100 mL), and fermented for at least 60 h. The fermentation medium contained hemin with the final concentration of 5, 10, 20, and 40 mg/L respectively. The results are shown in FIG. 5A. When the final concentration of hemin in the medium was 40 mg/L, the titer of porcine myoglobin was higher than those under other conditions.

Example 4: Production of Porcine Myoglobin Under Different Dissolved Oxygen Conditions (Fermenter Level)

(68) 1. Preparation of a primary seed solution: the strain P. pastoris X33-α GAP-Mb constructed in Example 1 and stored at −80° C. was streaked on a plate. Single colonies were picked and inoculated in a 50 mL sterile culture tube containing 5 mL of YPD medium, and cultured at 30° C., 220 rpm on a shaker for 16-18 h to obtain the primary seed solution.

(69) 2. Preparation of a secondary seed solution: the primary seed solution was inoculated into a 250 mL shake flask containing 50 mL of YPD medium at an inoculation amount of 1% (1 mL/100 mL), and cultured at 30° C., 220 rpm on a shaker for 22 h to an OD.sub.600 of 8-10.

(70) 3. Fermentation conditions: the secondary seed solution was inoculated into 5 L fermenters containing 1.8 L of fermentation medium (the fermentation medium was BMGY) at an inoculation amount of 10% (10 mL/100 mL). The fermentation medium contained 10 g/L of glycerol and hemin with the final concentration of 20 mg/L. The pH was controlled at about 5.50. The fermentation of porcine myoglobin was controlled at DO levels of 20%-Stat, 30%-Stat and 40%-Stat respectively, and the fermentation was performed at 30° C., 200-800 rpm and 1.5 VVM for 84 h.

(71) The detection results of the porcine myoglobin titer are shown in FIG. 6. When the DO level was controlled at 20%, 30%, and 40%, the titers were 219.13, 235.70, and 103.94 mg/L respectively.

Example 5: Production of Porcine Myoglobin with Different Concentration of Hemin by Fed-Batch

(72) (1) Production of porcine myoglobin by fermentation of P. pastoris X33-α GAP-Mb

(73) 1. Preparation of primary seed solutions: the strains P. pastoris X33-α GAP-Mb and P. pastoris X33-α G1-Mb constructed in Example 1 and stored at −80° C. were streaked on plates. Single colonies were picked and inoculated in 50 mL sterile culture tubes containing 5 mL of YPD medium, and cultured at 30° C., 220 rpm on a shaker for 16-18 h to obtain the primary seed solutions.

(74) 2. Preparation of secondary seed solutions: the primary seed solutions were inoculated into 250 mL shake flasks containing 50 mL of YPD medium at an inoculation amount of 1%, and cultured at 30° C., 220 rpm on a shaker for 22 h to an OD.sub.600 of 8-10.

(75) 3. Fermentation conditions: the seed solutions were inoculated into 5 L fermenters containing 1.8 L of fermentation medium at an inoculation amount of 10%. The fermentation medium contained 10 g/L of glycerol and hemin with the final concentration of 20 mg/L. Fermentation was performed according to a 30% DO-Stat fermentation strategy at an aeration rate of 1.5 VVM and a stirring speed of 200-800 rpm. After about 12 h of fermentation, the glycerol was exhausted and fed at this time. The speed of feeding was mainly automatically controlled by DO and stirring. When DO>30%, 50% (W/V) glycerol was fed, and the feeding amount of glycerol just met the needs of yeast growth. When DO<30%, the stirring speed was increased (the initial speed was 200 rpm, and the maximum speed was 800 rpm). In the process of fed-batch, hemin with the final concentration of 50 mg/L, 100 mg/L, 150 mg/L and 200 mg/L was added together with the glycerol, and fermentation was performed for 84 h.

(76) The detection results of the porcine myoglobin titer are shown in FIG. 7. When the final concentration of hemin was 150 mg/L, the titer was the highest, which was 243.43 mg/L. When the final concentration of hemin was 50 mg/L, 100 mg/L and 200 mg/L, the porcine myoglobin titers were 218.96, 242.92 and 204.45 mg/L respectively. The corresponding fermentation strain was P. pastoris X33-α GAP-Mb.

(77) (2) Production of porcine myoglobin by fermentation of P. pastoris X33-α G1-Mb

(78) P. pastoris X33-α G1-Mb was prepared into a seed solution according to the above steps and fermented, and the results are shown in FIG. 8. The detection results of the porcine myoglobin titers corresponding to the two strains P. pastoris X33-G1-Mb and P. pastoris X33-α GAP-Mb are shown in the figure. The porcine myoglobin titer corresponding to the P. pastoris X33-α GAP-Mb strain is 243.43 mg/L, and the porcine myoglobin titer corresponding to the P. pastoris X33-G1-Mb strain is 285.42 mg/L.

Example 6: Separation and Purification of Porcine Myoglobin from Fermentation Broth by Salting Out-Desalting-Anion Exchange Chromatography

(79) Salting out of fermentation broth: precipitation was performed by a one-step method. Ammonium sulfate powder was slowly added to the fermentation supernatant and stirred until the concentration of ammonium sulfate reached saturations of 30%, 40%, 50%, 60%, 70% and 80%. The mixture was allowed to stand at 4° C. for 2 h, and centrifuged at 4° C. at 10000 g, for 30 min to collect the precipitate. The precipitate was redissolved with 10 mM of Tris-HCl buffer at pH 9.20 and verified and analyzed by SDS-PAGE. FIG. 9 shows the results of salting out. Lanes 1 to 6 correspond to 30% ammonium sulfate, 40% ammonium sulfate, 50% ammonium sulfate, 60% ammonium sulfate, 70% ammonium sulfate, and 80% ammonium sulfate respectively. From the figure, when the concentration of ammonium sulfate was 60%, the porcine myoglobin salted out in large quantities, and when the concentration of ammonium sulfate was 80%, the porcine myoglobin was no longer concentrated. Therefore, ammonium sulfate with the concentration of 50% and 70% was used for performing two-stage salting out.

(80) 1. Two-stage ammonium sulfate precipitation (salting out): ammonium sulfate powder was slowly added to the fermentation supernatant and stirred until the concentration of ammonium sulfate reached a saturation of 50%. The mixture was allowed to stand at 4° C. for 2 h, and centrifuged at 4° C. at 10000 g for 30 min to collect the supernatant. Ammonium sulfate powder was added to the supernatant until the concentration of ammonium sulfate reached 70%. The mixture was allowed to stand at 4° C. overnight, and centrifuged at 10000 g for 30 min to collect the precipitate. The precipitate was redissolved with 10 mM of Tris-HCl buffer at pH

(81) 2. Desalting: the solution obtained in step 1 was loaded into a desalting column Sephadex G-25, and equilibrated and eluted with 10 mM of Tris-HCl buffer at pH 9.20, and an elution peak before the conductivity changed was collected by detecting the conductivity.

(82) 3. Anion exchange chromatography: the desalted sample obtained in step 2 was loaded into an anion exchange column DEAE-Sepharose, equilibrated with 10 mM of Tris-HCl buffer at pH 9.20, and then subjected to gradient elution with 1 M of NaCl buffer, and a second elution peak was collected by detecting UV 280 nm.

(83) The samples obtained in step 2 and step 3 were verified and analyzed by SDS-PAGE respectively. The results are shown in FIG. 10. Lane 1 represents the desalting result; and lane 3 represents the purification result, the purity is 81.60%, and the purification recovery rate is 48.25%.

Example 7: Separation and Purification of Porcine Myoglobin from Fermentation Broth by Salting Out-Desalting-Gel Filtration Chromatography

(84) 1. Two-stage ammonium sulfate precipitation: same as the ammonium sulfate precipitation step in Example 3.

(85) 2. Desalting: the solution obtained in step 1 was loaded into a desalting column, and equilibrated and eluted with 10 mM of Tris-HCl buffer at pH 9.20, and an elution peak before the conductivity changed was collected by detecting the conductivity.

(86) 3. Gel filtration chromatography: the desalted sample obtained in step 2 was loaded into a Superdex gel filtration chromatographic column, equilibrated with 10 mM of Tris-HCl buffer at pH 9.20, and then eluted with 10 mM of Tris-HCl buffer at pH 9.20, and an elution peak was collected by detecting UV 280 nm.

(87) The sample obtained in step 3 was verified and analyzed by SDS-PAGE. The result is shown by lane 2 in FIG. 10. The purity is 100%, and the purification recovery rate is 14.84%.

Example 8: Separation and Purification of Porcine Myoglobin from Fermentation Broth by Concentration-Anion Exchange Chromatography

(88) 1. Sample preparation: the concentrated fermentation broth (according to the two-stage ammonium sulfate precipitation step described in Example 6) was adjusted with Tris base to the pH of 9.20, and filtered with a 0.45 μm membrane. After that, the fermentation broth was transferred into a Vivaflow 200 membrane module return-flow system, and the myoglobin with the molecular weight greater than 10 kDa was cut off to perform concentration. The specific operation steps of the membrane module return-flow are as follows: the Vivaflow 200 membrane module was connected according to the instructions to form a return-flow system. Then, ultrafiltration concentration was performed under the action of a peristaltic pump to obtain an ultrafiltration concentrated solution.

(89) 2. Equilibration of Q anion exchange column packing material: column equilibration of Q Beads 6FF anion packing material was carried out with a buffer A solution which was 5 times the column volume.

(90) 3. Sample loading: a sample 1 time of the column volume was added and flowed down spontaneously because of gravity. After the liquid run out, the buffer A solution was added to equilibrate the sample.

(91) 4. Elution: the sample was subjected to gradient elution with buffer B solutions of different concentration (10% buffer B, and 30%-90% buffer B respectively), and the eluate was collected.

(92) The eluates were verified and analyzed by SDS-PAGE, and the results are shown in FIG. 12. Lane 1 of FIG. 12A corresponds to the purification result, the purity is 88.04%, and the highest purification rate can reach 66.05%. FIG. 12B corresponds to gradient elution. Lane 2 corresponds to the eluate of the 20% buffer B, and lane 1 and lanes 3 to 9 correspond to the eluates of the 10% buffer B (10% salt concentration) and the 30%-90% buffer B, respectively.

Example 9: Heme Extraction and Optical Detection

(93) 1. Acidified acetone method: purified porcine myoglobin was extracted with an acidified acetone solution (V.sub.acetone:V.sub.hydrochloric acid=3:100) for 40 min, and then the pH of the solution was adjusted to neutrality using 1 M of NaOH. The resulting solution was centrifuged at 3000 g for 5 min to obtain the supernatant, and acetone was removed using a rotary evaporator. The pH of the resulting solution was adjusted to 5-7 with 1 M of HCl, and heme precipitate occurred. The solution with the heme precipitate was centrifuged at 3000 g for 15 min and washed twice with distilled water.

(94) 2. Heme extracted by the above method was detected by an optical detection method. By full wavelength scanning (200 μl of purified solutions were added to 96-well plates respectively, and then scanned at a wavelength of 200-800 nm), and characteristic peaks were determined. Then, corresponding response values were measured under the characteristic peaks, and the detection results are shown in FIG. 13.

(95) The results show that when the concentration of exogenous substrate hemin was 150 mg/L, the amount of heme bound to the myoglobin was the highest, which was 0.22 mol of heme/mol of porcine myoglobin.

(96) Although the disclosure has been disclosed as above in preferred examples, it is not intended to limit the disclosure. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the disclosure. Therefore, the protection scope of the disclosure should be defined by the claims.